BR A IN RE S E A RCH 1 2 14 ( 20 0 8 ) 7 3 –8 3

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Advancement of reproductive senescence and changes in the

early expression of estrogen, progesterone and µ-opioid
receptors induced by neonatal hypoxia in the female rat

Marcelo E. Ezquer a,c,⁎, Susana R. Valdez a , Alicia M. Seltzer b , Graciela A. Jahn a

a
Laboratorio de Reproducción y Lactancia, IMBECU-CRICYT-CONICET, C.C. 855, 5500 Mendoza, Argentina
b
Sección Neurobiología IHEM-CONICET, Mendoza, Argentina
c
Instituto de Ciencias, Facultad de Medicina Clínica Alemana Universidad del Desarrollo, Santiago, Chile

A R T I C LE I N FO AB S T R A C T

Article history: Perinatal hypoxia is a frequent birth complication, and although its early consequences on
Accepted 18 March 2008 brain development have been well studied, few studies address any long-term effects.
Available online 27 March 2008 Postnatal insults producing small disturbances in endocrine function can have marked and
long-lasting effects. In the present work we studied the effects of two types of perinatal
Keywords: brain injury: global hypoxia (H, 6.5% O2 for 50 min) and hypoxia plus ischemia (HI, ligature of
Senescence the right carotid artery) on female rat reproductive performance and expression of
Reproduction mediobasal hypothalamus-preoptic area (MBH-PO) estrogen, progesterone and µ-opioid
Hormone receptors at different times after injury, measuring the mRNA (by semiquantitative RT-PCR)
Receptor and protein (by Western blot). H or HI advanced approximately 3 months after the
Female rat appearance of blunted preovulatory LH surges and cyclic irregularities (prolonged estrus)
Hypoxia characteristic of the early stages of reproductive senescence. 48 h after H or HI we observed
decreases in ERβ, µOR and PR (only in the H group) mRNAs and in total ER and µOR proteins,
followed by increased PR levels (mRNA and protein) 7 days post-injury and by increased µOR
protein and ERβ mRNA in the H group and ERα, ERβ and µOR mRNAs and ER protein in the HI
group 30 days post-injury. Thus, an episode of hypoxia suffered during early postnatal life
induces premature reproductive senescence on the female rats, accompanied by early
changes in some MBH-PO hormone receptors (µOR, ER and PR), whose expression is
intimately involved in the regulation of gonadotropin secretion and female sexual cyclicity.
© 2008 Elsevier B.V. All rights reserved.

1. Introduction
The normal function of all organ systems is regulated by
endocrine factors. Small disturbances in endocrine function,
specially during early stages of life such as embryonic
development and early postnatal period, can have marked
and long-lasting effects (Rhind et al., 2003; Nagao et al., 2001;
DePaolo and Chappel 1986).
Hormonal imprinting is a phenomenon which takes place
at the first encounter between a hormone and its developing
receptor in the critical periods of life, usually at the perinatal
stage, and determines the later signal transduction capacity of

⁎ Corresponding author. Laboratorio de Reproducción y Lactancia, IMBECU-CRICYT-CONICET, C.C. 855, 5500 Mendoza, Argentina.
E-mail address: mezquer@lab.cricyt.edu.ar (M.E. Ezquer).
Abbreviations: MBH-PO, mediobasal hypothalamus-preoptic area; ER, estrogen receptor; PR, progesterone receptor; μOR, μ-opioid
receptor; H, hypoxia; HI, Hypoxia–Ischemia

