Field Crops Research

Soil fumigation in potato production systems has varying effects on soil health
--Manuscript Draft--

Manuscript Number: FIELD-D-23-00701

Article Type: Research Paper

Keywords: Fumigation; Metam sodium; Soil microbiome; Soil health; Sustainability

Abstract: Sustainable agriculture requires soil management practices that increase productivity
while minimizing detrimental impacts on soil health. Soil fumigation is a common
practice which controls soil-borne diseases and promotes yield, but it potentially
influence soil health by suppressing soil microorganisms. Considering the wide use of
fumigation, we still lack a complete understanding of its effects on soil health, which
prevents us from understanding the resilience of agricultural ecosystems and
prescribing management activities accordingly. Moreover, soils are highly variable,
and so both the agronomic benefits and any negative impacts of fumigation on soil
health may vary across soil types. In this study, we investigated the impact of metam
sodium fumigation on soil health using the potato fields of Wisconsin. We collected soil
and potatoes from 7 commercial potato fields subjected to fumigation and non-
fumigation treatments, representing two distinct growing regions. We measured the
effect of fumigation on tuber yield and soil-borne diseases, soil chemistry, microbial
activities, and community structure. Fumigated plots showed higher potato yields as
well as bacterial diversity and microbial-mediated carbon retention than unfumigated
plots in central sandy soils; the opposite trend was observed in northern loamy soils.
We also found that soil bacterial community diversity plays an important role in
determining yield responses to fumigation. We concluded that fumigation has varying
effects on soil health depending on the soil conditions. Sustainability of soil health is
largely dependent on soil microbiome, as treadmill effect is more likely to happen
where microbial diversity is sensitive to fungicide application.

Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation
Highlights

1. Metam sodium fumigation had varying impacts on potato yield, soil microbial community and

nutrient cycling depending on the soil conditions.

2. Soil bacterial diversity plays an important role in determining plant yield responses to fumigation.

3. Fumigation “treadmill” effect is closely related to soil bacterial diversity.

Declaration of interest statement

Declaration of interests

☒The authors declare that they have no known competing financial interests or personal relationships
that could have appeared to influence the work reported in this paper.

☐The authors declare the following financial interests/personal relationships which may be considered
as potential competing interests:
Manuscript File Click here to view linked References

1 Soil fumigation in potato production systems has varying effects on soil health

2 Shan Shana*, Richard A. Lankaua, Matthew D. Ruarkb

a
3 Department of Plant Pathology, University of Wisconsin-Madison, Madison, Wisconsin, USA

b
4 Department of Soil Science, University of Wisconsin-Madison, Madison, Wisconsin, USA

5 * Corresponding author

6 Full postal address: Shan Shan, 1630 Linden Dr., Russell lab, Madison, WI, 53706

7 Email: Shan Shan, sshan5@wisc.edu

10

11

12

13

14

15

16

17

18

19

20

1
21 Abstract

22 Sustainable agriculture requires soil management practices that increase productivity while

23 minimizing detrimental impacts on soil health. Soil fumigation is a common practice which controls soil-

24 borne diseases and promotes yield, but it potentially influence soil health by suppressing soil

25 microorganisms. Considering the wide use of fumigation, we still lack a complete understanding of its

26 effects on soil health, which prevents us from understanding the resilience of agricultural ecosystems and

27 prescribing management activities accordingly. Moreover, soils are highly variable, and so both the

28 agronomic benefits and any negative impacts of fumigation on soil health may vary across soil types. In

29 this study, we investigated the impact of metam sodium fumigation on soil health using the potato fields

30 of Wisconsin. We collected soil and potatoes from 7 commercial potato fields subjected to fumigation

31 and non-fumigation treatments, representing two distinct growing regions. We measured the effect of

32 fumigation on tuber yield and soil-borne diseases, soil chemistry, microbial activities, and community

33 structure. Fumigated plots showed higher potato yields as well as bacterial diversity and microbial-

34 mediated carbon retention than unfumigated plots in central sandy soils; the opposite trend was observed

35 in northern loamy soils. We also found that soil bacterial community diversity plays an important role in

36 determining yield responses to fumigation. We concluded that fumigation has varying effects on soil

37 health depending on the soil conditions. Sustainability of soil health is largely dependent on soil

38 microbiome, as treadmill effect is more likely to happen where microbial diversity is sensitive to

39 fungicide application.

40 Keywords: Fumigation; Metam sodium; Soil microbiome; Soil health; Sustainability

41

42 1. Introduction

43 Soil is a non-renewable natural resource that supports important ecosystem services of benefit to

44 humans and the environment. Soil harbors a myriad of organisms, maintains biogeochemical cycles,

2
45 supports plant productivity, and serves as an environmental filter to provide clean air and water.

46 Deterioration of soil health is of vital concern, not only because human life is adversely affected, but also

47 because the regeneration of soil resources takes geological time. Degradation and loss of productive

48 agricultural land has become one of the most pressing ecological and economic concerns in the past few

49 decades with the rapid growth of the world population (Blum, 2013). Thus, managing soil health has

50 become an important priority for maintaining the integrity of terrestrial ecosystems.

51 Soil health is defined as the continued capacity of soil to function as a vital living ecosystem that

52 sustains plants, animals, and humans (NRCS, 2018). It is a multi-dimensional concept which

53 encompasses different aspects of ecosystem services, including sustainable plant production, disease

54 control, and environmental quality regulation. Historically, assessment of soil health has been focused on

55 chemical fertility and crop production. More recently, emphasis has shifted towards the integrated

56 functions of soil (Larkin, 2015). To increase the sustainability of agricultural systems, soil management

57 practices must not only benefit yield, but also promote a generally healthier soil environment.

58 Unfortunately, managing soil to improve one service may result in trade-offs with other services. When

59 keeping plant production as the primary goal, management practices such as fertilization, tillage, and

60 pesticides can compromise other aspects of soil functions and eventually lead to a series of environmental

61 problems. Consequently, it remains a major challenge to conserve ecosystem services while maintaining

62 or improving agricultural yield.

63 Fumigation is one management example which targets the control of soil-borne diseases but can

64 potentially impair other ecosystem services. In the US Midwest, many potato growers rely on injecting

65 broad-spectrum fungicide into the soil prior to planting to minimize potato yield loss from soil-borne

66 diseases. Metam sodium is a commonly used fumigant, mostly due to its effectiveness in controlling

67 Verticillium wilt (Rowe and Powelson, 2002; Kelling et al., 2017). Verticillium wilt is a disease caused

68 by the fungus Verticillium dahlia, with symptoms of leaf chlorosis, early senescence, and plant wilting.

69 Verticillium wilt is the primary factor for Potato Early Dying (PED), which can result in 10% to 50%

3
70 yield losses (Johnson and Dung, 2010). Metam sodium is also used for controlling potato common scab

71 (Al-Mughrabi et al., 2016), which is caused by the bacterial pathogen Streptomyces scabies and relatives.

72 With symptoms of pitted, corky lesions on the tuber surface, potato common scab causes significant

73 economic losses due to the rejection of infected tubers.

74 With the known broad biocidal activity of fumigants, fumigation raises concerns regarding effects

75 on soil microbiomes and associated ecosystem services (Chellemi and Porter, 2001). First, most soil

76 microorganisms are heterotrophs that make nutrients available to plants through decomposition activities.

77 Reductions in the abundance and diversity of the general microbial community has the potential to affect

78 organic matter decomposition and nutrient supply to plants. For instance, metam sodium has been found

79 to reduce soil enzyme activities related to carbon (C), nitrogen (N), and phosphorus (P) decomposition (Li

80 et al., 2017), and negatively impact microbial functions in N mineralization in both lab and field settings

81 (Collins et al., 2006; Kelling et al., 2017; Crants et al., 2021; Sennett et al., 2021). However, observations

82 within those studies were limited to a few months. On the other hand, microbial biomass also acts as a

83 sink for C and nutrients, which can play an important role in stabilizing nutrient retention. Loss of this

84 buffering capacity can lead to deteriorated soil quality and nutrient leaching loss, subsequently

85 contributing to the already existing problematic underground and surface water quality issues surrounding

86 agricultural areas. Unfortunately, our understanding of the fumigation effect on microbial retention of

87 nutrients remains very limited (Li et al., 2017; Sun et al., 2020).

