ORIGINAL RESEARCH ARTICLE

Journal of
1114
Cellular
Physiology
Early Growth Response 3 (Egr3)
Contributes a Maintenance of
C2C12 Myoblast Proliferation
MITSUTOSHI KUROSAKA, YUJI OGURA,* TOSHIYA FUNABASHI, AND TATSUO AKEMA
Department of Physiology, St. Marianna University School of Medicine, Kawasaki, Kanagawa, Japan

Satellite cell proliferation is a crucially important process for adult myogenesis. However, its regulatory mechanisms remain unknown.
Early growth response 3 (Egr3) is a zinc-finger transcription factor that regulates different cellular functions. Reportedly, Egr3 interacts
with multiple signaling molecules that are also known to regulate satellite cell proliferation. Therefore, it is possible that Egr3 is involved in
satellite cell proliferation. Results of this study have demonstrated that Egr3 transcript levels are upregulated in regenerating mouse
skeletal muscle after cardiotoxin injury. Using C2C12 myoblast culture (a model of activated satellite cells), results show that inhibition of
Egr3 by shRNA impairs the myoblast proliferation rate. Results also show reduction of NF-кB transcriptional activity in Egr3-inhibited cells.
Inhibition of Egr3 is associated with an increase in annexin Vþ cell fraction and apoptotic protein activity including caspase-3 and caspase-7,
and Poly-ADP ribose polymerase. By contrast, the reduction of cellular proliferation by inhibition of Egr3 was partially recovered by
treatment of pan-caspase inhibitor Z-VAD-FMK. Collectively, these results suggest that Egr3 is involved in myoblast proliferation by
interaction with survival signaling.
J. Cell. Physiol. 232: 1114–1122, 2017. ß 2016 Wiley Periodicals, Inc.

Skeletal muscle formation in adults principally originates from
myogenic stem cells, designated as satellite cells (Brack and
Rando, 2012; Yin et al., 2013; Wang et al., 2014; Dumont
et al., 2015). Upon injury, for example, the satellite cells
become activated (i.e., myoblast); they proliferate and
differentiate to repair or newly form a myofiber (Brack and
Rando, 2012; Yin et al., 2013; Wang et al., 2014; Dumont
et al., 2015). Previous studies have demonstrated that genetic
loss of satellite cells engenders a defect of muscle
regeneration after injury (Lepper et al., 2011; McCarthy et al.,
2011; Murphy et al., 2011; Fry et al., 2015). Therefore, proper
functioning of satellite cells is important to maintain skeletal
muscle homeostasis. Satellite cell proliferation is a crucially
important step to give a sufficient number of muscle
progenitors during adult myogenesis. Decreased satellite cell
proliferation has been demonstrated to exaggerate muscle
regeneration after injury (Angione et al., 2011; Yoshida et al.,
2013; Ogura et al., 2015). Moreover, a decline of satellite cell
proliferation capability accounts for muscle weakness in aged
skeletal muscle (Day et al., 2010; Bernet et al., 2014; Lacraz
et al., 2015). However, the regulation of satellite cell
proliferation is not yet fully understood.
Early growth response 3 (Egr3) is a zinc-finger transcription
factor that is included in the immediately early genes group
(O’Donovan et al., 1999). Accumulated evidence has revealed
the biological role of Egr3 in mammalian cells. Examples of
some roles are activation and cytokine production in T-cells
(Safford et al., 2005; Sumitomo et al., 2013a,b), neuronal
adaptation (O’Donovan et al., 1998), and transduction of
growth signaling in endothelial cells (Suehiro et al., 2010).
Moreover, Egr3 has been implicated in the proliferation of
mammalian cells such as hematopoietic stem cells (Cheng et al.,
2015) and T-cells (Xi et al., 2006). In skeletal muscle, Egr3 is
reported as vitally important for the development of muscle
spindles as a downstream molecule of neuregulin-1/Erbb2
signaling (Tourtellotte and Milbrandt, 1998; Tourtellotte et al.,
2001; Hippenmeyer et al., 2002; Jacobson et al., 2004). In one
study, specific deletion of ErbB2 in differentiated muscles, but
not in satellite cells, caused a defect of muscle regeneration
after a crush injury in mice (Andrechek et al., 2002). However,
it remains unknown whether Egr3 is also necessary for satellite
cell function.
The satellite cell function is regulated by many signaling
molecules. Recent studies have uncovered regulatory
interactions between Egr3 and several molecules, including
signal transducers and activators of transcription (STAT)
(Li et al., 2012; Sumitomo et al., 2013b), activator protein-1
(Li et al., 2012; Sumitomo et al., 2013b) and nuclear factor-
kappa B (NF-кB) (Wieland et al., 2005). These latter
molecules are known to regulate satellite cell proliferation and
self-renewal (Lehtinen et al., 1996; Guttridge et al., 1999;
Kurosaka and Machida, 2013; Ogura et al., 2013; Price et al.,
Abbreviations: ANOVA, analysis of variance; CTX, cardiotoxin; Egr,
early growth response; EdU, 5-ethylnyl-2’-deoxyuridine; GM,
growth medium; shRNA, short hairpin RNA; eMyHC, embryonic
myosin heavy chain; FBS, fetal bovine serum; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; NF-кB, nuclear
factor-kappa B; PBS, phosphate buffered saline; PARP, Poly ADP
ribose polymerase; PPAR-g, peroxisome proliferator activated
receptor-gamma; QRT-PCR, quantitative reverse transcription-
polymerase chain reaction; STAT, signal transducers and activator
of transcription; TA, tibialis anterior; XIAP, X-linked inhibitor of
apoptosis protein.
Conflicts of interest: The authors declare that they have no conflict
of interest related to this study.
Contract grant sponsor: The Nakatomi Foundation.
Contract grant sponsor: JSPS KAKENHI;
Contract grant numbers: #24700706, #15K01633.
Contract grant sponsor: St. Marianna University School of
Medicine.
*Correspondence to: Yuji Ogura, Department of Physiology,
St. Marianna University School of Medicine, 2-16-1 Sugao,
Miyamae-ku, Kawasaki, Kanagawa 216-8511, Japan.
E-mail: yuji_ogura@marianna-u.ac.jp
Manuscript Received: 27 May 2016
Manuscript Accepted: 29 August 2016
Accepted manuscript online in Wiley Online Library
(wileyonlinelibrary.com): 30 August 2016.
DOI: 10.1002/jcp.25574

