13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023].

See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
Received: 29 August 2020 | Revised: 30 October 2020 | Accepted: 27 November 2020

DOI: 10.1111/are.15052

ORIGINAL ARTICLE

Prevalence of antibiotic-resistant bacteria in freshwater fish

farms

Ahmed H. Sherif1 | Mofeed Gouda2 | Shawky Darwish3 | Asmail Abdelmohsin4

1
Fish Diseases Department, Animal Health
Research Institute AHRI, Agriculture Abstract
Research Centre ARC, Kafrelsheikh, Egypt The emergence of antibiotic-resistant bacteria (ARBs) has become a threat to the
2
Pathology Department, Animal Health
aquatic industry. Virulent bacterial spp. namely Aeromonas hydrophila, A. vero-
Research Institute AHRI, Agriculture
Research Centre ARC, Kafrelsheikh, Egypt nii, Pseudomonas fluorescens and P. aeruginosa that were isolated from Nile tilapia
3
Limnology Department, Center Laboratory (Oreochromis niloticus) and grey mullet (Mugil cephalus) were collected from freshwa-
of Aquaculture Research, Agriculture
Research Centre ARC, Kafrelsheikh, Egypt
ter fish farms at three different sites, and their associated antibiotic-resistant genes
4
Genetic Department, Faculty of (ARBs) were further characterized. The ARGs for sulphonamide and tetracycline
Agriculture, Kafrelsheikh University, were the most prevalent ones. Out of 50 O. niloticus and 50 M. cephalus, A. hydrophila
Kafrelsheikh, Egypt
(16.5 ± 5.5 and 11 ± 1.0 respectively) and P. aeruginosa (16 ± 1.0 and 12.5 ± 2.5 re-
Correspondence spectively) had significantly higher infection rates. At site 3, O. niloticus and M. cepha-
Ahmed H. Sherif, Fish Diseases Department,
Animal Health Research Institute AHRI, lus showed severe lesions in the hepatic tissues which had higher residues of iron
Agriculture Research Centre ARC, (Fe, 1238.3–1250.0 µg/g) and zinc (Zn, 940.0–078.0 µg/g) compared with sites 1 and
Kafrelsheikh, Egypt.
Email: ahsherif77@yahoo.com 2. The severity of hepatic tissue lesions was associated with bacterial infection and
heavy metal residues, and also the presence of ARGs was associated with histopatho-
logical alterations of the hepatic tissues. It was concluded that ARGs (sulphonamide
and tetracycline) could be developed in bacteria isolated from fish, which subjected
to heavy metal pollution (Fe, Mn and Zn).

KEYWORDS

Aeromonas, antibiotic-resistant genes, Mugil cephalus, Oreochromis niloticus, Pseudomonas

1 | I NTRO D U C TI O N Recently, environmental reservoirs for antibiotic-resistant bac-

Nile tilapia (Oreochromis niloticus) and grey mullet (Mugil cephalus) are
the most consumed fish spp. in the Egyptian market, and the fish
productions are about 1.5 million tons per year (FAO, 2003–2020).
Poultry manure is used as a fertilizer in fish farms to increase nat-
ural food (phytoplankton) productions. However, it has antimicrobial
residues (Furtula et al., 2010; Kumar et al., 2005) which disseminate
in aquatic environment (Khan et al., 2008; Rooklidge, 2004; Song
et al., 2007). The use of antibiotic in aquaculture and in other industrial
food animal production settings contributes to the development of an-
tibiotic-resistant bacteria (ARBs) and the widespread of antibiotic-resis-
tant genes (ARGs). ARBs and ARGs have been extensively isolated from
aquatic animals (Naik et al., 2018) and aquatic environments (water and
sediment) (Pham et al., 2018; Shah et al., 2012) in the last decade.
teria have attracted the attention of the aquatic researchers (Huerta
et al., 2013). The antibiotics are partially metabolized by humans
and animals; thus, they are released into aquatic environments and
besides moderately removed by wastewater treatment plants (Gros
et al., 2012), thus allowing the spread of ARGs (Baquero et al., 2008).
Fish are usually exposed to antibiotics, which are used as pro-
phylactic or treatment agents in some countries wherein safety
regulations are not applied (Pruden et al., 2013); therefore, ARGs
presented in bacteria isolated from such fish (Deng et al., 2014;
Muziasari et al., 2017). In Egypt, WHO (2006) aquatic farmers and
paramedics rottenly use large quantities of antibiotics during dis-
ease outbreaks without veterinary consultation or supervision, also
the insufficient regulations for the antimicrobial registration facili-
tating its illegal use. Also, Saqr et al. (2016) found that 95% (38/40)

2036 | © 2020 John Wiley & Sons Ltd wileyonlinelibrary.com/journal/are Aquaculture Research. 2021;52:2036–2047.

SHERIF et al.
of Escherichia coli isolated from O. niloticus (El-Behera Governorate,
Egypt) harbouring multiple antibiotic resistances. Also, they added
that blaTEM gene (beta-lactamase) and aadA gene (aminoglycoside)
were the most detected antibiotic-resistant genes (ARGs) 15 (21.4%)
and 18 (25.7%) respectively.
Sulphonamide, tetracycline, quinolone and erythromycin are
antimicrobials that have been commonly used to treat fish, poultry
and other animal diseases. Moreover, the ARGs (sulI, tetA, qnrS and
ermB) for these antibiotics can easily spread among bacteria as they
exist in conjugative plasmids (Blair et al., 2015). Several ARGs have
been isolated from bacteria isolated from the sediments of rivers,
for example sulphonamide and tetracycline RGs in the South Platte
River basin in the United States (Storteboom et al., 2010) and in the
Haihe River in China (Luo et al., 2010) and β-lactamase RGs and
quinolone RGs in India and Sweden (Kristiansson et al., 2011). It has
been reported that both the heavy metal RGs and ARGs occasionally
share the same mobile genetic elements, similar to class 1 integrons
(Di Cesare et al., 2016).
The failure of antibiotic treatment of the diseased fish has be-
come a major obstacle in the aquaculture industry. Therefore, the
present study aimed to investigate the emergence of ARGs in fresh-
water fish farms in relation to heavy metals pollution.
2 | M ATE R I A L S A N D M E TH O DS
2.1 | Fish samples and sites of fish farms
A total of 300 fish were randomly collected from freshwater fish farms
(suffered from fish mortality) located at three different sites (sites 1–3)
at El-Ryad Village, Kafrelsheikh, Egypt. Each site is away by a distance
of 5 km from each other and shares the source of the water supply. The
50 Nile tilapia Oreochromis niloticus and 50 grey mullet Mugil cephalus
were sampled per site, and their weights ranged between 185–210 and
230–280 g respectively. Fish were transported alive in aerated water
tanks. At the arrival time, fish were euthanized by immersion in MS222
solution (250 mg/L; 25–30°C) that assumed to cause rapid uncon-
sciousness according to AVMA (2007). All the fish farms in this study
used poultry manure as a fertilizer to increase the natural feed (phy-
toplankton). The fish collected had not been previously treated with
antibiotics. All applicable international, national and/or institutional
guidelines for the care and use of animals were followed by the authors.
2.2 | Isolation and identification of bacteria
2.2.1 | Primary isolation of bacteria
The collected fish were bacteriologically examined. Briefly, bacte-
riological swabs were obtained from the liver, spleen and kidneys of
the fish according to Woo and Bruno (2014) and inoculated in tryp-
tic soy broth. The inoculums were then streaked on Aeromonas agar
at 28°C/24 h for Aeromonas spp, as described previously (Austin &
|
13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2037
Austin, 2012), and on Pseudomonas agar plates for Pseudomonas spp
(Buller, 2004) at 28°C for 24 h according to a previously described
method (Muratori, 2001). All media used in the bacterial analyses
were produced by Oxoid, Canada.
2.2.2 | Identification of the bacteria
Bacteria spp. were identified using API 20 E and API ZYM Kits (bi-
oMerieux) according to methods described by the manufacturer.
2.2.3 | Detection of bacterial isolates and antibiotic-
resistant genes
The further identification of bacterial isolates and ARGs was per-
formed using polymerase chain reaction (PCR); the primers used are
listed in Table 1, and they were manufactured by Metabion, Germany.
DNA for the bacterial spp. A. hydrophila, A. veronii, P. fluorescens and
P. aeruginosa was extracted using the QIAamp DNA Mini Kit (Qiagen
GmbH), according to the manufacturer's instructions. PCR amplifi-
cation was achieved using the Emerald Amp Max PCR Master Mix
(Takara), and the PCR products were separated by electrophoresis
on 1% agarose gels (AppliChem GmbH) in 1 × Tris/borate/ethylene-
diaminetetraacetic acid buffer (TE buffer) at room temperature using
gradients of 5 V/cm. GelPilot 100 bp (Qiagen GmbH) ladders were
used to determine fragment sizes. The gel was visualized by a gel
documentation system (Alpha Innotech, Biometra).
2.3 | Challenge test
A total of 60 O. niloticus (50 ± 5 g/fish) were acclimatized in indoor water
tank (1.5 × 1.5 × 3 m) for 2 weeks at the wet laboratory of Animal Health
Research Institute. The tank was supplied with dechlorinated water and
a continuous oxygen supply by an air pump. During the acclimation pe-
riod, the water temperature and pH were adjusted at 25 ± 2.5°C and
7.2–8.2 respectively. Feeding was allowed once daily (30% protein con-
tent) at a rate of 3% of the fish body weight, and the wastes of fish were
removed daily with the exchange of one-third of aquarium water.
Fish were subdivided into six groups G1–G6 (10 fish per group),
and each group was stocked in a glass aquarium (60 × 40×40 cm), G1
(control 1) held untreated, G2 (control 2) injected intraperitoneally
with 0.5 ml of PBS (0.65%) (Boijink et al., 2001), while G3 and G4 were
injected intraperitoneally (IP) with 0.5 ml of 108 CFU/ml of 24-h-grown
A. hydrophila (Sherif et al., 2020) and 0.5 ml of 5.2 × 106 CFU/ml of
24-h-grown and A. veronii (Hassan et al., 2017) respectively. G5 and
G6 injected IP by 0.1 ml of PBS containing 3 × 107 CFU/ml of 24 h
grown P. fluorescens and P. aeruginosa respectively (Eissa et al., 2010).
Fish were observed for 7 days. The bacterial isolates were considered
positive when more than 50% of the injected fish had clinical signs
and/or died within 96 h. All bacterial strains that were re-isolated
from samples of spleen, liver and kidneys were collected from the
 |

13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2038 SHERIF et al.

