International Journal of
Molecular Sciences
Article
Roles of Nrf2/HO-1 and ICAM-1 in the Protective Effect of
Nano-Curcumin against Copper-Induced Lung Injury
Wedad S. Sarawi * , Ahlam M. Alhusaini
Citation: Sarawi, W.S.; Alhusaini,
A.M.; Alghibiwi, H.K.; Alsaab, J.S.;
Hasan, I.H. Roles of Nrf2/HO-1 and
ICAM-1 in the Protective Effect of
Nano-Curcumin against
Copper-Induced Lung Injury. Int. J.
Mol. Sci. 2023, 24, 13975. https://
doi.org/10.3390/ijms241813975
Academic Editor: Barbara Ruaro
Received: 24 August 2023
Revised: 8 September 2023
Accepted: 9 September 2023
Published: 12 September 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Int. J. Mol. Sci. 2023, 24, 13975. https://doi.org/10.3390/ijms241813975
, Hanan K. Alghibiwi, Juman S. Alsaab and Iman H. Hasan
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University,
P.O. Box 22452, Riyadh 11495, Saudi Arabia; aelhusaini@ksu.edu.sa (A.M.A.); halghibiwi@ksu.edu.sa (H.K.A.);
443203447@student.ksu.edu.sa (J.S.A.); ihasan@ksu.edu.sa (I.H.H.)
* Correspondence: wsarawi@ksu.edu.sa
Abstract: Copper (Cu) is an essential trace element for maintaining normal homeostasis in living
organisms. Yet, an elevated level of Cu beyond homeostatic capacity may lead to oxidative damage
of cellular components in several organs, including the lungs. This work investigated the effects of
curcumin (Curc) and nano-curcumin (nCurc) against Cu-induced lung injury, accenting the roles of
oxidative stress, inflammation, and the nuclear factor erythroid 2-related factor/heme oxygenase-1
Nrf2/HO-1 pathway. Rats were challenged with 100 mg/kg of copper sulfate (CuSO4 ) while being
treated with Curc or nCurc for 7 days. Cu-triggered lung oxidative stress detected as dysregulation
of oxidative/antioxidant markers, a downregulation of Nrf-2/HO-1 signaling, and an increase in the
inflammatory markers interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-α), and intracellular
adhesion molecule-1 (ICAM-1). Additionally, it decreased the expression of lung-specific proteins,
surfactant protein-C (SP-C), and mucin-1 (MUC-1), induced apoptosis, and caused changes in lung
histology. Curc and nCurc alleviated CuSO4 -induced lung injury by suppressing oxidative damage
and inflammation and activating Nrf-2/HO-1. They also prevented apoptosis and restored the normal
expression of SP-C and MUC-1. We concluded that nCurc exhibited superior efficacy compared with
Curc in mitigating CuSO4 -induced lung injury. This was associated with reduced oxidative stress,
inflammation, and apoptotic responses and increased Nrf2/HO-1 signaling and expression of SP-C
and MUC-1.
Keywords: curcumin; lung toxicity; inflammation; copper sulfate; oxidative stress; Nrf2/HO-1
pathway; ICAM-1
1. Introduction
Copper (Cu) is a crucial trace element and a cofactor of several redox enzymes. It is
involved in numerous biological functions, including blood coagulation, neurotransmitter
synthesis, antioxidant defense, energy production, and cellular metabolism [1,2]. The
maintenance of Cu homeostasis is tightly regulated via the balancing of its absorption,
excretion, and circulating levels. Cu possesses the potential for toxicity owing to its chemical
redox potential and capacity to engage in free radical reactions [3]. It is widely used in many
industries to synthesize electronics, building materials, wood protection, and pesticides.
Cu toxicity may result from acute or chronic exposure to excess Cu due to accidents,
occupational hazards, and environmental pollution. It can also be accumulated due to
genetic defects, as in the case of Wilson’s disease, an inherited mutation in the ATP7B gene
that encodes for a protein responsible for Cu excretion [4–6]. Such toxicity increases the
risk of developing neurological, hepatic, and renal diseases, which are attributed primarily
to oxidative stress, DNA damage, and cell apoptosis [4,7,8].
Copper sulfate (CuSO4 ) is an inorganic compound frequently used in agriculture,
analytical, and tissue culture laboratories as it possesses pesticidal, redox potential, and
antimicrobial actions, respectively. However, accidental or deliberate intoxication with Cu
https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2023, 24, 13975 2 of 16

may cause multiorgan toxicity, which can be life-threatening [9,10]. The acute toxicity of
CuSO4 can cause hepatitis, jaundice, intravascular hemolysis, methemoglobinemia, erosive
gastritis, acute tubular necrosis, and rhabdomyolysis [11,12]. The toxic effect of CuSO4
ingestion on the lungs has been reported previously as it exhibits corrosive effects on
mucous membranes [13]. Repeated exposure to CuSO4 pentahydrate via inhalation results
in a dose-related pulmonary inflammatory response and increased lung weight due to
epithelial hyperplasia in rats [14]. Chelating therapies, including D-penicillamine, trientine,
and deferoxamine (DFO), are still used to control Cu toxicity, just like with other metals [15].
However, the adoption of safer substitutes is required owing to the partial efficacy and side
effects of these agents.
Since the lungs are usually exposed to substantial oxygen levels, they possess a
collection of enzymatic and non-enzymatic antioxidants that often function extensively to
counter any potential oxidative assaults [16]. It was recently reported that an elevation in
urinary Cu levels was directly correlated with a higher risk of lung fibrotic changes [17].
In addition, there is an association between environmental Cu exposure and the risk of
developing lung cancer [18]. Copper oxide nanoparticles (CuO NPs) induce lung epithelial
cell death and pulmonary fibrosis in mice [19]. Likewise, studies have revealed that
Cu has the capacity to elicit oxidative stress and provoke an accumulation of reactive
oxygen species (ROS) [20,21]. ROS incur cycles of catastrophic events that initiate several
inflammatory responses and cytokine release [22,23]. Persistent release of these mediators
can cause tissue injury by activating the nuclear factor kappa B (NF-κB) pathway, mitogen-
activated protein kinases (MAPKs), and apoptosis [4,24].
Curcumin (Cur) is a natural phytochemical present in turmeric with substan-
tial antioxidant, anti-inflammatory, immunomodulatory, antibacterial, and antiviral
actions [25–27]. Curc exerts in vivo and in vitro antioxidant effects via multiple mecha-
nisms as it neutralizes ROS and reactive nitrogen species (RNS) [28,29]. This neutraliza-
tion is attributed to the abundance of conjugated double bonds in its structure which
serve as efficient electron donors in the counteraction of reactive species in many redox
reactions [30]. Curc has some therapeutic effects in acute and chronic lung diseases like
acute lung injury (ALI), asthma, pneumonia, and chronic obstructive pulmonary disease
(COPD) [31,32]. While there are existing studies that demonstrate its protective efficacy
against viral-induced lung injury in acute respiratory distress syndrome in mice [33]
and ventilator-induced lung injury (VILI) in rats [34], and reduced symptoms, hospital
stay, and mortality in COVID-19 patients [35], the protective effect of Curc against lung
injury caused by CuSO4 has not yet been studied. Some of the therapeutic potential of
Curc is hindered by its inadequate solubility in water, limited absorption and systemic
bioavailability, fast metabolism, physicochemical instability, and low effectiveness in
penetrating and targeting specific sites [36]. Therefore, this study investigated the impact
of CuSO4 -induced lung injury in rats and explored the potential protective effects of
Curc and its nanoformulation (nano-curcumin, nCurc) against such injury. These were
achieved by assessing the pulmonary expression of the nuclear factor erythroid 2-related
factor 2 (Nrf2)/heme oxygenase-1 (HO-1) signaling pathway, inflammatory cytokines,
and intracellular adhesion molecule-1 (ICAM-1) expression in rats.

2. Results
2.1. Curc and nCurc Mitigate Oxidative Stress after CuSO4 -Induced Lung Injury
Lipid peroxidation, indicated by MDA, was significantly increased in the lung tis-
sue homogenate of CuSO4 -intoxicated rats relative to that of the control rats (p ≤ 0.01;
Figure 1A). In contrast, the SOD activity (p ≤ 0.0001; Figure 1B), GSH level (p ≤ 0.01;
Figure 1C), and GPX2 level (p ≤ 0.0001; Figure 1D) were reduced after such injury in
comparison to those of the control group. The concurrent use of nCurc showed profound
mitigation of pulmonary oxidative stress by lowering the MDA level and increasing SOD,
GSH, and GPX2 relative to the CuSO4 group (p ≤ 0.01, p ≤ 0.05, p ≤ 0.01, and p ≤ 0.0001,
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 3 of 16
Int. J. Mol. Sci. 2023, 24, 13975 3 of 16

Curc exhibited significant elevations in GSH and GPX-2 (p ≤ 0.05, p ≤ 0.0001), while DFO
respectively).
increased GPX2 Curc
(p exhibited
≤ 0.0001)significant elevations
only following CuSOin GSH and GPX-2 (p ≤ 0.05, p ≤ 0.0001),
4 overexposure.
while DFO increased GPX2 (p ≤ 0.0001) only following CuSO4 overexposure.