© 2 0 1 6 W I L E Y P E R I O D I C A L S , I N C .
 REGULATION OF MYOBLAST PROLIFERATION BY Egr3
2014; Tierney et al., 2014; Ogura et al., 2015). Therefore, we
hypothesized that Egr3 might be involved in satellite cell
proliferation. This study was conducted to clarify the role of
Egr3 in satellite cell proliferation using C2C12 cells.
Materials and Methods
Ethical approval
All animal experimental procedures were approved by the
Institute for Animal Experimentation, St. Marianna University
School of Medicine. Experimental procedures using recombinant
DNA were approved by the St. Marianna University Gene
Recombination Experiment Safety Committee.
Animals
From SLC Inc. (Hamamatsu, Shizuoka, Japan), 7–8-week-old male
C57BL/6J mice were purchased. They were subsequently
maintained at an institutional animal facility. All animals were given
standard rodent chow and water ad libitum.
Muscle injury
To induce injury response in skeletal muscle, 100 ml of 10 mM
cardiotoxin (CTX; Latoxan, Valence, France) dissolved in saline was
injected into one leg of the tibialis anterior (TA) muscle (Ogura et al.,
2013), under anesthesia using an isoflurane–oxygen gas mixture.
Saline was injected into contralateral TAs as a vehicle treatment. At
3 and 5 days post CTX injection, TA muscles were excised under
anesthesia with inhalation of the isoflurane–oxygen mixture, after
which they were frozen in liquid N2 and stored at 80°C.
Cell culture
Cells of the C2C12 mouse myoblast cell line from the European
Collection of Cell Cultures were used as a model of activated
satellite cells. After purchase from Public Health England (Porton
Down, Salisbury, UK), they were maintained in growth medium
(GM; 10% fetal bovine serum, 1% penicillin/streptomycin, and
Dulbecco’s modified Eagle’s medium, all from Life Technologies
Inc., Carlsbad, CA). The cell’s passage under 11 was used for the
experiment.
Short-hairpin RNA (shRNA)
The pLKO.1-mCherry-puro plasmid was provided by Dr. Renzhi
Han (The Ohio State University Wexner Medical Center,
Columbus, OH). The target siRNA sequences for mouse Egr3
were designed using BLOCK-iT RNAi Designer (Life
Technologies Inc.). The synthesized siRNA oligonucleotides
(Integrated DNA Technologies, Inc., Coralville, IA) were annealed
and inserted into the plasmid using AgeI/EcoRI sites to contain, in
order, the sense strand of sequences for mouse Egr3 (shEgr3,
GCAACAAGACCGTGACCTACT), a loop sequence
(CTCGAG), the reverse complement sequences of sense strand
for shEgr3, and a termination signal for RNA polymerase III
(TTTTT) (Ogura et al., 2015). The success of insertion was tested
using cycle DNA sequencing (ABI Prism 3100-Avant; Life
Technologies Inc.). The appropriate plasmid was amplified using a
standard bacterial culture. Two siRNA sequences were validated
for knockdown of Egr3 mRNA in preliminary experiments. One
was used for this study. Control cells were transfected with the
backbone plasmid that harbors the scrambled sequence.
Electroporation for plasmid delivery
Plasmid DNA was transferred by electroporation (1,500 V, 10 ms,
3 pulses) using a transfection system (Neon; Life Technologies Inc.)
as described in an earlier report (Ogura et al., 2015). Our
JOURNAL OF CELLULAR PHYSIOLOGY
1115
electroporation procedure routinely attains 70–80% of transfection
efficiency at 24 h post transfection (Supplementary Fig. S1).
Indirect cell number measurement
Vector-transfected cells were grown for 24 and 48 h in GM. Cells at
each time point were counted (cell counting kit-8 #CK04; Dojindo
Laboratories, Kamimashiki-gun, Kumamoto, Japan) according to the
manufacturer’s description. The indirect cell number was
expressed with absolute absorbance at 450 nm (Multiskan MS; Life
Technologies Inc.). The proliferation rate was calculated as the cell
number at 48 h divided by the cell number at 24 h.
5-Ethynyl-20 -deoxyuridine (EdU) incorporation assay
Vector-transfected myoblasts were grown in GM for 24 h. For the
final 0.5 and 2 h, cells were labeled with EdU followed by staining
with Click-iT Plus EdU cell proliferation assay kit (Alexa fluor 488;
Life Technologies Inc.) (Ogura et al., 2013). Nuclei were
counterstained with Hoechst 33342 in PBS for 30 min at room
temperature. Images were visualized using a fluorescence
microscope (Eclipse Ti-S; Nikon Instech Co., Ltd., Minato-ku,
Tokyo, Japan) attached to a digital camera (Infinity 3-6UR;
Lumenera Corporation, Ottawa, ON, Canada). The percentages
of EdUþ cells in mCherryþ cells were ascertained. Five images per
sample were analyzed.
NF-kB promoter activity
The cells were transfected with NF-kB-Luc plasmid (a gift from
Dr. Ahosk Kumar, University of Louisville, Louisville, KY) and pRT-TK
vector (Promega Corp., Madison, WI) with either shEgr3 or scramble
vectors. After 24 and 48 h, the cells were harvested and processed for
NF-kB-Luc and Renilla activities using a dual luciferase assay kit
(#E1910; Promega Corp.). NF-kB-Luc activity was normalized by
Renilla activity and expressed relative to the control cells.
Annexin V-propidium iodide (PI) staining
The existence of apoptosis was estimated with annexin V-PI
staining as described previously (Ogura et al., 2015) using a
commercially available kit (#4700; Medical and Biological
Laboratories Co. Ltd., Nagoya, Aichi, Japan). In brief, vector-
transfected cells were grown for 48 h in GM, followed by gentle
removal from culture dishes. After washing with PBS, cells were
suspended with binding buffer (85 ml) and were stained with
annexin V conjugated with fluorescein (10 ml) and PI (5 ml) for
20 min at room temperature (RT) in dark. The cells were then
diluted with addition of binding buffer and were counted using flow
