BRANCHED-CHAIN AMINO ACIDS PROTECT AGAINST

DEXAMETHASONE-INDUCED SOLEUS MUSCLE ATROPHY IN RATS

DAISUKE YAMAMOTO, MS,1 TAIKI MAKI, MS,1 ELIZABETH HENNY HERNINGTYAS, MD, PhD,1,2 NOBUKO IKESHITA, MS,1
HIROMI SHIBAHARA, MS,1 YUKA SUGIYAMA, MS,1 SHIHO NAKANISHI, BS,1 KEIJI IIDA, MD, PhD,3 GENZO IGUCHI, MD, PhD,3
YUTAKA TAKAHASHI, MD, PhD,2 HIDESUKE KAJI, MD, PhD,4 KAZUO CHIHARA, MD, PhD,3
and YASUHIKO OKIMURA, MD, PhD1
1
Department of Biophysics, Kobe University Graduate School of Health Science, 7-10-2, Tomogaoka, Suma-ku, Kobe 654-0142, Japan
2
Division of Diabetes, Metabolism, and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of
Medicine, Kobe, Japan
3
Department of Medicine, Hyogo Prefectural Kakogawa Hospital, Kakogawa, Japan
4
College of Nursing Art and Science, University of Hyogo, Akashi, Japan
Accepted 10 November 2009

ABSTRACT: We investigated the utility of branched-chain phy.1–3 Atrogin-1 has been reported to be induced 8–
amino acids (BCAA) in dexamethasone-induced muscle atrophy.
Dexamethasone (600 lg/kg, intraperitoneally) and/or BCAA (600
40-fold in muscle atrophy in diabetes, cancer, renal
mg/kg, orally) were administered for 5 days in rats, and the effect failure, and during fasting1; up to 3-fold in hindlimb
of BCAA on dexamethasone-induced muscle atrophy was eval- suspension, immobilization, and denervation; and up
uated. Dexamethasone decreased total protein concentration of
rat soleus muscles. Concomitant administration of BCAA to 10-fold in a cachectic or dexamethasone adminis-
reversed the decrease. Dexamethasone decreased mean cross- tration model.2 MuRF1 was initially found in associa-
sectional area of soleus muscle fibers, which was reversed by tion with myofibrils6 and is suggested to play an im-
BCAA. Dexamethasone increased atrogin-1 expression, which
has been reported to play a pivotal role in muscle atrophy. The portant role in myofibrillar protein breakdown. In
increased expression of atrogin-1 mRNA was significantly attenu- the autophagic/lysosomal pathway, cytoplasmic pro-
ated by BCAA. Furthermore, dexamethasone-induced conver- teins and organelles are sequestered in vacuoles
sion from microtubule-associated protein 1 light chain 3 (LC3)-I
to LC3-II, which is an indicator of autophagy, was blocked by called autophagosomes. These autophagosomes fuse
BCAA. These findings suggest that BCAA decreased protein with lysosomes, resulting in digestion of the content
breakdown to prevent muscle atrophy. BCAA administration
appears to be useful for prevention of steroid myopathy.
of the vacuoles by lysosomal hydrolases.7 Autophagy is
Muscle Nerve 41: 819–827, 2010 enhanced in skeletal muscle disorders. Pompe and
Danon diseases, which are genetic diseases character-
Skeletal muscle atrophy results from a variety of dis- ized by myopathy, result from the deficiency of lysoso-
eases and conditions, including sepsis, cancer, renal
mal proteins and are associated with the accumula-
failure, glucocorticoid excess, denervation, and mus-
tion of autophagosomes.
cle disuse. In these diverse conditions, the atrophy-
Pharmacological inhibition of lysosomal function
ing muscles show increased protein degradation.1–3
causes vacuolar myopathy, such as chloroquine my-
Protein degradation in skeletal muscle is medi-
opathy.8 Furthermore, electron-microscopic studies
ated by the activation of three pathways, the ubiqui-
have shown that autophagy is activated in denerva-
tin–proteasomal pathway, the autophagic/lysosomal
tion atrophy.9 These reports showed that the autoph-
pathway,4 and the calpain pathway. In the ubiquitin–
agy system is stimulated in different conditions lead-
proteasomal pathway, target proteins are conjugated
ing to muscle atrophy.10 The calpain pathway is also
with multiple molecules of ubiquitin, followed by deg-
involved in myofibrillar proteolysis.11 Calpains are a
radation within the proteasome.5 It has been
family of intracellular, non-lysosomal, Ca2þ-depend-
reported that the expression of atrophy gene-1/mus-
ent cysteine proteases. A number of studies have
cle atrophy F-box (atrogin-1/MAFbx) and muscle
focused on the role of calpains in conditions that
ring-finger protein 1 (MuRF1), both of which are
induce muscle atrophy.12–14 Ca2þ is the most impor-
muscle-specific ubiquitin-ligases, is involved in protein
tant calpain activator. During sepsis, accompanied by
degradation in muscle and increased in muscle atro-
muscle atrophy, intracellular Ca levels are increased,
Abbreviations: ANOVA, analysis of variance; ATPase, adenosine tripho- and calpain expression is upregulated in skeletal mus-
phosphatase; atrogin-1/MAFbx, atrophy gene-1/muscle atrophy F-box; cle. In addition, calpain activity is increased in skele-
BCAA, branched-chain amino acid(s); CSA, cross-sectional area; Ct, the
threshold cycle; Dex, dexamethasone; DTT, dithiothreitol; ECL, enhanced tal muscle15 in sepsis. Other catabolic conditions
chemiluminescence; EDL, extensor digitorum longus; EDTA, ethylene- involve increased calpain activity. Glucocorticoids are
dimine tetraacetic acid; EGTA, ethylene-glycol tetraacetic acid; GAPDH,
glyceraldehyde 3-phosphate dehydrogenase; LC3, microtubule-associated reported to increase calpain activity in skeletal mus-
protein 1 light chain 3; mTOR, mammalian target of rapamycin; MuRF1, cle, resulting in proteolysis of the skeletal muscle.16
muscle ring-finger protein 1; RT, reverse transcription; RT-PCR, reverse
transcription–polymerase chain reaction; TBS, Tris-buffered saline On the other hand, several factors have been
Key words: atrogin-1; autophagy; BCAA; dexamethasone; muscle atrophy reported to stimulate protein synthesis or to inhibit
Correspondence to: Y. Okimura; e-mail: okimuray@kobe-u.ac.jp
protein breakdown. One of these factors is
V
C 2010 Wiley Periodicals, Inc.