88 Over time fumigation can lead to deteriorated soil health if the benefits of growth-promotion and

89 disease-suppressiveness brought by soil microorganisms are lost. Anecdotally, potato growers sometime

90 report a “fumigation treadmill effect”, where fumigation is effective at reducing disease in the short-term,

91 but increased fumigation intensity and frequency over time is needed to maintain fumigation efficacy and

92 yield (Hills et al., 2020). Two mechanisms have been proposed to explain this phenomenon. First,

93 repeated fumigation may increase soil pathogen populations over time by inducing fungicide resistance

94 over generations of selection, leading to reduced fumigation efficiency (Domsch, 1964; Gómez Expósito

4
 95 et al., 2017). However, evidence for increased soil pathogen population over time is lacking from past

96 literature. Soil pathogen levels usually decrease immediately following fumigation and recover to pre-

97 fumigation levels one year after application (Freeman et al., 2002; Weiland et al., 2011). Even soil

98 pathogen population levels stay constant, the disease pressure may increase if the broader soil microbial

99 community loses its ability to suppress soil pathogens (Weller et al., 2002). Correspondingly, a second

100 hypothesis for the treadmill effect is that repeated fumigation suppresses the growth-promotion and

101 disease-suppressiveness functions of soil microbiomes. Many soil microorganisms such as Trichoderma,

102 Streptomycetes, and Bacillus are antagonistic against soil-borne diseases. Fumigation has been found to

103 eliminate Fusarium wilt-suppressing microorganisms (Weller et al., 2002) and decrease the portion of

104 beneficial Trichoderma in the soil microbial community (Chen et al., 2022). Contrasting findings have

105 also been reported in a 3-year field study where soil Trichoderma population increased with repeated

106 fumigation (De los Santos et al., 2003). However, the disease-suppressiveness of soil is more often

107 contributed to the overall makeup of the microbial community (Schlatter et al., 2017). In this case,

108 evaluating treadmill risks will require a more comprehensive understanding of the responses of microbial

109 community profile to fumigation, as those responses can provide important implications on their abilities

110 to recover from disturbances and maintain beneficial functions. More importantly, we need to be able to

111 link microbial responses to plant responses, which has been a piece of missing information in past

112 research and is important for understanding the mechanisms of fumigation treadmill effect.

113 Driven by our interests in investigating the effect of fumigation application on soil health, we

114 reached out to Wisconsin potato growers in search of collaboration during the fall of 2020. Three

115 growers offered to leave a section of their fields unfumigated for potato crops in 2021 and declined our

116 offer to compensate them for extra work and yield loss. A total of seven fields were provided by those

117 growers with two in northern WI and five in central WI. Those commercial fields distributed across the

118 two major growing regions represent the heterogenous potato growing systems of Wisconsin. Compared

119 to the fields through the university research stations, the grower fields provide a much more realistic

5
120 context for studying fumigation effects without heavy modification by past research projects. With this

121 opportunity we investigated three overarching questions related to fumigation:

122 (1) How does fumigation affect potato tuber yields and soil-borne disease severity, and does the

123 magnitude or direction of this effect vary across regions?

124 (2) How does fumigation affect soil health, and does the magnitude or direction of this effect vary across

125 regions? Specifically, we investigated the effect of metam sodium fumigation on 1) soil physiochemical

126 properties, 2) microbial activities related to nutrient cycling, and 3) microbial community composition

127 and abundance.

128 (3) How does the initial state of the soil system, and the response of the soil system to fumigation, explain

129 the variable effects of fumigation on potato yield?

130 With these questions we hope to (1) gain a deeper understanding of metam sodium’s effect on

131 soil health, (2) link soil microbial responses to fumigation to the consequences on ecosystem functions,

132 including soil nutrient cycling, plant growth and long-term sustainability. (3) At last, by investigating

133 both the short-term benefits of fumigation on soil borne disease control and yields along with the

134 potential for long-term consequences via changes in soil health, we aim to inform management practices

135 of fumigation application for the goal of sustainable agriculture.

136 2. Methods

137 2.1. Study sites

138 The study sites are 7 commercial potato fields across a gradient of soil physicochemical

139 properties, with five fields located in Waushara County of central Wisconsin, and two located in Langlade

140 County of northern Wisconsin. The soils varied from sand to silt loams (Table 1), with pH ranging from

141 4.8 to 6.4, and organic matter (OM) content ranging from 0.55% to 3.52% (Table 2). Fields ranged in

142 size from 28-60 ha, with regular application of pesticides for insect and disease control, fertilization, and

6
143 irrigation. All fields had a 3-year crop rotation history, but different rotation crops and potato cultivars

144 planted from 2019-2021 (Table 1). Fields were fumigated with metam sodium (42%) by surface injection

145 between Oct 12 and Oct 29 of 2020. Tillage was performed in some of the fields (Table 1) a few days

146 before fumigation, to prepare the soil by incorporating the previous season’s crop residue into the soil. A

147 strip across every field ranging from 4 m to 27 m in width was left unfumigated as the control. For fields

148 CF1-CF4, 20 sampling plots were established within each field, with 10 located in the unfumigated strip,

149 and the other 10 located in the adjacent fumigated region paired with the unfumigated plots. The

150 unfumigated plots were 11~14 m away from the fumigated plots. For fields CF5, NF1 and NF2, 8

151 sampling plots were established within each field, with 4 plots in the unfumigated strip and the other 4 in

152 the fumigated region. Each plot was a 3-meter-long hill. Plots of the same fumigation treatment were 10-

153 17 m away from each other along the potato hills. No Cover crops were planted over the winter. Across

154 sites, potatoes were planted between mid-April to the end of May of 2021 and harvested between late

155 August to mid-September.

Crop rotation Fumigation

Field/Location Soil Till Cultivar/Variety
2020/2019 Rate (Liter ha-1)
CF1/Central Coloma loamy sand, mixed, mesic Corn/Soybean No Lakeview/Russet 355
Lamellic Udipsamments
CF2/Central Sparta loamy sand, mixed, mesic Entic Corn/Soybean No Atlantic/Chipper 178
Hapludolls
CF3/Central Richford loamy sand, mixed, Heath/Corn Yes Burbank/Russet 355
superactive, mesic Arenic Hapludalfs
CF4/Central Plainfield sand, mixed, mesic Typic Heath/Corn Yes Goldrush/Russet 355
Udipsamments
CF5/Central Richford loamy sand, mixed, Corn/Soybean No Goldrush/Russet 355
superactive, mesic Arenic Hapludalfs
NF1/Northern Antigo silt loam, mixed, superactive, Alfalfa/Alfalfa Yes Private/Chipper 374
frigid Haplic Glossudalfs
NF2/Northern Padus sandy loam, mixed, superactive, Oats/Clover Yes Private/Chipper 374
frigid Alfic Haplorthods
156 Table 1 Field information for the sampling locations (Till: tillage before fumigation).

157 2.2. Soil and potato sampling

158 Soils were collected with a 2.54 cm diameter soil auger to the depth of 15 cm from each plot on

159 July 24th and 25th of 2021 during the growth season. We established 6 sampling locations evenly across

160 each 3-meter-long plot. At each sampling location, five soil cores were collected from the top of a hill,

7
161 two shoulders, and the two trenches. The five cores were thoroughly mixed and composited into one

162 sample. A total of 30 soil cores were collected for each plot. Soils were transported to the lab and stored

163 at 4 °C till analysis for N mineralization and microbial biomass C and N analysis within 3 days after

164 collection. A subsample of fresh soil was frozen in -80 until used for microbial community, abundance,

165 and enzyme analysis. Another 300 g of the homogenized soils were air-dried at 35 °C for the analysis of

166 soil physiochemical properties.

167 At the end of the growing season, each plot was harvested by hand. Potatoes were cleaned from

168 soil residue and measured for total yield on a potato grading machine (AgRay, CA) at the Hancock

169 Agricultural Research Station. A random set of 20 tubers from each plot were visually assessed for

170 superficial and pitted scab as well as the percentage coverage by the two types of lesions. The incidence

171 of superficial or pitted scab was calculated as the number of infected tubers divided by the total number of

172 tubers. We calculated scab severity as the average percentage coverage by superficial-scab and pitted-

173 scab. Finally, we cut open the tuber to look for vascular discoloration caused by V. dahlia infection. The

174 incidence of vascular discoloration was calculated as described above.

175 2.3. Soil physiochemical properties

176 The air-dried soils were shipped to the Agvise soil testing lab (Benson, MN) for analysis of

177 chemical properties. Soil pH was measured in 1:1 soil/water mixture. Total C and organic matter

178 content was quantified by dry combustion and total inorganic C was determined by measuring the CO2

179 released with a calcimeter after treating the soil with HCl. Total organic C (TOC) was the difference

180 between total C and total inorganic C. Autoclave citrate extractable protein was measured by autoclaving

181 the sodium citrate extracts of soil samples, followed by centrifuge and colorimetric assay with

182 bicinchoninic acid (Schindelbeck et al., 2016). Soil inorganic N (nitrate-N and ammonium-N) was

183 measured by extracting soils with KCl and running the extracts on a FIA auto-analyzer. Soil extractable P

184 was measured using the Bray method, where a hydrochloric acid-ammonium fluoride solution was used

185 to react with soil P, and the reaction was reduced with ascorbic acid for color development and measure

8
186 of absorbency. Soil potassium (K) was measured by digesting the soil with hydrochloric acid, nitric acid

187 and hydrogen peroxide, and then quantifying the cation concentration with Inductive Coupled Plasma-

188 Atomic Emission Spectroscopy (ICP-AES).

189 2.4. Microbial activities related to nutrient cycling

190 Microbial extracellular enzyme activity was measured using a high-throughput fluorescence-

191 based assay. Briefly, 3 g of frozen soils were thawed at room temperature, and then ground in 125 mL of

192 50 mM sodium acetate buffer with pH close to that of the soil. The soil slurry was then incubated with

193 fluorophore-linked substrates at room temperature for 3 hours in a black 96-well plate. Fluorescence

194 intensity was read at excitation of 365 and emission of 450 nm wavelength on a plate reader. The

195 concentrations of substrates were optimized with an incubation study where the enzyme catalytic rates

196 corresponding to a concentration gradient were measured and the substrate concentrations just reaching

197 the saturation were selected (Bailey et al., 2011). A standard curve was included for each sample to

198 account for the quenching effect and background fluorescence. Aminopeptidase, β-glucosidase, β-N-

199 acetylglucosaminidase, cellobiolydrolase, and acid phosphatase were measured using the corresponding

200 substrates described in Shan (2020). Microbial C enzyme activity was expressed as the sum of β-

201 glucosidase, β-N-acetylglucosaminidase, and cellobiolydrolase activity. Microbial N enzyme activity was

202 the sum of Aminopeptidase and β-N-acetylglucosaminidase activity. Microbial P enzyme activity was

203 the activity of acid phosphatase.