Figure 1. Curc and nCurc mitigate oxidative stress after CuSO4 -induced lung injury. Treatment with
Figure
nCurc 1. Curc and
decreased nCurc
(A) MDAmitigate oxidative
and increased stress
(B) SOD after (C)
activity, CuSO 4-induced lung injury. Treatment with
GSH, and (D) GPX2. Curc increased
nCurc decreased (A) MDA and increased (B) SOD activity,
GSH and GPX2 after CuSO4 overexposure. Data are depicted as mean (C) GSH,±and
SEM(D)
(n GPX2.
= 7). * pCurc increased
≤ 0.05,
GSH and GPX2 after CuSO 4 overexposure. Data are depicted as mean ± SEM (n = 7). * p ≤ 0.05, ** p
** p ≤ 0.01, *** p ≤ 0.001, and **** p ≤ 0.0001.
≤ 0.01, *** p ≤ 0.001, and **** p ≤ 0.0001.
2.2. Curc and nCurc Attenuate CuSO4 -Induced Histopathological Changes in Lung Tissues
2.2. Curc and nCurc
Histological Attenuate
staining was CuSO 4-Induced
utilized to assessHistopathological Changesthat
the pathological changes in Lung Tissues
occurred in
the lungs after CuSO
Histological 4 exposure
staining was and their response
utilized to assesstothe
treatments (Figure
pathological 2A–J). The
changes thatcontrol
occurred in
group showed a normal bronchus, alveoli with thin inter-alveolar septa, and type I and II
the lungs after CuSO4 exposure and their response to treatments (Figure 2A–J). The con-
pneumocytes. In contrast, CuSO4 induced some pathological changes which were identified
trol group showed
as infiltration a normalintra-alveolar
of lymphocytes, bronchus, alveoli with thin
hemorrhage, inter-alveolar
and ruptured alveoli.septa, and type I
Treatment
and
withIIDFO
pneumocytes. In contrast,
showed alveoli with thinCuSO 4 induced
inter-alveolar some
septa andpathological changes
mild lymphocyte which were
infiltration.
identified
Curc and nCurc improved lung tissue appearance and reversed the pathological changesalveoli.
as infiltration of lymphocytes, intra-alveolar hemorrhage, and ruptured
Treatment
induced bywithCuSO DFO
4. showed alveoli with thin inter-alveolar septa and mild lymphocyte
infiltration. Curc and nCurc improved lung tissue appearance and reversed the patholog-
2.3. Curc and nCurc Modulate Pulmonary Keap-1/Nrf-2/HO-1 Signaling after CuSO4 -Induced
ical changes
Lung Injury induced by CuSO4.
The protein expression of pulmonary Keap1 was significantly upregulated, while
2.3. Curc and nCurc Modulate Pulmonary Keap-1/Nrf-2/HO-1 Signaling after CuSO4-Induced
Nrf-2 and HO-1 were significantly downregulated in CuSO4 -intoxicated rats, as compared
Lung
withInjury
the control group (p ≤ 0.0001, as shown in Figure 3). However, treatment of those
rats The
with protein
DFO, Curc,expression
and nCurcofexhibited
pulmonary Keap1 decrease
a significant was significantly upregulated,
in Keap-1 expression and while
an increase
Nrf-2 in Nrf-2
and HO-1 were and HO-1 expression
significantly (p ≤ 0.0001).inNotably,
downregulated nCurc upregulated
CuSO4-intoxicated HO-1
rats, as compared
expression significantly compared with DFO or Curc (p ≤ 0.0001).
with the control group (p ≤ 0.0001, as shown in Figure 3). However, treatment of those rats
with DFO,and
2.4. Curc Curc, and
nCurc nCurc exhibited
Ameliorate Inflammationa significant decreaseLung
after CuSO4 -Induced in Keap-1
Injury expression and an
increase in Nrf-2 and HO-1 expression (p ≤ 0.0001). Notably, nCurc upregulated HO-1
To confirm the lung-protective effects of DFO, Curc, and nCurc, we measured the levels
expression significantly
of inflammatory compared
biomarkers with DFO
(IL-1β, TNF-α, or Curc (p
and ICAM-1) in ≤ 0.0001).
lung tissues. Rats exposed to
CuSO4 demonstrated a significant increase in these markers (Figure 4) compared with the
control group. Nevertheless, treatment with antioxidants effectively mitigated the levels of
these inflammatory markers in rats administered CuSO4 , as demonstrated in Figure 4.
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 4 of 16
Int. J. Mol. Sci. 2023, 24, 13975 4 of 16

Figure
Figure 2. 2.
Curc andand
Curc nCurc improve
nCurc tissuetissue
improve appearance and reverse
appearance CuSO4-induced
and reverse lung injury.
CuSO4 -induced lung Rep-
injury.
resentative images of H&E-stained lung sections of control rats (A,B) showing
Representative images of H&E-stained lung sections of control rats (A,B) showing normal lung normal lung histol-
ogy. CuSO4-challenged
histology. rats (C,D)
CuSO4 -challenged showing
rats inter-alveolar
(C,D) showing septum (black
inter-alveolar septumarrow),
(blackintra-alveolar hem-
arrow), intra-alveolar
orrhage and congestion (yellow arrow), bronchus (red arrow), ruptured alveolus (green arrow). Cu-
hemorrhage and congestion (yellow arrow), bronchus (red arrow), ruptured alveolus (green arrow).
challenged rats treated with DFO (E,F) showing alveoli with thin inter-alveolar septum (black ar-
Cu-challenged
row), rats treated
mild infiltration with DFO
of lymphocytes (E,F)
(red showing
arrow), alveoli
bronchus witharrow),
(yellow thin inter-alveolar
type I and typeseptum (black
II pneu-
mocytes are also seen (green arrow). CuSO4-challenged rats treated with Curc (G,H) and nCurc (I,J)type
arrow), mild infiltration of lymphocytes (red arrow), bronchus (yellow arrow), type I and
II pneumocytes
showing are normal
alveoli with also seen (green arrow).
inter-alveolar CuSO
septum 4 -challenged
(black ratsItreated
arrow), type and typewith Curc (G,H) and
II pneumocytes
are also seen
nCurc (red arrow).
(I,J) showing (200×:
alveoli (A,C,E,G,I),
with scale bar = 200septum
normal inter-alveolar µm, 400×: (B,D,F,H,J),
(black scale Ibar
arrow), type and = 100
type II
µm).
pneumocytes are also seen (red arrow). (200×: (A,C,E,G,I), scale bar = 200 µm, 400×: (B,D,F,H,J),
scale bar = 100 µm).
Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 5 of 16
Int. J. Mol. Sci. 2023, 24, 13975 5 of 16

Figure 3. Curc and nCurc modulate pulmonary Keap-1/Nrf-2/HO-1 signaling after CuSO4-indu
lung injury (A–D). Exposure to CuSO4 caused an increase in Keap-1 and a decrease in Nrf-2
HO-1 protein expression. Treatment with DFO, Curc, and nCurc improved the expression of t
proteins. Data are depicted as mean ± SEM (n = 7). **** p ≤ 0.0001.

2.4. Curc and nCurc Ameliorate Inflammation after CuSO4-Induced Lung Injury
To confirm the lung-protective effects of DFO, Curc, and nCurc, we measured
levels of inflammatory biomarkers (IL-1β, TNF-α, and ICAM-1) in lung tissues. Rats
posed to CuSO4 demonstrated a significant increase in these markers (Figure 4) compa
Figure 3. Curc and nCurc modulate pulmonary Keap-1/Nrf-2/HO-1 signaling after CuSO4 -induced
with
Figure the
3. control
Curc group.
and nCurc Nevertheless,
modulate pulmonarytreatment with antioxidants
Keap-1/Nrf-2/HO-1 effectively
signaling after mitiga
CuSO4-induced
lung injury (A–D). Exposure to CuSO4 caused an increase in Keap-1 and a decrease in Nrf-2 and
lung
the injury
levels(A–D). Exposure
of these to CuSO4markers
inflammatory caused aninincrease in Keap-1 andCuSO
rats administered a decrease in Nrf-2 and
4, as demonstrate
HO-1 protein expression. Treatment with DFO, Curc, and nCurc improved the expression of these
HO-1
Figureprotein expression. Treatment with DFO, Curc, and nCurc improved the expression of these
proteins.4.
Data are depicted as mean ± SEM (n = 7). **** p ≤ 0.0001.
proteins. Data are depicted as mean ± SEM (n = 7). **** p ≤ 0.0001.

2.4. Curc and nCurc Ameliorate Inflammation after CuSO4-Induced Lung Injury
To confirm the lung-protective effects of DFO, Curc, and nCurc, we measured the
levels of inflammatory biomarkers (IL-1β, TNF-α, and ICAM-1) in lung tissues. Rats ex-
posed to CuSO4 demonstrated a significant increase in these markers (Figure 4) compared
with the control group. Nevertheless, treatment with antioxidants effectively mitigated
the levels of these inflammatory markers in rats administered CuSO 4, as demonstrated in
Figure 4.

4. Curc
Figure 4.
Figure Curcand andnCurc
nCurcameliorate
amelioratepulmonary
pulmonaryinflammation after CuSO
inflammation -induced
after 4CuSO lung injury
4-induced lung injury

C). Cu exposure caused an increase in inflammatory marker levels. TreatmentDFO,

(A–C). Cu exposure caused an increase in inflammatory marker levels. Treatment with withCurc,
DFO, Curc,
and nCurc ameliorated the inflammation. Data are depicted as mean ± SEM (n = 7). *
nCurc ameliorated the inflammation. Data are depicted as mean ± SEM (n = 7). * p ≤ 0.05, ** p ≤ 0 p ≤ 0.05,
** p ≤ 0.01, **** p ≤ 0.0001.
**** p ≤ 0.0001.