Published online 18 February 2010 in Wiley InterScience (www.

branched-chain amino acids (BCAA). BCAA activate
interscience.wiley.com). DOI 10.1002/mus.21621 mammalian target of rapamycin (mTOR) and
Effect of BCAA on Muscle Atrophy MUSCLE & NERVE June 2010 819
increase protein synthesis in cultured cells17 as well
as in rats18 and humans.19 In addition, we and
others have shown that BCAA, arginine, and methi-
onine inhibited atrogin-1 and MuRF1 expression in
the C2C12 mouse muscle cell line20 and QT6 quail
muscle cell line,21 suggesting that the BCAA, argi-
nine, and methionine may protect against muscle at-
rophy via inhibition of protein breakdown.
In this study, we examined the effects of BCAA
administration on dexamethasone-induced muscle
atrophy in rats as a model of muscle atrophy that is
often observed during steroid hormone treatment
in humans. We found that BCAA have an inhibitory
effect on dexamethasone-induced soleus muscle at-
rophy. We also examined the involvement of the
ubiquitin–proteasomal, the autophagic/lysosomal,
and calpain pathways in this model. Further, we
found that BCAA decreased atrogin-1 mRNA level
and the conversion from microtubule-associated
protein 1 light chain 3 (LC3)-I to LC3-II, which has
been reported as an indicator of autophagy,22 sug-
gesting the involvement of the ubiquitin–proteaso-
mal and the autophagic/lysosomal pathways.
METHODS
Animals. All experiments were performed using 8-
week-old male Sprague-Dawley rats, weighing 220–
250 g. Animals were maintained in cages at 22
C
under a 12-h light/12-h dark cycle and were allowed
free access to food. All animal protocols were
approved by the Committee on Animal Experimen-
tation, Kobe University School of Medicine.
Experimental Procedures. Twenty-four rats were di-
vided into four groups of six animals each. One
group was used as a glucocorticoid-induced skeletal
muscle atrophy group and given dexamethasone.
The second group received dexamethasone and
additional administration of BCAA. The third group
received only BCAA. The fourth group, a control
group, was given an equivalent volume of saline
(0.9% NaCl) and water. Dexamethasone (600 lg/kg
body mass) was injected intraperitoneally once per
day. This dose was determined from a previous
study.23 BCAA [600 mg/kg body mass; LIVACT
(46% leucine, 28% valine, and 23% isoleucine); Aji-
nomoto] solution was dissolved in water. Rats were
allowed free access to the BCAA solution from 8:00
a.m. to 9:00 p.m. All BCAA solution was consumed
by 9:00 p.m. and thereafter water was supplied. The
amount of BCAA administered was estimated at
about 20% of the daily intake of BCAA from food.
The body mass of the rats was measured every day at
10:00 a.m. After 5 days of treatment with dexameth-
asone, BCAA, or both, soleus and extensor digito-
rum longus (EDL) muscles were collected for analy-
sis under pentobarbital anesthesia.
820 Effect of BCAA on Muscle Atrophy
Histological Analysis. The collected soleus and
EDL muscles were embedded in tragacanth gum
(Nacalai Tesque), frozen in acetone chilled with
dry ice, and sectioned with a cryostat. The result-
ing 10-lm transverse sections were examined with
adenosine triphosphatase (ATPase) staining (pH
10.7). Cross-sectional areas (CSAs) of 400 muscle
fibers of a muscle from each rat were measured
using Scion Image software.
Total RNA Extraction and Reverse Transcription. To-
tal RNA was extracted from soleus muscles
(RNeasy Fibrous Tissue Mini Kit; Qiagen) accord-
ing to the manufacturer’s instructions. The reverse
transcription (RT) reaction was performed at 42
C
for 60 min with 2 lg of the total RNA in 25 ll of
reaction volume. The cDNA obtained by RT was
diluted 1:30, and 3 ll of the diluted solution was
used as a template in the real-time quantitative po-
lymerase chain reaction (PCR).
Primer Design. All primers used in this study were
designed using Primer 3 software. The primer
sequences were as follows: atrogin-1 (forward
primer GAACATCATGCAGAGGCTGA, reverse
primer GTAGCCGGTCTTCACTGAGC); MuRF1
(forward primer ACATCTTCCAGGCTGCCAAT,
reverse primer GTTCTCCACCAGCAGGTTCC);
and glyceraldehye 3-phosphate dehydrogenase
(GAPDH; forward primer AGACAGCCGCATCTT
CTTGT, reverse primer TCCCATTCTCAGCCT
TGACT).