0006-8993/$ – see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.brainres.2008.03.029
74 BR A IN RE S EA RCH 1 2 14 ( 20 0 8 ) 7 3 –83
the cell. This contributes to complete the maturation of the
developing receptor-signal transduction system and may set
the binding capacity and density of receptors for life, thereby
contributing to define the responsiveness of the system.
Altered imprinting can be caused by several factors present
in inadequate levels at the critical periods with life-long
morphological, biochemical and behavioural consequences
(Csaba, 2008; Tekes et al., 2004; Csaba and Karabelyos, 2001;
Csaba, 1994; DePaolo and Chappel, 1986).
Excess or deficiency of any hormone at this critical period
can alter the latter receptor–hormone interactions and the
pattern of cellular responses to the hormones (Csaba, 1994).
The presence of related molecules acting on the hormone
receptors (members of the same hormone family, synthetic
hormone analogues, environmental endocrine disruptors,
stress hormones or others) may also induce developmental
alterations (Csaba, 2000; Mirzahosseini et al., 1996; Csaba,
1980), such as modifications in morphology (Gibson et al., 1991;
Bern et al., 1987), behaviour (Bern et al., 1987) and life-long gene
expression (persistent gene induction) of the targeted cells
(Gray-Nelson et al., 1994).
Disturbance of the cellular redox status by reactive oxygen
species (ROS) induced by environmental and physical risk factors
(including hypoxia or hypoxia–ischemia), modifies DNA binding
and transactivation activities, which in turn, lead to changes in
expression of a variety of target genes that may be implicated in
the pathogenesis of different neuroendocrine processes (Ezquer
et al., 2006; Tamir et al., 2002; Butterfield et al., 2001).
The first week of life is particularly important to the
neuroendocrine aspects of reproductive development. In ro-
dents it is associated with neurogenesis, synaptogenesis and
gliogenesis, and is also a critical period for sexual differentiation
of the brain (Becu-Villalobos et al., 1997). Acute hypoxia during
neonatal development compromises the energy supply to the
central nervous system, and the diminished oxygen avail-
ability elicits a cascade of events that may end in brain injury
(Bossenmeyer-Pourie et al., 2002). Perinatal hypoxia is a major
cause of neurologic injury in the newborn, leading to reversible
and irreversible brain damage ranging from minimal brain
dysfunction to death (Bernert et al., 2003).
Although the basic pathologic processes appear to be
similar in vivo, the hypoxic reoxigenation model seems to be
a milder oxidative insult than hypoxia plus ischemia (du
Plessis and Volpe, 2002; Pearigen et al., 1996). Nevertheless,
there are no studies, to our knowledge, that attempt a
comparative investigation of the multiple factors involved in
these types of insults.
Information on the effects of hypoxic/ischemic brain lesions
on sexual maturation or pituitary hormone regulation is scarce
and it remains a field to be explored further. Some of the
neuroendocrine or behavioural disruptions described as seque-
lae for these kinds of lesions may be accompanied by early
changes in hormonal patterns of secretion. Interestingly,
Robertson et al. (1990) described an increased incidence of
early sexual maturation in girls with neonatal encephalopathy.
In this context, we performed a study of the potential
effects of early perinatal exposure to global hypoxia or hypoxia
plus ischemia on subsequent lifetime reproductive perfor-
mance of the female rat. With this aim, we applied the method
described by Vannucci (1993) and Vannucci and Vannucci
(2005) submitting 7-day old rats (PND7) to hypoxia or hypoxia
combined with an unilateral cerebral ischemia episode. These
procedures have been proposed as models for the hypoxia of
the close to term human fetus (Vannucci 1993; Dobbing and
Sands 1979). Although these procedures cause some mortality
during their application and induce inflammatory responses
in the central nervous system (Ezquer et al., 2006; Ezquer and
Seltzer 2003), the hypoxia alone has milder effects (Valdez
et al., 2007; Otoya et al., 1997; Pearigen et al., 1996) and does not
provoke any gross defects in neural development, motricity or
behaviour, while the hypoxia–unilateral ischemia model
produces cell death in the ipsilateral hemisphere and some