Figure 4. Curc and nCurc ameliorate pulmonary inflammation after CuSO4-induced lung injury (A–
C). Cu exposure caused an increase in inflammatory marker levels. Treatment with DFO, Curc, and
Int.
Int.J.J.Mol.
Mol.Sci.
Sci. 2023, 24, xxFOR
2023, 24, FORPEER
PEERREVIEW
REVIEW 6 of 16 6 o

Int. J. Mol. Sci. 2023, 24, 13975 6 of 16

2.5.
2.5.Curc
Curcand nCurc
and Restore
nCurc SP-CSP-C
Restore and MUC-1 LevelsLevels
and MUC-1 after CuSO
after4-Induced Lung Injury
CuSO4-Induced Lung Injury
To further confirm the protective effects of Curc and nCurc, we measured the levels
To further confirm the protective effects of Curc and nCurc, we measured the lev
of 2.5.
SP-C Curc
andand nCurc in
MUC-1 Restore SP-Ctissues.
the lung and MUC-1CuSO Levels after CuSO4 -Induced
4-administered Lung Injury a signifi-
rats demonstrated
of SP-C and MUC-1 in the lung tissues. CuSO4-administered rats demonstrated a sign
cant decrease
To furtherin confirm
these markers (Figure
the protective 5) compared
effects of Curc andwith thewe
nCurc, control group.
measured the However,
levels of
cant
SP-Cdecrease
treatmentandwith
MUC-1 ininthese markers
the lung
antioxidants tissues.(Figure
effectively CuSO 5) the
compared
4 -administered
restored with
levels rats the control
demonstrated
of these group.
markersHowev
a significant
inflammatory
treatment
in decrease with antioxidants
in these markers
rats administered CuSO4(Figure
. effectively
5) compared with the control group. However, treatment mark
restored the levels of these inflammatory
in ratsantioxidants
with administered CuSO4restored
effectively . the levels of these inflammatory markers in rats
administered CuSO4 .

Figure 5. Curc and nCurc restore the pulmonary expression of SP-C and MUC-1 after CuSO4-in-
duced lung injury (A,B). Data are depicted as mean ± S.E.M. (n = 7). * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001,
Figure
**** 5. Curc and nCurc restore the pulmonary expression of SP-C and MUC-1 after CuSO4 -induced
p ≤ 0.0001.
Figure 5. Curc and nCurc restore the pulmonary expression of SP-C and MUC-1 after CuSO4
lung injury (A,B). Data are depicted as mean ± S.E.M. (n = 7). * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001,
duced lung injury (A,B). Data are depicted as mean ± S.E.M. (n = 7). * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.
****
2.6. p ≤ and
Curc 0.0001.
nCurc Prevent Apoptosis by Regulating BAX and Bcl-2 Gene Expression Levels
**** p ≤ 0.0001.
after
2.6.CuSO -Induced
Curc 4and nCurcLung Injury
Prevent Apoptosis by Regulating BAX and Bcl-2 Gene Expression Levels after
CuSOThe4 -Induced
CuSO 4 Lung Injury
2.6. Curc and nCurc Prevent group
-administered showed
Apoptosis a significant
by Regulating BAXupregulation of BAX
and Bcl-2 Gene gene ex- Level
Expression
pression The
after CuSO CuSO
(p ≤4-Induced
0.001)
4 -administered
and group
downregulation
Lung Injury showed a significant upregulation of BAX gene
of Bcl-2 gene expression (p ≤ 0.001) compared ex-
pression
with (p ≤ 0.001)
the control group,andas downregulation
depicted in Figureof Bcl-2 gene expression
6. Nevertheless, (p ≤ 0.001)
treatment with compared
DFO, Curc,
andwith The
nCurc
CuSO4group,
the control -administered
significantly as depicted
mitigated
group
the
showed
in effects
Figure a significant
6. Nevertheless,
of CuSO4 on gene
upregulation
treatment with(pDFO,
expression
ofCurc,
≤ 0.001)
BAXby
gene
pression
and nCurc
restoring (psignificantly
their ≤average
0.001) expression
and downregulation
mitigated the effects of of
levels. Bcl-2
CuSO 4 ongene
gene expression
expression (p(p≤ ≤0.001)
0.001)
by compa
with the control
restoring group,
their average as depicted
expression levels.in Figure 6. Nevertheless, treatment with DFO, Cu
and nCurc significantly mitigated the effects of CuSO4 on gene expression (p ≤ 0.001)
restoring their average expression levels.

Figure 6. Curc and nCurc prevent apoptosis by regulating BAX and Bcl-2 gene expression after
Figure 6. Curc and nCurc prevent apoptosis by regulating BAX and Bcl-2 gene expression after
CuSO4 -induced lung injury (A–C). CuSO4 exposure caused an increase in BAX and a reduction in
CuSO4-induced lung injury (A–C). CuSO4 exposure caused an increase in BAX and a reduction in
Bcl2 mRNA levels. Treatment with DFO, Curc, and nCurc improved the levels of apoptotic markers.
Bcl2 mRNA levels. Treatment with DFO, Curc, and nCurc improved the levels of apoptotic markers.
Data
Data areare
depicted mean±±
depictedasasmean SEM(n(n= =7).7).****p p≤ ≤
SEM ****p p≤ ≤
0.01,****
0.01, 0.0001.
0.0001.

Figure 6. Curc and nCurc prevent apoptosis by regulating BAX and Bcl-2 gene expression a
CuSO4-induced lung injury (A–C). CuSO4 exposure caused an increase in BAX and a reductio
Bcl2 mRNA levels. Treatment with DFO, Curc, and nCurc improved the levels of apoptotic mark
Int. J. Mol. Sci. 2023, 24, 13975 7 of 16

3. Discussion
Cu is a pivotal micromineral for many physiological processes in the body, such
as cellular respiration, enzyme activation, immune responses, antioxidant defenses, and
energy homeostasis [1]. Despite its importance, excess Cu can cause serious multiorgan
toxicities if absorbed systemically through the lungs, skin, and gastrointestinal tract [9].
Extensive occupational exposure to Cu can cause severe lung diseases primarily from
inhaled particulates from mining or metal fumes from smelting, welding, agriculture, or
other related enterprises [5,37]. Cu accumulation is a risk for multiple tissue damage
and fibrosis, including in the lungs [38]. Limited research has been conducted regarding
pulmonary toxicity due to copper exposure. One case report revealed that the ingestion
of CuSO4 caused severe pulmonary toxicity manifested by acute, bilateral pulmonary
infiltrates and hypoxemia [13]. Yet, the deleterious effects and mechanistic consequences
of this metal on the lungs are less addressed. Therefore, we investigated the role of Curc
and its nanoform against CuSO4 -induced pulmonary injury in rats, pointing towards the
changes in inflammation, the Nrf2/HO-1 pathway, and the lung-functioning proteins SP-C
and MUC-1.
The present study demonstrated that exposure to CuSO4 resulted in pulmonary
oxidative stress, as evidenced by an elevation in lipid peroxidation levels and a reduction
in SOD activity, GSH, and GPX2 levels. Cu has a redox catalytic reactivity that is crucial
for many biological reactions. On the contrary, when its concentration surpasses a certain
limit, this metal generates free radicals that are extremely reactive and toxic [39]. Cu can
also alter the activity of electron respiratory chain proteins, which are crucial for releasing
energy in the mitochondria, and produce excess ROS [40]. ROS are strong oxidizers that
enhance lipid peroxidation, protein damage, DNA fragmentation, and cell death [4,41].
In addition, aberrations in the oxidant/antioxidant balance caused by Cu result in the
oxidation of proteins’ sulfhydryl groups, thereby depleting GSH stores and reducing SOD
activity in the lungs and other organs, as previously reported [42–45]. MDA is the most
prominent byproduct of lipid peroxidation, and it crosslinks to tissue DNA or protein to
form adducts, resulting in biomolecular damage [46]. GSH is a non-enzymatic antioxidant
defense that acts directly on free radicals by quenching their reactivity, thus protecting cells
from their destructive consequences, or indirectly by activating detoxification enzymes such
as glutathione peroxidases, glutathione S-transferases, and glyoxalases [47–49]. SOD is an
enzymatic antioxidant found in most organs, including the brain, liver, thyroid, and lungs.
This enzyme converts toxic superoxide radicals to less reactive dioxygen and hydrogen
peroxide [50,51]. Moreover, Cu causes downregulation of some antioxidant genes including
GPX2, GSR., and KEAP1, in A549 lung epithelial cells [48]. It competes with other metals
inside the cells, displaces them from their metal binding sites, and further impairs cellular
health and survival [52].
Considering the contribution of oxidative stress in the mechanism of Cu-induced lung
injury, Curc can potentially mitigate such damage because of its antioxidant action and
modulation of the Keap-1/Nrf-2/HO-1 signaling pathway. In the present study, rats that
received Curc or nCurc concurrently with CuSO4 exhibited a notable reversal in pulmonary
oxidative stress markers by decreasing MDA levels and increasing GSH, GPX2, and SOD
activity. Previous studies reported that Curc possessed antioxidant effects against animal
models of lung toxicity or injury induced by nicotine [53], elastase and cigarette smoke [54],
bleomycin [55], cyclophosphamide [25], and even radiation [56]; it decreased MDA and
enhanced GSH and antioxidant enzymes that parallel with our findings. The rats that
received nCurc displayed more significant antioxidant effects than those observed in rats
administered the native form of Curc. In the same context, the protective findings for
Curc and nCurc were analyzed using histopathological observations of rat lungs after Cu
injury. The histopathological examination of the lung tissue of rats exposed to CuSO4
demonstrated degenerative changes that supported the previous biochemical results. These
changes included pulmonary congestion, intra-alveolar hemorrhage, ruptured alveoli,
Int. J. Mol. Sci. 2023, 24, 13975 8 of 16