cytometry (LSR-II, BD Biosciences, Franklin Lakes, NJ). The data
(10,000 events/each) were analyzed using software (FlowJo Ver.
10; FlowJo LLC., Ashland, OR). Fractions of annexin V/PIþ,
annexin Vþ/PIþ, annexin Vþ/PI, and annexin Vþ were calculated
respectively to determine necrotic cells, late apoptotic cells, early
apoptotic cells, and apoptotic cells.
Caspase inhibitor treatment
Pan-caspase inhibitor Z-VAD-FMK was purchased from Promega
Corp. For cell treatment, Z-VAD-FMK was added to culture
medium at a concentration of 20 mM (Ogura et al., 2015) before
incubation for 24 and 48 h. After the indicated period, the cells
were subjected to analysis of the indirect cell number.
Western blotting
Samples were processed as described previously (Ogura et al.,
2013). The primary antibodies used were the following: Egr3
(1:1000, #2559S; Cell Signaling Technology Inc., CST, Danvers,
1116 K U R O S A K A E T A L.
MA), cleaved caspase 3 (1:1000; #9664P, CST), cleaved caspase 7
(1:1000; #8438P, CST), Poly-ADP ribose polymerase (PARP,
1:2000; #9542P, CST), embryonic myosin heavy chain (eMyHC;
F1.652, 1:100; Developmental Studies Hybridoma Bank, Iowa City,
IA), developmental myosin heavy chain (dMyHC; NCL-HMCd,
1:100; Leica Microsystems Newcastle Ltd., Newcastle Upon Tyne,
UK), and GAPDH (1:10000; #2118S, CST). After incubation with
an HRP-linked secondary antibody (1:3000, CST), the membrane
was developed using enhanced chemiluminescence reagent
(General Electric Co., Little Chalfont, Buckinghamshire, UK).
Signals were captured using an imaging system (LAS-4000; Fujifilm
Corp., Minato-ku, Tokyo, Japan). Densitometry analysis was
conducted using Image J software.
Quantitative RT-PCR (QRT-PCR)
Relative mRNA levels were analyzed using QRT-PCR as described
previously, with b-actin as an internal reference for delta–delta Ct
analysis (Ogura et al., 2013) using a real-time PCR system (Step
One; Life Technologies Inc.) with Syber green master mix reagent
(QPS-101; Toyobo Co. Ltd., Osaka, Osaka, Japan). Following are
the primer sequences (from 50 to 30 ) used for this study: Egr3-
forward, GCTGCCTCCTTATTCCAACTGC; Egr3-reverse,
AAGATTGCTGTCCAAGGCCG; p65-forward, AGGACTC
TTCTTCATGATACTCTTG; p65-reverse, GAGTTCCAGTA
CTTGCCAGAC; b-actin-forward, CATCCGTAAAGACCTC
TATGCCAAC; and b-actin-reverse, ATGGAGCCACCGATC
CACA.
Statistics
All values are presented as the mean  SEM. Differences between
two groups were analyzed using unpaired t-tests. Results for
caspase inhibitor experiment were analyzed using one-way analysis
of variance (ANOVA) with a Tukey’s multiple comparison test
(Prism 6.0; GraphPad Software, Inc., La Jolla, CA). Significance was
inferred for P < 0.05.
Results
Egr3 mRNA increases during muscle regeneration after
injury
We first examined the effect of muscle injury on mRNA
and protein levels of Egr3 in skeletal muscle of mice.
Fig. 1. Egr3 mRNA levels increase in regenerating mouse tibialis anterior (TA) muscles. (A) Schematic representation of CTX injury
experiment. (B) mRNA levels of Egr3 after 3 and 5 days of CTX injection. N ¼ 4/each.  P < 0.05 by unpaired t-test. Error bars represent the
SEM. (C) Representative protein bands for dMyHC, eMyHC, and GAPDH in TA muscle. Both MyHC isoforms were undetected at 3 days.
JOURNAL OF CELLULAR PHYSIOLOGY
The mouse TA muscle was harvested after 3 and 5 days of the
CTX-induced injury (Fig. 1A). Despite multiple attempts, we
were unable to find an effective antibody for detecting Egr3
protein in muscle tissue. Therefore, we analyzed mRNA
levels of Egr3 in TA muscles after injury. Results indicated
that mRNA levels of Egr3 in injured TA were increased
significantly (P < 0.05) compared to control TA at 3 and
5 days (Fig. 1B). No expression of differentiation markers
dMyHC or eMyHC was detected at 3 days in either injured
or control muscles. However, they were evident at 5 days of
injury (Fig. 1C). These results suggest that Egr3 is involved in
muscle regeneration after injury.
Inhibition of Egr3 impairs C2C12 myoblast proliferation
Muscle regeneration includes complicated processes that
require participation of different cell types. To investigate the
myoblast-specific role of Egr3, we conducted experiments
using C2C12 myoblast culture. C2C12 cells were transfected
with pLKO.1-mcherry vector, which harbors either Egr3
shRNA to inhibit Egr3 or scrambled sequences. Introduction of
shEgr3 significantly (P < 0.05) reduced both mRNA and protein
levels of Egr3 at 24 and 48 h post transfection (Fig. 2A–C).
Using this approach, the indirect cell counting assay revealed
that the cell numbers at 24 and 48 h were significantly
(P < 0.05) lower in shEgr3-transfected cells than in scramble-
transfected control cells (Fig. 2D and E). Moreover, the cellular
proliferation rate during 24–48 h was significantly (P < 0.05)
lower in shEgr3-transfected cells than in scramble-transfected
cells (Fig. 2F).
We examined the inhibitory effect of Egr3 on myoblast
proliferation further by performing the EdU incorporation
assay in C2C12 myoblast. We inhibited Egr3 with shRNA for
24 h. The cells were then incubated with EdU for an additional
0.5 and 2 h, with subsequent visualization of their incorporation
using Click-iT chemistry (Fig. 2G). As portrayed in Fig. 2H, the
percentage of EdUþ incorporated cells in mCherryþ cells
(i.e., vector-transfected cells) was significantly (P < 0.05) lower
in shEgr3-transfected cells than in scramble-transfected cells
without the effect of the EdU incubation period (i.e., 0.5 and
2 h). Taken together, these results indicate that Egr3 is
implicated in C2C12 myoblast proliferation. These results
were confirmed when different shEgr3 plasmid was used
(Supplementary Fig. S2).
 REGULATION OF MYOBLAST PROLIFERATION BY Egr3 1117