motor defects on the opposite half of the body, that do not
compromise growth or development of the rats. We studied
puberty onset, estrous cycle regularity, reproductive perfor-
mance and reproductive senescence, finding a significant
advancement in the onset of reproductive senescence.
The aging of the reproductive system is associated with
altered expression of PR in the MBH-PO (Mills et al., 2002), ER
(α/β) (Chakraborty and Gore, 2004) and µOR (Brann and
Mahesh, 2005), among other factors. In order to attempt to
elucidate the cellular and molecular bases for the advance-
ment in reproductive senescence produced by the perinatal H
or HI episodes, we evaluated the MBH-PO expression of ER (α/
β), PR (A/B) and µOR at mRNA and protein level at different
times after the insults, since these receptors may play a key
role during the establishment of the neuronal circuitry that
will regulate cyclicity in the adult female.
2. Results
2.1. Growth rate and reproductive performance
2.1.1. Survival and growth
During the procedures for induction of H or HI applied at PND7,
a death rate of 10–20% was observed, confirming previous
results (Ezquer et al., 2006; Vannucci, 1993). Thereafter, there
was no further mortality of the animals until the end of the
experimental period. Parameters of physical development
such as body growth rate and ages of initiation of hair growth,
teeth eruption and eye opening were not affected by the early
postnatal exposure to H or HI.
The day of vaginal opening in the H and HI treated
groups was similar to the control groups, at day 36 ± 1. All
groups studied presented at this stage a median body weight
of 120 g.
2.1.2. Estrous cycle evaluation
Fig. 1 shows the estrous cycle pattern for CR, H or HI female
rats during the experimental period. After puberty, all the rats
showed regular 4-day cycles up to 4–5 months of age.
Thereafter the H and HI rats started prolonged estrous phases,
approximately 3 months earlier than controls, which devel-
oped an irregular pattern at 7–8 months of age.
Between the ages of 8 and 10 months, 80% of the control
females exhibited persistent vaginal estrus, while the H and HI
groups presented periods of persistent vaginal estrus inter-
spersed with periods of persistent diestrus, both of variable
length (Fig. 1).
 BR A IN RE S E A RCH 1 2 14 ( 20 0 8 ) 7 3 –8 3
2.1.3. Reproductive performance
At three months of age H or HI did not affect the ovulation and
pregnancy rates (95–100% in the three groups), duration of
Fig. 1 – Effect of perinatal hypoxia or hypoxia–ischemia on
the maintenance of estrous cyclicity. Age-related changes
in estrous cyclicity in control (CR) female rats, or rats
subjected perinatally to hypoxia (H) or hypoxia–ischemia
(HI). Vaginal smears were taken daily on 20 consecutive days
each month. Data are presented as the percent of females
(n = 20 for each group) exhibiting regular cycles (a), cycles with
periods of extended estrus (b) or cycles with periods of
extended diestrus (c). See text for further details.
75
Fig. 2 – Effect of perinatal exposure to hypoxia (H) or
hypoxia–ischemia (HI) on circulating LH and FSH levels. CR:
controls. To determine the pattern of hormonal secretion
during the cycle, rats of each experimental group or controls
were bled by the tail vein at 12:00 h and 19:00 h on proestrus
and estrus at 3 (middle-aged) and 8 (old rats) months of age.
a) serum LH profile; b) serum FSH profile. Values represent
the means ± s.e.m. of groups of 10 rats. *p < 0.05 compared
with the respective control group using ANOVA and
Bonferroni post-hoc test.
pregnancy, maternal behaviour, litter size, male/female ratio,
pup mortality or litter growth rate. These data indicate that all
the reproductive indexes studied at 3–4 months of age were
apparently normal.
2.2. Hormone secretion patterns during the estrous cycle at
3 and 8 months of age
To determine the pattern of hormonal secretion during the
cycle, circulating concentrations of LH, FSH, PRL, progesterone
and estradiol were measured at 3 and 8 months of age, when
the rats were cycling normally or most of them showed
persistent estrus respectively. Fig. 2a shows that at the age of
three months the proestrus LH surge was significantly
blunted, compared with the control rats, in the animals that
76 BR A IN RE S EA RCH 1 2 14 ( 20 0 8 ) 7 3 –83