204 Nitrogen mineralization potential was measured using a 21-day incubation study. Briefly, 15 g of

205 freshly collected soils were extracted with 30 mL of 2 M KCl on a rotary shaker for 40 mins, followed by

206 filtration through Whatman #1 filter paper. Another set of 15 g of soils were incubated at room

207 temperature for 21 days in loosely capped centrifuge tubes placed in a bin. A thin layer of water was kept

208 in the bottom of the bin to help maintain the soil moisture during incubation. This set of soils was then

209 extracted with the above method. The dissolved inorganic N was measured in the soil extracts with a FIA

210 auto-analyzer at the Soil and Forage Analysis Lab of University of Wisconsin-Madison. Nitrogen

9
211 mineralization rate was represented by the change of soil inorganic N concentration over the incubation

212 period.

213 Microbial biomass C and N (MBC, MBN) were measured using the chloroform fumigation-

214 incubation method (Vance et al., 1987). Briefly, a subsample of 10 g of fresh soil was fumigated with

215 ethanol-free chloroform for 72 hours at room temperature in a sealed desiccator in the dark. The

216 fumigated soil and an unfumigated subsample were extracted using 0.5 M K2SO4 for the C and N. The

217 dissolved organic C (DOC) was measured using a total organic C analyzer at the Water Science and

218 Engineering Lab of University of Wisconsin-Madison. Total dissolved N (DN) in the extract was

219 measured using Kjeldahl digestion at the Soil and Forage Analysis Lab of University of Wisconsin-

220 Madison. Microbial biomass C/N was represented by the difference between the DOC/DN contents of

221 the fumigated and unfumigated samples divided by the conversion factor of 0.45 (Jenkinson et al., 2004).

222 Potential C mineralization was measured in the Agvise soil testing lab by incubating re-wetted

223 dry soils for 24 hours and measuring the CO2 produced with an infrared gas analyzer (Haney et al., 2008).

224 We normalized the potential C mineralization rate by microbial biomass C, expressed as the amount of C

225 loss through respiration per unit microbial biomass. Results are expressed on an oven-dry soil basis

226 (105°C, 24 h).

227 2.5. Microbial community composition

228 DNA was extracted from 0.25 g of frozen soils using the Powersoil Pro kit (Qiagen, Hilden,

229 Germany) following the manufacture’s protocol. DNA quality and quantity was measured using a Qubit

230 fluorometer (ThermoFisher Scientific, Waltham, MA). The V3 and V4 region of bacteria 16S rRNA was

231 amplified using the primer sets V3F (CCTACGGGAGGCAGCAG) and 806R

232 (GGACTACHVGGGTWTCTAAT) (Gohl et al., 2016). The fungal ITS 2 region was amplified using

233 primer 5.8S (TCGATGAAGAACGCAGCG) and ITS4 (TCCTCCGCTTATTGATATGC) (Wang et al.,

234 2015). The primary PCR reaction was a 10 µL reaction containing 0.2 µL of Takara PrimeSTAR high-

10
235 fidelity polymerase (Takara Bio, Kusatsu, Japan), 0.25 µL of each of the forward and reverse primers (10

236 µM), 2 µL of PrimeSTAR buffer, 0.07 µL of T4 DNA ligase, 1 µL of DNA template. The amplification

237 cycling conditions were: 98 °C for 5 min; 30 or 34 cycles of 98 °C for 45 or 30 s, 50 °C for 45 s, and

238 68 °C for 90 s or 1 min; and 68 °C for 5 or 15 min. The products of the primary PCR were then used as

239 the template for a second PCR reaction where the Illumina flow cell adaptors and indices were added.

240 The final PCR products were pooled at equimolar concentrations and cleaned-up using a PCR clean-up

241 kit (Zymo Research, Irvine, CA). The amplicons were sequenced in a pair-end 2×300 bp run on an

242 Illumina Miseq platform at the Biotechnology center of University of Wisconsin-Madison. The amplicon

243 sequencing data were processed in Qiime 2 (Bolyen et al., 2018). For ITS reads, the demultiplexed

244 sequences were first trimmed using cutadapt to remove the forward and reverse primers before fed into

245 the DADA2 pipeline; whereas 16S reads were directly processed in DADA2. In DADA2, reads were

246 truncated to allow a minimum overlap of 20 nucleotides, and filtered to a maxEE of 4, then denoised,

247 pair-end reads merged, and chimeras removed to produce a feature table of amplicon sequence variant

248 (ASV). Taxonomy was assigned using the RDP Naïve Bayesian Classifier fit to the SILVA 138 database

249 for 16S reads and UNITE database for ITS reads using Qiime 2’s feature-classifier plugin. Mitochondrial

250 and chloroplast sequences were excluded using the feature-table plugin.

251 2.6. Microbial abundance

252 The abundance of total bacteria, fungi, Pathogenic Streptomyces, and V. dahlia in the soil samples

253 were determined by quantitative PCR targeting bacterial 16S rRNA, fungal ITS, V. dahlia IGS, and

254 thaxtomin synthetase (txtAB) genes, respectively. Primers used were Eub338

255 (ACTCCTACGGGAGGCAGCAG) and Eub518 (ATTACCGCGGCTGCTGG) for total bacteria (Fierer

256 et al., 2005), ITS86F (GTGAATCATCGAATCTTTGAA) and ITS4 (TCCTCCGCTTATTGATATGC)

257 for total fungi (Op De Beeck et al., 2014), StrepF (GCAGGACGCTCACCAGGTAGT) and StrepR

258 (ACTTCGACACCGTTGTCCTCAA) for Pathogenic Streptomyces (Qu et al., 2008), and Vdf929

259 (CGTTTCCCGTTACTCTTCT) and Vdr1076 (GGATTTCGG CCCAGAAACT) for V. dahlia (Bilodeau

11
260 et al., 2012). Standard curves were created by 10-fold serial dilution of the target gene cloned into an E.

261 coli plasmid (pGem-T Vector, Promega, Madison, WI). Standard curves showed PCR amplification

262 efficiencies of 90-105%, with r2>0.99. Each qPCR reaction contained 5 µL of Sooadvanced Sybr Green

263 supermix (Bio-rad, Hercules, CA), 0.4 µL of each of the 20 µM forward and reverse primers, 2.7 µL

264 nuclease free water, and 1.5 µL diluted soil DNA. PCR cycling conditions were 95°C for 5 min; 38

265 cycles of 95°C for 15 s, selected annealing temperature for 30 s, and 72°C for 30 s; and a melting curve

266 from 65°C to 95°C with increase of 0.5°C per cycle. The optimal annealing temperature was selected

267 using a gradient PCR, and set at 47°C for total bacteria, 55°C for total fungi, and 58°C for Pathogenic

268 Streptomyces and V. dahlia.

269 2.7. Statistical analysis

270 We used a variety of univariate and multivariate analysis to answer our three overarching

271 questions.

272 (1) How does fumigation affect potato tuber yields and soil-borne disease severity, and does the

273 magnitude or direction of this effect vary across regions?

274 The fumigation effects on yield and soil-borne disease severity were tested using a linear mixed

275 model including the fixed effects of fumigation (yes vs. no), region of the field (central vs. northern), and

276 the interaction between fumigation and region. Field identity, nested within region, was included as a

277 random effect using the glimmix procedure in SAS 9.4. The Satterthwaite approximation was used to

278 calculate the effective degrees of freedom. The model used pooled standard deviation from central and

279 northern regions to test fumigation effect in both regions. When a significant interaction effect was

280 identified, the fumigation effect at each level of region (central or northern) was further tested using a

281 partial F test with the slicediff statement. Data were assessed for normality and were transformed in case

282 of skewed distributions.

12
283 (2) How does fumigation affect soil health, and does the magnitude or direction of this effect vary across

284 regions?

285 We used similar mixed effects models as described above to test the fumigation effects on the

286 measured soil health parameters: soil chemical variables, microbial activities, microbial community

287 diversity and abundance.

288 The soil 16S and ITS community data was processed in R using the phyloseq and vegan package.

289 Alpha diversity measured as the Inverse Simpson index was calculated using phyloseq after samples were

290 rarefied to the minimum sample depth to account for variations in sequencing depth. Alpha diversity was

291 initially calculated at ASV level; then the ASVs were merged at Class, Order, Family, and Genus level

292 and the corresponding alpha diversities at each level were calculated. A Principal Coordinate Analysis

293 (PCoA) based on Bray-Curtis dissimilarity was performed to visualize the differences in microbial

294 community structure. PERMANOVA was used to test the difference between the fumigated and

295 unfumigated soil microbial communities using the adonis function in Vegan. The permutation was

296 stratified by field. Due to the clear separation of northern field microbial communities from those of the

297 central fields, we performed PCoA and PERMANOVA for the two regions separately. The first two

298 principal coordinates were extracted as descriptions of the community to be used in the later analysis. The

299 first two axes extracted by the Principal Component Analysis explained 27.2%, 29.8%, 23.7%, and 38.9%

300 of the variation of the taxa for central field bacterial, central field fungal, northern field bacterial, and

301 northern field fungal community, respectively.