Fig. 2. Egr3 is involved in proliferation of C2C12 myoblast. (A) Egr3 mRNA level in scramble-transfected and shEgr3-transfected cells.
N ¼ 5–6/each for 24 h. N ¼ 3–4/each for 48 h.  P < 0.05 by unpaired t-test. Error bars represent the SEM. (B) Immunoblot for Egr3 in scramble
(scr)-transfected and shEgr3 (sh)-transfected cells. (C) Relative Egr3 protein levels. N ¼ 5/each.  P < 0.05 by unpaired t-test. Error bars
represent the SEM. (D) Representative image of C2C12 cells 48 h after transfection. Scale bar: 100 mm. (E) Indirect cell number in C2C12
myoblast transfected with either scramble or shEgr3. N ¼ 7–8/each.  P < 0.05 by unpaired t-test. Error bars represent the SEM. (F)
Proliferation rate from 24 to 48 h in scramble-transfected and shEgr3-transfected cells. N ¼ 8/each.  P < 0.05 by unpaired t-test. Error bars
represent the SEM. (G) EdUþ cells (green) were counted only in mCherry expressing cells (Red). Scale bar: 100 mm. Arrows indicate EdUþ/
mCherryþ cells. (H) Percentage of EdUþ/mCherryþ cells. N ¼ 4/each.  P < 0.05 by unpaired t-test. Error bars represent the SEM.