Quantitative RT-PCR. Real-time quantitative PCR
analysis (SYBR Green Real-Time PCR Master Mix;
Toyobo) was then carried out (My iQ Real-Time
PCR Detection System; Bio-Rad). The real-time
PCR parameters were as follows: 15 min at 95
C
followed by 40 cycles of 15 s at 94
C; 30 s at 57
C;
and 30 s at 72
C. PCR products of each assay were
subjected to agarose gel electrophoresis to confirm
amplification specificity. All measurements were
performed in triplicate. For each sample, the
threshold cycle (Ct) was calculated based on the
cycle at which the fluorescence increased above a
threshold level. The DCt values were calculated
in every sample for the target gene as follows: Ct
(target gene)  Ct (internal control gene), with
GAPDH as internal control gene. The relative
expression level for one target gene (DDCt) was
calculated by subtracting the mean DCt for the
control group from the DCt of each sample in the
treated groups. Finally, the relative expression
value, normalized to an endogenous reference, was
given by: 2DDCt.
Measurement of Total Protein Concentration. Total
protein concentration in soleus muscle was meas-
ured by the Bradford method.
MUSCLE & NERVE June 2010
Immunoblot Analysis. Muscles were weighed and
homogenized in ice-cold buffer [20 mM Tris-HCl
(pH 8.0), 1% Nonidet P40, 120 mM NaCl, 20 mM
NaF, 1 mM ethylene-diamine tetraacetic acid
(EDTA), 1 mM ethylene-glycol tetraacetic acid
(EGTA), 15 mM sodium pyrophosphate, 30 mM b-
glycerophosphate, 2 mM sodium orthovanadate]
with a protease inhibitor cocktail using a Polytron
homogenizer and centrifuged at 12,000  g for 10
min at 4
C. The supernatants were used in the fol-
lowing analysis. Protein concentration of the super-
natant was determined using a Bradford protein
assay (Bio-Rad Laboratories). Aliquots of muscle
lysate were solubilized in 2 sample buffer [125 mM
Tris-HCl (pH 6.8), 4% sodium dodecylsulfate, 20%
glycerol, 100 mM dithiothreitol (DTT), 1% bromo-
phenol blue]. The samples were boiled for 5 min
and cooled on ice before being used for sodium
dodecylsulfate–polyacrylamide gel electrophoresis
(SDS-PAGE). After gel electrophoresis, proteins
were transferred to polyvinylidene fluoride (PVDF)
membranes. The membranes were blocked in
Blocking One (Nacalai Tesque) for 30 min at room
temperature and then incubated with anti-LC3 anti-
body (Medical & Biologica Laboratories) for 1 h at
room temperature. The membranes were washed
with Tris-buffered saline (TBS) containing 0.1%
Tween 20 (TBS-T) and incubated with anti-rabbit
antibody coupled with horseradish peroxidase for 1
h at room temperature, followed by washing in TBS-
T. Proteins were visualized by enhanced chemilumi-
nescence (ECL) Western blotting reagents (Amer-
sham) and quantified by scanning (LAS-3000 mini)
in combination with Multi Gauge software (version
3.0; Fujifilm). The LC3-II/LC3-I ratio, calculated by
dividing the density of LC3-II by that of LC3-I, was
normalized to a-tubulin, then the LC3-II/LC3-I in
each treated group was normalized to the LC3-II/
LC3-I in the control group.
Calpain Activity Assay. Calpain activity was meas-
ured using the Calpain-Glo Protease Assay kit
(Promega) according to manufacturer’s instruc-
tions. Soleus muscles were weighed and homoge-
nized in ice-cold buffer [100 mM Tris-HCl (pH
7.5), 1 mM EDTA] using a Polytron homogenizer
and centrifuged at 12,000  g for 10 min at 4
C.
For the calpain activity assay, 200 lg of protein was
used, and the activity was measured in Calpain-Glo
reagent with 2 mM CaCl2.
Statistical Analysis.Results are expressed as
mean 6 SEM. Differences were determined by
analysis of variance (ANOVA) followed by the
Tukey–Kramer test. Differences between means
were considered significant at P < 0.05.
Effect of BCAA on Muscle Atrophy
RESULTS
Body Mass and Muscle Mass. During the 5-day
treatment, dexamethasone decreased body mass
irrespective of BCAA administration (Fig. 1A).
BCAA and dexamethasone did not have a signifi-
cant influence on the soleus muscle mass (Fig.
1B). Dexamethasone, however, decreased EDL
muscle mass. On the other hand, BCAA did not
affect the EDL muscle mass (Fig. 1C).
Histological Analysis. The administration of dexa-
methasone reduced the mean CSA of muscle fibers
in soleus muscles by 22% (Fig. 2A and B). On the
other hand, BCAA administration increased the
mean CSA and prevented a decrease in the mean
CSA of soleus muscle fibers in the dexamethasone-
treated rats (Fig. 2A and B). We also evaluated the
differences between the type 1 and type 2 fibers in
soleus muscles and found that BCAA administra-
tion increased the mean CSA and prevented a
decrease in the mean CSA of type 1 fibers in sol-
eus muscles in the dexamethasone-treated rats
(Fig. 2C). Similarly, BCAA administration inhibited
a decrease in the mean CSA of type 2 fibers in sol-
eus muscle induced by dexamethasone (Fig. 2D).
The composition of type 1 and type 2 fibers in sol-
eus muscles was not altered (Fig. 2E).
Administration of dexamethasone also reduced
the mean CSA of muscle fibers in EDL muscles (Fig.
3A and B). BCAA administration, however, did not
change the mean CSA of EDL muscle fibers (Fig. 3A
and B) and did not influence a decrease in the
mean CSA of both type 1 and type 2 fibers in EDL
muscles in the dexamethasone-treated rats (Fig.
3C). The composition of type 1 and type 2 fibers in
EDL muscles was not altered (Fig. 3E).