TA B L E 1 Primers used in the current study to detect bacteria and antibiotic-resistant genes

Annealing Product
Primer name Primer sequences temperature (°C) size (bp) References

Aeromonas hydrophila F: GAAAGGTTGATGCCTAATACGTA 50 625 Gordon et al. (2007)

16S rRNA R: CGTGCTGGCAACAAAGGACAG
A. veronii F: CGTGCCGGCTTTGAAGTC 65 244 Persson et al. (2015)
16S rRNA R: GATCACGTACTTGCCTTCTTCAATA
A. hydrophila and A. veronii
Act F: AGAAGGTGACCACCACCAAGAACA 55 232 Nawaz et al. (2010)
R: AACTGACATCGGCCTTGAACTC
Alt F: TGACCCAGTCCTGGCACGGC 55 442
R: GGTGATCGATCACCACCAGC
Pseudomonas aeruginosa F: GGGGGATCTTCGGACCTCA 52 956 Spilker et al. (2004)
16S rRNA R: TCCTTAGAGTGCCCACCCG
P. fluorescens F: TGCATTCAAAACTGACTG 48 850 Machado et al. (2013)
16S rRNA R: AATCACACCGTGGTAACCG
P. aeruginosa and P. fluorescens
toxA F: GACAACGCCCTCAGCATCACCAGC 55 396 Matar et al. (2002)
R: CGCTGGCCCATTCGCTCCAGCGCT
fliC F: TGAACGTGGCTACCAAGAACG 56.2 180 Ghadaksaz et al. (2015)
R: TCTGCAGTTGCTTCACTTCGC
Antibiotic-resistant genes ARG
SulI F: CGGCGTGGGCTACCTGAACG 68 433 Kerrn et al. (2002)
R: GCCGATCGCGTGAAGTTCCG
TetA F: GCTACATCCTGCTTGCCTTC 55 210 Mendez et al. (1980)
R: CATAGATCGCCGTGAAGAGG
qnrS F: ACGACATTCGTCAACTGCAA 53 417 Robicsek et al. (2006)
R: TAAATTGGCACCCTGTAGGC
ermB F: TGGTATTCCAAATGCGTAATG 62 745 Malhotra-Kumar
R: CTGTGGTATGGCGGGTAAGT et al. (2005)

diseased and/or dead fish and then confirmed by PCR using specific
primers listed in Table 1. The challenge test was conducted as per the
method described by Schaperclaus et al. (1992).
2.4 | Measurement of heavy metal residues in the
hepatic tissues
Hepatic tissues were processed according to the Association of
Official Agricultural Chemists (AOAC, 1990). Approximately 5 g of wet
tissue was dried, ignited and digested with concentrated HNO3 and
HCL. The levels of heavy metals [iron (Fe), copper (Cu), zinc (Zn), man-
ganese (Mn), cadmium (Cd), lead (Pb) and mercury (Hg)] in the hepatic
tissues were determined using an atomic absorption spectrophotom-
eter (Thermo, Electro Corporation, S Series with graphite furnace), ac-
cording to previously described procedures (APHA, 2000).
At the fish farms, portable devices were used for measuring water
temperature and salinity (model YSI environmental, EC300), dis-
solved oxygen (DO) levels (Aqualytic, OX 24), and pH (Thermo
Orion, model 420A). Water samples were collected using a poly-
vinyl chloride tube column sampler at a depth of 0.5 m from the
water surface. Water samples collected from three different lo-
cations (1 L/location) at each farm were mixed in a plastic bucket,
and samples of 1 L were placed in a polyethylene bottle, kept
refrigerated at 4°C and transferred cold to the laboratory for
analysis of total ammonia (TA), unionized ammonia (NH 3), nitrite
(NO2) and nitrate (NO3) using a UV/Visible spectrophotometer
(Thermo-Spectronic 300) according to Fishman and Friedman
(1989).
2.6 | Histopathological examination

2.5 | Water physicochemical parameters and
heavy metals
Three water samples were collected from each site and analysed
according to the previously described procedures (APHA, 2000).
Five O. niloticus and 5 M. cephalus (10 fish per site) were randomly se-
lected and subjected to histopathological examination. Tissue speci-
mens from the liver were fixed with 10% neutral buffered formalin.
Tissues were processed, stained with haematoxylin and eosin, and
examined using an Olympus BX51 light electric microscope, accord-
ing to previously described methods Roberts (2012).
 |

13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SHERIF et al. 2039

2.7 | Statistical analysis respectively. To confirm the pathogenicity of A. hydrophila, A. veronii,

P. fluorescens and P. aeruginosa, O. niloticus was challenged with LD50
All statistical were performed using analysis of vari- of each bacterial strain.
ance (ANOVA) for means, standard error and signif-
icance. All statistics were conducted using the spss 16.0 software
(SPSS, 2004). 3.2 | Prevalence of antibiotic-resistant genes in fish

3 | R E S U LT S
3.1 | Bacterial identification and infection rate in
fish farms
Oreochromis niloticus (150) and M. cephalus (150) were collected
from three different sites and examined for the presence of bac-
terial pathogens, as listed in Table 2. Aeromonas hydrophila, A. ve-
ronii, P. fluorescens and P. aeruginosa were isolated and identified
using API 20E, and their profile numbers were 3,006,527 (99.3%),
3,247,124 (95.1%), 2,001,046 (95%) and 2,012,006 (95%), respec-
tively, further identification with PCR technique was performed
using the specific primers (Table 1) for 16s rRNA and virulence
genes.
High infection rates of A. hydrophila were recorded in M. cephalus
(50 fish) and O. niloticus (50 fish) at 11 ± 1.0 and 16.5 ± 5.5 respec-
tively. The analysis of infection rates according to site revealed that,
at site 1, A. hydrophila exhibited a higher infection rate (5.5 ± 0.5)
in O. niloticus than other pathogens, whereas P. aeruginosa was the
most abundant bacterium in M. cephalus, with an infection rate of
3 ± 1.0; at site 2, P. aeruginosa and A. hydrophila had infection rates
of 12.5 ± 2.5 and 10 ± 2.0 respectively, in O. niloticus; and at site
3, A. hydrophila and P. aeruginosa were the most abundant bacte-
ria in O. niloticus, with infection rates of 16.5 ± 5.5 and 16 ± 1.0
The ARGs (sulI, tetA, qnrS and ermB) were identified from the
pathogenic bacteria A. hydrophila, A. veronii, P. fluorescens and
P. aeruginosa, with variable abundance rates between sites and
fish species (Table 3). At site 1, ARGs qnrS and ermB were not
identified, whereas those for tetA and sulI were the most abun-
dant ARGs. Moreover, no ARGs were detected for A. veronii in this
study, and no differences in the ARG abundance rates were re-
corded between O. niloticus and M. cephalus. The results obtained
for site 2 were similar to those obtained for site 1, with the ex-
ception of detection of positive qnrS genes for A. hydrophila and
P. fluorescens. At site 3, Pseudomonas aeruginosa had ARGs for all
the antibiotics except for ermB. P. fluorescens had no ARGs and
A. veronii carried ARGs for tetA, sulI and ermB. ermB RGs were
present only at site 3.
3.3 | Heavy metal residues in the hepatic tissues
The levels of Fe, Cu, Zn, Mn, Cd, Pb and Hg were measured in the he-
patic tissue of the fish collected at the three sites (Table 4). The levels
of Fe and Zn were significantly higher in the livers of O. niloticus and
M. cephalus (1238.3 ± 15.9 and 1250.0 ± 76.4 µg/g, respectively,
and 940 ± 11.5 and 1078.3 ± 10.9 µg/g respectively) at site 3. The
lowest levels of heavy metals were recorded for Hg in O. niloticus
and M. cephalus.