and lymphocyte infiltration. The antioxidant agents almost restored normal lung tissue
architecture with no sign of ruptured alveoli or lymphocyte infiltration.
Keap-1/Nrf-2/HO-1 is a prominent pathway of cytoprotective responses to both en-
dogenous and exogenous stresses resulting from ROS. An essential signaling protein within
this pathway is the transcription factor Nrf2. The significance of Nrf2 in the pulmonary
system has emerged via knockout experiments in which mice lacking the Nrf2 gene exhibit
increased susceptibility to various chemically induced pulmonary toxicities and patholo-
gies [57]. The disruption of the Nrf2 gene in mice results in prompt and severe emphysema
upon exposure to cigarette smoke [58]. Moreover, Nrf2−/− mice exhibited severe lung
damage characterized by increased protein permeability, macrophage inflammation, and
epithelial injury after hyperoxia exposure [59]. Previous studies have reported that Cu
toxicity can cause downregulation of Nrf2 and HO-1 in the liver [60], brain [61,62], and
testes [45], which supports our findings.
The beneficial effects of Curc and nCurc against CuSO4 -induced oxidative lung injury
might be attributed to the activation of Nrf2/HO-1 signaling and induction of detoxifying
enzymes. Of note, nCurc was more effective than Curc in upregulating pulmonary HO-1
expression. In consistence with the results, Curc upregulated the Nrf2/HO-1 pathway
and attenuated oxidative stress in lipopolysaccharide (LPS)-induced lung injury [60]. It
also regulates this pathway in several other organs, either in vitro or in vivo as reviewed
in [60,63,64]. Nrf2, a redox-sensitive factor, regulates cellular antioxidant responses against
oxidative stress by controlling the transcription of antioxidant genes [65]. Nrf2 expression
is low under basal conditions and sequestered by its repressor Keap-1. During oxida-
tive stress conditions such as Cu toxicity, however, Nrf2 expression is strikingly elevated
due to its dissociation from Keap-1. Nrf2 then migrates to the nucleus and attaches to
the antioxidant response element (ARE) sequence to upregulate the expression of some
genes encoding antioxidant proteins, including HO-1 [57,60]. HO-1 is responsible for
heme degradation and has antioxidant, cytoprotective, and anti-inflammatory proper-
ties [31]. The anti-inflammatory properties of Curc are mediated by the activation of this
enzyme via the Nrf2 and p38 MAPK signaling pathways. The capacity of Curc to reduce
inflammation is abolished when HO-1 is inhibited in vascular endothelial cells [66]. In
addition, Curc protects against H2 O2 -induced damage in lung mesenchymal stem cells via
the Akt/Nrf2/HO-1 signaling pathway [67].
In light of the association between CuSO4 pulmonary toxicity and oxidative stress,
inflammation is another logical consequence of this stress. Cu-induced lung tissue in-
flammation is a characteristic of augmented pathological tissue injury. Several studies
reported that Cu overload induced a significant immune response and elevated IL-6 and
TNF-α levels in murine bronchoalveolar lavage fluid [68] and rat liver tissue [24]. The
generation of ROS by Cu is the key step behind inflammation development. Our findings
are supported by the study of Kim et al. [69] who reported that excess ROS production can
induce upregulation of ICAM-1 via the activation of many signaling molecules, including
NF-κB. Similarly, a study by Gosens et al. showed pulmonary toxicity after inhalation
of CuO NPs induced interstitial and alveolar inflammation accompanied by abundant
macrophages and/or granulocytes at higher doses of CuO NPs [70]. In this regard, lung
tissue inflammation was denoted by the elevated levels of pro-inflammatory cytokines,
IL-6, and TNF-α and upregulation of ICAM-1 in CuSO4 -treated rats. ICAM-1 is a cell
surface glycoprotein that is normally expressed at low levels in immune, endothelial, and
epithelial cells, but its expression can be upregulated by inflammatory cytokines [71]. The
pro-inflammatory effects of TNF-α are exerted in part by promoting monocyte adhesion to
the pulmonary epithelium and upregulation of ICAM-1 expression in an NF-κB-dependent
manner [72].
On the other hand, Curc can reduce inflammation and protect the lungs from damage
via other mechanisms. Curc downregulated the expression of ICAM-1 induced by NF-κB
and TNF-α in lung epithelial cells [34,73–75]. The suppression of ICAM-1 production by
Curc may have a protective effect on the integrity of the epithelial-endothelial cells by
Int. J. Mol. Sci. 2023, 24, 13975 9 of 16

changing the interactions between their surface molecules and thereby limiting neutrophil
adherence to endothelial cell monolayers in vivo [31]. Curc confers immunomodulatory
actions by regulating the activation of various immune cells: T-cells, B-cells, macrophages,
neutrophils, natural killer, and dendritic cells [76]. Furthermore, the anti-inflammatory
activity of Curc can be partly credited to the upregulation of the Nrf2/HO-1 pathway as
confirmed in Nrf2-knockout macrophages [77].
In the inflammation context, CuSO4 reduced the SP-C level in rat lungs, possibly
due to tissue inflammation and lymphocyte infiltration. It has been reported that SP-C
deficiency in human and animal models is correlated with increased inflammation and
delayed healing. This protein can inhibit inflammation by decreasing JAK/STAT activation
during lung repair [78]. SP-C consists of a complex mixture of phospholipids that coats the
surfaces of the alveoli of the lungs where gas exchange takes place to maintain alveolar
integrity and lower the surface tension that is essential for normal respiratory function.
Numerous studies showed that TNF-α caused negative effects on surfactant synthesis in the
lungs [79–81]. Furthermore, some studies revealed a strong association between surfactant
C and lung diseases; for example, Stephan et al. demonstrated that the absence of SP-C or
pro-SP-C is directly linked with the pathogenesis of interstitial lung disease in mice [82].
SP-C is dramatically decreased in different lung injuries and is frequently associated with
apoptosis in type II alveolar epithelial cells. Inhibiting SP-C in these cells may enhance
CXCL1 and 2, as well as their receptor CXCR2 and ICAM-1 expression, indicating an
inflammatory response [83]. In the current study, the use of Curc or nCur almost restored
the normal expression of SP-C. Guzel et al. reported that Curc significantly reduced the
severity of intestinal ischemia/reperfusion injury by decreasing the activity of inducible
nitric oxide synthase and increasing SP-D expression in lung tissue [84].
In addition, exposure to CuSO4 reduced the expression of MUC-1 in rat lungs, while
Curc and nCurc restored the normal protein expression. MUC-1 is a membrane-bound
glycoprotein expressed on the surfaces of all epithelial cells that line mucosal surfaces.
Under physiological conditions, MUC-1 is vital in lubrication, preventing dehydration,
and providing protection from degradative enzymes and microorganisms [85]. However,
during exposure to pathogenic stimuli, MUC-1 exerts anti-inflammatory effects mediated
by the inhibition of Toll-like receptor 5 (TLR-5) signaling [86]. MUC-1-knockout mice
had more inflammation in response to flagellin, a TLR5 agonist, than wild-type mice,
confirming that MUC-1 has an anti-inflammatory function during airway infection. Also,
the knockdown of MUC-1 in normal human bronchial epithelial cells can induce the release
of IL-8 after TLR5 agonist addition [86,87]. On the contrary, other studies reported that TNF
upregulated MUC-1 gene expression [88] or neutrophil elastase [89], suggesting that the
expression of the MUC-1 gene increased in response to inflammatory mediators to control
inflammation. However, data showing the role of Cu in IL-8 and TLR expression and their
association with MUC-1 are lacking; thus, future studies are needed.
Moreover, apoptosis regulatory genes were measured in order to determine the effect
of CuSO4 in lung tissue. Cu-induced cell death might be directly related to the induced
oxidative stress and inflammatory response. As expected, apoptotic cell death was found
in the lungs of CuSO4 -challenged rats, in which Bax and Bcl-2 gene expression was in-
creased and decreased, respectively. These findings align with prior research indicating
that overexposure to CuSO4 elicits cellular apoptosis in several organs [43–45]. ROS and
pro-inflammatory mediators induce the pro-apoptotic Bax, thus disturbing the outer mi-
tochondrial membrane. Consequently, cytochrome c can leak out into the cytoplasm and
trigger the activation of several caspases, including caspase-3, the main executioner en-
zyme of cell apoptosis [90]. Excessive Cu exposure induced autophagic gene expression
such as Beclin1, reduced mitochondrial membrane potential (∆Ψm), and increased the
number of dead cells as reported by TUNEL assay [91]. The anti-apoptotic BCL-2, how-
ever, inhibits the release of cytochrome c by dimerization with BAX, controlling Ca2+ and
suppressing caspases, and thus interferes with apoptosis [42]. In agreement with previous
studies [92,93], Curc showed anti-apoptotic effects in the lungs after CuSO4 exposure by
Int. J. Mol. Sci. 2023, 24, 13975 10 of 16

restoring the regular expression of BAX and Bcl-2 and controlling Bax/Bcl-2-mediated cell
death. Nevertheless, the potency of nCurc was superior to its native form in attenuating
apoptosis.

4. Materials and Methods

4.1. Chemicals
CuSO4 , Cur, carboxymethylcellulose (CMC), trichloroacetic acid, thiobarbituric acid,
reduced glutathione (GSH), pyrogallol, hematoxylin and eosin (H&E), acrylamide, agarose,
and primers were procured from Sigma (St. Louis, MO, USA). Deferoxamine (DFO) and
nCurc were obtained from Novartis Pharma AG (Rotkreuz, Switzerland) and Lipolife
(LLT1, Essex, UK), respectively. The nCurc was encapsulated liposomal nano-curcumin
to enhance the pharmacokinetic properties and systemic bioavailability by up to 98%. It
was manufactured in a European laboratory registered under the Hazard Analysis Critical
Control Point (HACCP) system. IL-6 and TNF-α ELISA kits were obtained from R&D
Systems (Minneapolis, MN, USA), while other ELISA kits for glutathione peroxidase 2
(GPX2), ICAM-1, mucin-1 (MUC-1), and surfactant protein C (SP-C) were purchased from
MyBioSource (San Diego, CA, USA). Antibodies targeting Keap1, Nrf2, HO-1, and β-actin
were bought from Novus Biologicals (Centennial, CO, USA).