Total Protein Concentration in Soleus Muscles. Ad-
ministration of dexamethasone decreased total
protein concentration in soleus muscles. BCAA
administration did not alter the concentration of
total protein in soleus muscles compared with con-
trol rats. However, BCAA reversed the decrease in
total protein concentration in dexamethasone-
treated rats (24.2 6 0.9 mg/soleus muscle 100 mg
in the control group, 21.0 6 0.8 mg/soleus muscle
100 mg in dexamethasone administration group,
24.3 6 2.0 mg/soleus muscle 100 mg in BCAA
administration group, 24.3 6 0.9 mg/soleus
muscle 100 mg in dexamethasone and BCAA
administration group) (Fig. 4).
Atrogin-1 and MuRF1 mRNA Levels in Soleus
Muscles. To assess the mechanisms of the inhibi-
tory effect of BCAA on soleus muscle atrophy, we
measured the levels of atrogin-1 and MuRF1 mRNA
in soleus muscles. Administration of dexametha-
sone for 5 days increased atrogin-1 mRNA levels in
MUSCLE & NERVE June 2010 821

FIGURE 1. BCAA administration did not change body mass
and muscle mass in rats. Dexamethasone (Dex, 600 lg/kg)
was injected intraperitoneally to 8-week-old male rats once a
day for 5 days. BCAA (600 mg/kg) was orally administered for
5 days. (A) The effect of 5-day administration of Dex (filled tri-
angles), BCAA (open circles), or both (open triangles) on body
mass is shown. Dex decreased body mass compared with sa-
line control (filled circles) on the fourth and fifth days of the
treatment. (B) BCAA and Dex did not show a significant influ-
ence on soleus muscle mass. (C) Dex decreased extensor digi-
torum longus (EDL) muscle mass compared with saline control
irrespective of BCAA administration. *P < 0.05 vs. control
group.
822 Effect of BCAA on Muscle Atrophy
soleus muscles of rats (Fig. 5A). The increased atro-
gin-1 mRNA level was significantly attenuated by
BCAA (Fig. 5A). In addition, BCAA attenuated, but
not significantly, the MuRF1 mRNA level induced
by dexamethasone treatment (Fig. 5B).
Effect of BCAA on Autophagy in Soleus Muscles. To
examine the involvement of autophagy in muscle
atrophy, we performed Western blots for LC3, the
homolog of yeast Atg8. LC3 is detected as two dif-
ferent bands, LC3-I and LC3-II, in Western blots.
LC3-I is cleaved and conjugated to phosphatidyle-
thanolamine during autophagic vacuole formation
to generate a faster migrating form, LC3-II. The
LC3-II/LC3-I ratio has been reported to be an in-
dicator of autophagy.22 The ratio of LC3-II to LC3-
I was increased in soleus muscles after dexametha-
sone treatment. On the other hand, BCAA admin-
istration suppressed the increase in LC3-II induced
by dexamethasone administration (Fig. 6).
Calpain Activity in Soleus Muscles. Dexamethasone
and BCAA did not have a significant effect on cal-
pain activity (Fig. 7).
DISCUSSION
In this study, we found that daily administration of
BCAA inhibited dexamethasone-induced soleus
muscle atrophy in the rat. In addition, we found
that BCAA decreased expression of atrogin-1
mRNA and processing of LC3-I to LC3-II in soleus
muscles of dexamethasone-treated rats.
Catabolic effects of glucocorticoids including
dexamethasone on muscle protein metabolism are
well known. It is generally accepted that glucocorti-
coids inhibit muscle protein synthesis and stimu-
late muscle protein breakdown.24–28 As a result,
glucocorticoid administration results in muscle at-
rophy. To confirm the effect of dexamethasone,
we measured the concentration of total protein in
soleus muscles. Dexamethasone treatment signifi-
cantly decreased the protein concentration in sol-
eus muscles. The decreased concentration of pro-
tein in soleus muscles was completely reversed by
concomitant administration of BCAA. This
decreased protein concentration by dexametha-
sone and the reversion by BCAA ran parallel to
the effect of BCAA on mean CSA of muscle fibers.
Dexamethasone decreased mean CSA of muscle
fibers in soleus and EDL muscles. BCAA adminis-
tration increased mean CSA of soleus muscle fibers
and prevented the decrease by dexamethasone.
On the other hand, in EDL muscles of rats treated
with dexamethasone, BCAA administration failed
to prevent the decreased mean CSA of muscle
fibers.
Based on the expression of myosin heavy
chain isoforms, skeletal muscle fibers can be
MUSCLE & NERVE June 2010
FIGURE 2. BCAA reversed the decrease in cross-sectional area of soleus muscles fibers induced by dexamethasone. (A) After treat-
ment with dexamethasone (Dex, 600 lg/kg), BCAA (600 mg/kg), or both, soleus muscles were collected and examined with ATPase
staining (pH 10.7). With this stain, type 1 fibers stain light, and type 2 fibers are dark. Scale bar: 200 lm. (B) Cross-sectional areas of
400 muscle fibers per soleus muscle were measured. Dex administration significantly decreased mean cross-sectional area of soleus
muscle fibers. BCAA, when administered alone, showed an increase in mean cross-sectional area and a protective effect against Dex-
induced decrease in mean cross-sectional area. (C) Cross-sectional areas of type 1 fibers in soleus muscles were measured. Dex
administration significantly decreased the mean cross-sectional area of type 1 fibers in soleus muscles. BCAA, when administered
alone, showed an increase in mean cross-sectional area and a protective effect against Dex-induced decrease in mean cross-sectional
area. (D) Cross-sectional areas of type 2 fibers in soleus muscles were measured. BCAA reversed the Dex-induced decrease in mean
cross-sectional area. *P < 0.05 vs. control group; †P < 0.05 vs. Dex-treated group. (E) The composition of type 1 and type 2 fibers in
soleus muscles was evaluated. Neither BCAA nor Dex affected the composition of type 1 and type 2 fibers.