TA B L E 2 Infection rates of bacterial species in fish farms

Site 1 Site 2 Site 3

Items No. % No. % No. %

Aeromonas hydrophila
O 5.5b ± 0.5 11 10.0a ± 2.0 20 16.5a ± 5.5 33
b a a
M 1.5 ± 0.5 3 8.5 ± 0.5 17 11.0 ± 1.0 22
A. veronii
O 0 0 0 0 4.0 ± 1.0 8
M 0 0 0 0 7.5 ± 0.5 15
Pseudomonas fluorescens
O 4.5a ± 1.5 9 7.0a ± 1.0 14 0 0
a a
M 2.0 ± 2.0 4 6.0 ± 1.0 12 0 0
P. aeruginosa
O 0 0 0 0 16.0 ± 1.0 32
M 3.0a ± 1.0 6 12.5a ± 2.5 25 13.5a ± 4.5 27
Note: Values are presented as mean ± standard error (n = 50) of bacterial infection. Values with different letters in the same row are significantly
different at p ≤ 0.05.
Abbreviations: M, Mugil cephalus; No., fish number; O, Oreochromis niloticus.
 |

13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2040 SHERIF et al.

TA B L E 3 Prevalence of ARGs in bacteria isolated from fish collected at different sites

Site 1 Site 2 Site 3

Items T S Q E T S Q E T S Q E

Aeromonas hydrophila
O + + − − + + + − + + − +
M + + − − + + + − + + − +
A. veronii
O − − − − − − − − + + − +
M − − − − − − − − + + − +
Pseudomonas fluorescens
O + + − − + + + − − − − −
M + + − − + + + − − − − −
P. aeruginosa
O − − − − − − − − + + + −
M + + − − + + − − + + + −
Note: (+) Presence of ARGs for tetracycline (T), sulphonamide (S), quinolone (Q) or erythromycin (E) and (−) their absence.
Abbreviations: M, Mugil cephalus; O, Oreochromis niloticus.

TA B L E 4 Levels of heavy metals in the liver of O. niloticus and M. cephalus

Heavy metal Fish Site 1 (µg/g) Site 2 (µg/g) Site 3 (µg/g)

c b
Fe O 953.3 ± 31.8 1082.3 ± 36.7 1238.3a ± 15.9
a a
M 1073.3 ± 14.5 1210.0 ± 37.8 1250.0a ± 76.4
Cu O 124.0 c ± 2.3 171.5a ± 2.53 159.7b ± 1.45
a a
M 124.0 ± 9.45 187.8 ± 6.4 141.1a ± 60.7
Zn O 820.0 b ± 40.4 876.3ab ± 25.1 940.0a ± 11.5
c b
M 870.0 ± 11.5 998.7 ± 9.4 1078.3a ± 10.9
Mn O 18.03b ± 1.29 22.99a ± 0.57 25.17a ± 0.67
b a
M 33.3 ± 0.4 43.2 ± 1.6 39.8a ± 0.7
Cd O 22.9c ± 0.86 29.8a ± 0.82 27.2b ± 0.2
c a
M 27.9 ± 0.8 41.5 ± 0.8 37.1b ± 0.9
Pb O 35.5b ± 1.87 48.7a ± 1.6 47.2a ± 1.0
c a
M 44.1 ± 0.8 67.7 ± 1.8 60.2b ± 0.6
Hg O 5.4b ± 0.16 8.3a ± 0.26 7.7a ± 0.26
a a
M 8.3 ± 0.7 10.2 ± 0.6 8.97a ± 2.0
Note: Values are presented as mean ± standard error of different heavy metals. Values with different letters in the same row are significantly
different at p ≤ 0.05.
Abbreviations: M, Mugil cephalus; O, Oreochromis niloticus.

The abundance of ARGs in the isolated bacteria A. hydrophila, significant differences were recorded in the water parameters at
A. veronii, P. fluorescens and P. aeruginosa in O. niloticus and M. ceph- the three sites, with the exception of pH (8.35 and 8.83 at sites 3
alus was associated with the levels of the residues of heavy metals and 1 respectively) and salinity (3.37 and 1.87 g/L at sites 3 and 1
in the hepatic tissue. respectively).

3.4 | Physicochemical parameters of the farm water 3.5 | Histopathology picture of the hepatic tissues

The findings of the water parameter analysis of the fish farms Histopathological examination (Figure 1) of the collected O. niloticus
located at the three sites are presented in Table 5. Temperature, and M. cephalus showed no differences within the same site. At site
pH, DO levels, salinity, and TA, NH3 , NO2 and NO3 levels were 3, the lesions observed in the hepatic tissues were more severe than
examined in terms of any deviation from the normal ranges. No those of sites 1 and 2. The hepatic tissue of Oreochromis niloticus
 |

13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SHERIF et al. 2041

TABLE 5 Physicochemical parameters of the water samples

Items Site 1 Site 2 Site 3 Limits (References)

Temperature (°C) 27.8a ± 0.21 27.97a ± 0.12 27.53a ± 0.32 11.0–42.0 (FAO, 2012)
ab b a
pH 8.33 ± 0.13 8.35 ± 0.13 8.65 ± 0.09 6.5–9.0 (Boyd, 1998)
DO (mg/L) 5.67a ± 0.09 5.97b ± 0.09 5.83b ± 0.2 ≥5.0 (Lloyd, 1992) and
3.0–5.0 (Bhatnagar &
Devi, 2013)
Salinity (g/L) 1.87b ± 0.34 2.19b ± 0.21 3.37a ± 0.09 <15.0 (Boyd, 1998)
a a a
TA (mg/ L) 0.2 ± 0.06 0.21 ± 0.02 0.24 ± 0.02 0.2–2.0 (Boyd, 1998)
NH3 (mg/L) 0.03a ± 0.02 0.03a ± 0.01 0.04a ± 0.01 0.02–0.05 (Boyd, 1998)
a a a
NO2 (mg/L) 0.02 ± 0.01 0.02 ± 0.0 0.02 ± 0.01 <0.5 (Swann, 1997)
<1.0 (Pillay &
Kutty, 2005)
NO3 (mg/L) 0.33a ± 1.3 0.35a ± 1.7 0.5a ± 2.1 <10.0 (Pillay &
Kutty, 2005)
Note: Values are presented as mean ± standard error. Values with different letters in the same row are significantly different at p ≤ 0.05.

F I G U R E 1 (a) Normal architecture of

(a) (b)
the hepatic tissue of Oreochromis niloticus
collected from site 1; haematoxylin
and eosin (H&E) staining (100×). (b)
The hepatic tissue of Mugil cephalus
collected from site 3 showing (triangle)
severe vacuolar degeneration and (star)
blood vessels engorged with blood; H&E
staining (100×). (c) The hepatic tissue of
O. niloticus collected at site 3 showing
severe vacuolar degeneration and blood
vessels congested with blood pyknosis
(triangle); H&E staining (100×). (d) The (c) (d)
hepatic tissue of O. niloticus collected at
site 3 showing a necrotic area (triangle);
H&E staining (100×) [Colour figure can be
viewed at wileyonlinelibrary.com]