suffered neonatal hypoxia or hypoxia–ischemia procedure.

Control rats at 8 months of age showed that the afternoon
proestrus LH surge significantly attenuated compared with
the values observed at 3 months, while the hormone levels of
H or HI rats did not fall any further, so that at this age all
groups showed similar values. In contrast, proestrus peak FSH
values were not modified by the hypoxia treatments or by
aging (Fig. 2b), but the values of H or HI in the young females
rats tended to be higher at the other times measured, as at 12 h
of proestrus when H and HI rats had significantly higher
circulating FSH compared with controls and at 19 h of estrus
values were also higher, but they achieved significance only in
the H group, suggesting higher basal FSH in the H or HI groups.
The pattern of FSH secretion on the 3 months old H and HI
group was similar to the pattern observed on the 8 month old
rats in the three groups, specially at 12 h of proestrus, when
the concentrations were elevated compared with the values of
the young control rats (Fig. 2b). The patterns of secretion of
PRL, progesterone and estradiol were unaffected by the
treatments or by age (results not shown). On diestrus, there
were no differences among groups for any of the hormones
studied (results not shown).

2.3. Expression of estrogen, progesterone and µ-opioid

receptors on MBH-PO at different times after H or HI

It has been shown that a decrease in the preovulatory surge of

LH precedes the initiation of cycle irregularities and, in female
rodents, it is considered as the trigger of reproductive senes-
cence (Wise, 1984). This decrease in LH levels is associated with
alterations of the MBH-PO systems that regulate secretion of
GnRH, among them the opioid system and the hypothalamic
response to estrogen (Brann and Mahesh, 2005).
To explore possible effects of H or HI on hypothalamic
GnRH regulatory systems we measured the expression of
mRNA and protein of estrogen receptor (ER) subtypes, pro-
gesterone receptor (PR) and µ-opioid receptor (µOR) in the
MBH-PO at 48 h, 7 d, 30 d, 8 mo and 18 mo after injury (H and
HI). This area contains GnRH perikarya, most of the GnRH
axons and neuroterminals, and includes the median emi-
nence, where GnRH neurons release the decapeptide into the
portal capillaries.