302 The main phyla/subphyla of bacterial community was categorized as copiotrophs or oligotrophs

303 based on past literature of naturally occurring microbial communities (Ho et al., 2017; Vadstein et al.,

304 2018). Actinobacteria was not grouped as it may contain both copiotrophic and oligotrophic families

305 (Morrissey et al., 2016). We calculated the absolute abundance of each copiotrophic- or oligotrophic-

306 associated phyla by multiplying the relative abundance obtained from sequencing data by the qPCR

307 measure of the total abundance of soil bacteria.

13
308 (3) How does the initial state of the soil system, and the response of the soil system to fumigation, explain

309 the variable effects of fumigation on potato yield?

310 We used stepwise regression to determine the soil health parameters that can explain the variation

311 in fumigation effects on potato yields across fields. We did this in two ways: Model 1 built models with

312 soil health parameters measured in the unfumigated section of the field as predictors of yield response, to

313 determine how variation in the initial state of the soil ecosystem predicts fumigation effects, and Model 2

314 used the degree of change in soil health parameters between paired fumigated/unfumigated soil samples,

315 in addition to the selected predictors from the previous model, to determine how the responses of soil

316 health to fumigation predicted the fumigation effect on yield. In each case, a full model was constructed

317 with variables of interests, followed by a stepwise selection procedure to produce the best predictors.

318 We calculated the fumigation effect on potato yield as the relative difference of yield between

319 each paired fumigated and unfumigated sampling plots: (fumigated-unfumigated)/unfumigated. This

320 calculation results in 4 measurements of the fumigation effect for each field. The soil health parameters

321 of unfumigated soils from each field were used to predict the fumigation effect on yield, as these were

322 taken to represent the initial, or undisturbed properties of the soil system. Initially, a multiple linear

323 regression model was constructed using (1) potato variety (chipper vs Russet), (2) qPCR abundance of

324 soil V. dahlia, (3) soil pH, organic matter, N, and K, (4) N mineralization rate and microbial N enzyme

325 activity, (5) bacterial and fungal diversity, and (6) bacterial and fungal community structure represented

326 as values of the first two principal coordinates axes (see above). Prior to model selection,

327 multicollinearity analysis was performed by quantifying variance inflation and condition index scores.

328 We found significant correlations among some of the bacterial and fungal community principal

329 coordinates and other variables. We then simplfied the microbial community variables (6) by retaining

330 the second principal coordinates axis of fungal community and removing the first axes of bacterial and

331 fungal communities as those correlated with potato variety and soil pH; the second axis of bacterial

332 community composition was also removed as it correlated with bacterial diversity and the latter had a

14
333 much higher correlation coefficient (Pearson correlation coefficient, -0.35 vs 0.05) with the fumigation

334 effect on yield. A stepwise procedure was then used to add or remove predictor variables to produce the

335 best model with the lowest scores of AIC.

336 Second, as we were also interested to know whether the response of soil health to fumigation

337 would predict the response of yield to fumigation, we included a few extra variables representing the

338 response of soil health to fumigation to the best model selected from the previous procedure. We added

339 the fumigation effects on (7) soil chemistry, (8) microbial activity, (9) qPCR abundance of total soil

340 bacteria, fungi, and V. dahlia, (10) bacterial and fungal diversity, (11) bacterial and fungal community

341 structure, as well as (12) scab severity and vascular discoloration incidence in the tuber. The fumigation

342 effect on soil chemistry was calculated as the euclidean distance between each paired fumigated and

343 unfumigated plots in their soil physiochemical properties. The fumigation effects on microbial activity

344 were calculated the same way. The fumigation effects on qPCR abundance, microbial diversity, scab

345 severity and vascular discoloration incidence were calculated as the relative difference between each

346 paired fumigated vs. unfumigated plots: (fumigated-unfumigated)/unfumigated. The fumigation effects

347 on microbial community structure were represented as the Bray-Curtis dissimilarity between each paired

348 fumigated and unfumigated plots. Stepwise procedure was used to select the best predictors as described

349 before. Multiple linear regression analysis was performed in R.

350 3. Results

351 (1) How does fumigation affect potato tuber yields and soil-borne disease severity, and does the

352 magnitude or direction of this effect vary across regions?

353 3.1. Fumigation effect on tuber yield and diseases

354 The effects of fumigation on potato tuber yield varied between the northern and central fields of

355 Wisconsin (fumigation×region, P=0.01, Table 2). Potato yield was higher with fumigation in central

15
356 fields (fumigation effect at the “central” level of the variable “region”, P<0.01), but showed a lower trend

357 with fumigation in northern fields (P=0.16, Fig. 1a).

358 Fumigated plots generally presented a similar level of scab incidence and severity compared to

359 those of the unfumigated plots (fumigation main effect, P>0.1, Table 2, Fig. 1b-d). The incidence of

360 vascular discoloration was marginally lower with fumigation (P=0.06) in both central and northern fields

361 (P=0.36, Fig. 1e).

362 Soil pathogenic Streptomyces abundance measured by qPCR was not different between the

363 fumigated and unfumigated plots (P=0.85, Fig. 1f). Soil V. dahlia abundance measured by qPCR was

364 also not different between the fumigated and unfumigated plots (P=0.76, Fig. 1g).

Fumigation Region Fumigation×Region

Yield and disease DF F P DF F P DF F P
Tuber yield 1, 5.9 0.52 0.50 1, 5.4 0.47 0.52 1, 5.9 11.84 0.01
Superficial-scab incidence 1, 9.4 0.46 0.51 1, 7.1 0.93 0.37 1, 9.4 0.52 0.49
Pitted-scab incidence 1, 5.8 0.44 0.53 1, 7.1 0.05 0.83 1, 5.8 0.02 0.88
Scab severity 1, 5.9 2.71 0.15 1, 5.1 0.46 0.53 1, 5.9 0.36 0.57
Vascular discoloration 1, 8.2 4.60 0.06 1, 5.7 0.60 0.47 1, 8.2 0.94 0.36
Soil Strep abundance 1, 5 0.04 0.85 1, 5 0.02 0.89 1, 5 0.01 0.93
Soil V. dahlia abundance 1, 5 0.76 0.42 1, 5 0.66 0.45 1, 5 0.32 0.60
365 Table 2 Two-way ANOVA summary of the effect of fumigation, region, and fumigation×region on tuber

366 yield, disease frequency and severity, and soil pathogen abundance.

367 (2) How does fumigation affect soil health, and does the magnitude or direction of this effect vary across

368 regions?

369 3.2. Fumigation effect on soil physiochemical properties

370 Growing season soil pH was similar between the unfumigated and fumigated plots (P=0.77,

371 Table 3, 4). Soil organic matter content differed between the unfumigated and fumigated plots depending

372 on the region (fumigation×region, P=0.05): soil organic matter content showed a higher trend with

373 fumigation in central fields (P=0.25), but was marginally lower with fumigation in northern fields

374 (P=0.06, Table 3, 4). Soil total organic C content showed the same pattern (fumigation×region, P=0.02),

375 with a higher trend with fumigation in central fields (P=0.20), but lower values with fumigation in

16
376 northern fields (P=0.03, Table 3, 4). Similarly, there is a marginal effect of fumigation×region on the soil

377 protein content (P=0.08), with a trend of higher values in fumigated plots in central fields (P=0.32) and a

378 trend of lower values in fumigated plots in northern fields (P=0.11, Table 3, 4). Soil dissolved inorganic

379 N, P and K concentration was not different between the fumigated and unfumigated plots (Table 3, 4).

Fumigation Region Fumigation×Region

Soil chemistry DF F P DF F P DF F P
pH 1, 6.2 0.09 0.77 1, 5.1 15.19 0.01 1, 6.2 0.04 0.84
OM 1, 4.7 1.79 0.24 1, 5 9.17 0.03 1, 4.7 7.29 0.05
TOC 1, 5.4 2.96 0.14 1, 5 11.54 0.02 1, 5.4 10.44 0.02
Protein 1, 4.7 1.26 0.32 1, 5 13.45 0.01 1, 4.7 5.10 0.08
Inorganic N 1, 40.7 0.69 0.41 1, 5 2.25 0.19 1, 40.7 0.16 0.70
P 1, 7.9 0.56 0.48 1, 5.1 11.11 0.02 1, 7.9 2.15 0.18
K 1, 5 1.95 0.22 1, 5 8.93 0.03 1, 5 2.35 0.19
380 Table 3 Two-way ANOVA summary of the effect of fumigation, region, and fumigation×region on soil

381 physiochemical properties.

Central
Soil chemistry Unfumigated Fumigated
pH 5.88 (0.15) 5.84 (0.15)
OM 1.00 (0.25) 1.16 (0.25)
TOC 0.63 (0.10) 0.71 (0.10)
Protein 3.28 (0.49) 3.55 (0.49)
Inorganic N 24.75 (4.81) 24.66 (4.80)
P 111.3 (21.1) 120.9 (21.0)
K 90.0 (23.3) 93.8 (23.3)
382 Table 4 Physiochemical properties of the unfumigated and fumigated soils measured during the growing
Northern
Unfumigated Fumigated
4.80 (0.25) 4.79 (0.24)
2.70 (0.40) 2.23 (0.40) †
1.42 (0.16) 1.17 (0.16) *
7.12 (0.79) 6.33 (0.79)
40.06 (7.85) 38.92 (7.76)
300.8 (34.3) 270.0 (33.9)
233.6 (37.1) 152.1 (37.0)

383 season in central and northern WI potato fields. Data shows the least square means of the five central

384 fields (or two northern fields) with standard error of the mean in parenthesis. * denotes significant

385 differences (P<0.05) and † denotes marginal differences (P<0.10) between the fumigated and

386 unfumigated soils based on the partial F test when a significant fumigation×region interaction effect was

387 detected.