4.2. Animals and Experimental Design

A total of forty male Wistar Albino rats, weighing between 180 g and 200 g, were ob-
tained from the Animals Research Centre at King Saud University (KSU). The experiments
complied with the regulations set forth by the research ethics committee of KSU, as indi-
cated by the ethical approval no. SE-19-129. The rats were placed in standard cages, divided
into five groups with eight rats in each, and allowed to acclimate for one week. They were
provided free access to water and food and kept under standard temperature, humidity,
and a 12-h light/dark cycle. After one week of acclimation, the control group, designated as
Group I, was given 1% C.M.C. orally. All rats in the remaining groups received 100 mg/kg
CuSO4 [94,95], but only groups III, IV, and V were treated with daily doses of 23 mg/kg
DFO [96], 80 mg/kg Curc [9,96], and 80 mg/kg nCurc [9,96], respectively. All treatments
were suspended in 1% C.M.C. and administered orally for 7 days. Twenty-four hours post-
treatment, the rats were sacrificed under anesthesia, blood samples were collected to obtain
sera, and the lungs were harvested and rinsed with cold phosphate-buffered saline (PBS).
Some tissue was snap-frozen in liquid nitrogen for RNA isolation and Western blotting
experiments. The remaining tissues were preserved in 4% neutral-buffered formaldehyde
for histopathological experiments and some were homogenized in Tris-HCl buffer (10%
w/v, pH 7.4) and centrifuged to collect supernatants for biochemical assays.

4.3. Measuring Oxidative Stress Markers

The lung tissue supernatants were used to measure malondialdehyde (MDA), GSH, and
SOD activity based on colorimetric methods as previously described in Ohkawa et al. [97],
Ellman [98], and Marklund and Marklund [99], respectively.

4.4. Histological Evaluation

The fixed lung tissues were processed, embedded in paraffin wax, and then sliced
into 5 µm thick sections. The sections were subsequently stained using H&E stains and
visualized using light microscopy.

4.5. Determination of Inflammatory and Lung-Specific Biomarkers

IL-6 and TNF-α were measured using R&D Systems ELISA kits (R&D Systems, Min-
neapolis, MN, USA), whereas other markers, GPX2, ICAM-1, MUC-1, and SP-C, were
determined using MyBioSource ELISA kits (MyBioSource, San Diego, CA, USA). All assays
were carried out in compliance with the manufacturer’s protocols.
Int. J. Mol. Sci. 2023, 24, 13975 11 of 16

4.6. Gene Expression

In this study, we employed quantitative polymerase chain reaction (qPCR) to ascertain
whether CuSO4 and treating agents changed the expression of B cell lymphoma-2 (BCL-2)
and BCL-2-associated X protein (BAX). In brief, RNA extraction was performed using
TRIzol reagent (Invitrogen, Waltham, MA, USA) and then the RNA concentrations were
measured using Nanodrop. High-quality RNA samples were reverse-transcribed to cDNA
using a high-capacity cDNA reverse transcription kit (ThermoFisher Scientific, Waltham,
MA, USA). The PCR mixture contained cDNA, SYBR Green PCR master mix (ThermoFisher
Scientific, Waltham, MA, USA), and the primer pairs listed in Table 1. The cycling conditions
began with 10 min denaturation at 95 ◦ C, then 40 cycles at 95 ◦ C for 15 s, and 60 ◦ C for
1 min. The obtained data were analyzed using the 2−∆∆Ct method [100], normalized to the
reference gene β-actin, and the gene expression of samples was presented as a fold change
relative to controls [101].

Table 1. Primers used for gene expression assay.

Gene GenBank Accession Number Primers (50 –30 ) Amplicon Size (bp)
F: AGGACGCATCCACCAAGAAG
BAX NM_017059.2 166
R: CAGTTGAAGTTGCCGTCTGC
F: ACTCTTCAGGGATGGGGTGA
BCL-2 NM_016993.1 94
R: TGACATCTCCCTGTTGACGC
F: AGGAGTACGATGAGTCCGGC
β-actin NM_031144.3 71
R: CGCAGCTCAGTAACAGTCCG

4.7. Western Blotting

Changes in the protein expression of Keap1, Nrf2, HO-1, and β-actin were determined
in lung homogenates in which the tissue was lysed by the addition of RIPA buffer and
Protease Inhibitor CocktailX (Sigma, St. Louis, MO, USA). A Bradford protein assay kit
(BioBasic, Markham, ON, Canada) was used to determine protein concentrations. A total
of 50 µg of protein lysate was separated using 10% SDS-PAGE and transferred onto PVDF
membranes (Millipore, Bedford, MA, USA). Following a 1 h incubation at room temperature
with 5% milk, the membranes were incubated overnight at 4 ◦ C with primary antibodies.
On the next day, the membranes were thoroughly washed with TBST and then incubated
with HRP-labeled secondary antibody. The signal was developed using Pierce™ ECL
Western Blotting Substrate (ThermoFisher Scientific, Waltham, MA, USA), and the protein
bands were acquired using ImageQuant LAS 4000 and quantified using Image J software.

4.8. Statistical Analysis

The data analysis and comparison of means were carried out using one-way ANOVA
and Tukey’s post hoc test using GraphPad Prism 10 software (GraphPad, San Diego, CA,
USA), and the data were presented as means ± standard errors of the mean (SEM). The
mean differences were deemed statistically significant if the p-values ≤ 0.05.

5. Conclusions
To sum up, by addressing oxidative stress, the Nrf-2/HO-1 pathway, and inflammation
in the lungs, we indicate the mechanisms underlying CuSO4 -induced lung injury in rats
and determine the efficacy of Curc and nCurc in preventing such toxicity. These beneficial
effects were accompanied by the suppression of apoptotic markers and restoration of SP-C
and MUC-1 expression. The enhanced Curc bioavailability in its nanoform improved
lung protection against CuSO4 . These results shed new light on Curc and nCurc and their
lung-protective effects against CuSO4 -induced lung injury, but further research is needed
to investigate other associated mechanisms.
Int. J. Mol. Sci. 2023, 24, 13975 12 of 16

Author Contributions: Conceptualization, W.S.S. and A.M.A.; methodology, W.S.S., A.M.A. and
I.H.H.; validation, W.S.S.; formal analysis, W.S.S. and I.H.H.; investigation, W.S.S., A.M.A.,
H.K.A., J.S.A. and I.H.H.; resources, W.S.S. and A.M.A.; data curation, W.S.S., A.M.A. and I.H.H.;
writing—original draft preparation, W.S.S.; writing—review and editing, W.S.S., I.H.H., A.M.A.,
H.K.A. and J.S.A.; visualization, W.S.S.; supervision, W.S.S.; project administration, W.S.S. and
A.M.A.; funding acquisition, W.S.S. All authors have read and agreed to the published version of
the manuscript.
Funding: This research was funded by the Researchers Supporting Project number (RSPD2023R778),
King Saud University, Riyadh, Saudi Arabia.
Institutional Review Board Statement: The experiment was carried out in accordance with the
guidelines outlined in the National Institutes of Health (NIH) publication No. 85-23, revised in 2011.
Additionally, it received approval from the research ethics committee at King Saud University, with
an ethical reference number of SE-19-129.
Informed Consent Statement: Not applicable.
Data Availability Statement: Data analyzed or generated during this study are included in this
manuscript.
Acknowledgments: The authors would like to extend their gratitude to Researchers Supporting
Project number (RSPD2023R778), King Saud University, Riyadh, Saudi Arabia for funding this work.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Uriu-Adams, J.Y.; Keen, C.L. Copper, oxidative stress, and human health. Mol. Asp. Med. 2005, 26, 268–298. [CrossRef]
2. Scheiber, I.; Dringen, R.; Mercer, J.F. Copper: Effects of deficiency and overload. Met. Ions Life Sci. 2013, 13, 359–387. [CrossRef]
[PubMed]
3. Denoyer, D.; Masaldan, S.; La Fontaine, S.; Cater, M.A. Targeting copper in cancer therapy: ‘Copper That Cancer’. Met. Integr.
Biometal Sci. 2015, 7, 1459–1476. [CrossRef]
4. Gaetke, L.M.; Chow-Johnson, H.S.; Chow, C.K. Copper: Toxicological relevance and mechanisms. Arch. Toxicol. 2014, 88,
1929–1938. [CrossRef] [PubMed]
5. Roychoudhury, S.; Nath, S.; Massanyi, P.; Stawarz, R.; Kacaniova, M.; Kolesarova, A. Copper-induced changes in reproductive
functions: In vivo and in vitro effects. Physiol. Res. 2016, 65, 11–22. [CrossRef]
6. Gosens, I.; Cassee, F.R.; Zanella, M.; Manodori, L.; Brunelli, A.; Costa, A.L.; Bokkers, B.G.H.; de Jong, W.H.; Brown, D.; Hristozov,
D.; et al. Organ burden and pulmonary toxicity of nano-sized copper (II) oxide particles after short-term inhalation exposure.
Nanotoxicology 2016, 10, 1084–1095. [CrossRef]
7. Oe, S.; Miyagawa, K.; Honma, Y.; Harada, M. Copper induces hepatocyte injury due to the endoplasmic reticulum stress in
cultured cells and patients with Wilson disease. Exp. Cell Res. 2016, 347, 192–200. [CrossRef]
8. Lamtai, M.; Zghari, O.; Ouakki, S.; Marmouzi, I.; Mesfioui, A.; El Hessni, A.; Ouichou, A. Chronic copper exposure leads to
hippocampus oxidative stress and impaired learning and memory in male and female rats. Toxicol. Res. 2020, 36, 359–366.
[CrossRef]
9. Hashish, E.A.; Elgaml, S.A. Hepatoprotective and Nephroprotective Effect of Curcumin against Copper Toxicity in Rats. Indian J.
Clin. Biochem. IJCB 2016, 31, 270–277. [CrossRef]
10. Motlhatlhedi, K.; Firth, J.A.; Setlhare, V.; Kaguamba, J.K.; Mmolaatshepe, M. A novel and fatal method of copper sulphate
poisoning. Afr. J. Emerg. Med. 2014, 4, e23–e25. [CrossRef]
11. Franchitto, N.; Gandia-Mailly, P.; Georges, B.; Galinier, A.; Telmon, N.; Ducassé, J.L.; Rougé, D. Acute copper sulphate poisoning:
A case report and literature review. Resuscitation 2008, 78, 92–96. [CrossRef]
12. Gamakaranage, C.S.; Rodrigo, C.; Weerasinghe, S.; Gnanathasan, A.; Puvanaraj, V.; Fernando, H. Complications and management
of acute copper sulphate poisoning; a case discussion. J. Occup. Med. Toxicol. 2011, 6, 34. [CrossRef] [PubMed]
13. Cho, Y.S.; Moon, J.M.; Jeong, Y.H.; Lee, D.H.; Chun, B.J. Successful extracorporeal life support in respiratory failure after copper
sulphate ingestion. Natl. Med. J. India 2018, 31, 83–85. [CrossRef] [PubMed]
14. Poland, C.A.; Hubbard, S.A.; Levy, L.; Mackie, C. Inhalation toxicity of copper compounds: Results of 14-day range finding
study for copper sulphate pentahydrate and dicopper oxide and 28-day subacute inhalation exposure of dicopper oxide in rats.
Toxicology 2022, 474, 153221. [CrossRef] [PubMed]
15. Lawson, M.K.; Valko, M.; Cronin, M.T.D.; Jomová, K. Chelators in Iron and Copper Toxicity. Curr. Pharmacol. Rep. 2016, 2, 271–280.
[CrossRef]
16. Rahman, I.; Biswas, S.K.; Kode, A. Oxidant and antioxidant balance in the airways and airway diseases. Eur. J. Pharmacol. 2006,
533, 222–239. [CrossRef]
Int. J. Mol. Sci. 2023, 24, 13975 13 of 16