collected from site 1 showed normal architecture of the hepatic tis-
sue (Figure 1a). Hepatic tissue of M. cephalus (Figure 1b) that had been
exposed to heavy metals in site 3 showed some lesions including
congestion of hepatic blood vessels sinusoids. While lesions includ-
ing haemorrhage, severe vacuolar degeneration and focal infiltration
with macrophages (Figure 1c,d). Moreover, increased melanomac-
rophage centres and severe vacuolar degenerative changes were
observed in some hepatocytes of O. niloticus at site 3 (Figure 1c),
whereas necrosis was observed in other hepatocytes (Figure 1d).
4 | D I S CU S S I O N
Antibiotic-resistant bacteria and ARGs have become widely prev-
alent in fish farms over the last few years, mainly because of the
uncontrolled usage of antibiotics in fish production (treatment,
prophylaxis and growth promotion), the fertilization of fish ponds
with animal and poultry manure, and the insufficient treatment of
municipal wastewater.
In Egypt, municipal sewage is usually discharged untreated into
the drainage water acting as a continuous source of pollution, since
sewage contains antibiotic residues and resistant bacteria from
different sources (Amine, 2013; Ezzat et al., 2012). Also, Hamza
et al. (2020) added that such unregulated use of antibiotics to treat
fish, or through agricultural sources, faecal contaminated, or the
workers in the aquaculture could result in the emergence of antibi-
otic-resistant strains of Enterobacteriaceae.
In the present study, the bacterial pathogens (Table 2) A. hydroph-
ila, A. veronii, P. fluorescens and P. aeruginosa that were isolated from
diseased fish at three sites exhibited varying infection rates. The
 |
2042
isolated bacteria were examined for virulence genes (Table 1). The
most prevalent bacteria were A. hydrophila (1.5 ± 0.5–16.5 ± 5.5 out
of 50 fish) and P. aeruginosa (3 ± 1.0–16 ± 1.0 out of 50 fish), regard-
less of the fish species. A. veronii was isolated only from the diseased
fish collected at site 3. In agreement with our findings, A. hydrophila,
A. caviae, A. sobria and A. veronii are the commonly reported patho-
gens in fish; these bacteria are Gram-negative motile rods and are
among the most frequently isolated bacterial pathogens causing
outbreaks of motile A. septicemia infections (acute and chronic) with
open dermal ulcers in countries with a warm climate (Angka, 1990;
Cai et al., 2012; Esteve et al., 1993). In addition, Sherif et al. (2015)
has reported that A. hydrophila, P. fluorescens and P. aeruginosa are
highly prevalent among diseased O. niloticus, with infection rates of
71.4% and 75%; 66.7% and 85.7%; and 25% and 57.1% respectively.
Moreover, those authors concluded that the infection and mortality
rates were associated with high levels of ammonia compounds.
The ARGs detected worldwide are prevalent in Gram-negative
bacteria isolated and identified from fish farms located in Japan,
Korea the United States (Furushita et al., 2003; Nonaka et al., 2007),
Australia (Akinbowale et al., 2007) and Denmark (Schmidt
et al., 2001), as well as from water samples from the Seine River
(Paris, France) (Cattoir et al., 2007). Furthermore, a positive cor-
relation between Gram-negative bacteria and tetA RGs has been
reported (Jang et al., 2018; Jun et al., 2004).
In the present study, the ARGs tetA, sulI, qnrS and ermB (Table 3)
were isolated from pathogenic bacteria which infected freshwater
fish. Many studies discuss the potential sources of antibiotics in the
aquatic environment; antibiotics have been identified in wastewa-
ter at the nanogram level because they were incompletely degraded
during raw sewage treatment (Janzon et al., 2012; Marti et al., 2013),
with effluents of wastewater treatment being one of the major
sources of the release of pharmaceuticals into the aquatic environ-
ment (Gros et al., 2012; Petrovic et al., 2003). Although the concen-
trations of antibiotics in these effluents have been reported to be
diluted upon reaching the water stream, these antibiotics could still
propagate bacterial resistance even at a concentration below the min-
imum inhibitory concentration (Kummerer, 2009; Martinez, 2008).
Also, aquatic sediments provide a reservoir for antibiotics in which
horizontal ARG transfer can occur (Taylor et al., 2011). The ARGs
sulI and qnrS have been reported to be highly abundant in bacteria
isolated from common carp reared in a polluted environment (Foix
reservoir and La Liosa del Cavall) (Marti et al., 2018).
Table 3 shows that tetA and sulI were present at all the sites,
regardless of the bacterial species, probably because of the wide-
spread use of these antibiotics in animal production. According to
the Ministry of Food and Drug Safety (2015) report in South Korea,
coastal aquaculture reportedly consumes approximately 4.8 tons/
year of tetracycline, which represents 2.4% of the whole aquacul-
ture sector that consumes 139 tons/year (i.e., approximately 69.3%
of the total sales of antibiotics). Tetracycline is used to treat fish
diseases on fish farms of the Mediterranean area, and worldwide,
26.3% of the isolated pathogens harbour at least one of the tetra-
cycline RGs (Rigos & Troisi, 2005). Moreover, the abundance of the
13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SHERIF et al.
tetracycline RGs was more than 50% of the total ARGs isolated from
infected bacteria in fish and ducks (Huang et al., 2017).
Shah et al. (2014) have reported the presence of an abun-
dance of sulI and sulII in the coastal aquaculture of Southern
Chile, whereas Rosser and Young (1999) have demonstrated that
sulphonamide is used more often in the treatment of human dis-
eases than in animal production. It has been reported that the rel-
ative abundance of sulphonamide RGs represented 56.14% of the
sulII and sulIII in fish tanks (He et al., 2017), and the widespread
presence of sulI in the aquatic environment may be related to the
fact that sulI is accompanied by integrons (Gao et al., 2012; Su
et al., 2012). Moreover, the increased levels of sulphonamide RGs
in the presence of streptomycin may be due to the fact that strA
and sulII share the same genetic elements (Hradecka et al., 2008). A
contradictory finding has been reported by Aydin et al. (2015) who
stated that the levels of sulphamethoxazole RGs were higher than
those of tetracycline RGs, in accordance with the concentration of
the antibiotics in wastewater.
In the present study, qnrS was recovered from A. hydrophila and
P. fluorescens isolated from fish at site 2, where the fish were treated
with antibiotics, and from all the bacterial species isolated at site 3,
with the exception of P. fluorescens. Accordingly, Cattoir et al. (2007)
have reported that quinolone RGs were isolated and identified from
Aeromonas spp. recovered from water samples collected from the
Seine River in Paris, France. Conversely, Jang et al. (2018) have re-
ported the presence of quinolone and florfenicol RGs (qnrD, qnrS,
aac (60)-Ib-cr and floR) in all the samples collected from the Jeju
Island. In addition, Robicsek et al. (2006) isolated and identified the
qnrS RGs—qnrA and qnrB—from Escherichia coli and Klebsiella pneu-
moniae in the United States. These results may be explained by the
fact that quinolone RGs are plasmid-mediated genes in bacteria iso-
lates from freshwater finfish in Egypt (Ishida et al., 2010).
In the present study, the ermC was isolated from A. hydrophila
and A. veronii present in O. niloticus and M. cephalus on the fish farms
at site 3. This may be attributed to the low erythromycin usage in
fish and animal production at these sites. The use of erythromycin
in the aquaculture sector is limited owing to its high cost (Di Cesare
et al., 2013; Pruden et al., 2013). Accordingly, a low abundance of
the ermC-encoding erythromycin-resistant methylase has been ob-
served in the Jeju Island (Jang et al., 2018). Conversely, Alexander
et al. (2015) have stated that erythromycin RGs have prevailed in the
aquatic environments, such as clinical, municipal and swine waste-
water; however, the fish farms included in this study were not lo-
cated near swine farms.
Table 3 shows that A. hydrophila, A. veronii, P. fluorescens and
P. aeruginosa exhibited more than one ARG. This could be explained
by the presence of multiple sources of antibiotics that had reached
the fish farms. Moreover, the findings of Ishida et al. (2010) stat-
ing that 33.2% of the tested bacterial isolates (including many fish
pathogens and zoonotic bacteria), which were isolated from fish
farms located in the north of Egypt, exhibited a multidrug-resis-
tant phenotype mainly against ampicillin, streptomycin, tetracy-
cline, cefpodoxime, cefoxitin, aztreonam, nalidixic acid, cefotaxime,

SHERIF et al.
chloramphenicol, trimethoprim/sulphamethoxazole and ciprofloxa-
cin were in agreement with our findings.
The measurement of the heavy metals residues in hepatic tissue
serves as an indicator of the pollution. We found that hepatic tissues
retained high levels of heavy metals at the different sites (Table 4) in
the order of site 1 ˂ site 2 ˂ site 3. Overall, the levels of Fe (1250 and
953.3 µg/g) and Zn (1078.3–820 µg/g) were significantly higher than
those of the other heavy metals, regardless of the site or fish spe-
cies. In addition, M. cephalus retained a higher level of heavy metals
than did O. niloticus. Heavy metal residues in fish tissues are com-
plex and dependent on the type and concentration of the metal and
the duration of the exposure as well as on the biological features
of the fish (tissue, sex, maturity and age) (Canli & Atli, 2003; Jarv
et al., 2013). The liver of fish is the main organ involved in the de-
toxification, accumulation, and excretion of toxins and heavy metals
(Abdel-Baki et al., 2011; Sherif & Soliman, 2012). These observa-
tions could be explained by the results of Jobling (1995) who stated
that hepatic tissue is the site of production of metallothionein,
which is a protein that is synthesized to detoxify heavy metals. The
hepatic tissues of cichlid fish reared near agricultural areas have a
tendency to accumulate Cu and Cd (Abdel-Baki et al., 2011; Jent
et al., 1998), whereas another fish species Perca fluviatiles (perch)
reportedly exhibited the highest levels of heavy metals (including
Cu and Zn) in the hepatic tissues of fish in the inland waters of Latvia
(Klavins et al., 2009).
Bacteria exposed to acute or chronic heavy metal pollution
has developed metal resistance genes and ARGs (Baker-Austin
et al., 2006; Dickinson et al., 2019). The presence of ARGs was pos-
itively associated with the residues of heavy metals (mainly Fe, Mn
and Zn) in the hepatic tissues of fish in the present study. Accordingly,
He et al. (2017) have reported that Zn or Cu increases the incidences
and abundance of ARGs for tetracycline and sulphonamide in the Zn
tank was reported to be 12.4% higher than that in the Cu tank and
22.5% higher than that in the tetracycline and sulphonamide tank.
In the present study, Hg was not associated with infection rates or
ARGs, which may be attributed to its low levels in hepatic tissues.
ARGs could develop in P. aeruginosa and Escherichia coli under the
stress of heavy metals (Zn, Cd, Cu and Pb) contamination in environ-
mental reservoirs (Nguyen et al., 2019). Heavy metal contamination
could have resulted in oxidative stress and irreversible damage to
the DNA of bacteria (Peltier et al., 2010; Seiler & Berendonk, 2012;
Sinegani & Younessi, 2017).
The hepatic tissues of the examined fish in site 3 (Figure 1b–d)
showed blood vessel congestion, inflammatory cell infiltration,
vacuolar degeneration and hepatocyte necrosis. The severity of
the histopathological lesions was associated with both the heavy
metal levels and the bacterial infection. Similarly, the exposure to
chemical toxins and/or heavy metals has been reported to signifi-
cantly alter the normal architecture of the liver, with signs of vac-
uolar and necrotic degeneration accompanied with inflammatory
cell infiltrations (Montaser et al., 2010; Myers et al., 1998). The he-
patic tissues of Clarias gariepinus grown in areas of mines showed
severe changes in fat content changes, with loss of the sinusoid
|
13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2043
space (Syakalima et al., 2001); the changes in fat content may be
due to the high dietary lipid intake in fish or the interference of
heavy metals with the metabolic process of lipids (Barlas, 1999;
Handy et al., 1999).
The liver is the main target organ during bacterial infection, and
many authors have recorded severe lesions such as haemorrhage
and vacuolar and necrotic degeneration in blue tilapia (AlYahya
et al., 2018) and Cyprinus carpio (Stratev et al., 2015) following A. hy-
drophila infection. The extracellular products of A. hydrophila, such
as haemolysin, protease and elastase, cause severe damage in hepa-
topancreatic tissues (Afifi et al., 2000; Kumar et al., 2016). A. veronii
infection results in distinct alterations in hepatic tissues, such as
vacuolar degeneration, necrosis, and hepatocyte and melanophore
aggregation in O. niloticus (Hassan et al., 2017) and largemouth bass,
Micropterus salmoides (Huizinga et al., 1979), and the severity of the
lesions has been associated with virulence factors. Although the he-
patic tissues of healthy C. gariepinus have shown different sizes of
cytoplasmic vacuoles, P. aeruginosa infection causes marked vacu-
olar degeneration; thus, the damage to the liver observed may be
due to the fact that it is the main detoxifying site of bacterial tox-
ins (Amrevuawho et al., 2014). In addition, the extracellular prod-
ucts of P. fluorescens reportedly lead to degenerative changes and
severe haemorrhage in the hepatic tissues of O. niloticus (Mahmoud
et al., 2014; Miyazaki et al., 1984).
In future work, the prevalence of ARGs in the bacteria of intes-
tinal microbiota and the aquatic environment should be considered
along with the pathogenic bacteria.
We concluded that A. hydrophila, A. veronii, P. fluorescens and
P. aeruginosa were the most prevalent bacteria in O. niloticus and
M. cephalus. The ARGs for tetracycline and sulphonamide were pre-
dominantly isolated from virulent bacteria. The abundance of ARGs
was associated with the level of the heavy metal residues mostly
Fe, Mn and Zn in the hepatic tissue. Naturally infected fish which
exposed to heavy metals had histopathological alterations in their
hepatic tissues.
AC K N OW L E D G E M E N T S
The authors wish to acknowledge the support of Animal Health
Research Institute, Agriculture Research Center, Egypt where the
laboratory investigations were carried out.
C O N FL I C T O F I N T E R E S T
The authors declare that they have no conflict of interest.
E T H I C A L A P P R OVA L
All applicable international, national and/or institutional guidelines
for the care and use of animals were followed by the authors.
DATA AVA I L A B I L I T Y S TAT E M E N T
Data are available on request from the authors.
ORCID
Ahmed H. Sherif https://orcid.org/0000-0002-7739-0129
 |