388 3.3. Fumigation effect on microbial activities related to nutrient cycling

389 Microbial C enzyme activity responded to fumigation depending on the location of the field

390 (P=0.06, Table 5): microbial C enzyme showed a higher trend with fumigation in central fields, but a

391 lower trend with fumigation in northern fields (Fig. 2a). Microbial N and P enzyme activities did not

17
392 respond to fumigation (Table 5), but followed a similar trend in response to fumigation in the two regions

393 (Fig. 2b, c). Nitrogen mineralization and nitrification rate also did not respond to fumigation (P=0.49,

394 P=0.11, respectively, Table 5), although N mineralization rate showed an increasing trend with

395 fumigation in northern fields (Fig. 2d). The potential C mineralization rate normalized by microbial

396 biomass C did not respond to fumigation (P=0.97); there is a general trend of lower values with

397 fumigation in central fields and higher values with fumigation in northern fields (Fig. 2e). Microbial

398 biomass C responded to fumigation depending on the region (fumigation×region, P=0.03), with

399 marginally higher biomass C in the central fields and a general trend of lower biomass C in the northern

400 fields in response to fumigation (Fig. 2f). Microbial biomass N overall was not affected by fumigation

401 (P=1.0, Table 5).

Fumigation Region Fumigation×Region

Microbial activity DF F P DF F P DF F P
C enzyme 1, 5 0.07 0.80 1, 5 2.97 0.15 1, 5 5.63 0.06
N enzyme 1, 4.7 0.73 0.44 1, 5 0.05 0.83 1, 4.7 2.05 0.22
P enzyme 1, 5 0.65 0.46 1, 5 4.02 0.10 1, 5 2.64 0.16
N mineralization 1, 5.2 0.55 0.49 1, 5 0.00 0.96 1, 5.2 0.85 0.40
Nitrification 1, 5 3.78 0.11 1, 4.3 0.99 0.37 1, 5 2.05 0.21
C mineralization 1, 4.1 0.00 0.97 1, 4.8 5.75 0.06 1, 4.1 2.94 0.16
MBC 1, 4.3 0.35 0.58 1, 4.8 6.19 0.06 1, 4.3 9.51 0.03
MBN 1, 10.1 0.00 1.00 1, 10.1 0.14 0.72 1, 10.1 0.07 0.79
402 Table 5 Two-way ANOVA summary of the effect of fumigation, region, and fumigation×region on soil

403 microbial activities related to nutrient cycling.

404 3.4. Fumigation effect on microbial community composition and abundance

405 Bacterial community diversity measured as the Inverse Simpson index overall was lower with

406 fumigation at the class level (P=0.03), but had contrasting responses to fumigation between the two

407 regions at the order, family, genus and OTU level (fumigation×region, P=0.01, P=0.03, P<0.01, P=0.02,

408 respectively, Fig. 3a-e). In central fields, bacterial community diverity was higher with fumigation at the

409 order (P=0.04), family (P=0.09), and genus (P<0.01) level, and showed an increasing trend with

410 fumigation at the OTU (P=0.32) level. In northern fields, bacterial community diversity was lower with

411 fumigation at the order (P=0.04), family (P=0.08), genus (P=0.02) and OTU (P=0.02) level (Fig. 3a-e).

18
412 Fumigation did not affect the diversity of fungal community at the class (P=0.89) or order (P=0.25) level,

413 but decreased the diversity at the family, genus, and OTU levels (P=0.05, P=0.09, P=0.05, respectively)

414 consistently between central and northern fields (fumigation×region, P=0.80, P=0.88, P=0.71,

415 respectively, Fig. 3f-j).

416 Soil total bacterial abundance was marginally higher in fumigated plots as compared to the

417 unfumigated plots (P=0.07) and this effect was consistent between regions (P=0.20, Fig. 3k). Soil total

418 fungal abundance was not affected by fumigation (P=0.29, Fig. 3l).

Fumigation Region Fumigation×Region

Microbial community DF F P DF F P DF F P
Bacterial diversity
Class 1, 4.8 8.69 0.03 1, 5 0.05 0.83 1, 4.8 2.50 0.18
Order 1, 4.9 0.63 0.46 1, 5 0.07 0.81 1, 4.9 14.25 0.01
Family 1, 4.9 0.48 0.52 1, 5 0.15 0.71 1, 4.9 9.16 0.03
Genus 1, 4.7 0.37 0.57 1, 5 0.12 0.74 1, 4.7 31.08 <0.01
OTU 1, 4.9 5.81 0.06 1, 5 0.23 0.65 1, 4.9 13.23 0.02
Fungal diversity
Class 1, 9.4 0.02 0.89 1, 9.4 23.30 <0.01 1, 9.4 0.08 0.78
Order 1, 5.1 1.72 0.25 1, 4.9 2.38 0.18 1, 5.1 0.11 0.75
Family 1, 4.7 6.87 0.05 1, 4.9 0.08 0.79 1, 4.7 0.07 0.80
Genus 1, 4.9 4.31 0.09 1, 4.9 0.20 0.67 1, 4.9 0.03 0.88
OTU 1, 4.8 6.41 0.05 1, 5 0.05 0.82 1, 4.8 0.16 0.71
Microbial abundance
Bacterial abundance 1, 4.4 5.63 0.07 1, 5 2.42 0.18 1, 4.4 2.31 0.20
Fungal abundance 1, 9.5 1.24 0.29 1, 9.5 0.77 0.40 1, 9.5 0.18 0.68
419 Table 6 Two-way ANOVA summary of the effect of fumigation, region, and fumigation×region on

420 microbial community’s diversity and abundance.

421 In central fields, mid-season soil bacterial community overall was not different between the

422 fumigated and unfumigated plots (PERMANOVA, R2=0.02, P=0.25) as the communities within each

423 field responded to fumigation in different directions (Fig. 4a). Fungal community composition differed

424 between the fumigated and unfumigated plots (R2=0.04, P<0.01) with separations along both the first and

425 second PCoA axes (Fig. 4b). In northern fields, both bacterial and fungal communities were significantly

426 different between the fumigated and unfumigated plots (R2=0.07, P=0.04; R2=0.08, P=0.05, respectively)

427 with separations along the second PCoA axis (Fig. 4c, d).

19
428 The effect of fumigation on the overall abundance of oligotrophic-associated bacteria

429 phyla/subphyla varied by region (fumigation×region, P=0.07): oligotrophic bacterial abundance was

430 higher with fumigation (P=0.05) in central fields, but not in northern fields (P=0.33, Fig. 5). Fumigation

431 did not affect the abundance of oligotrophic-associated bacteria Acidobacteria (P=0.73),

432 Alphaproteobacteria (P=0.24), and Planctomycetota (P=0.42). However, fumigation had contrasting

433 effects on the abundance of Chloroflexi between the two regions (fumigation×region, P<0.01): compared

434 to the unfumigated plots, fumigated plots showed higher Chloroflexi abundance in central fields

435 (P<0.01), but marginally lower abundance in northern fields (P=0.07). Fumigation marginally increased

436 Verrucomicrobiota abundance in both regions (fumigation main effect, P=0.06, fumigation×region,

437 P=0.25).

438 Fumigation did not affect the overall abundance of copiotrophic-associated bacteria (P=0.22) in

439 both central and northern fields (Fig. 5). Fumigation did not affect copiotrophic-associated Bacteroidota

440 (P=0.13), Firmicutes (P=0.96), or Gammaproteobacteria (P=0.40) abundance. Fumigation had different

441 effects on the abundance of Gemmatimonadetes between the two regions (fumigation×region, P=0.05):

442 Gemmatimonadetes abundance was higher with fumigation (P<0.01) in central fields, but not in northern

443 fields (P=0.97).

444 We did not detect an overall fumigation effect on the oligotrophs:copiotrophs ratio of central and

445 northern field soils (P=0.62, Fig. 5), even though northern fields showed a trend of lower

446 oligotrophs:copiotrophs ratios in response to fumigation. Actinobacteria responded to fumigation

447 depending on the location of the fields (fumigation×region, P<0.01): Actinobacteria abundance was

448 higher with fumigation in central soils (P<0.01), but not in northern soils (P=0.52, Fig. 5).

449 (3) How does the initial state of the soil system, and the response of the soil system to fumigation, explain

450 the variable effects of fumigation on potato yield?

451 3.5. Regression results

20
452 Stepwise regression with soil health parameters measured in the unfumigated plots (Model 1)

453 produced a simple multiple linear regression model with potato variety, soil organic matter content,

454 bacterial diveristy, and soil inorganic N as the best predictors for the fumigation effect on yield (Table 7).

455 Stepwise regression with addition of the response of soil health parameters to fumigation to the first

456 model (Model 2) produced a simple multiple linear regression model with soil organic matter content,

457 bacterial diveristy, soil inorganic N, and the fumigation effect on bacterial diversity as the best predictors

458 for the fumigation effect on yield (Table 7).