NF-кB-Luc activity and p65 protein expression were
decreased in Egr3-inhibited myoblast
Results of an earlier study suggested interaction between Egr3
and NF-кB signaling in human kidney cells (Wieland et al., 2005).
NF-кB is also known to be important for the progression of the
cell cycle in myoblast (Guttridge et al., 1999). Therefore, we
hypothesized that decreased proliferation in Egr3-inhibited
cells is associated with NF-кB activity. Figure 3A shows that
NF-кB-Luc activity was decreased significantly (P < 0.05) in
Egr3-ihibited cells compared to control cells at 24 and 48 h post
transfection. p65 is an important protein that assembles NF-кB
heterodimer. Therefore, we next investigated the expression of
p65 in Egr3-inhibited cells. The results indicate that inhibition of
Egr3 significantly (P < 0.05) decreased the protein expression of
p65 at 24 and 48 h compared to control cells (Fig. 3B and C).
The mRNA level of p65 significantly (P < 0.05) increased in
shEgr3-transfected cells after 24 h following transfection
(Fig. 3D). However, no significant difference was found in p65
mRNA between Egr3-inhibited and control cells at 48 h after
transfection (Fig. 3D). Collectively, these findings indicate that
inhibition of Egr3 influences NF-кB activity in C2C12 myoblasts.
Apoptosis was induced in Egr3-inhibited cells by shRNA
NF-кB is known to play anti-apoptotic roles in cells. Therefore,
we assume that apoptotic cell death might be included in the

JOURNAL OF CELLULAR PHYSIOLOGY

1118 K U R O S A K A E T A L.

Fig. 3. Inhibition of Egr3 reduced the expression of p65 protein and NF-kB promoter activity (A) Relative NF-kB-Luc activity. N ¼ 7–8/each
for 24 h. N ¼ 4/each for 48 h.  P < 0.05 by unpaired t-test. Error bars represent the SEM. (B) Representative immunoblot for p65 and GAPDH.
Scr and sh respectively denote scramble and shEgr3. (C) Relative protein levels of p65. N ¼ 3/each.  P < 0.05 by unpaired t-test. Error bars
represent the SEM. (D) p65 mRNA level in scramble-transfected and shEgr3-transfected cells. N ¼ 7–8/each for 24 h. N ¼ 4/each for 48 h.