classified as type 1 or type 2. Type 1 fibers are
oxidative, slow-twitch fibers with high endurance,
whereas type 2 fibers are glycolytic, fast-twitch
fibers with low endurance. Glucocorticoid-induced
muscle atrophy is known to occur predominantly
in fast-twitch muscles, including EDL
muscles.23,29,30 The predominant atrophy of fast-
Effect of BCAA on Muscle Atrophy
twitch muscles may be related to the defect of a
counteracting mechanism by BCAA. Type 2 fibers
are further categorized into type 2a, 2x, and 2b
fibers. Soleus muscle has more type 2a fibers,
whereas EDL has more type 2x and 2b fibers.31–35
Our results have shown that the CSA of type 2
fibers in soleus, but not EDL, are rescued by
MUSCLE & NERVE June 2010 823
FIGURE 3. BCAA did not reverse the decrease in cross-sectional area of EDL muscles fibers induced by dexamethasone. (A) After
treatment with dexamethasone (Dex, 600 lg/kg), BCAA (600 mg/kg), or both, EDL muscles were collected and examined with ATPase
staining (pH 10.7). With this stain, type 1 fibers stain light, and type 2 fibers are dark. Scale bar: 200 lm. (B) Cross-sectional areas of
400 muscle fibers per EDL muscle were measured. Dex administration significantly decreased mean cross-sectional area of EDL mus-
cle fibers. BCAA did not change the mean cross-sectional area. (C) Cross-sectional areas of type 1 fibers in EDL muscles were meas-
ured. Dex administration significantly decreased the mean cross-sectional area of type 1 fibers in EDL muscles. BCAA did not affect
the mean cross-sectional area of type 1 fibers in EDL muscles. (D) Cross-sectional areas of type 2 fibers in EDL muscles were meas-
ured. BCAA did not affect the mean cross-sectional area of type 2 fibers in EDL muscles. *P < 0.05 vs. control group; †P < 0.05 vs.
Dex-treated group. (E) The composition of type 1 and type 2 fibers in EDL muscles was evaluated. Neither BCAA nor Dex affected the
composition of type 1 and type 2 fibers.

BCAA administration. These results suggest that a
difference in response to BCAA between skeletal
muscle types is more likely a difference due to
the proportion of type 2a fibers to type 2x and
2b fibers in soleus and EDL muscles. It is possible
that type 2a fibers are more strongly influenced
by BCAA than type 2x and 2b fibers, although
the mechanism is unknown. As far as we know,
824 Effect of BCAA on Muscle Atrophy
there are no other reports concerning the effect
of BCAA on CSA of muscle fibers.
BCAA, especially leucine, modulate muscle pro-
tein metabolism and lead to muscle protein anabo-
lism. Leucine or BCAA administration stimulates
the rate of muscle protein synthesis in rat stud-
ies.18,36–44 BCAA phosphorylate and activate
mTOR in skeletal muscle, which in turn
MUSCLE & NERVE June 2010

FIGURE 4. BCAA administration blocked the dexamethasone-
induced decrease in total protein concentration in rat soleus
muscles. After treatment with dexamethasone (Dex, 600 lg/kg),
BCAA (600 mg/kg), or both, soleus muscles were homogenized
in ice-cold buffer, as described in Methods, and the protein con-
centration of each sample was measured using the Bradford
method. Dex significantly decreased total protein concentration
in soleus muscles. BCAA blocked the decrease in total protein
concentration in soleus muscles. *P < 0.05 vs. control group;
†
P < 0.05 vs. Dex-treated group.
BCAA decreased atrogin-1 mRNA expression
induced by dexamethasone in rats in accordance
with our in vitro data.20 These results suggest that
BCAA prevent dexamethasone-induced soleus mus-
cle atrophy, at least in part, through the inhibition
of atrogin-1 mRNA expression.
Autophagy is a tightly orchestrated intracellular
process for bulk degradation of cytoplasmic pro-
teins in various organisms.8,53,54 Previous reports
have shown that autophagy is activated in denerva-
tion atrophy9 and that the lysosomal proteolytic
system is stimulated in different conditions leading
to muscle atrophy.10 The mechanism of autophagy
has been clarified. During autophagy, LC3 is proc-
essed from the cytosolic form (LC3-I) to the mem-
brane-bound form (LC3-II). To estimate the con-
tribution of the autophagic/lysosomal pathway to

phosphorylates S6K. Phosphorylated active S6K1

can stimulate the initiation of protein synthesis
through activation of S6 ribosomal protein and
other components of the translational machinery.
In addition, mTOR has been shown to phosphoryl-
ate 4E-BP1. Non-phosphorylated 4E-BP1 binds
tightly to the translation initiation factor eIF4E,
preventing it from binding to 50 capped mRNAs.
Upon phosphorylation by mTOR, 4E-BP1 releases
eIF4E, allowing it to perform its function.
In addition to a stimulating effect on protein
synthesis, BCAA are reported to inhibit muscle
protein breakdown in incubated diaphragms in
vitro45,46 and in perfused rat hindlimb.47 In
humans, some reports suggest that leucine pro-
motes muscle protein synthesis,48 but others show
suppressed muscle protein breakdown without
increased protein synthesis during leucine49 or
BCAA50,51 infusion. Although species differences
may be present, BCAA appear to play a role in
both protein synthesis and degradation.