459 Fumigation’s effect on tuber yield was negatively correlated with soil bacterial diverisity and soil

460 organic matter content measured in the unfumigated plots, but positively correlated with soil inorganic N

461 measured in the unfumigated plots and the fumigation effect on bacterial diversity (Fig. 6).

Selected predictors Estimate SE t Pr(>|t|)

Model 1 OM -0.44 0.20 -2.17 0.04
Inorganic N 0.56 0.16 3.42 0.00
Bacterial diversity -0.53 0.15 -3.58 0.00
Potato Variety (Chipper) -0.54 0.35 -1.56 0.13
Model 2 FE:Bacterial diversity 0.27 0.13 2.14 0.04
OM -0.57 0.14 -3.94 0.00
Inorganic N 0.46 0.17 2.71 0.01
Bacterial diversity -0.38 0.15 -2.59 0.01
462 Table 7 Coefficient estimates of the selected simple linear models of the fumigation effect on yield with

463 predictors of soil health parameters measured in the unfumigated plots (Model 1) and the response of soil

464 health parameters to fumigation added into the model (Model 2). FE:Bacterial diversity: fumigation effect

465 on soil bacterial diversity.

466 4. Discussion

467 Soils are complex systems of integrated physical, chemical, and biological attributes. Attempts to

468 manage soil-based problems, such as soil-borne diseases, run the risk of altering the general function of

469 soil in ecosystem services. In this study, we found that fumigation with metam sodium, a common

470 practice to control soil-borne diseases in potato production affected not only the tuber yield, but also soil

471 microbial community composition and functions in organic matter recycling. Moreover, these effects

21
472 occurred in opposite directions between the central and northern potato growing regions of Wisconsin.

473 Our results suggest that fumigation creates varying consequences in regards to soil health. Prescribing

474 soil management recommendations should be specific to regional conditions.

475 Metam sodium fumigation increased potato tuber yield in central, but not in northern Wisconsin

476 fields. Fumigation is generally thought to improve plant growth and yield. However, in this study we

477 found that fumigation’s effect on tuber yield varied depending on the location of the field. We

478 investigated a set of potential predictors for the yield responses to fumigation, and bacterial diversity

479 stood out as one of the strongest. Yield response to fumigation was higher where bacterial diversity was

480 low. Bacterial diversity may have influenced the fumigation effect through soil native disease-

481 suppressiveness (Lankau et al., 2020). In central fields where soil bacterial diversity is low, the native

482 disease-suppressiveness of the soil may also be low, resulting in fumigation improving plant growth by

483 allievating the disease pressure. In contrast, northern fields with high bacterial diversity may have had

484 higher soil disease-suppressiveness. In this case, fumigation’s benefit on plant growth can be diminished

485 because the native microbes are already providing growth promotion benefits. Fumigation may even

486 negatively impact growth by depressing the growth-promoting microorganisms. It is worth noting that

487 while bacterial diversity was strongly driven by field location, there were still significant variations within

488 each field, which supports a causal connection between diversity and yield response even at local scales.

489 Metam sodium fumigation led to different microbial-mediated soil nutrient dynamics in central

490 and northern fields. Past studies have generally reported negative effects of metam sodium on microbial

491 functions in C mineralization and nitrification (Li et al., 2017; Crants et al., 2021). Our study shows

492 regional differences of fumigation effects. In central fields, we observed microbial activities related to

493 higher C retention in responses to fumigation. Specifically, fumigation increased microbial biomass C

494 and a trend of decreased unit microbial biomass respiratory C loss. This suggests that C might have been

495 preferably fixed into the microbial biomass, rather than being lost into the atmosphere through respiratory

496 activities. Increased biomass growth could also increase enzyme production, as suggested by the trend of

22
497 higher C, N, and P enzyme activities with fumigation in central fields (Fig. 2). Higher microbial biomass

498 growth and enzyme production would contribute to faster turnover of organic matter between the

499 microbial biomass and soil organic matter pools (Manzoni et al., 2012), which can benefit soil organic

500 matter retention, considering the important role of microbial growth/death in soil organic matter

501 formation (Zhu et al., 2020).

502 As a contrast, in northern fields, microbial responses to fumigation could contribute to the loss of

503 soil organic matter from the ecosystem. Our data shows a trend of lower microbial biomass C and higher

504 respiratory C loss per unit biomass with fumigation treatment in northern soils. Rather than allocating

505 effort to biomass growth, microbes might have prioritized activities that require high costs of respiratory

506 C, such as mining nutrients from the soil organic matter (Manzoni, 2017). The trend of higher N

507 mineralization rate with fumigation would be consistent with this hypothesis. Lower microbial biomass

508 growth can negatively influence enzyme production and slow down the turnover of organic matter. In

509 summary, our result suggests that metam sodium has the potential to shift microbial functions in nutrient

510 cycling towards different directions depending on the field location.

511 Soil microbial communities experienced a trophic lifestyle shift corresponding to the changes in

512 soil nutrient dynamics under the influence of fumigation. In central fields, fumigation increased the

513 oligtrophic bacterial abundance. This would be consistent with the trend of higher enzyme activity and

514 lower C mineralization rate responses in these fields. It is thought that oligotrophs priorotize the

515 production of extracellular enzymes that are vital for nutrient uptake, at the expense of other metabolic

516 pathways to cope with the general low resource availability in their habitat (Piton et al., 2020). Also

517 oligotrophs-dominated soils present lower C mineralization rates (Fierer et al., 2007). In northern fields,

518 we did not detect significant fumigation effects on the abundance of oligtrophic and copiotropic bacteria

519 or their ratio. However, fumigated plots showed a trend of lower oligotrophs:copiotrophs ratio, which is

520 consistent with the trend of lower C enzyme activity and higher C mineralization rate responses to

521 fumigation.

23
522 Fumigation showed contrasting effects on soil bacterial diversity between regions, which can be

523 explained by site specific factors. Bacterial diversity increased in central fields, but decreased in northern

524 fields following fumigation. There are two possible explainations. First, the bacterial diversity response

525 to fumigation could be mostly driven by organic matter input. Fumigation increased plant growth in

526 central fields and tended to decrease those in northern fields. It is very likely that the organic matter input

527 to the soil would follow the same pattern, as root turnover provides a significant source of soil organic

528 matter (Dijkstra et al., 2021). In central sandy soils with limited nutrient and C resources, the initial

529 microbial diveristy can be low with relatively few taxa dominating the microbial community. Competitive

530 release following suppression of dominant taxa, combined with increased organic matter input could

531 stimulate the growth of some rare taxa. This can increase the number of phyla dominating the community

532 and result in increased eveness and diversity. Consistent with this hypothesis, we observed greater

533 bacterial diversity from the higher (order) level. In contrast, less organic matter input in northern fields

534 could lead to loss of taxa that depends on litter input, and eventually lead to decreased diversity.

535 Second, soil texture could interact with the population dynamics of microorganisms under the

536 influence of fumigation, which can lead to varying microbial diversity responses in different soils. Collins

537 et al. (2006) found that the numbers of fungi surviving fumigation were greater for the fine- than coarse-

538 textured soils, as fine-textured soils may offer more protections against fumigants both physically and

539 biologically. Similarly in our study, fumigation could have had a greater initial negative impact on the

540 microbial populations of the sandier (central) soils compared to those of the loamier (northern) soils, as

541 the loamy soil could provide more refugee sites for microbes. However, in sandy soils, a significant

542 decrease of microbial population size and death of microbial cells can release a substantial amount of C

543 and nutrient resources for certain groups of microorganisms to utilize and rapidly re-colonize the soil,

544 thus increasing the bacterial diversity. Contrarily in loamy soils, the niche released by fumigation might

545 not be essential for the re-colonization of new communities, given that these soil ecosystems are already

24
546 highly diverse and competitive. The initial loss of taxa might not be compensated for by re-growth,

547 which can eventually lead to decreased diversity.

548 Fumigation’s effect on bacterial diversity suggests that the “fumigation treadmill” effect may be

549 more likely to happen in northern loamy fields than in the central sandy fields. In northern fields, the

550 suppressed bacterial diversity at one growing season after fumigation could have significant implications

551 for future soil health. As bacterial diversity was lost at higher taxonomic levels with major phylla

552 significantly reduced, fumigation could have impaired major soil functions including growth promotion

553 and disease suppressiveness (Lankau et al., 2022). This negative effect is likely to persist over time, as

554 the impacts from lost species are often long-lasting (Isbell et al., 2015). In this case, application of metam

555 sodium in the following years may lead to greater postive yield responses with less dependence on the

556 natural beneficial microorganisms. If the following-year’s fumigation continuingly impairs the native

557 microbiome, this would eventually lead to the “fumigation treadmill” effect, where grower’s dependence

558 on the chemical use continues to increase over time with the depletion of beneficial microorganisms.

559 Sandy soil shows a very different scenario. Even though soil bacterial diveristy increased during the first

560 growing season following fumigation, this benefit may be ephemeral, as the build-up of biodiversity and

561 related ecosystem benefits usually takes time (Meyer et al., 2016). It is uncertain whether microbial

562 diversity will remain elevated during the next fumigation cycle, especially with rotation crops in the

563 following season. Longer-term monitoring is necessary for better understanding of the microbial

564 dynamics following repeated fumigation in sandy soils.