P < 0.05 by unpaired t-test. Error bars represent the SEM.

low number of cells in Egr3-inhibited cells. To address this
point, we transfected myoblast with shEgr3 or scramble
vectors and grew them for 48 h. Then the cells were subjected
to annexin V-PI staining (Fig. 4A). No difference was found in
annexin V/PIþ (Fig. 4B) and annexin Vþ/PIþ (Fig. 4C) between
scramble-transfected cells and shEgr3-transfected cells.
However, annexin V þ/PI cells (Fig. 4D) and annexin Vþ cells
(Fig. 4E) were significantly (P < 0.05) higher in Egr3-inhibited
cells than control cells.
Next, we examined the activation of executor caspases and
PARP proteins in Egr3 inhibited cells by performing Western
blot analysis (Fig. 5A). Results show that a cleaved form of
PARP, caspase 3, and caspase 7 were all significantly (P < 0.05)
increased in Egr3-inhibited cells at 24 and 48 h post transection
than those in control cells (Fig. 5B–D).
Finally, we examined whether inhibition of caspase can
reverse the proliferation of myoblast in Egr3-inhibited cells, or
not. The shEgr3-or scramble-vector transfected cells were
incubated with a pan-caspase inhibitor Z-VAD-FMK or vehicle
(DMSO) for 24 and 48 h, followed by cell count analysis. As
depicted in Fig. 6A, no significant difference was found at 24 h
among groups when the data were analyzed using one-way
ANOVA. In contrast, the cell number at 48 h post transfection
was significantly (P < 0.05) decreased by inhibition of Egr3 with
shRNA. Treatment of Z-VAD-FMK significantly (P < 0.05)
increased the cell number in Egr3-inhibited cells compared
to those treated with DMSO at 48 h (Fig. 6A). As depicted
in Fig. 6B, inhibition of Egr3 by shRNA significantly
(P < 0.05) decreased the proliferation rate. However, the
treatment of Z-VAD-FMK significantly (P < 0.05) increased the
shEgr3-mediated decline of the proliferation rate (Fig. 6B).
Taken together, these results implicate apoptosis in the
suppression of proliferation in Egr3-inhibited C2C12 myoblast.
Discussion
This study was conducted to clarify the role of Egr3 in myoblast
proliferation, a critical process for myogenesis. Our primary
finding is that inhibition of Egr3 by shRNA impaired cellular
proliferation in C2C12 myoblasts. It is particularly interesting
that the reduction of proliferation was associated with a
decrease in NF-kB signaling and enhancement of apoptosis.
Pharmacologic caspase inhibitions partially but significantly
restore the shRNA-related decline of proliferation. Therefore,
we propose that Egr3 is necessary for the maintenance of
myoblast proliferation.
Implication of apoptosis
Our results suggest involvement of apoptosis in lower
proliferation in Egr3-inhibited cells (Figs. 4–6). Apoptosis is
known to be an important mechanism in the multiple level of
biological events including organ development and cell size
dynamics (Schwartz, 2008; Suzanne and Steller, 2013).
Additionally, it is important for maintaining cellular
proliferation. Indeed, the normality of cell cycling status is well
known to be monitored by check point mechanisms. Cells
showing inappropriate status such as irreversible DNA damage
is eliminated by apoptosis (Pucci et al., 2000). Therefore, our
results of increased apoptosis in Egr3-inhibited cells might be

JOURNAL OF CELLULAR PHYSIOLOGY

 REGULATION OF MYOBLAST PROLIFERATION BY Egr3
Fig. 4. Annexin V-PI staining in myoblast transfected with scramble or shEgr3. (A) Typical gating results of annexin V-PI staining by flow
cytometry. Quantitative results for a fraction of annexin V/PIþ (B), annexin Vþ/PIþ (C), annexin Vþ/PI (D), and annexin Vþ (E) that
respectively indicate necrotic cells, late apoptotic cells, early apoptotic cells, and apoptotic cells. N ¼ 5/each.  P < 0.05 by unpaired t-test. Error
bars represent the SEM.
related to interference of normal cell cycling by lowered Egr3
availability in those myoblasts.
It was observed that a fraction of PI positive cells or late
apoptotic cells were similar between scramble and shEgr3-
transfected cells (Fig. 4B and C), which indicates that lower
proliferation in Egr3-inhibited cells leads to slower or ceased
cell cycling rather than apoptotic cellular death at the time
of 48 h of post transfection. This idea might be supported by
the result of a low EdU incorporated cell, which might indicate
delayed entry of DNA synthesis phase, in shEgr3-transfected
cells (Fig. 2H). Therefore, our results might show that
induction of apoptosis process was sufficient to impair
myoblast proliferation in Egr3-inhibited cells.
Our results showed that Z-VAD-FMK treatment can only
partially reverse the compromised cell number and
proliferation rate of Egr3-inhibited cells (Fig. 6). This indicates
that mechanisms other than apoptosis are implicated in the
proliferation defect in Egr3-inhibited cells. One possible reason
is involvement of signal transduction mechanisms related to
Egr3 because Egr3 can interact with multiple signaling
molecules. One example is that Egr3 inhibits STAT3 activity by
stimulating the suppression of cytokine signaling 3 (Li et al.,
2012; Sumitomo et al., 2013b). STAT3 has been found to inhibit
proliferation via stimulation of MyoD expression in myoblasts
JOURNAL OF CELLULAR PHYSIOLOGY
1119
(Tierney et al., 2014). The potential role of different signaling
molecules warrants examination in future studies.
Possible role of NF-kB signaling
Our results obtained using Luc-reporter demonstrated clearly
that inhibition of Egr3 compromised NF-kB activity (Fig. 3A).
One important function of NF-kB is the protection of cells
from apoptotic cell death via survival signaling (Kumar et al.,
2004; Hayden and Ghosh, 2008). For example, NF-kB is known
to stimulate the expression of X-linked inhibitor of apoptosis
protein (XIAP) and to inhibit the activity of some caspases that
are crucially important for apoptotic signaling (Deveraux et al.,
1997). Therefore, it is reasonable to expect that higher
apoptosis in Egr3-inhibited myoblast is associated with
decreased NF-kB activity.
In addition to this, previous studies have suggested that
NF-kB activity is important for normal proliferation of
myoblasts during myogenesis (Kumar et al., 2004; Li et al.,
2008). Indeed, NF-kB activity is necessary to promote cell cycle
progression by stimulating cyclin D1 expression in myogenic
cells (Guttridge et al., 1999). Reduced NF-kB activity in muscle-
derived stem cells from haplodeletion of p65 (p65þ/) mouse is
associated with the proliferation defect (Lu et al., 2012).
1120 K U R O S A K A E T A L.