Protein degradation was regulated by several
mechanisms. One is specific protein degradation
by the ubiquitin–proteasomal system and another
is non-specific bulk degradation by the autopha-
gic/lysosomal system. It has been reported previ-
FIGURE 5. Administration of BCAA attenuated atrogin-1 mRNA
ously that expression of atrogin-1 and MuRF1, expression in rat soleus muscles. Dexamethasone (Dex, 600
both of which are muscle-specific ubiquitin-ligases, ag/kg) was injected intraperitoneally in 8-week-old male rats
are involved in protein degradation in muscle and once a day for 5 days. BCAA (600 mg/kg) was administered for
increased in the presence of dexamethasone caus- 5 days. (A) Dex stimulated atrogin-1 mRNA expression in sol-
eus muscles. Dex-induced expression of atrogin-1 mRNA was
ing muscle atrophy.1,52 We have already reported
significantly attenuated by BCAA. *P < 0.05 vs. control group;
that BCAA decrease atrogin-1 and MuRF1 expres- †
P < 0.05 vs. Dex-treated group. (B) BCAA and Dex did not
sion levels induced by serum-free starvation in significantly influence MuRF1 mRNA expression in soleus
C2C12 myocytes.20 In this study, we found that muscles.

Effect of BCAA on Muscle Atrophy MUSCLE & NERVE June 2010 825
dexamethasone-induced muscle atrophy, the ratio
of LC3-II/LC3-I is reported as an indicator.22
Thus, we performed Western blots for LC3. BCAA
suppressed dexamethasone-induced conversion of
LC3 from the unlipidated species (LC3-I) to the
lipidated species (LC3-II). This finding indicates
that BCAA administration inhibits the autophagic/
lysosomal pathway and may prevent dexametha-
sone-induced soleus muscle atrophy through that
pathway.
To further clarify other mechanisms of protein
degradation in soleus muscles of rats, we measured
the calpain activity in rat soleus muscles. Calpain is a
calcium-dependent protease and is reported to be
involved in skeletal muscle protein breakdown. Pre-
vious reports have shown that glucocorticoids,
including dexamethasone and corticosterone, stim-
ulate calcium-dependent proteolysis in cultured
myotubes55 and rats,16 resulting from increased cal-
pain activity. In our study, however, there were no
significant differences in calpain activity in soleus
muscles of rats treated with dexamethasone, BCAA,
or both. Unlike soleus muscles, the decreased CSA
in EDL muscles treated by dexamethasone was not
rescued by BCAA administration. We cannot
exclude the possibility that the calpain pathway is
regulated differently between muscle types with
FIGURE 6. BCAA attenuated dexamethasone-induced lipidation
of LC3. Dexamethasone (Dex, 600 lg/kg) was injected intra-
peritoneally in 8-week-old male rats once a day for 5 days.
BCAA (600 mg/kg) was orally administered for 5 days. (A) LC3
protein level was determined by Western blot. a-tubulin was
used as loading control. (B) LC3 conversion ratio (LC3-II/LC3-I)
was calculated after densitometric analysis. Dex increased the
conversion of LC3-I to LC3-II. BCAA completely reversed the
conversion by Dex. *P < 0.05 vs. control group; †P < 0.05 vs.
Dex-treated group.
826 Effect of BCAA on Muscle Atrophy
FIGURE 7. BCAA did not change calpain activity in soleus
muscles. After treatment with dexamethasone (Dex, 600 lg/kg),
BCAA (600 mg/kg), or both, soleus muscles were homogenized
in buffer, as described in Methods, and calpain activity of each
sample was measured using a luminescent assay. Neither
BCAA nor Dex affected calpain activity in rat soleus muscles.
dexamethasone administration. Indeed, several
studies demonstrated that calpain responds differ-
ently to regeneration after injury,56 apoptosis with
aging,57 and atrophy by disuse,58 between soleus
and EDL muscles. In EDL muscles, the calpain path-
way might be activated by dexamethasone.
In conclusion, we found that BCAA prevented
dexamethasone-induced soleus muscle atrophy in
rats. BCAA also decreased dexamethasone-induced
atrogin-1 expression in rat soleus muscles, and
attenuated the dexamethasone-induced LC3-II
increase. These findings suggest that BCAA use
may prevent dexamethasone-induced soleus mus-
cle atrophy through inhibition of protein degrada-
tion resulting from the activation of both the ubiq-
uitin–proteasomal pathway and autophagic/
lysosomal pathway. BCAA administration appears
to be a promising approach in the treatment of
steroid myopathy.
The authors thank Ajinomoto Co. for the generous gift of LIVACT
granules. This work was supported in part by Grants-in-Aid for Sci-
entific Research from the Japanese Ministry of Education, Science,
Sports and Culture, and grants from the Japanese Ministry of
Health, Welfare and Labor, the Growth Science Foundation, and
the Nakatomi Foundation.
REFERENCES
1. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA,
et al. Identification of ubiquitin ligases required for skeletal muscle
atrophy. Science 2001;294:1704–1708.
2. Gomes MD, Lecker SH, Jagoe RT, Navon A, Goldberg AL. Atrogin-1,
a muscle-specific F-box protein highly expressed during muscle atro-
phy. Proc Natl Acad Sci USA 2001;98:14440–14445.
3. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, et al.
Multiple types of skeletal muscle atrophy involve a common program
of changes in gene expression. FASEB J 2004;18:39–51.
4. Mammucari C, Milan G, Romanello V, Masiero E, Rudolf R, Del Pic-
colo P, et al. FoxO3 controls autophagy in skeletal muscle in vivo.
Cell Metab 2007;6:458–471.
5. Lecker SH, Goldberg AL, Mitch WE. Protein degradation by the
ubiquitin–proteasome pathway in normal and disease states. J Am
Soc Nephrol 2006;17:1807–1819.
6. Kandarian SC, Jackman RW. Intracellular signaling during skeletal
muscle atrophy. Muscle Nerve 2006;33:155–165.
MUSCLE & NERVE June 2010
 7. Lum JJ, DeBerardinis RJ, Thompson CB. Autophagy in metazoans:
cell survival in the land of plenty. Nat Rev Mol Cell Biol 2005;6:
439–448.