565 We also observed other interesting fumigation effects on soil microbial community structure.

566 Fumigation significantly decreased fungal diversity and modified the community structure. This strong

567 suppression effect of metam sodium on fungal community has also been reported in a 62-day mesocosm

568 experiment (Mocali et al., 2015). This result is to be expected given the fungicide nature of metam

569 sodium. Consistent with other studies (Macalady et al., 1998; Sederholm et al., 2018), we also observed a

570 preferential increase of Actinobacteria following metam sodium fumigation. As Actinobacteria play an

25
571 important role in producing bioacive chemicals to degrade contaiminants (Mawang et al., 2021),

572 fumigation with metam sodium might have resulted in the selection of microbes that specialize in the

573 degradation of the fumigant itself (Warton et al., 2003).

574 One important principle of sustainable agriculture is integrated pest management, which requires

575 comprehensive understanding of pesticide interactions with the environment and use of pestcide by the

576 most economical and environmentally friendly means. This study shows the close link between soil

577 microbial community structure and soil functions, and suggests the important role of bacterial diversity in

578 regulating the fumigation effect on potato tuber yield. The soil microbiome is a promising field for future

579 research of sustainable agiculture, as some of their features can compensate the need for fumigation. For

580 the sake of soil health, prescripton of management activities should focus on the natural yield-supporting

581 capacities of the soil. Our results suggest that soil management practices need to be evaluated carefully

582 for their holistic effect on the soil ecosystem, and assessed across a range of soil conditions to determine

583 the contextual nature of the effects; if not, practices that show benefits in the short-term may result in net

584 losses over the long-term due to the degradation of soil health.

585 Acknowledgements

586 This work was funded by USDA Specialty Crop Multi-State Program grant number SCMP1701

587 and USDA Specialty Crop Research Initiative Coordinated Agricultural Project 2018-51181-28704. We

588 would like to thank Ruark lab for their assistance with soil and potato collection; Griffin Vizgirda and

589 Elizabeth Lane for help with soil nutrient analysis. We would also like to thank Eagle River Seed Farm,

590 Schroeder Brother’s Farms, and Coloma Farms for providing the potato fields and setting up fumigation

591 treatments, and their support for potato and soil microbiome research. Biotechnology Center and Water

592 Science and Engineering Lab of University of Wisconsin-Madison provided services and equipments for

593 DNA sequencing and soil chemistry analysis.

594 References

26
595 Al-Mughrabi, K.I., Vikram, A., Poirier, R., Jayasuriya, K., Moreau, G., 2016. Management of common

596 scab of potato in the field using biopesticides, fungicides, soil additives, or soil fumigants. Biocontrol

597 Science and Technology 26, 125-135.

598 Bailey, V.L., Fansler, S.J., Smith, J.L., Bolton Jr, H., 2011. Reconciling apparent variability in effects of

599 biochar amendment on soil enzyme activities by assay optimization. Soil biology and biochemistry 43,

600 296-301.

601 Bilodeau, G.J., Koike, S.T., Uribe, P., Martin, F.N., 2012. Development of an assay for rapid detection

602 and quantification of Verticillium dahliae in soil. Phytopathology 102, 331-343.

603 Blum, W.E., 2013. Soil and land resources for agricultural production: general trends and future

604 scenarios-a worldwide perspective. International soil and water conservation research 1, 1-14.

605 Bolyen, E., Rideout, J.R., Dillon, M.R., Bokulich, N.A., Abnet, C., Al-Ghalith, G.A., Alexander, H., Alm,

606 E.J., Arumugam, M., Asnicar, F., 2018. QIIME 2: Reproducible, interactive, scalable, and extensible

607 microbiome data science. PeerJ Preprints.

608 Chellemi, D., Porter, I., 2001. The role of plant pathology in understanding soil health and its application

609 to production agriculture. Australasian Plant Pathology 30, 103-109.

610 Chen, L., Xie, X., Kang, H., Liu, R., Shi, Y., Li, L., Xie, J., Li, B., Chai, A., 2022. Efficiency of calcium

611 cyanamide on the control of tomato soil-borne disease and their impacts on the soil microbial community.

612 Applied Soil Ecology 176, 104522.

613 Collins, H.P., Alva, A., Boydston, R.A., Cochran, R.L., Hamm, P.B., McGuire, A., Riga, E., 2006. Soil

614 microbial, fungal, and nematode responses to soil fumigation and cover crops under potato production.

615 Biology and Fertility of Soils 42, 247-257.

616 Crants, J.E., Kinkel, L.L., Dundore-Arias, J.P., Robinson, A.P., Gudmestad, N.C., Rosen, C.J., 2021.

617 Potato nitrogen response and soil microbial activity as affected by fumigation. American Journal of

618 Potato Research 98, 285-303.

27
619 De los Santos, B., Barrau, C., Blanco, C., Arroyo, F., Porras, M., Medina, J., Romero, F., 2003.

620 Relationship between Trichoderma soil populations and strawberry fruit production in previously

621 fumigated soils. HortScience 38, 1400-1402.

622 Dijkstra, F.A., Zhu, B., Cheng, W., 2021. Root effects on soil organic carbon: a double‐ edged sword.

623 New Phytologist 230, 60-65.

624 Domsch, K.H., 1964. Soil fungicides. Annual review of phytopathology 2, 293-320.

625 Fierer, N., Bradford, M.A., Jackson, R.B., 2007. Toward an ecological classification of soil bacteria.

626 Ecology 88, 1354-1364.

627 Fierer, N., Jackson, J.A., Vilgalys, R., Jackson, R.B., 2005. Assessment of soil microbial community

628 structure by use of taxon-specific quantitative PCR assays. Applied and Environmental Microbiology 71,

629 4117-4120.

630 Freeman, S., Shalev, Z., Katan, J., 2002. Survival in soil of Colletotrichum acutatum and C.

631 gloeosporioides pathogenic on strawberry. Plant Disease 86, 965-970.

632 Gohl, D.M., Vangay, P., Garbe, J., MacLean, A., Hauge, A., Becker, A., Gould, T.J., Clayton, J.B.,

633 Johnson, T.J., Hunter, R., 2016. Systematic improvement of amplicon marker gene methods for increased

634 accuracy in microbiome studies. Nature biotechnology 34, 942-949.

635 Gómez Expósito, R., De Bruijn, I., Postma, J., Raaijmakers, J.M., 2017. Current insights into the role of

636 rhizosphere bacteria in disease suppressive soils. Frontiers in Microbiology 8, 2529.

637 Haney, R., Brinton, W., Evans, E., 2008. Soil CO2 respiration: Comparison of chemical titration, CO2

638 IRGA analysis and the Solvita gel system. Renewable Agriculture and Food Systems 23, 171-176.

639 Hills, K., Collins, H., Yorgey, G., McGuire, A., Kruger, C., 2020. Improving soil health in pacific

640 northwest potato production: A review. American Journal of Potato Research 97, 1-22.

641 Ho, A., Di Lonardo, D.P., Bodelier, P.L., 2017. Revisiting life strategy concepts in environmental

642 microbial ecology. FEMS microbiology ecology 93.

643 Isbell, F., Tilman, D., Polasky, S., Loreau, M., 2015. The biodiversity‐ dependent ecosystem service debt.

644 Ecology letters 18, 119-134.

28
645 Jenkinson, D.S., Brookes, P.C., Powlson, D.S., 2004. Measuring soil microbial biomass. Soil biology and

646 biochemistry 36, 5-7.

647 Johnson, D.A., Dung, J.K., 2010. Verticillium wilt of potato–the pathogen, disease and management.

648 Canadian Journal of Plant Pathology 32, 58-67.

649 Kelling, K.A., Rouse, D.I., Speth, P.E., 2017. Fumigation and fertilizer nitrogen source effects on potato

650 yield, quality, and early dying. American Journal of Potato Research 94, 481-489.

651 Lankau, E.W., Xue, D., Christensen, R., Gevens, A.J., Lankau, R.A., 2020. Management and soil

652 conditions influence common scab severity on potato tubers via indirect effects on soil microbial

653 communities. Phytopathology 110, 1049-1055.

654 Lankau, R.A., George, I., Miao, M., 2022. Crop performance is predicted by soil microbial diversity

655 across phylogenetic scales. Ecosphere 13, e4029.

656 Larkin, R.P., 2015. Soil health paradigms and implications for disease management. Annual review of

657 phytopathology 53, 199-221.

658 Li, J., Huang, B., Wang, Q., Li, Y., Fang, W., Han, D., Yan, D., Guo, M., Cao, A., 2017. Effects of

659 fumigation with metam-sodium on soil microbial biomass, respiration, nitrogen transformation, bacterial

660 community diversity and genes encoding key enzymes involved in nitrogen cycling. Science of The Total

661 Environment 598, 1027-1036.

662 Macalady, J.L., Fuller, M.E., Scow, K.M., 1998. Effects of metam sodium fumigation on soil microbial

663 activity and community structure. Journal of Environmental Quality 27, 54-63.

664 Manzoni, S., 2017. Flexible carbon-use efficiency across litter types and during decomposition partly

665 compensates nutrient imbalances—results from analytical stoichiometric models. Frontiers in

666 Microbiology 8, 661.

667 Manzoni, S., Taylor, P., Richter, A., Porporato, A., Ågren, G.I., 2012. Environmental and stoichiometric

668 controls on microbial carbon‐ use efficiency in soils. New Phytologist 196, 79-91.