13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2044 SHERIF et al.

REFERENCES Blair, J. M., Webber, M. A., Baylay, A. J., Ogbolu, D. O., & Piddock, L.
J. (2015). Molecular mechanisms of antibiotic resistance. Nature
Abdel-Baki, A. S., Dkhil, M. A., & Al-Quraishy, S. I. (2011). Bioaccumulation
Reviews Microbiology, 13(1), 42–51. https://doi.org/10.1038/nrmic​
of some heavy metals in tilapia fish relevant to their concentration in
ro3380
water and sediment of Wadi Hanifah, Saudi Arabia. African Journal
Boijink, C. D. L., Brandão, D. A., Vargas, A. C. D., Costa, M. M. D., &
of Biotechnology., 10(13), 2541–2547. https://doi.org/10.5897/
Renosto, A. V. (2001). Inoculação de suspensão bacteriana de
AJB10.1772
Plesiomonas shigelloides em jundiá, Rhamdia quelen (teleostei:
Afifi, S. H., Al-Thobiati, S., & Hazaa, M. S. (2000). Bacteriological and
Pimelodidae). Ciência Rural, 31(3), 497–501. https://doi.org/10.1590/
histopathological studies on Aeromonas hydrophila infection of Nile
S0103​-84782​0 0100​0300023
tilapia (Oreochromis niloticus) from fish farms in Saudi Arabia. Assiut
Boyd, C. E. (1998). Water quality for pond aquaculture. Research and
Veterinary Medicine Journal, 42, 195–205.
Development Series No. 43. International Center for Aquaculture and
Akinbowale, O. L., Peng, H., & Barton, M. D. (2007). Diversity of tet-
Aquatic Environments, Alabama Agricultural Experiment Station,
racycline resistance genes in bacteria from aquaculture sources in
Auburn University, Alabama.
Australia. Journal of Applied Microbiology, 103(5), 2016–2025. https://
Buller, N. B. (2004). Bacteria from fish and other aquatic animals: A practical
doi.org/10.1111/j.1365-2672.2007.03445.x
identification manual. CABI Publishing.
Alexander, J., Bollmann, A., Seitz, W., & Schwartz, T. (2015).
Cai, S. H., Wu, Z. H., Jian, J. C., Lu, Y. S., & Tang, J. F. (2012). Characterization
Microbiological characterization of aquatic microbiomes targeting
of pathogenic Aeromonas veronii bv. veronii associated with ulcerative
taxonomical marker genes and antibiotic resistance genes of op-
syndrome from Chinese longsnout catfish (Leiocassis longirostris
portunistic bacteria. Science of the Total Environment, 512, 316–325.
Günther). Brazilian Journal of Microbiology, 43(1), 382–388. https://
https://doi.org/10.1016/j.scito​tenv.2015.01.046
doi.org/10.1590/S1517​-83822​01200​01000046
AlYahya, S. A., Ameen, F., Al-Niaeem, K. S., Al-Sa'adi, B. A., Hadi, S., &
Canli, M., & Atli, G. (2003). The relationships between heavy metal (Cd,
Mostafa, A. A. (2018). Histopathological studies of experimental
Cr, Cu, Fe, Pb, Zn) levels and the size of six Mediterranean fish species.
Aeromonas hydrophila infection in blue tilapia, Oreochromis aureus.
Environmental Pollution, 121(1), 129–136. https://doi.org/10.1016/
Saudi Journal of Biological Sciences, 25(1), 182–185. https://doi.
S0269​-7491(02)00194​-X
org/10.1016/j.sjbs.2017.10.019
Cattoir, V., Poirel, L., Mazel, D., Soussy, C. J., & Nordmann, P. (2007). Vibrio
Amine, A. E. K. (2013). Extended spectrum beta-lactamase producing
splendidus as the source of plasmid-mediated QnrS-like quinolone re-
bacteria in waste water alexandria, Egypt. International Journal of
sistance determinants. Antimicrobial Agents and Chemotherapy, 51(7),
Bioscience, Biochemistry and Bioinformatics, 3(6), 605–608. https://
2650–2651. https://doi.org/10.1128/AAC.00070​- 07
doi.org/10.7763/IJBBB.2013.V3.285
Deng, Y. T., Wu, Y. L., Tan, A. P., Huang, Y. P., Jiang, L., Xue, H. J., Wang,
Amrevuawho, O. M., Akinyemi, A. A., Ezeri, O. G. N., Bankole, O. M., &
W. L., Luo, L., & Zhao, F. (2014). Analysis of antimicrobial resistance
Takeet, O. V. (2014). Pathological study of Clarias gariepinus (Burchell,
genes in Aeromonas spp. isolated from cultured freshwater animals
1822) sub-adult artificially infected with Pseudomonas aeruginosa.
in China. Microbial Drug Resistance, 20(4), 350–356. https://doi.
Brazilian Journal of Aquatic Science and Technology, 18(2), 65–69.
org/10.1089/mdr.2013.0068
https://doi.org/10.14210​/bjast.v18n2.p65-69
Di Cesare, A., Eckert, E. M., D'Urso, S., Bertoni, R., Gillan, D. C., Wattiez,
Angka, S. L. (1990). The pathology of the walking catfish, Clarias batra-
R., & Corno, G. (2016). Co-occurrence of integrase 1, antibiotic and
chus (L.), infected intraperitoneally with Aeromonas hydrophila. Asian
heavy metal resistance genes in municipal wastewater treatment
Fisheries Science, 3, 343–351.
plants. Water Research, 94, 208–214. https://doi.org/10.1016/j.
AOAC (1990). Association of official agriculture chemists official methods of
watres.2016.02.049
analysis (15th ed., Vol. 1(1), pp. 41–44). A.O.A.C. Benjamin Franklin
Di Cesare, A., Luna, G. M., Vignaroli, C., Pasquaroli, S., Tota, S., Paroncini,
Station.
P., & Biavasco, F. (2013). Aquaculture can promote the presence and
APHA (2000). American Public Health Association standard method for
spread of antibiotic-resistant Enterococci in marine sediments. PLoS
the examination of water and waste water (18th ed.). Washington,
One, 8(4), e62838. https://doi.org/10.1371/journ​al.pone.0062838
DC: American Water Works Association & Water Environment
Dickinson, A. W., Power, A., Hansen, M. G., Brandt, K. K., Piliposian,
Federation.
G., Appleby, P., O'Neill, P. A., Jones, R. T., Sierocinski, P., Koskella,
Austin, B., & Austin, D. A. (2012). Bacterial fish pathogens: Disease of
B., & Vos, M. (2019). Heavy metal pollution and co-selection
farmed and wild fish (3rd ed., pp. 112–115). Springer.
for antibiotic resistance: A microbial palaeontology approach.
AVMA (2007). AVMA guidelines on euthanasia. Journal of the American
Environment International, 132, 105117. https://doi.org/10.1016/j.
Veterinary Medical Association, 218, 675–685.
envint.2019.105117
Aydin, S., Ince, B., & Ince, O. (2015). Development of antibiotic resis-
Eissa, N. M. E., Abou El-Ghiet, E. N., Shaheen, A. A., & Abbass, A.
tance genes in microbial communities during long-term operation
(2010). Characterization of Pseudomonas species isolated from ti-
of anaerobic reactors in the treatment of pharmaceutical waste-
lapia “Oreochromis niloticus” in Qaroun and Wadi-El-Rayan lakes,
water. Water Research, 83, 337–344. https://doi.org/10.1016/j.
Egypt. Global Veterinaria, 5(2), 116–121. https://doi.org/10.13140​
watres.2015.07.007
/2.1.5002.4961
Baker-Austin, C., Wright, M. S., Stepanauskas, R., & McArthur, J. V. (2006).
Esteve, C., Biosca, E. G., & Amaro, C. (1993). Virulence of Aeromonas hydroph-
Co-selection of antibiotic and metal resistance. Trends in Microbiology,
ila and some other bacteria isolated from European eels Anguilla anguilla
14(4), 176–182. https://doi.org/10.1016/j.tim.2006.02.006
reared in fresh water. Diseases of Aquatic Organisms, 16(1), 15–20.
Baquero, F., Martinez, J. L., & Canton, R. (2008). Antibiotics and antibiotic
Ezzat, S. M., Mahdy, H. M., Abd El Shakour, E. H., & El-Bahnasawy, M.
resistance in water environments. Current Opinion in Biotechnology,
A. (2012). Water quality assessment of river Nile at Rosetta branch:
19(3), 260–265. https://doi.org/10.1016/j.copbio.2008.05.006
Impact of drains discharge. Middle-East Journal of Scientific Research,
Barlas, N. (1999). Histopathological examination of gill, liver and kidney
12(4), 413–423.
tissues of carp (Cyprinus carpio L., 1758) fish in the upper Sakarya
FAO (2003–2020). National aquaculture sector overview. In A. M. Salem,
River Basin. Turkish Journal of Veterinary and Animal Sciences, 23(EK2),
& M. A. Saleh (Eds.), Egypt. National aquaculture sector overview fact
277–284.
sheets. FAO Fisheries and Aquaculture Department [online]. Rome:
Bhatnagar, A., & Devi, P. (2013). Water quality guidelines for the man-
FAO. Updated 16 November 2010. Retrieved from http://www.fao.
agement of pond fish culture. International Journal of Environmental
org/fishe​r y/count​r ysec​tor/naso_egypt​/en
Sciences, 3(6), 1980–2009.