17. Chiou, H.C.; Wang, C.W.; Chen, S.C.; Tsai, M.L.; Lin, M.H.; Hung, C.H.; Kuo, C.H. Copper Exposure Induces Epithelial-
Mesenchymal Transition-Related Fibrotic Change via Autophagy and Increase Risk of Lung Fibrosis in Human. Antioxidants
2023, 12, 532. [CrossRef]
18. Zhang, X.; Yang, Q. Association between serum copper levels and lung cancer risk: A meta-analysis. J. Int. Med. Res. 2018, 46,
4863–4873. [CrossRef] [PubMed]
19. Lai, X.; Zhao, H.; Zhang, Y.; Guo, K.; Xu, Y.; Chen, S.; Zhang, J. Intranasal Delivery of Copper Oxide Nanoparticles Induces
Pulmonary Toxicity and Fibrosis in C57BL/6 mice. Sci. Rep. 2018, 8, 4499. [CrossRef]
20. Liu, H.; Lai, W.; Liu, X.; Yang, H.; Fang, Y.; Tian, L.; Li, K.; Nie, H.; Zhang, W.; Shi, Y.; et al. Exposure to copper oxide nanoparticles
triggers oxidative stress and endoplasmic reticulum (ER)-stress induced toxicology and apoptosis in male rat liver and BRL-3A
cell. J. Hazard. Mater. 2021, 401, 123349. [CrossRef]
21. Zhang, Z.; Weichenthal, S.; Kwong, J.C.; Burnett, R.T.; Hatzopoulou, M.; Jerrett, M.; van Donkelaar, A.; Bai, L.; Martin, R.V.;
Copes, R.; et al. A Population-Based Cohort Study of Respiratory Disease and Long-Term Exposure to Iron and Copper in Fine
Particulate Air Pollution and Their Combined Impact on Reactive Oxygen Species Generation in Human Lungs. Environ. Sci.
Technol. 2021, 55, 3807–3818. [CrossRef]
22. Yang, F.; Liao, J.; Yu, W.; Pei, R.; Qiao, N.; Han, Q.; Hu, L.; Li, Y.; Guo, J.; Pan, J.; et al. Copper induces oxidative stress with
triggered NF-κB pathway leading to inflammatory responses in immune organs of chicken. Ecotoxicol. Environ. Saf. 2020, 200,
110715. [CrossRef] [PubMed]
23. Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. CB 2014, 24, R453–R462. [CrossRef]
[PubMed]
24. Patwa, J.; Flora, S.J.S. MiADMSA abrogates chronic copper-induced hepatic and immunological changes in Sprague Dawley rats.
Food Chem. Toxicol. 2020, 145, 111692. [CrossRef] [PubMed]
25. Saghir, S.; Alharbi, S.; Al-garadi, M.; Al-Gabri, N.; Rady, H.; Olama, N.; Abdulghani, M.; Alhroob, A.; Almaiman, A.; Bin-Jumah,
M.; et al. Curcumin Prevents Cyclophosphamide-Induced Lung Injury in Rats by Suppressing Oxidative Stress and Apoptosis.
Processes 2020, 8, 127. [CrossRef]
26. Pizzo, P.; Scapin, C.; Vitadello, M.; Florean, C.; Gorza, L. Grp94 acts as a mediator of curcumin-induced antioxidant defence in
myogenic cells. J. Cell Mol. Med. 2010, 14, 970–981. [CrossRef]
27. Aggarwal, B.B.; Harikumar, K.B. Potential therapeutic effects of curcumin, the anti-inflammatory agent, against neurodegenerative,
cardiovascular, pulmonary, metabolic, autoimmune and neoplastic diseases. Int. J. Biochem. Cell Biol. 2009, 41, 40–59. [CrossRef]
[PubMed]
28. Yonar, M.E.; Mişe Yonar, S.; İspir, Ü.; Ural, M. Effects of curcumin on haematological values, immunity, antioxidant status and
resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas salmonicida subsp. achromogenes. Fish Shellfish Immunol.
2019, 89, 83–90. [CrossRef]
29. Al-Dossari, M.H.; Fadda, L.M.; Attia, H.A.; Hasan, I.H.; Mahmoud, A.M. Curcumin and Selenium Prevent Lipopolysaccharide/
Diclofenac-Induced Liver Injury by Suppressing Inflammation and Oxidative Stress. Biol. Trace Elem. Res. 2020, 196, 173–183.
[CrossRef]
30. Scazzocchio, B.; Minghetti, L.; D’Archivio, M. Interaction between Gut Microbiota and Curcumin: A New Key of Understanding
for the Health Effects of Curcumin. Nutrients 2020, 12, 2499. [CrossRef]
31. Venkatesan, N.; Punithavathi, D.; Babu, M. Protection from acute and chronic lung diseases by curcumin. Adv. Exp. Med. Biol.
2007, 595, 379–405. [CrossRef] [PubMed]
32. Suresh, M.V.; Francis, S.; Aktay, S.; Kralovich, G.; Raghavendran, K. Therapeutic potential of curcumin in ARDS and COVID-19.
Clin. Exp. Pharmacol. Physiol. 2023, 50, 267–276. [CrossRef]
33. Avasarala, S.; Zhang, F.; Liu, G.; Wang, R.; London, S.D.; London, L. Curcumin modulates the inflammatory response and inhibits
subsequent fibrosis in a mouse model of viral-induced acute respiratory distress syndrome. PLoS ONE 2013, 8, e57285. [CrossRef]
[PubMed]
34. Wang, X.; An, X.; Wang, X.; Bao, C.; Li, J.; Yang, D.; Bai, C. Curcumin ameliorated ventilator-induced lung injury in rats. Biomed.
Pharmacother. 2018, 98, 754–761. [CrossRef] [PubMed]
35. Vahedian-Azimi, A.; Abbasifard, M.; Rahimi-Bashar, F.; Guest, P.C.; Majeed, M.; Mohammadi, A.; Banach, M.; Jamialahmadi, T.;
Sahebkar, A. Effectiveness of Curcumin on Outcomes of Hospitalized COVID-19 Patients: A Systematic Review of Clinical Trials.
Nutrients 2022, 14. [CrossRef] [PubMed]
36. Flora, G.; Gupta, D.; Tiwari, A. Nanocurcumin: A promising therapeutic advancement over native curcumin. Crit. Rev. Ther.
Drug Carr. Syst. 2013, 30, 331–368. [CrossRef]
37. Vázquez-Blanco, R.; Arias-Estévez, M.; Bååth, E.; Fernández-Calviño, D. Comparison of Cu salts and commercial Cu based
fungicides on toxicity towards microorganisms in soil. Environ. Pollut. 2020, 257, 113585. [CrossRef]
38. Janssen, R.; de Brouwer, B.; von der Thüsen, J.H.; Wouters, E.F.M. Copper as the most likely pathogenic divergence factor between
lung fibrosis and emphysema. Med. Hypotheses 2018, 120, 49–54. [CrossRef]
39. Gunther, M.R.; Hanna, P.M.; Mason, R.P.; Cohen, M.S. Hydroxyl Radical Formation from Cuprous Ion and Hydrogen Peroxide: A
Spin-Trapping Study. Arch. Biochem. Biophys. 1995, 316, 515–522. [CrossRef]
40. Husain, N.; Mahmood, R. Copper(II) generates ROS and RNS, impairs antioxidant system and damages membrane and DNA in
human blood cells. Environ. Sci. Pollut. Res. Int. 2019, 26, 20654–20668. [CrossRef]
Int. J. Mol. Sci. 2023, 24, 13975 14 of 16