Fig. 5. Activation of apoptosis-related proteins in Egr3-inhibited myoblast. (A) Representative bands for full-length and cleaved PARP,
cleaved caspase 3, cleaved caspase 7, and GAPDH in shEgr3-transfected and scramble-transfected cells. Scr and sh, respectively, denote
scramble and shEgr3. (B) Relative protein levels of cleaved PARP. N ¼ 4/each.  P < 0.05 by unpaired t-test. Error bars represent the SEM. (C)
Relative protein levels of cleaved caspase 3. N ¼ 4/each.  P < 0.05 by un-paired t-test. Error bars represent the SEM. (D) Relative protein levels
of cleaved caspase 7. N ¼ 4/each.  P < 0.05 by unpaired t-test. Error bars represent the SEM.

Therefore, these notions suggest that reduction of NF-kB can
influence different levels of cellular function, which might
explain the limited effect of Z-VAD-FMK on Egr3-inhibited
myoblast.
Our results showed that the protein level of p65 was
decreased in Egr3-inhibited cells to a greater extent at 48 h
post transfection (Fig. 3B and C). p65 is a necessary protein that
assembles NF-kB heterodimer with p50 protein to stimulate
canonical NF-kB signaling (Kumar et al., 2004; Hayden and
Ghosh, 2008; Li et al., 2008). NF-kB activity is known to be
inhibited in muscle-derived stem cells from above p65þ/
mouse (Lu et al., 2012). Therefore, the reduction of NF-kB
activity in Egr3-inhibited cells might be attributable to the low
protein level of p65 in this study.
In contrast to the protein level, our results showed no
decrease in p65 mRNA levels with inhibition of Egr3
(Fig. 3D), which suggests that the reduction of p65 protein
(Fig. 3B and C) in the present study was caused by post
translational mechanisms such as protein degradation. An
earlier report described that peroxisome proliferator
activated receptor-gamma (PPAR-g) acts as a E3-ubiquitin
ligase for p65 proteasome degradation in mouse embryonic
fibroblast (Hou et al., 2012). Moreover, Egr1, an Egr-family
protein, has been found to inhibit PPAR-g protein expression
and transcriptional activity in hepatic satellite cells (Zhou
et al., 2009). Therefore, although the precise mechanism
remains unclear, these reports lead us to infer that Egr
protein can protect p65 from proteasome degradation by
suppressing E3 activity of PPAR-g. Upregulation of p65
mRNA levels at 24 h of the transfection in Egr3-inhibited
myoblast (Fig. 3D) might be a compensation mechanism for
the low level of p65 protein.
Interpretation of Egr3 upregulation in regenerating
skeletal muscle
Egr3 was upregulated by CTX-injured muscles of mice at
least in mRNA level in this study (Fig. 1B), suggesting that
Egr3 is important for muscle regeneration in adult skeletal
muscle. However, it is noteworthy that Egr3 is also known
to be important in the function of cells other than those of
muscle cell type. Indeed, Egr3 can function in the
development of neurons (Quach et al., 2013), activation of
T-cells (Safford et al., 2005; Sumitomo et al., 2013a,b) and
vascular endothelial cells (Suehiro et al., 2010), and
macrophage differentiation (Carter and Tourtellotte,
2007). In this regard, previous reports have described that
muscle injury by CTX is neurotoxic (Harris, 2003).
Furthermore, myotoxin-induced muscle injury is known to
be accompanied by intramuscular vessel damage (Ownby
et al., 1993) and inflammation reactions (Tidball and
Villalta, 2010). Therefore, even though myogenic cells are
primary components, these results of studies suggest

JOURNAL OF CELLULAR PHYSIOLOGY

 REGULATION OF MYOBLAST PROLIFERATION BY Egr3 1121

Fig. 6. Caspase inhibitor partially restored proliferation in Egr3-inhibited myoblast. (A) Indirect cell number after either pan-caspase
inhibitor Z-VAD-FMK or DMSO in shEgr3-transfected and scramble-transfected cells. N ¼ 7–8/each.  P < 0.05 by one-way ANOVA with
Tukey’s multiple comparison test. Error bars represent the SEM. (B) Proliferation rate from 24 to 48 h after either Z-VAD-FMK or DMSO in
shEgr3-transfected and scramble-transfected cells. N ¼ 7–8/each.  P < 0.05 by one-way ANOVA with Tukey’s multiple comparison test. Error
bars represent the SEM.

Fig. 7. Putative role of Egr3 in myoblast proliferation. Normally, Egr3 stabilizes p65, which is necessary for basal activity of NF-kB. NF-kB
acts as a part of anti-apoptotic system leading to the preservation of myoblast proliferation (A). However, the inhibition of Egr3 results in
degradation of p65, which exaggerates NF-kB activity. In the latter case, apoptotic signaling is activated excessively (B). Pan-caspase inhibitor
only partially restores proliferation in Egr3-inhibited myoblast, indicating that mechanisms other than apoptosis exist for maintaining
myoblast proliferation by Egr3 (dashed line).

that CTX-related muscle injury and regeneration can be
associated with the activity of multiple cell types that
engage in restoring muscle normality. The contributions of
Egr3 in regenerating muscle cells in vivo must be confirmed
in future investigations.
In conclusion, the results of this study constitute initial
evidence implicating Egr3 in myoblast proliferation and survival
signaling. A hypothesis drawn from this study is portrayed in
Fig. 7. An additional investigation is necessary to understand
the physiological role of Egr3 in the function of myoblast and
myogenesis.
Authors’ Contributions
KM and YO designed and performed experiments. KM and YO
analyzed data. KM, YO, TF, and TA wrote the manuscript. TF
and TA supervised the study.