SHERIF et al.
FAO (2012). Cultured aquatic species information programme. In J. E.
Rakocy (Ed.), Oreochromis niloticus. Cultured aquatic species informa-
tion programme. FAO Fisheries and Aquaculture Department, Rome.
Fishman, M. J., & Friedman, L. C. (1989). Methods for determination of inor-
ganic substances in water and fluvial sediments. US Department of the
Interior, Geological Survey.
Furtula, V., Farrell, E. G., Diarrassouba, F., Rempel, H., Pritchard, J., &
Diarra, M. S. (2010). Veterinary pharmaceuticals and antibiotic re-
sistance of Escherichia coli isolates in poultry litter from commercial
farms and controlled feeding trials. Poultry Science, 89(1), 180–188.
https://doi.org/10.3382/ps.2009-00198
Furushita, M., Shiba, T., Maeda, T., Yahata, M., Kaneoka, A., Takahashi,
Y., Torii, K., Hasegawa, T., & Ohta, M. (2003). Similarity of tetracy-
cline resistance genes isolated from fish farm bacteria to those from
clinical isolates. Applied and Environmental Microbiology, 69(9), 5336–
5342. https://doi.org/10.1128/AEM.69.9.5336-5342.2003
Gao, P., Mao, D., Luo, Y., Wang, L., Xu, B., & Xu, L. (2012). Occurrence of
sulfonamide and tetracycline-resistant bacteria and resistance genes
in aquaculture environment. Water Research, 46(7), 2355–2364.
https://doi.org/10.1016/j.watres.2012.02.004
Ghadaksaz, A., Fooladi, A. A. I., Hosseini, H. M., & Amin, M. (2015). The
prevalence of some Pseudomonas virulence genes related to biofilm
formation and alginate production among clinical isolates. Journal
of Applied Biomedicine, 13(1), 61–68. https://doi.org/10.1016/j.
jab.2014.05.002
Gordon, L., Giraud, E., Ganiẽre, G. P., Armand, F., Bouju-Albert, A., de
la Cotte, N., Mangion, C., & Le Bri, H. (2007). Antimicrobial resis-
tance survey in a river receiving effluents from freshwater fish
farms. Journal of Applied Microbiology, 102(4), 1167–1176. https://doi.
org/10.1111/j.1365-2672.2006.03138.x
Gros, M., Rodríguez-Mozaz, S., & Barceló, D. (2012). Fast and compre-
hensive multi-residue analysis of a broad range of human and vet-
erinary pharmaceuticals and some of their metabolites in surface
and treated waters by ultra-high-performance liquid chromatog-
raphy coupled to quadrupole-linear ion trap tandem mass spec-
trometry. Journal of Chromatography A, 1248, 104–121. https://doi.
org/10.1016/j.chroma.2012.05.084
Hamza, D., Dorgham, S., Ismael, E., Abd El-Moez, S. I., Elhariri, M.,
Elhelw, R., & Hamza, E. (2020). Emergence of β-lactamase-and car-
bapenemase-producing Enterobacteriaceae at integrated fish farms.
Antimicrobial Resistance & Infection Control, 9(1), 1–12. https://doi.
org/10.1186/s1375​6-020-00736​-3
Handy, R. D., Sims, D. W., Giles, A., Campbell, H. A., & Musonda, M. M.
(1999). Metabolic trade-off between locomotion and detoxification
for maintenance of blood chemistry and growth parameters by rain-
bow trout (Oncorhynchus mykiss) during chronic dietary exposure to
copper. Aquatic Toxicology, 47(1), 23–41. https://doi.org/10.1016/
S0166​- 445X(99)00004​-1
Hassan, M. A., Noureldin, E. A., Mahmoud, M. A., & Fita, N. A. (2017).
Molecular identification and epizootiology of Aeromonas veronii in-
fection among farmed Oreochromis niloticus in Eastern Province, KSA.
The Egyptian Journal of Aquatic Research, 43(2), 161–167. https://doi.
org/10.1016/j.ejar.2017.06.001
He, X., Xu, Y., Chen, J., Ling, J., Li, Y., Huang, L., Zhou, X., Zheng, L., &Xie,
G. (2017). Evolution of corresponding resistance genes in the water
of fish tanks with multiple stresses of antibiotics and heavy metals.
Water Research, 124, 39–48.
Hradecka, H., Karasova, D., & Rychlik, I. (2008). Characterization of
Salmonella enterica serovar Typhimurium conjugative plasmids trans-
ferring resistance to antibiotics and their interaction with the viru-
lence plasmid. Journal of Antimicrobial Chemotherapy, 62(5), 938–941.
https://doi.org/10.1093/jac/dkn286
Huang, L., Xu, Y. B., Xu, J. X., Ling, J. Y., Chen, J. L., Zhou, J. L., Zheng,
L., & Du, Q. P. (2017). Antibiotic resistance genes (ARGs) in duck
and fish production ponds with integrated or non-integrated mode.
|
13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2045
Chemosphere, 168, 1107–1114. https://doi.org/10.1016/j.chemo​
sphere.2016.10.096
Huerta, B., Marti, E., Gros, M., Lopez, P., Pompeo, M., Armengol, J.,
Barcelo, D., Balcazar, J. L., Rodriguez-Mozaz, S., & Marce, R. (2013).
Exploring the links between antibiotic occurrence, antibiotic resis-
tance, and bacterial communities in water supply reservoirs. Science
of the Total Environment, 456, 161–170. https://doi.org/10.1016/j.
scito​tenv.2013.03.071
Huizinga, H. W., Esch, G. W., & Hazen, T. C. (1979). Histopathology
of red-sore disease (Aeromonas hydrophila) in naturally and ex-
perimentally infected largemouth bass Micropterus salmoides
(Lacepede). Journal of Fish Diseases, 2(4), 263–277. https://doi.
org/10.1111/j.1365-2761.1979.tb001​69.x
Ishida, Y., Ahmed, A. M., Mahfouz, N. B., Kimura, T., El-Khodery, S. A.,
Moawad, A. A., & Shimamoto, T. (2010). Molecular analysis of an-
timicrobial resistance in Gram-negative bacteria isolated from fish
farms in Egypt. Journal of Veterinary Medical Science, 72(6), 727–734.
https://doi.org/10.1292/jvms.09-0538
Jang, H. M., Kim, Y. B., Choi, S., Lee, Y., Shin, S. G., Unno, T., & Kim, Y.
M. (2018). Prevalence of antibiotic resistance genes from effluent
of coastal aquaculture, South Korea. Environmental Pollution, 233,
1049–1057. https://doi.org/10.1016/j.envpol.2017.10.006
Janzon, A., Kristiansson, E., & Larsson, D. J. (2012). Environmental micro-
bial communities living under very high antibiotic selection pressure.
In P. L. Keen, & M. Montforts (Eds.), Antimicrobial resistance in the
environment (pp. 483–501). Wiley-Blackwell.
Jarv, L., Kotta, J., & Simm, M. (2013). Relationship between biological
characteristics of fish and their contamination with trace metals: A
case study of perch Perca fluviatilis L. in the Baltic Sea. Proceedings of
the Estonian Academy of Sciences, 62(3), 193–201.
Jent, S., Heing, J. S., & Tate, C. M. (1998). Concentration distribution and
composition of selected trace elements in bed sediment and fish tissue in
the South Platte River Basin, USA, 1992–1993. National water-quality
Assessment (NAWQA) program report.
Jobling, M. (1995). Environmental biology of fishes (1st ed.). Chapman and
Hall.
Jun, L. J., Jeong, J. B., Huh, M. D., Chung, J. K., Choi, D. L., Lee, C. H., & Do
Jeong, H. (2004). Detection of tetracycline-resistance determinants
by multiplex polymerase chain reaction in Edwardsiella tarda isolated
from fish farms in Korea. Aquaculture, 240(1–4), 89–100. https://doi.
org/10.1016/j.aquac​ulture.2004.07.025
Kerrn, M. B., Klemmensen, T., Frimodt-Moller, N., & Espersen, F. (2002).
Susceptibility of Danish Escherichia coli strains isolated from uri-
nary tract infections and bacteraemia, and distribution of sul
genes conferring sulphonamide resistance. Journal of Antimicrobial
Chemotherapy, 50(4), 513–516. https://doi.org/10.1093/jac/
dkf164
Khan, S. J., Roser, D. J., Davies, C. M., Peters, G. M., Stuetz, R. M., Tucker,
R., & Ashbolt, N. J. (2008). Chemical contaminants in feedlot wastes:
Concentrations, effects and attenuation. Environment International,
34(6), 839–859. https://doi.org/10.1016/j.envint.2007.10.007
Klavins, M., Potapovics, O., & Rodinov, V. (2009). Heavy metals in fish
from lakes in Latvia: Concentrations and trends of changes. Bulletin
of Environmental Contamination and Toxicology, 82(1), 96–100. https://
doi.org/10.1007/s0012​8-008-9510-x
Kristiansson, E., Fick, J., Janzon, A., Grabic, R., Rutgersson, C., Weijdegard,
B., Soderstrom, H., & Larsson, D. J. (2011). Pyrosequencing of anti-
biotic-contaminated river sediments reveals high levels of resistance
and gene transfer elements. PLoS One, 6(2), 17038.
Kumar, K., Gupta, S. C., Chander, Y., & Singh, A. K. (2005). Antibiotic
use in agriculture and its impact on the terrestrial environment.
Advances in Agronomy, 87, 1–54. https://doi.org/10.1016/S0065​
-2113(05)87001​- 4