8. Shintani T, Klionsky DJ. Autophagy in health and disease: a double-
edged sword. Science 2004;306:990–995.
9. Schiaffino S, Hanzlikova V. Studies on the effect of denervation in
developing muscle. II. The lysosomal system. J Ultrastruct Res 1972;
39:1–14.
10. Bechet D, Tassa A, Taillandier D, Combaret L, Attaix D. Lysosomal
proteolysis in skeletal muscle. Int J Biochem Cell Biol 2005;37:
2098–2114.
11. Ono Y, Torii F, Ojima K, Doi N, Yoshioka K, Kawabata Y, et al. Sup-
pressed disassembly of autolyzing p94/CAPN3 by N2A connectin/
titin in a genetic reporter system. J Biol Chem 2006;281:
18519–18531.
12. Ellis S, Nagainis PA. Activity of calcium activated protease in skeletal
muscles and its changes in atrophy and stretch. Physiologist 1984;
27(suppl):S73–74.
13. Spencer MJ, Lu B, Tidball JG. Calpain II expression is increased by
changes in mechanical loading of muscle in vivo. J Cell Biochem
1997;64:55–66.
14. Taillandier D, Aurousseau E, Meynial-Denis D, Bechet D, Ferrara M,
Cottin P, et al. Coordinate activation of lysosomal, Ca2þ-activated
and ATP-ubiquitin-dependent proteinases in the unweighted rat sol-
eus muscle. Biochem J 1996;316:65–72.
15. Smith IJ, Lecker SH, Hasselgren PO. Calpain activity and muscle
wasting in sepsis. Am J Physiol Endocrinol Metab 2008;295:
E762–771.
16. Hayashi K, Tada O, Higuchi K, Ohtsuka A. Effects of corticosterone
on connectin content and protein breakdown in rat skeletal muscle.
Biosci Biotechnol Biochem 2000;64:2686–2688.
17. Ijichi C, Matsumura T, Tsuji T, Eto Y. Branched-chain amino acids
promote albumin synthesis in rat primary hepatocytes through the
mTOR signal transduction system. Biochem Biophys Res Commun
2003;303:59–64.
18. Anthony JC, Yoshizawa F, Anthony TG, Vary TC, Jefferson LS, Kim-
ball SR. Leucine stimulates translation initiation in skeletal muscle
of postabsorptive rats via a rapamycin-sensitive pathway. J Nutr 2000;
130:2413–2419.
19. Blomstrand E, Eliasson J, Karlsson HK, Kohnke R. Branched-chain
amino acids activate key enzymes in protein synthesis after physical
exercise. J Nutr 2006;136(suppl):269S–273.
20. Herningtyas EH, Okimura Y, Handayaningsih AE, Yamamoto D,
Maki T, Iida K, et al. Branched-chain amino acids and arginine sup-
press MaFbx/atrogin-1 mRNA expression via mTOR pathway in
C2C12 cell line. Biochim Biophys Acta 2008;1780:1115–1120.
21. Tesseraud S, Metayer-Coustard S, Boussaid S, Crochet S, Audouin E,
Derouet M, et al. Insulin and amino acid availability regulate atro-
gin-1 in avian QT6 cells. Biochem Biophys Res Commun 2007;357:
181–186.
22. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T,
et al. LC3, a mammalian homologue of yeast Apg8p, is localized in
autophagosome membranes after processing. EMBO J 2000;19:
5720–5728.
23. Ma K, Mallidis C, Bhasin S, Mahabadi V, Artaza J, Gonzalez-Cadavid
N, et al. Glucocorticoid-induced skeletal muscle atrophy is associated
with upregulation of myostatin gene expression. Am J Physiol Endo-
crinol Metab 2003;285:E363–371.
24. Auclair D, Garrel DR, Chaouki Zerouala A, Ferland LH. Activation
of the ubiquitin pathway in rat skeletal muscle by catabolic doses of
glucocorticoids. Am J Physiol 1997;272:C1007–1016.
25. Hickson RC, Czerwinski SM, Wegrzyn LE. Glutamine prevents down-
regulation of myosin heavy chain synthesis and muscle atrophy from
glucocorticoids. Am J Physiol 1995;268:E730–734.
26. Kayali AG, Young VR, Goodman MN. Sensitivity of myofibrillar pro-
teins to glucocorticoid-induced muscle proteolysis. Am J Physiol
1987;252:E621–626.
27. Santidrian S, Moreyra M, Munro HN, Young VR. Effect of corticos-
terone and its route of administration on muscle protein breakdown,
measured in vivo by urinary excretion of N tau-methylhistidine in
rats: response to different levels of dietary protein and energy. Me-
tabolism 1981;30:798–804.
28. Shoji S, Pennington RJ. The effect of cortisone on protein break-
down and synthesis in rat skeletal muscle. Mol Cell Endocrinol 1977;
6:159–169.
29. Roy RR, Gardiner PF, Simpson DR, Edgerton VR. Glucocorticoid-
induced atrophy in different fibre types of selected rat jaw and hind-
limb muscles. Arch Oral Biol 1983;28:639–643.
30. Tiao G, Lieberman M, Fischer JE, Hasselgren PO. Intracellular regu-
lation of protein degradation during sepsis is different in fast- and
slow-twitch muscle. Am J Physiol 1997;272:R849–856.
31. Windisch A, Gundersen K, Szabolcs MJ, Gruber H, Lomo T. Fast to
slow transformation of denervated and electrically stimulated rat
muscle. J Physiol 1998;510:623–632.
Effect of BCAA on Muscle Atrophy
32. Bassel-Duby R, Olson EN. Signaling pathways in skeletal muscle
remodeling. Annu Rev Biochem 2006;75:19–37.