41. Su, L.J.; Zhang, J.H.; Gomez, H.; Murugan, R.; Hong, X.; Xu, D.; Jiang, F.; Peng, Z.Y. Reactive Oxygen Species-Induced Lipid
Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxidative Med. Cell. Longev. 2019, 2019, 5080843. [CrossRef] [PubMed]
42. Yang, F.; Pei, R.; Zhang, Z.; Liao, J.; Yu, W.; Qiao, N.; Han, Q.; Li, Y.; Hu, L.; Guo, J.; et al. Copper induces oxidative stress and
apoptosis through mitochondria-mediated pathway in chicken hepatocytes. Toxicol. Vitr. 2019, 54, 310–316. [CrossRef] [PubMed]
43. Sarawi, W.S.; Alhusaini, A.M.; Fadda, L.M.; Alomar, H.A.; Albaker, A.B.; Aljrboa, A.S.; Alotaibi, A.M.; Hasan, I.H.; Mahmoud,
A.M. Curcumin and Nano-Curcumin Mitigate Copper Neurotoxicity by Modulating Oxidative Stress, Inflammation, and
Akt/GSK-3β Signaling. Molecules 2021, 26, 5591. [CrossRef] [PubMed]
44. Sarawi, W.S.; Alhusaini, A.M.; Fadda, L.M.; Alomar, H.A.; Albaker, A.B.; Aljrboa, A.S.; Alotaibi, A.M.; Hasan, I.H.; Mahmoud,
A.M. Nano-Curcumin Prevents Cardiac Injury, Oxidative Stress and Inflammation, and Modulates TLR4/NF-kappaB and MAPK
Signaling in Copper Sulfate-Intoxicated Rats. Antioxidants 2021, 10, 1414. [CrossRef] [PubMed]
45. Sarawi, W.S.; Alhusaini, A.M.; Fadda, L.M.; Alomar, H.A.; Albaker, A.B.; Alghibiwi, H.K.; Aljrboa, A.S.; Alotaibi, A.M.; Hasan,
I.H.; Mahmoud, A.M. Nano-Curcumin Prevents Copper Reproductive Toxicity by Attenuating Oxidative Stress and Inflammation
and Improving Nrf2/HO-1 Signaling and Pituitary-Gonadal Axis in Male Rats. Toxics 2022, 10, 356. [CrossRef]
46. Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde
and 4-hydroxy-2-nonenal. Oxidative Med. Cell. Longev. 2014, 2014, 360438. [CrossRef]
47. Averill-Bates, D.A. The antioxidant glutathione. Vitam. Horm. 2023, 121, 109–141. [CrossRef]
48. Hufnagel, M.; Neuberger, R.; Wall, J.; Link, M.; Friesen, A.; Hartwig, A. Impact of Differentiated Macrophage-Like Cells on
the Transcriptional Toxicity Profile of CuO Nanoparticles in Co-Cultured Lung Epithelial Cells. Int. J. Mol. Sci. 2021, 22, 5044.
[CrossRef]
49. Kwon, J.T.; Kim, Y.; Choi, S.; Yoon, B.L.; Kim, H.S.; Shim, I.; Sul, D. Pulmonary Toxicity and Proteomic Analysis in Bronchoalveolar
Lavage Fluids and Lungs of Rats Exposed to Copper Oxide Nanoparticles. Int. J. Mol. Sci. 2022, 23, 13265. [CrossRef]
50. Valko, M.; Jomova, K.; Rhodes, C.J.; Kuca, K.; Musilek, K. Redox- and non-redox-metal-induced formation of free radicals and
their role in human disease. Arch. Toxicol. 2016, 90, 1–37. [CrossRef]
51. Valko, M.; Morris, H.; Cronin, M.T. Metals, toxicity and oxidative stress. Curr. Med. Chem. 2005, 12, 1161–1208. [CrossRef]
[PubMed]
52. Witkowska, D.; Słowik, J.; Chilicka, K. Heavy Metals and Human Health: Possible Exposure Pathways and the Competition for
Protein Binding Sites. Molecules 2021, 26, 6060. [CrossRef] [PubMed]
53. Kalpana, C.; Menon, V.P. Curcumin ameliorates oxidative stress during nicotine-induced lung toxicity in Wistar rats. Ital. J.
Biochem. 2004, 53, 82–86. [PubMed]
54. Suzuki, M.; Betsuyaku, T.; Ito, Y.; Nagai, K.; Odajima, N.; Moriyama, C.; Nasuhara, Y.; Nishimura, M. Curcumin attenuates
elastase- and cigarette smoke-induced pulmonary emphysema in mice. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2009, 296,
L614–L623. [CrossRef]
55. Zhang, D.; Huang, C.; Yang, C.; Liu, R.J.; Wang, J.; Niu, J.; Brömme, D. Antifibrotic effects of curcumin are associated with
overexpression of cathepsins K and L in bleomycin treated mice and human fibroblasts. Respir. Res. 2011, 12, 154. [CrossRef]
56. Lee, J.C.; Kinniry, P.A.; Arguiri, E.; Serota, M.; Kanterakis, S.; Chatterjee, S.; Solomides, C.C.; Javvadi, P.; Koumenis, C.; Cengel,
K.A.; et al. Dietary curcumin increases antioxidant defenses in lung, ameliorates radiation-induced pulmonary fibrosis, and
improves survival in mice. Radiat. Res. 2010, 173, 590–601. [CrossRef]
57. Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [CrossRef]
58. Rangasamy, T.; Cho, C.Y.; Thimmulappa, R.K.; Zhen, L.; Srisuma, S.S.; Kensler, T.W.; Yamamoto, M.; Petrache, I.; Tuder, R.M.;
Biswal, S. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J. Clin. Investig. 2004,
114, 1248–1259. [CrossRef]
59. Cho, H.Y.; Jedlicka, A.E.; Reddy, S.P.; Kensler, T.W.; Yamamoto, M.; Zhang, L.Y.; Kleeberger, S.R. Role of NRF2 in protection
against hyperoxic lung injury in mice. Am. J. Respir. Cell Mol. Biol. 2002, 26, 175–182. [CrossRef]
60. Garcia-Nino, W.R.; Pedraza-Chaverri, J. Protective effect of curcumin against heavy metals-induced liver damage. Food Chem.
Toxicol. 2014, 69, 182–201. [CrossRef]
61. Jiang, W.D.; Liu, Y.; Hu, K.; Jiang, J.; Li, S.H.; Feng, L.; Zhou, X.Q. Copper exposure induces oxidative injury, disturbs the
antioxidant system and changes the Nrf2/ARE (CuZnSOD) signaling in the fish brain: Protective effects of myo-inositol. Aquat.
Toxicol. 2014, 155, 301–313. [CrossRef] [PubMed]
62. Lu, Q.; Zhang, Y.; Zhao, C.; Zhang, H.; Pu, Y.; Yin, L. Copper induces oxidative stress and apoptosis of hippocampal neuron via
pCREB/BDNF/and Nrf2/HO-1/NQO1 pathway. J. Appl. Toxicol. JAT 2022, 42, 694–705. [CrossRef] [PubMed]
63. Ashrafizadeh, M.; Ahmadi, Z.; Mohammadinejad, R.; Farkhondeh, T.; Samarghandian, S. Curcumin Activates the Nrf2 Pathway
and Induces Cellular Protection against Oxidative Injury. Curr. Mol. Med. 2020, 20, 116–133. [CrossRef] [PubMed]
64. Shahcheraghi, S.H.; Salemi, F.; Peirovi, N.; Ayatollahi, J.; Alam, W.; Khan, H.; Saso, L. Nrf2 Regulation by Curcumin: Molecular
Aspects for Therapeutic Prospects. Molecules 2021, 27, 167. [CrossRef] [PubMed]
65. Satta, S.; Mahmoud, A.M.; Wilkinson, F.L.; Yvonne Alexander, M.; White, S.J. The Role of Nrf2 in Cardiovascular Function and
Disease. Oxidative Med. Cell. Longev. 2017, 2017, 9237263. [CrossRef]
66. Xiao, Y.; Xia, J.; Wu, S.; Lv, Z.; Huang, S.; Huang, H.; Su, X.; Cheng, J.; Ke, Y. Curcumin Inhibits Acute Vascular Inflammation
through the Activation of Heme Oxygenase-1. Oxidative Med. Cell. Longev. 2018, 2018, 3295807. [CrossRef]
Int. J. Mol. Sci. 2023, 24, 13975 15 of 16