JOURNAL OF CELLULAR PHYSIOLOGY

1122 K U R O S A K A E T A L.
Acknowledgments
This work was partially supported by a grant from The Nakatomi
Foundation to MK, JSPS KAKENHI grants (#24700706,
#15K01633 to MK), and by a research grant from the
St. Marianna University School of Medicine to YO.
Literature Cited
Andrechek ER, Hardy WR, Girgis-Gabardo AA, Perry RL, Butler R, Graham FL, Kahn RC,
Rudnicki MA, Muller WJ. 2002. ErbB2 is required for muscle spindle and myoblast cell
survival. Mol Cell Biol 22:4714–4722.
Angione AR, Jiang C, Pan D, Wang YX, Kuang S. 2011. PPARdelta regulates satellite cell
proliferation and skeletal muscle regeneration. Skelet Muscle 1:33.
Bernet JD, Doles JD, Hall JK, Kelly Tanaka K, Carter TA, Olwin BB. 2014. P38 MAPK
signaling underlies a cell-autonomous loss of stem cell self-renewal in skeletal muscle of
aged mice. Nat Med 20:265–271.
Brack AS, Rando TA. 2012. Tissue-specific stem cells: Lessons from the skeletal muscle
satellite cell. Cell Stem Cell 10:504–514.
Carter JH, Tourtellotte WG. 2007. Early growth response transcriptional regulators are
dispensable for macrophage differentiation. J Immunol 178:3038–3047.
Cheng H, Hao S, Liu Y, Pang Y, Ma S, Dong F, Xu J, Zheng G, Li S, Yuan W, Cheng T. 2015.
Leukemic marrow infiltration reveals a novel role for Egr3 as a potent inhibitor of normal
hematopoietic stem cell proliferation. Blood 126:1302–1313.
Day K, Shefer G, Shearer A, Yablonka-Reuveni Z. 2010. The depletion of skeletal muscle
satellite cells with age is concomitant with reduced capacity of single progenitors to
produce reserve progeny. Dev Biol 340:330–343.
Deveraux QL, Takahashi R, Salvesen GS, Reed JC. 1997. X-linked IAP is a direct inhibitor of
cell-death proteases. Nature 388:300–304.
Dumont NA, Wang YX, Rudnicki MA. 2015. Intrinsic and extrinsic mechanisms regulating
satellite cell function. Development 142:1572–1581.
Fry CS, Lee JD, Mula J, Kirby TJ, Jackson JR, Liu F, Yang L, Mendias CL, Dupont-Versteegden
EE, McCarthy JJ, Peterson CA. 2015. Inducible depletion of satellite cells in adult,
sedentary mice impairs muscle regenerative capacity without affecting sarcopenia. Nat
Med 21:76–80.
Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS, Jr. 1999. NF-kappaB controls
cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell
Biol 19:5785–5799.
Harris JB. 2003. Myotoxic phospholipases A2 and the regeneration of skeletal muscles.
Toxicon 42:933–945.
Hayden MS, Ghosh S. 2008. Shared principles in NF-kappaB signaling. Cell 132:344–362.
Hippenmeyer S, Shneider NA, Birchmeier C, Burden SJ, Jessell TM, Arber S. 2002. A role for
neuregulin1 signaling in muscle spindle differentiation. Neuron 36:1035–1049.
Hou Y, Moreau F, Chadee K. 2012. PPARgamma is an E3 ligase that induces the degradation
of NFkappaB/p65. Nat Commun 3:1300.
Jacobson C, Duggan D, Fischbach G. 2004. Neuregulin induces the expression of
transcription factors and myosin heavy chains typical of muscle spindles in cultured human
muscle. Proceedings of the National Academy of Sciences of the United States of America
101:12218–12223.
Kumar A, Takada Y, Boriek AM, Aggarwal BB. 2004. Nuclear factor-kappaB: Its role in health
and disease. J Mol Med (Berl) 82:434–448.
Kurosaka M, Machida S. 2013. Interleukin-6-induced satellite cell proliferation is regulated by
induction of the JAK2/STAT3 signalling pathway through cyclin D1 targeting. Cell Prolif
46:365–373.
Lacraz G, Rouleau AJ, Couture V, Sollrald T, Drouin G, Veillette N, Grandbois M, Grenier G.
2015. Increased stiffness in aged skeletal muscle impairs muscle progenitor cell
proliferative activity. PLoS ONE 10:e0136217.
Lehtinen SK, Rahkila P, Helenius M, Korhonen P, Salminen A. 1996. Down-regulation of
transcription factors AP-1, Sp-1, and NF-kappa B precedes myocyte differentiation.
Biochem Biophys Res Commun 229:36–43.
Lepper C, Partridge TA, Fan CM. 2011. An absolute requirement for Pax7-positive satellite
cells in acute injury-induced skeletal muscle regeneration. Development 138:3639–3646.
Li H, Malhotra S, Kumar A. 2008. Nuclear factor-kappa B signaling in skeletal muscle atrophy.
J Mol Med (Berl) 86:1113–1126.
Li S, Miao T, Sebastian M, Bhullar P, Ghaffari E, Liu M, Symonds AL, Wang P. 2012. The
transcription factors Egr2 and Egr3 are essential for the control of inflammation and
antigen-induced proliferation of B and T cells. Immunity 37:685–696.
Lu A, Proto JD, Guo L, Tang Y, Lavasani M, Tilstra JS, Niedernhofer LJ, Wang B, Guttridge
DC, Robbins PD, Huard J. 2012. NF-kappaB negatively impacts the myogenic potential of
muscle-derived stem cells. Mol Ther 20:661–668.
McCarthy JJ, Mula J, Miyazaki M, Erfani R, Garrison K, Farooqui AB, Srikuea R, Lawson BA,
Grimes B, Keller C, Van Zant G, Campbell KS, Esser KA, Dupont-Versteegden EE,
JOURNAL OF CELLULAR PHYSIOLOGY
Peterson CA. 2011. Effective fiber hypertrophy in satellite cell-depleted skeletal muscle.
Development 138:3657–3666.
Murphy MM, Lawson JA, Mathew SJ, Hutcheson DA, Kardon G. 2011. Satellite cells,
connective tissue fibroblasts and their interactions are crucial for muscle regeneration.
Development 138:3625–3637.
O’Donovan KJ, Wilkens EP, Baraban JM. 1998. Sequential expression of Egr-1 and Egr-3 in
hippocampal granule cells following electroconvulsive stimulation. J Neurochem 70:1241–1248.
O’Donovan KJ, Tourtellotte WG, Millbrandt J, Baraban JM. 1999. The EGR family of
transcription-regulatory factors: Progress at the interface of molecular and systems
neuroscience. Trends Neurosci 22:167–173.
Ogura Y, Mishra V, Hindi SM, Kuang S, Kumar A. 2013. Proinflammatory cytokine tumor
necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) suppresses satellite cell
self-renewal through inversely modulating Notch and NF-kappaB signaling pathways. J Biol
Chem 288:35159–35169.
Ogura Y, Hindi SM, Sato S, Xiong G, Akira S, Kumar A. 2015. TAK1 modulates satellite stem
cell homeostasis and skeletal muscle repair. Nat Commun 6:10123.
Ownby CL, Fletcher JE, Colberg TR. 1993. Cardiotoxin 1 from cobra (Naja naja atra) venom
causes necrosis of skeletal muscle in vivo. Toxicon 31:697–709.
Price FD, von Maltzahn J, Bentzinger CF, Dumont NA, Yin H, Chang NC, Wilson DH,
Frenette J, Rudnicki MA. 2014. Inhibition of JAK-STAT signaling stimulates adult satellite
cell function. Nat Med 20:1174–1181.
Pucci B, Kasten M, Giordano A. 2000. Cell cycle and apoptosis. Neoplasia 2:291–299.
Quach DH, Oliveira-Fernandes M, Gruner KA, Tourtellotte WG. 2013. A sympathetic
neuron autonomous role for Egr3-mediated gene regulation in dendrite morphogenesis
and target tissue innervation. J Neurosci 33:4570–4583.
Safford M, Collins S, Lutz MA, Allen A, Huang CT, Kowalski J, Blackford A, Horton MR,
Drake C, Schwartz RH, Powell JD. 2005. Egr-2 and Egr-3 are negative regulators of T cell
activation. Nat Immunol 6:472–480.
Schwartz LM. 2008. Atrophy and programmed cell death of skeletal muscle. Cell Death
Differ 15:1163–1169.
Suehiro J, Hamakubo T, Kodama T, Aird WC, Minami T. 2010. Vascular endothelial growth
factor activation of endothelial cells is mediated by early growth response-3. Blood
115:2520–2532.
Sumitomo S, Fujio K, Okamura T, Morita K, Ishigaki K, Suzukawa K, Kanaya K, Kondo K,
Yamasoba T, Furukawa A, Kitahara N, Shoda H, Shibuya M, Okamoto A, Yamamoto K.
2013a. Transcription factor early growth response 3 is associated with the TGF-beta1
expression and the regulatory activity of CD4-positive T cells in vivo. J Immunol
191:2351–2359.
Sumitomo S, Fujio K, Okamura T, Yamamoto K. 2013b. Egr2 and Egr3 are the unique
regulators for systemic autoimmunity. Jak-Stat 2:e23952.
Suzanne M, Steller H. 2013. Shaping organisms with apoptosis. Cell Death Differ 20:669–675.
Tidball JG, Villalta SA. 2010. Regulatory interactions between muscle and the immune
system during muscle regeneration. Am J Physiol Regul Integr Comp Physiol 298:
R1173–R1187.
Tierney MT, Aydogdu T, Sala D, Malecova B, Gatto S, Puri PL, Latella L, Sacco A. 2014.
STAT3 signaling controls satellite cell expansion and skeletal muscle repair. Nat Med
20:1182–1186.
Tourtellotte WG, Milbrandt J. 1998. Sensory ataxia and muscle spindle agenesis in mice
lacking the transcription factor Egr3. Nat Genet 20:87–91.
Tourtellotte WG, Keller-Peck C, Milbrandt J, Kucera J. 2001. The transcription factor Egr3
modulates sensory axon-myotube interactions during muscle spindle morphogenesis.
Dev Biol 232:388–399.
Wang YX, Dumont NA, Rudnicki MA. 2014. Muscle stem cells at a glance. J Cell Sci
127:4543–4548.
Wieland GD, Nehmann N, Muller D, Eibel H, Siebenlist U, Suhnel J, Zipfel PF, Skerka C. 2005.
Early growth response proteins EGR-4 and EGR-3 interact with immune inflammatory
mediators NF-kappaB p50 and p65. J Cell Sci 118:3203–3212.
Xi H, Schwartz R, Engel I, Murre C, Kersh GJ. 2006. Interplay between RORgammat, Egr3,
and E proteins controls proliferation in response to pre-TCR signals. Immunity
24:813–826.
Yin H, Price F, Rudnicki MA. 2013. Satellite cells and the muscle stem cell niche. Physiol Rev
93:23–67.
Yoshida T, Galvez S, Tiwari S, Rezk BM, Semprun-Prieto L, Higashi Y, Sukhanov S, Yablonka-
Reuveni Z, Delafontaine P. 2013. Angiotensin II inhibits satellite cell proliferation and
prevents skeletal muscle regeneration. J Biol Chem 288:23823–23832.
Zhou Y, Jia X, Zhou M, Liu J. 2009. Egr-1 is involved in the inhibitory effect of leptin on
PPARgamma expression in hepatic stellate cell in vitro. Life Sci 84:544–551.
Supporting Information
Additional supporting information may be found in the online
version of this article at the publisher’s web-site.