Kumar, R., Pande, V., Singh, L., Sharma, L., & Saxena, N. (2016).
Pathological findings of experimental Aeromonas hydrophila infection
 |
2046
in golden mahseer (Tor putitora). Fisheries & Aquaculture Journal, 7,
160.
Kummerer, K. (2009). Antibiotics in the aquatic environment–A review–
Part I. Chemosphere, 75(4), 417–434. https://doi.org/10.1016/j.
chemo​sphere.2008.11.086
Lloyd, R. (1992). Pollution and freshwater fish (p. 192). Fishing News Books.
Luo, Y., Mao, D., Rysz, M., Zhou, Q., Zhang, H., Xu, L., & J. J. Alvarez, P.
(2010). Trends in antibiotic resistance genes occurrence in the Haihe
River, China. Environmental Science & Technology, 44(19), 7220–7225.
https://doi.org/10.1021/es100​233w
Machado, S. G., Bazzolli, D. M. S., & Vanetti, M. C. D. (2013). Development
of a PCR method for detecting proteolytic psychrotrophic bacte-
ria in raw milk. International Dairy Journal, 29(1), 8–14. https://doi.
org/10.1016/j.idair ​yj.2012.09.007
Mahmoud, M. M., El-Lamie, M. M., Dessouki, A. A., & Yusuf, M. S. (2014).
Effect of turmeric (Curcuma longa) supplementation on growth per-
formance, feed utilization, and resistance of Nile tilapia (Oreochromis
niloticus) to Pseudomonas fluorescens challenge. Global Research
Journal of Fishery Science and Aquaculture, 1(12), 26–33.
Malhotra-Kumar, S., Lammens, C., Piessens, J., & Goossens, H. (2005).
Multiplex PCR for simultaneous detection of macrolide and tetra-
cycline resistance determinants in Streptococci. Antimicrobial Agents
and Chemotherapy, 49(11), 4798–4800. https://doi.org/10.1128/
AAC.49.11.4798-4800.2005
Marti, E., Huerta, B., Rodriguez-Mozaz, S., Barcelo, D., Marce, R., &
Balcazar, J. L. (2018). Abundance of antibiotic resistance genes
and bacterial community composition in wild freshwater fish spe-
cies. Chemosphere, 196, 115–119. https://doi.org/10.1016/j.chemo​
sphere.2017.12.108
Marti, E., Jofre, J., & Balcazar, J. L. (2013). Prevalence of antibiotic re-
sistance genes and bacterial community composition in a river in-
fluenced by a wastewater treatment plant. PLoS One, 8(10), e78906.
https://doi.org/10.1371/journ​al.pone.0078906
Martinez, J. L. (2008). Antibiotics and antibiotic resistance genes in nat-
ural environments. Science, 321(5887), 365–367.
Matar, G. M., Ramlawi, F., Hijazi, N., Khneisser, I., & Abdelnoor, A. M.
(2002). Transcription levels of pseudomonas aeruginosa exotoxin
A gene and severity of symptoms in patients with otitis externa.
Current Microbiology, 45(5), 350–354. https://doi.org/10.1007/s0028​
4-002-3703-z
Mendez, B., Tachibana, C., & Levy, S. B. (1980). Heterogeneity of tet-
racycline resistance determinants. Plasmid, 3(2), 99–108. https://doi.
org/10.1016/0147-619X(80)90101​-8
Ministry of Food & Drug Safety (2015). Monitoring and characterization
of antimicrobial resistance of bacteria from livestock products (pp. 212–
213). Korea: Ministry of Food and Drug Safety Cheongju.
Miyazaki, T., Kubota, S. S., & Miyashita, T. (1984). A histopathological
study of Pseudomonas fluorescens infection in tilapia. Fish Pathology,
19(3), 161–166. https://doi.org/10.3147/jsfp.19.161
Montaser, M., Mahfouz, M. E., El-Shazly, S. A., Abdel-Rahman, G. H., &
Bakry, S. (2010). Toxicity of heavy metals on fish at Jeddah coast
KSA: Metallothionein expression as a biomarker and histopatholog-
ical study on liver and gills. World Journal of Fish and Marine Sciences,
2(3), 174–185.
Muratori, M. C. S. (2001). Edwardsiella septicemia mortality in tilapia
integrated with pig in fish farming. Arquivo Brasileiro de Medicina
Veterinaria Zootecnia, 53(6), 658–662.
Muziasari, W. I., Pitkanen, L. K., Sorum, H., Stedtfeld, R. D., Tiedje, J. M.,
& Virta, M. (2017). The resistome of farmed fish feces contributes
to the enrichment of antibiotic resistance genes in sediments below
Baltic Sea fish farms. Frontiers in Microbiology, 7, 2137.
Myers, M. S., Johnson, L. L., Olson, O. P., Stehr, C. M., Horness, B. H.,
Collier, T. K., & McCain, B. B. (1998). Toxicopathic hepatic lesions as
biomarkers of chemical contaminant exposure and effects in marine
bottomfish species from the Northeast and Pacific Coasts, USA.
13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
SHERIF et al.
Marine Pollution Bulletin, 37(1–2), 92–113. https://doi.org/10.1016/
S0025​-326X(98)00135​- 0
Naik, O. A., Shashidhar, R., Rath, D., Bandekar, J. R., & Rath, A. (2018).
Characterization of multiple antibiotic resistance of culturable mi-
croorganisms and metagenomic analysis of total microbial diversity
of marine fish sold in retail shops in Mumbai, India. Environmental
Science and Pollution Research, 25(7), 6228–6239. https://doi.
org/10.1007/s1135​6-017-0945-7
Nawaz, M., Khan, S. A., Khan, A. A., Sung, K., Tran, Q., Kerdahi, K.,
& Steele, R. (2010). Detection and characterization of virulence
genes and integrons in Aeromonas veronii isolated from catfish.
Food Microbiology, 27(3), 327–331. https://doi.org/10.1016/j.
fm.2009.11.007
Nguyen, C. C., Hugie, C. N., Kile, M. L., & Navab-Daneshmand, T.
(2019). Association between heavy metals and antibiotic-resistant
human pathogens in environmental reservoirs: A review. Frontiers
of Environmental Science & Engineering, 13(3), 46. https://doi.
org/10.1007/s1178​3-019-1129-0
Nonaka, L., Ikeno, K., & Suzuki, S. (2007). Distribution of tetracycline re-
sistance gene, tet (M), in gram-positive and gram-negative bacteria
isolated from sediment and seawater at a coastal aquaculture site
in japan. Microbes and Environments, 22(4), 355–364. https://doi.
org/10.1264/jsme2.22.355
Peltier, E., Vincent, J., Finn, C., & Graham, D. W. (2010). Zinc-induced
antibiotic resistance in activated sludge bioreactors. Water Research,
44(13), 3829–3836. https://doi.org/10.1016/j.watres.2010.04.041
Persson, S., Al-Shuweli, S., Yapici, S., Jensen, J. N., & Olsen, K. E. (2015).
Identification of clinical aeromonas species by rpoB and gyrB se-
quencing and development of a multiplex PCR method for detection
of Aeromonas hydrophila, A. caviae, A. veronii, and A. media. Journal of
Clinical Microbiology, 53(2), 653–656.
Petrovic, M., Gonzalez, S., & Barcelo, D. (2003). Analysis and removal
of emerging contaminants in wastewater and drinking water.
TrAC Trends in Analytical Chemistry, 22(10), 685–696. https://doi.
org/10.1016/S0165​-9936(03)01105​-1
Pham, T. T. H., Rossi, P., Dinh, H. D. K., Pham, N. T. A., Tran, P. A., Ho,
T. T. K. M., Dinh, Q. T., &De Alencastro, L. F. (2018). Analysis of
antibiotic multi-resistant bacteria and resistance genes in the ef-
fluent of an intensive shrimp farm (Long An, Vietnam). Journal of
Environmental Management, 214, 149–156. https://doi.org/10.1016/j.
jenvm​an.2018.02.089
Pillay, T. V. R., & Kutty, M. N. (2005). Aquaculture, principles and practices
(p. 630). Blackwell Publishing.
Pruden, A., Larsson, D. G. J., Amézquita, A., Collignon, P., Brandt, K. K.,
Graham, D. W., Lazorchak, J. M., Suzuki, S., Silley, P., Snape, J. R.,
Topp, E., Zhang, T., & Zhu, Y.-G. (2013). Management options for
reducing the release of antibiotics and antibiotic resistance genes
to the environment. Environmental Health Perspectives, 121(8), 878–
885. https://doi.org/10.1289/ehp.1206446
Rigos, G., & Troisi, G. M. (2005). Antibacterial agents in Mediterranean
finfish farming: A synopsis of drug pharmacokinetics in important
euryhaline fish species and possible environmental implications.
Reviews in Fish Biology and Fisheries, 15(1–2), 53–73. https://doi.
org/10.1007/s1116​0 -005-7850-8
Roberts, R. J. (2012). Fish pathology (4th ed.). W.B. Saunders, An imprint
of Harcourt Publishers.
Robicsek, A., Strahilevitz, J., Sahm, D. F., Jacoby, G. A., & Hooper, D. C.
(2006). qnr prevalence in ceftazidime-resistant Enterobacteriaceae
isolates from the United States. Antimicrobial Agents and
Chemotherapy, 50(8), 2872–2874. https://doi.org/10.1128/
AAC.01647​- 05
Rooklidge, S. J. (2004). Environmental antimicrobial contamination from
terraccumulation and diffuse pollution pathways. Science of the
Total Environment, 325(1–3), 1–13. https://doi.org/10.1016/j.scito​
tenv.2003.11.007