33. Handschin C, Chin S, Li P, Liu F, Maratos-Flier E, Lebrasseur NK,
et al. Skeletal muscle fiber-type switching, exercise intolerance, and
myopathy in PGC-1alpha muscle-specific knock-out animals. J Biol
Chem 2007;282:30014–30021.
34. Shi H, Scheffler JM, Pleitner JM, Zeng C, Park S, Hannon KM, et al.
Modulation of skeletal muscle fiber type by mitogen-activated pro-
tein kinase signaling. FASEB J 2008;22:2990–3000.
35. Jin TE, Wernig A, Witzemann V. Changes in acetylcholine receptor
function induce shifts in muscle fiber type composition. FEBS J
2008;275:2042–2054.
36. Anthony JC, Anthony TG, Layman DK. Leucine supplementation
enhances skeletal muscle recovery in rats following exercise. J Nutr
1999;129:1102–1106.
37. Anthony JC, Anthony TG, Kimball SR, Vary TC, Jefferson LS. Orally
administered leucine stimulates protein synthesis in skeletal muscle
of postabsorptive rats in association with increased eIF4F formation.
J Nutr 2000;130:139–145.
38. Anthony JC, Anthony TG, Kimball SR, Jefferson LS. Signaling path-
ways involved in translational control of protein synthesis in skeletal
muscle by leucine. J Nutr 2001;131(suppl):856S–860.
39. Anthony JC, Lang CH, Crozier SJ, Anthony TG, MacLean DA, et al.
Contribution of insulin to the translational control of protein synthe-
sis in skeletal muscle by leucine. Am J Physiol Endocrinol Metab
2002;282:E1092–1101.
40. Anthony JC, Reiter AK, Anthony TG, Crozier SJ, Lang CH, MacLean
DA, et al. Orally administered leucine enhances protein synthesis in
skeletal muscle of diabetic rats in the absence of increases in 4E-BP1
or S6K1 phosphorylation. Diabetes 2002;51:928–936.
41. Buse MG. In vivo effects of branched chain amino acids on muscle
protein synthesis in fasted rats. Horm Metab Res 1981;13:502–505.
42. Garlick PJ, Grant I. Amino acid infusion increases the sensitivity of
muscle protein synthesis in vivo to insulin. Effect of branched-chain
amino acids. Biochem J 1988;254:579–584.
43. Rieu I, Sornet C, Bayle G, Prugnaud J, Pouyet C, Balage M, et al.
Leucine-supplemented meal feeding for ten days beneficially affects
postprandial muscle protein synthesis in old rats. J Nutr 2003;133:
1198–1205.
44. Sakamoto A, Moldawer LL, Usui S, Bothe A Jr, Bistrian BR, Black-
burn GL. In vivo evidence for the unique nitrogen-sparing mecha-
nism of branched-chain amino acid administration. Surg Forum
1979;30:67–69.
45. Buse MG, Reid SS. Leucine. A possible regulator of protein turnover
in muscle. J Clin Invest 1975;56:1250–1261.
46. Fulks RM, Li JB, Goldberg AL. Effects of insulin, glucose, and amino
acids on protein turnover in rat diaphragm. J Biol Chem 1975;250:
290–298.
47. Li JB, Jefferson LS. Influence of amino acid availability on protein
turnover in perfused skeletal muscle. Biochim Biophys Acta 1978;
544:351–359.
48. Sherwin RS. Effect of starvation on the turnover and metabolic
response to leucine. J Clin Invest 1978;61:1471–1481.
49. Nair KS, Schwartz RG, Welle S. Leucine as a regulator of whole body
and skeletal muscle protein metabolism in humans. Am J Physiol
1992;263:E928–934.
50. Louard RJ, Barrett EJ, Gelfand RA. Effect of infused branched-chain
amino acids on muscle and whole-body amino acid metabolism in
man. Clin Sci (Lond) 1990;79:457–466.
51. Louard RJ, Barrett EJ, Gelfand RA. Overnight branched-chain amino
acid infusion causes sustained suppression of muscle proteolysis. Me-
tabolism 1995;44:424–429.
52. Yamamoto D, Ikeshita N, Matsubara T, Tasaki H, Herningtyas EH,
Toda K, et al. GHRP-2, a GHS-R agonist, directly acts on myocytes to
attenuate the dexamethasone-induced expressions of muscle-specific
ubiquitin ligases, Atrogin-1 and MuRF1. Life Sci 2008;82:460–466.
53. Takahashi Y, Coppola D, Matsushita N, Cualing HD, Sun M, Sato Y,
et al. Bif-1 interacts with Beclin 1 through UVRAG and regulates
autophagy and tumorigenesis. Nat Cell Biol 2007;9:1142–1151.
54. Yoshimori T. Autophagy: a regulated bulk degradation process inside
cells. Biochem Biophys Res Commun 2004;313:453–458.
55. Wang L, Luo GJ, Wang JJ, Hasselgren PO. Dexamethasone stimu-
lates proteasome- and calcium-dependent proteolysis in cultured L6
myotubes. Shock 1998;10:298–306.
56. Moraczewski J, Piekarska E, Zimowska M, Sobolewska M. Activity of
mu- and m-calpain in regenerating fast and slow twitch skeletal
muscles. Acta Biochim Pol 1996;43:693–700.
57. Rice KM, Blough ER. Sarcopenia-related apoptosis is regulated differ-
ently in fast- and slow-twitch muscles of the aging F344/N  BN rat
model. Mech Ageing Dev 2006;127:670–679.
58. Vermaelen M, Sirvent P, Raynaud F, Astier C, Mercier J, Lacampagne
A, et al. Differential localization of autolyzed calpains 1 and 2 in
slow and fast skeletal muscles in the early phase of atrophy. Am J
Physiol Cell Physiol 2007;292:C1723–1731.
MUSCLE & NERVE June 2010 827