67. Ke, S.; Zhang, Y.; Lan, Z.; Li, S.; Zhu, W.; Liu, L. Curcumin protects murine lung mesenchymal stem cells from H(2)O(2) by
modulating the Akt/Nrf2/HO-1 pathway. J. Int. Med. Res. 2020, 48, 300060520910665. [CrossRef]
68. Pietrofesa, R.A.; Park, K.; Mishra, O.P.; Johnson-McDaniel, D.; Myerson, J.W.; Shuvaev, V.V.; Arguiri, E.; Chatterjee, S.; Moorthy,
G.S.; Zuppa, A.; et al. Copper Oxide Nanoparticle-Induced Acute Inflammatory Response and Injury in Murine Lung Is
Ameliorated by Synthetic Secoisolariciresinol Diglucoside (LGM2605). Int. J. Mol. Sci. 2021, 22, 9477. [CrossRef]
69. Kim, S.R.; Bae, Y.H.; Bae, S.K.; Choi, K.S.; Yoon, K.H.; Koo, T.H.; Jang, H.O.; Yun, I.; Kim, K.W.; Kwon, Y.G.; et al. Visfatin enhances
ICAM-1 and VCAM-1 expression through ROS-dependent NF-kappaB activation in endothelial cells. Biochim. Biophys. Acta 2008,
1783, 886–895. [CrossRef]
70. Gosens, I.; Costa, P.M.; Olsson, M.; Stone, V.; Costa, A.L.; Brunelli, A.; Badetti, E.; Bonetto, A.; Bokkers, B.G.H.; de Jong, W.H.;
et al. Pulmonary toxicity and gene expression changes after short-term inhalation exposure to surface-modified copper oxide
nanoparticles. NanoImpact 2021, 22, 100313. [CrossRef]
71. Hubbard, A.K.; Rothlein, R. Intercellular adhesion molecule-1 (ICAM-1) expression and cell signaling cascades. Free Radic. Biol.
Med. 2000, 28, 1379–1386. [CrossRef] [PubMed]
72. Kim, H.; Hwang, J.S.; Woo, C.H.; Kim, E.Y.; Kim, T.H.; Cho, K.J.; Kim, J.H.; Seo, J.M.; Lee, S.S. TNF-alpha-induced up-regulation
of intercellular adhesion molecule-1 is regulated by a Rac-ROS-dependent cascade in human airway epithelial cells. Exp. Mol.
Med. 2008, 40, 167–175. [CrossRef] [PubMed]
73. Nemmar, A.; Subramaniyan, D.; Ali, B.H. Protective effect of curcumin on pulmonary and cardiovascular effects induced by
repeated exposure to diesel exhaust particles in mice. PLoS ONE 2012, 7, e39554. [CrossRef] [PubMed]
74. Youn, H.; Jeong, J.C.; Jeong, Y.S.; Kim, E.J.; Um, S.J. Quercetin potentiates apoptosis by inhibiting nuclear factor-kappaB signaling
in H460 lung cancer cells. Biol. Pharm. Bull. 2013, 36, 944–951. [CrossRef] [PubMed]
75. Yen, F.L.; Tsai, M.H.; Yang, C.M.; Liang, C.J.; Lin, C.C.; Chiang, Y.C.; Lee, H.C.; Ko, H.H.; Lee, C.W. Curcumin nanoparticles
ameliorate ICAM-1 expression in TNF-α-treated lung epithelial cells through p47 (phox) and MAPKs/AP-1 pathways. PLoS ONE
2013, 8, e63845. [CrossRef] [PubMed]
76. Basnet, P.; Skalko-Basnet, N. Curcumin: An anti-inflammatory molecule from a curry spice on the path to cancer treatment.
Molecules 2011, 16, 4567–4598. [CrossRef]
77. Boyanapalli, S.S.; Paredes-Gonzalez, X.; Fuentes, F.; Zhang, C.; Guo, Y.; Pung, D.; Saw, C.L.; Kong, A.N. Nrf2 knockout attenuates
the anti-inflammatory effects of phenethyl isothiocyanate and curcumin. Chem. Res. Toxicol. 2014, 27, 2036–2043. [CrossRef]
78. Jin, H.; Ciechanowicz, A.K.; Kaplan, A.R.; Wang, L.; Zhang, P.X.; Lu, Y.C.; Tobin, R.E.; Tobin, B.A.; Cohn, L.; Zeiss, C.J.; et al.
Surfactant protein C dampens inflammation by decreasing JAK/STAT activation during lung repair. Am. J. Physiology. Lung Cell.
Mol. Physiol. 2018, 314, L882–L892. [CrossRef]
79. Arias-Díaz, J.; Vara, E.; García, C.; Balibrea, J.L. Tumor necrosis factor-alpha-induced inhibition of phosphatidylcholine synthesis
by human type II pneumocytes is partially mediated by prostaglandins. J. Clin. Investig. 1994, 94, 244–250. [CrossRef]
80. Wispé, J.R.; Clark, J.C.; Warner, B.B.; Fajardo, D.; Hull, W.E.; Holtzman, R.B.; Whitsett, J.A. Tumor necrosis factor-alpha inhibits
expression of pulmonary surfactant protein. J. Clin. Investig. 1990, 86, 1954–1960. [CrossRef]
81. Pryhuber, G.S.; Khalak, R.; Zhao, Q. Regulation of surfactant proteins A and B by TNF-alpha and phorbol ester independent of
NF-kappa B. Am. J. Physiol. 1998, 274, L289–L295. [CrossRef] [PubMed]
82. Glasser, S.W.; Detmer, E.A.; Ikegami, M.; Na, C.L.; Stahlman, M.T.; Whitsett, J.A. Pneumonitis and emphysema in sp-C gene
targeted mice. J. Biol. Chem. 2003, 278, 14291–14298. [CrossRef] [PubMed]
83. Puthusseri, B.; Marudamuthu, A.; Tiwari, N.; Fu, J.; Idell, S.; Shetty, S. Regulation of p53-mediated changes in the uPA-fibrinolytic
system and in lung injury by loss of surfactant protein C expression in alveolar epithelial cells. Am. J. Physiology. Lung Cell. Mol.
Physiol. 2017, 312, L783–L796. [CrossRef] [PubMed]
84. Guzel, A.; Kanter, M.; Guzel, A.; Yucel, A.F.; Erboga, M. Protective effect of curcumin on acute lung injury induced by intestinal
ischaemia/reperfusion. Toxicol. Ind. Health 2013, 29, 633–642. [CrossRef] [PubMed]
85. Joshi, S.; Kumar, S.; Bafna, S.; Rachagani, S.; Wagner, K.U.; Jain, M.; Batra, S.K. Genetically engineered mucin mouse models for
inflammation and cancer. Cancer Metastasis Rev. 2015, 34, 593–609. [CrossRef] [PubMed]
86. Kim, K.C.; Lillehoj, E.P. MUC1 mucin: A peacemaker in the lung. Am. J. Respir. Cell Mol. Biol. 2008, 39, 644–647. [CrossRef]
87. Lu, W.; Hisatsune, A.; Koga, T.; Kato, K.; Kuwahara, I.; Lillehoj, E.P.; Chen, W.; Cross, A.S.; Gendler, S.J.; Gewirtz, A.T.; et al.
Cutting edge: Enhanced pulmonary clearance of Pseudomonas aeruginosa by Muc1 knockout mice. J. Immunol. 2006, 176,
3890–3894. [CrossRef]
88. Koga, T.; Kuwahara, I.; Lillehoj, E.P.; Lu, W.; Miyata, T.; Isohama, Y.; Kim, K.C. TNF-alpha induces MUC1 gene transcription
in lung epithelial cells: Its signaling pathway and biological implication. Am. J. Physiology. Lung Cell. Mol. Physiol. 2007, 293,
L693–L701. [CrossRef]
89. Kuwahara, I.; Lillehoj, E.P.; Hisatsune, A.; Lu, W.; Isohama, Y.; Miyata, T.; Kim, K.C. Neutrophil elastase stimulates MUC1 gene
expression through increased Sp1 binding to the MUC1 promoter. Am. J. Physiology. Lung Cell. Mol. Physiol. 2005, 289, L355–L362.
[CrossRef]
90. Shi, Y.; Chen, J.; Weng, C.; Chen, R.; Zheng, Y.; Chen, Q.; Tang, H. Identification of the protein-protein contact site and interaction
mode of human VDAC1 with Bcl-2 family proteins. Biochem. Biophys. Res. Commun. 2003, 305, 989–996. [CrossRef]
Int. J. Mol. Sci. 2023, 24, 13975 16 of 16

91. Li, Y.; Chen, H.; Liao, J.; Chen, K.; Javed, M.T.; Qiao, N.; Zeng, Q.; Liu, B.; Yi, J.; Tang, Z.; et al. Long-term copper exposure
promotes apoptosis and autophagy by inducing oxidative stress in pig testis. Environ. Sci. Pollut. Res. 2021, 28, 55140–55153.
[CrossRef] [PubMed]
92. Li, Y.; Zhang, S.; Geng, J.X.; Hu, X.Y. Curcumin inhibits human non-small cell lung cancer A549 cell proliferation through
regulation of Bcl-2/Bax and cytochrome C. Asian Pac. J. Cancer Prev. 2013, 14, 4599–4602. [CrossRef] [PubMed]
93. Guo, S.; Long, M.; Li, X.; Zhu, S.; Zhang, M.; Yang, Z. Curcumin activates autophagy and attenuates oxidative damage in
EA.hy926 cells via the Akt/mTOR pathway. Mol. Med. Rep. 2016, 13, 2187–2193. [CrossRef] [PubMed]
94. Kumar, V.; Kalita, J.; Misra, U.K.; Bora, H.K. A study of dose response and organ susceptibility of copper toxicity in a rat model.
J. Trace Elem. Med. Biol. 2015, 29, 269–274. [CrossRef] [PubMed]
95. Alhusaini, A.; Hasan, I.H.; Aldowsari, N.; Alsaadan, N. Prophylactic Administration of Nanocurcumin Abates the Incidence of
Liver Toxicity Induced by an Overdose of Copper Sulfate: Role of CYP4502E1, NF-kappaB and Bax Expressions. Dose-Response A
Publ. Int. Hormesis Soc. 2018, 16, 1559325818816284. [CrossRef]
96. Alhusaini, A.; Fadda, L.; Hassan, I.; Ali, H.M.; Alsaadan, N.; Aldowsari, N.; Aldosari, A.; Alharbi, B. Liposomal Curcumin
Attenuates the Incidence of Oxidative Stress, Inflammation, and DNA Damage Induced by Copper Sulfate in Rat Liver. Dose-
Response A Publ. Int. Hormesis Soc. 2018, 16, 1559325818790869. [CrossRef]
97. Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979,
95, 351–358. [CrossRef]
98. Ellman, G.L. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 1959, 82, 70–77. [CrossRef] [PubMed]
99. Marklund, S.L. Superoxide dismutase isoenzymes in tissues and plasma from New Zealand black mice, nude mice and normal
BALB/c mice. Mutat. Res. 1985, 148, 129–134. [CrossRef]
100. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆CT
Method. Methods 2001, 25, 402–408. [CrossRef]
101. Zhang, F.F.; Peng, W.; Sweeney, J.A.; Jia, Z.Y.; Gong, Q.Y. Brain structure alterations in depression: Psychoradiological evidence.
CNS Neurosci. Ther. 2018, 24, 994–1003. [CrossRef] [PubMed]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.