SHERIF et al.
Rosser, S. J., & Young, H. K. (1999). Identification and characterization of
class 1 integrons in bacteria from an aquatic environment. Journal of
Antimicrobial Chemotherapy, 44(1), 11–18. https://doi.org/10.1093/
jac/44.1.11
Saqr, S., Khaliel, R., & Ibrahim, M. S. (2016). Antibiotic resistance and vir-
ulence genes of E. coli isolated from fresh Nile tilapia (Oreochromis
niloticus) in El-Behera Governorate, Egypt. Alexandria Journal
for Veterinary Sciences, 48(2), 83–90. https://doi.org/10.5455/
ajvs.205169
Schaperclaus, W., Kulow, H.,& Schrecken-Bach, K. (1992). Fish diseases.
A.A. Balkema.
Schmidt, A. S., Bruun, M. S., Dalsgaard, I., & Larsen, J. L. (2001). Incidence,
distribution, and spread of tetracycline resistance determinants and
integron-associated antibiotic resistance genes among motile aero-
monads from a fish farming environment. Applied and Environment
Microbiology, 67(12), 5675–5682. https://doi.org/10.1128/
AEM.67.12.5675-5682.2001
Seiler, C., & Berendonk, T. U. (2012). Heavy metal driven co-selection
of antibiotic resistance in soil and water bodies impacted by agri-
culture and aquaculture. Frontiers in Microbiology, 3, 399. https://doi.
org/10.3389/fmicb.2012.00399
Shah, S. Q., Cabello, F. C., L'Abee-Lund, T. M., Tomova, A., Godfrey, H. P.,
Buschmann, A. H., & Sorum, H. (2014). Antimicrobial resistance and
antimicrobial resistance genes in marine bacteria from salmon aqua-
culture and non-aquaculture sites. Environmental Microbiology, 16(5),
1310–1320. https://doi.org/10.1111/1462-2920.12421
Shah, S. Q., Colquhoun, D. J., Nikuli, H. L., & Sorum, H. (2012). Prevalence
of antibiotic resistance genes in the bacterial flora of integrated
fish farming environments of Pakistan and Tanzania. Environmental
Science & Technology, 46(16), 8672–8679. https://doi.org/10.1021/
es301​8607
Sherif, A. H., Al-Sokary, E. T., Rizk, W. F., & Mahfouz, M. E. (2020). Immune
status of Oreochromis niloticus subjected to long-term lead nitrate
exposure and a Arthrospira platensis treatment trial. Environmental
Toxicology and Pharmacology, 76, 103352. https://doi.org/10.1016/j.
etap.2020.103352
Sherif, A. H., Elgamel, A. M., & Amin, H. A. (2015). Investigation of mass
mortality of some fresh water fish in late summer in some fish farms
at Kafr El Sheikh Governorate. Journal of the Arabian Aquaculture
Society, 374(3356), 1–12. https://doi.org/10.12816​/0026660
Sherif, A. H., & Soliman, H. A. (2012). A study on some heavy metals con-
centrations in some fresh water fishes in fish farms and Borullus Lake
in Kafr El- Sheikh Governorate, Egypt. Journal of Basic and Applied
Physiology, 11(1), 43–55.
Sinegani, A. A. S., & Younessi, N. (2017). Antibiotic resistance of bacte-
ria isolated from heavy metal-polluted soils with different land uses.
Journal of Global Antimicrobial Resistance, 10, 247–255. https://doi.
org/10.1016/j.jgar.2017.05.012
Song, W., Huang, M., Rumbeiha, W., & Li, H. (2007). Determination of am-
prolium, carbadox, monensin, and tylosin in surface water by liquid
chromatography/tandem mass spectrometry. Rapid Communications
|
13652109, 2021, 5, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/are.15052 by South African Medical Research, Wiley Online Library on [03/02/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2047
in Mass Spectrometry, 21(12), 1944–1950. https://doi.org/10.1002/
rcm.3042
Spilker, T., Coenye, T., Vandamme, P., & LiPuma, J. J. (2004). PCR-based
assay for differentiation of Pseudomonas aeruginosa from other
Pseudomonas species recovered from cystic fibrosis patients. Journal
of Clinical Microbiology, 42(5), 2074–2079. https://doi.org/10.1128/
JCM.42.5.2074-2079.2004
SPSS (2004). Statistical and package for social science, SPSS for windows
release 14.0.0, 19 June, 2004. Standard version, copyright SPSS,
1989–2004.
Storteboom, H., Arabi, M., Davis, J. G., Crimi, B., & Pruden, A. (2010).
Tracking antibiotic resistance genes in the South Platte River basin
using molecular signatures of urban, agricultural, and pristine
sources. Environmental Science & Technology, 44(19), 7397–7404.
https://doi.org/10.1021/es101​657s
Stratev, D., Stoev, S., Vashin, I., & Daskalov, H. (2015). Some varieties
of pathological changes in experimental infection of carps (Cyprinus
carpio) with Aeromonas hydrophila. Journal of Aquaculture Engineering
and Fisheries Research, 1(4), 191–202. https://doi.org/10.3153/JAEFR​
15019
Su, H. C., Ying, G. G., Tao, R., Zhang, R. Q., Zhao, J. L., & Liu, Y. S. (2012).
Class 1 and 2 integrons, sul resistance genes and antibiotic resis-
tance in Escherichia coli isolated from Dongjiang River, South China.
Environmental Pollution, 169, 42–49. https://doi.org/10.1016/j.
envpol.2012.05.007
Swann, L. D. (1997). A fish farmer's guide to understanding water quality,
Aquaculture Extension Illinois, Purdue University, Indiana Sea Grant
Program Fact Sheet AS-503.
Syakalima, M., Choongo, K., Nakazato, Y., Onuma, M., Sugimoto, C.,
Tsubota, T., Fukushi, H., Yoshida, M., Itagaki, T., & Jasuda, J. (2001).
An investigation of heavy metal exposure and risks to wildlife in the
Kafue Flats of Zambia. Journal of Veterinary Medical Science, 63(3),
315–318. https://doi.org/10.1292/jvms.63.315
Taylor, N. G., Verner-Jeffreys, D. W., & Baker-Austin, C. (2011). Aquatic
systems: Maintaining, mixing and mobilising antimicrobial resis-
tance? Trends in Ecology & Evolution, 26(6), 278–284. https://doi.
org/10.1016/j.tree.2011.03.004
Woo, P., & Bruno, D. (2014). Diseases and disorders of finfish in cage culture
(2nd ed., pp. 159–160). CABI Pub.
World Health Organization. (2006). Report of a joint FAO/OIE/WHO
Expert Consultation on antimicrobial use in aquaculture and antimicro-
bial resistance. Seoul, Republic of Korea, 13–16 June 2006.
How to cite this article: Sherif AH, Gouda M, Darwish S,
Abdelmhsin A. Prevalence of antibiotic-resistant bacteria in
freshwater fish farms. Aquaculture Research. 2021;52:2036–
2047. https://doi.org/10.1111/are.15052