669 Mawang, C.I., Azman, A.S., Fuad, A.S., Ahamad, M., 2021. Actinobacteria: An eco-friendly and

670 promising technology for the bioaugmentation of contaminants. Biotechnology Reports 32, e00679.

29
671 Meyer, S.T., Ebeling, A., Eisenhauer, N., Hertzog, L., Hillebrand, H., Milcu, A., Pompe, S., Abbas, M.,

672 Bessler, H., Buchmann, N., 2016. Effects of biodiversity strengthen over time as ecosystem functioning

673 declines at low and increases at high biodiversity. Ecosphere 7, e01619.

674 Mocali, S., Landi, S., Curto, G., Dallavalle, E., Infantino, A., Colzi, C., d’Errico, G., Roversi, P.F.,

675 D’Avino, L., Lazzeri, L., 2015. Resilience of soil microbial and nematode communities after biofumigant

676 treatment with defatted seed meals. Industrial Crops and Products 75, 79-90.

677 Morrissey, E.M., Mau, R.L., Schwartz, E., Caporaso, J.G., Dijkstra, P., Van Gestel, N., Koch, B.J., Liu,

678 C.M., Hayer, M., McHugh, T.A., 2016. Phylogenetic organization of bacterial activity. The ISME Journal

679 10, 2336-2340.

680 NRCS, 2018. Soil Health. https://www.nrcs.usda.gov/wps/portal/nrcs/main/soils/health/.

681 Op De Beeck, M., Lievens, B., Busschaert, P., Declerck, S., Vangronsveld, J., Colpaert, J.V., 2014.

682 Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies. PLOS ONE

683 9, e97629.

684 Piton, G., Foulquier, A., Martínez-García, L.B., Legay, N., Hedlund, K., da Silva, P.M., Nascimento, E.,

685 Reis, F., Sousa, J.P., De Deyn, G.B., 2020. Disentangling drivers of soil microbial potential enzyme

686 activity across rain regimes: An approach based on the functional trait framework. Soil biology and

687 biochemistry 148, 107881.

688 Qu, X., Wanner, L.A., Christ, B.J., 2008. Using the TxtAB operon to quantify pathogenic Streptomyces in

689 potato tubers and soil. Phytopathology 98, 405-412.

690 Rowe, R.C., Powelson, M.L., 2002. Potato early dying: management challenges in a changing production

691 environment. Plant Disease 86, 1184-1193.

692 Schindelbeck, R., Moebius-Clune, B., Moebius-Clune, D., Kurtz, K., van Es, H., 2016. comprehensive

693 assessment of soil health laboratory standard operating procedures. Cornell University, Ithaca, NY.

694 Schlatter, D., Kinkel, L., Thomashow, L., Weller, D., Paulitz, T., 2017. Disease suppressive soils: new

695 insights from the soil microbiome. Phytopathology 107, 1284-1297.

30
696 Sederholm, M.R., Schmitz, B.W., Barberán, A., Pepper, I.L., 2018. Effects of metam sodium fumigation

697 on the abundance, activity, and diversity of soil bacterial communities. Applied Soil Ecology 124, 27-33.

698 Sennett, L., Burton, D.L., Goyer, C., Zebarth, B.J., 2021. Influence of chemical fumigation and

699 biofumigation on soil nitrogen cycling processes and nitrifier and denitrifier abundance. Soil biology and

700 biochemistry 162, 108421.

701 Shan, S., 2020. The controls of nutrient limitation on resource allocation belowground. PhD dissertation.

702 Miami University, Oxford, OH. https://etd.ohiolink.edu/.

703 Sun, Z.C., Li, G.T., Zhang, C.L., Wang, Z.M., Lin, Q.M., Zhao, X.R., 2020. Contrasting resilience of soil

704 microbial biomass, microbial diversity and ammonification enzymes under three applied soil fumigants.

705 Journal of Integrative Agriculture 19, 2561-2570.

706 Vadstein, O., Attramadal, K.J., Bakke, I., Olsen, Y., 2018. K-selection as microbial community

707 management strategy: a method for improved viability of larvae in aquaculture. Frontiers in Microbiology

708 9, 2730.

709 Vance, E., Brookes, P., Jenkinson, D., 1987. Microbial biomass measurements in forest soils: the use of

710 the chloroform fumigation-incubation method in strongly acid soils. Soil biology and biochemistry 19,

711 697-702.

712 Wang, X.C., Liu, C., Huang, L., Bengtsson‐ Palme, J., Chen, H., Zhang, J.H., Cai, D., Li, J.Q., 2015. ITS

713 1: a DNA barcode better than ITS 2 in eukaryotes? Molecular ecology resources 15, 573-586.

714 Warton, B., Matthiessen, J.N., Shackleton, M.A., 2003. Cross-enhancement: enhanced biodegradation of

715 isothiocyanates in soils previously treated with metham sodium. Soil biology and biochemistry 35, 1123-

716 1127.

717 Weiland, J.E., Leon, A.L., Edmonds, R.L., Littke, W.R., Browning, J.E., Davis, A., Beck, B.R., Miller,

718 T.W., Cherry, M.L., Rose, R., 2011. The effects of methyl bromide alternatives on soil and seedling

719 pathogen populations, weeds, and seedling morphology in Oregon and Washington forest nurseries.

720 Canadian journal of forest research 41, 1885-1896.

31
721 Weller, D.M., Raaijmakers, J.M., Gardener, B.B.M., Thomashow, L.S., 2002. Microbial populations

722 responsible for specific soil suppressiveness to plant pathogens. Annual review of phytopathology 40,

723 309-348.

724 Zhu, X., Jackson, R.D., DeLucia, E.H., Tiedje, J.M., Liang, C., 2020. The soil microbial carbon pump:

725 From conceptual insights to empirical assessments. Global Change Biology 26, 6032-6039.

726

727 List of Figures

728 Fig. 1. The responses of (a) total tuber yield, (b-e) disease incidence and severity in the tuber, and (f-g)

729 soil pathogen abundance, to fumigation treatment in central and northern WI potato fields. Data shows

730 the least square mean for each treatment with standard error of the mean. * denotes significant

731 differences (P<0.05) between the fumigated and unfumigated plots based on the partial F test when a

732 significant fumigation×region interaction effect was detected. The presence of F or F×R indicates that the

733 effect of fumigation or fumigation×region interaction was (marginally) significant.

734 Fig. 2. The response of soil microbial activities to fumigation treatment in central and northern WI potato

735 fields. Data shows the least square mean for each treatment with standard error of the mean. † denotes

736 marginal differences (P<0.1) between the fumigated and unfumigated plots based on the partial F test

737 when a significant fumigation×region interaction effect was detected. The presence of F×R indicates that

738 the effect of fumigation×region interaction was (marginally) significant. MBC: microbial biomass C.

739 Fig. 3. The response of (a-e) bacterial community diversity at different taxonomic levels, (f-j) fungal

740 community diversity at different taxonomic levels, (k) soil total bacterial abundance, and (l) soil total

741 fungal abundance, to fumigation treatment in central and northern WI potato fields. Data shows the least

742 square mean for each treatment with standard error of the mean. * denotes significant differences

743 (P<0.05) and † denotes marginal differences (P<0.01) between the fumigated and unfumigated plots

744 based on the partial F test when a significant fumigation×region interaction effect was detected. The

32
745 presence of F or F×R indicates that the effect of fumigation or fumigation×region interaction was

746 (marginally) significant.

747 Fig. 4. Principal coordinate analysis (PCoA) plots of (a) central fields soil bacterial, (b) central fields soil

748 fungal, and (c) northern field soil bacterial and (d) northern field soil fungal communities.

749 Fig. 5. The repsonse ratio (fumigated divided by unfumigated) of oligtrophic and copiotrophic-associated

750 phyla or subphyla (finer taxonomic affliation given when available) in northern and central WI pototao

751 fields.

752 Fig. 6. Relationships between the fumigation effect on tuber yield (FE:Yield) and (A) soil bacterial

753 diversity, (B) soil organic matter content (OM), (C) inorganic N concentration of the unfumigated soils,

754 and (D) fumigation effect on soil bacterial diversity (FE:Bacterial diversity). Each point represents a

755 paired sample (matched fumigated vs. unfumigated sampling plot) from either a central (CF) or northern

756 Wisconsin field (NF).

757 Appendix A. Supplementary data

758 Supplement Fig. 1. Examples of (a) superficial scab, (b) pitted scab, and (c) vascular discoloration.

759 Supplement Fig. 2. Tuber yield and selected soil microbial properties of the fumigated and unfumigated

760 plots of seven Wisconsin potato fields. Each dot represents a sampling plot. A gray line was used to

761 connect a pair of the unfumigated and fumigated plots.

762

763

764

765

33
Figure Click here to access/download;Figure;Fig1.jpg
Figure Click here to access/download;Figure;Fig2.jpg
Figure Click here to access/download;Figure;Fig3.jpg
Figure Click here to access/download;Figure;Fig4.png
Figure Click here to access/download;Figure;Fig5.jpg
Figure Click here to access/download;Figure;Fig6.png
Supplementary Material

Click here to access/download

Supplementary Material
SSFig.1.jpg
Supplementary Material

Click here to access/download

Supplementary Material
SSFig.2.jpg