2.3.1. ER expression
Figs. 3a and b show that the expression of the ERβ transcript
was markedly decreased in the MBH-PO of both injured rat
groups (H and HI) (p < 0.05) at 48 h post-lesion, but returned to
control levels after 7 days. At 30 d post-injury the expression of
ERβ was significantly increased in both experimental groups
(H and HI).
ERα mRNA expression was not modified 48 h and 7 d after
injury but at 30 d was significantly increased only in the HI
group. At 8 and 18 months of age there were no differences in
the expression of both ER isoforms (results not shown).
To determine whether the receptor protein changes in
parallel with the variations observed in ER mRNA, we
investigated the presence of ER immunoreactivity in homo-
genates of MBH-PO by Western blot using a polyclonal
antibody that recognizes both ER isoforms (Figs. 3c and d).
Owing to the slight molecular weight difference between ERα
Fig. 3 – ER α/β mRNA and protein levels in the MBH-PO in
control (CR) rats, or rats exposed perinatally to hypoxia (H) or
hypoxia–ischemia (HI). ER mRNA levels were measured
using RT-PCR (panels a and b) and protein levels by Western
blots (panels c and d) on samples obtained at 48 h (PND9),
7 d (PND14) and 30 d after injury. a) composite of RT-PCR
results showing representative control and treated rats (H
and HI). b) semiquantitative analysis of the abundance of ER
isoforms relative to β-actin level. c) representative
immunoblots showing ER levels in the MBH-PO homogenates.
Blots were probed for β-actin to control for loading of samples.
d) graph representing changes in ER levels in the MBH-PO after
perinatal H or HI expressed as % of the respective control
values for each postnatal day. Values represent the mean ±
s.e.m. of groups of 6 rats. *p < 0.05 compared with the respective
control group using ANOVA and Bonferroni
post-hoc test.
 BR A IN RE S E A RCH 1 2 14 ( 20 0 8 ) 7 3 –8 3
and β isoforms, in most cases a doublet could be observed, but
the small separation precluded quantification of the indivi-
dual bands. Therefore, the graph represents the quantification
of total ER, relative to β-actin to normalize for total protein
content. We detected a band at the expected molecular weight
of 68 kDa at all times studied, which was downregulated 48 h
after injury (H and HI) (p < 0.05). Seven days after the lesion ER
levels in H rats returned to control values, but the HI group
levels still remained significantly diminished. In contrast, at
30 days post-injury HI rats showed a rebound of ER immunor-
eactivity with values significantly higher than control, while
the H group remained similar to control.
Fig. 4 – PR mRNA and protein levels in the MBH-PO in control
(CR) rats, or rats exposed perinatally to hypoxia (H) or
hypoxia–ischemia (HI). PR mRNA levels were measured
using RT-PCR (panels a and b) and protein levels by Western
blots (panels c and d) on samples obtained at 48 h (PND9),
7 d (PND14) and 30 d after injury. a) composite of RT-PCR
results showing representative control and treated rats (H
and HI). b) semiquantitative analysis of the abundance of PR
relative to β-actin level. c) representative immunoblots
showing PR levels in the MBH-PO homogenates. Blots were
probed for β-actin to control for loading of samples. d) graph
representing changes in PR A levels expressed as % of the
respective control values for each postnatal day. Values
represent the mean ± s.e.m. of groups of 6 rats. *p < 0.05
compared with the respective control group using ANOVA
and Bonferroni post-hoc test.
77
Fig. 5 – µOR mRNA and protein levels in the MBH-PO in
control (CR) rats, or rats exposed perinatally to hypoxia (H) or
hypoxia–ischemia (HI). µOR mRNA levels were measured
using RT-PCR (panels a and b) and protein levels by Western
blots (panels c and d) on samples obtained at 48 h (PND9),
7 d (PND14) and 30 d after injury. a) composite of RT-PCR
results showing representative control and treated rats (H
and HI). b) semiquantitative analysis of the abundance of µOR
relative to β-actin level. c) representative immunoblots
showing µOR levels in the MBH-PO homogenates. Blots were
probed for β-actin to control for loading of samples. d) Graph
representing changes in µOR levels expressed as % of the
respective control values for each postnatal day. Values
represent the mean ± s.e.m. of groups of 6 rats.
The antibody used was highly specific, since no back-
ground or nonspecific bands were observed and blots incu-
bated without the ER antibody did not show any bands.
2.3.2. PR expression
Figs. 4a and b show that the expression of PR mRNA
transcripts relative to β-actin was decreased in the MBH-PO
of the H rats (p < 0.05) at 48 h after injury and markedly
increased in both experimental groups (H and HI) 7 days after
injury. No statistically significant differences were detected in
the PR expression at 30 d (Fig. 4b), 8 and 18 months post-injury
(not shown). It is well documented that the steroid binding
forms of PR express as two isoforms commonly designated as
the A and B and that the relative proportions of these forms
may vary among tissues and species. However, since the A
78 BR A IN RE S EA RCH 1 2 14 ( 20 0 8 ) 7 3 –83
form is a truncated variant of the B form, and the primers used
amplify a common sequence to both isoforms belonging to the
binding site of the PR, the results presented correspond to the
total mRNA PR.
We also investigated the immunoreactive PR protein iso-
forms in MBH-PO homogenates by Western blot using a
polyclonal antibody, that revealed the presence of two proteins
corresponding to a N-terminally truncated form, PR-A–86 kDa–,
observed at all ages, and a full length form, PR-B–110 kDa–that
was detected only in middle-aged (8 months) and old
(18 months) rats and was not affected by H or HI (not shown).
Figs. 4c and d show that the only significant difference
detected in PR immunoreactivity was observed at 7 d when
PRA protein levels were significantly higher in the H and HI
rats compared to control (p < 0.05).
2.3.3. µOR expression
We also assessed the expression of µOR in the MBH-PO at
different times after injury in H and HI rats. Figs. 5a and b show
that the expression of µOR mRNA transcript relative to β-actin
was markedly decreased in the MBH-PO of the treated rats (H
and HI) (p < 0.05) at 48 h, returned to control levels at 7 d and by
30 d post-injury the expression of µOR was significantly
increased in both experimental groups (H and HI). Eight and
18 months after injury, the values were similar in the three
groups (results not shown). Western blot of MBH-PO protein
homogenates, using a specific polyclonal antibody, revealed a
53 kDa band which was significantly downregulated 48 h after
injury (H and HI) (p < 0.05) (Figs. 5c and d). In the HI group, the
µOR remained significantly diminished at 7 d. In contrast with
the pattern of mRNA expression, at 30 days the values in both
injured groups were similar to controls.
The antibody used was highly specific, since no back-
ground or nonspecific bands were observed. In addition a blot
without the µOR antibody did not show any bands.
3. Discussion
The most striking effect of neonatal H or HI observed in the
present work was the marked advancement in the onset of
cyclic irregularities indicative of female reproductive senes-
cence that was preceded by decreased preovulatory LH surges,
increased circulating FSH on the morning of proestrus and the
afternoon of estrus at 3–4 months of age and by even earlier
changes in expression of ER, PR and µOR. Surprisingly, the
effects of H and HI upon cyclicity and the duration of the
female fertile stage studied in this work were similar, not-
withstanding the more severe lesion provoked by the uni-
lateral ischemia administered to the hypoxiated pups. This
may mean that the generalized or systemic effects of hypoxia
on the brain are sufficient to produce the observed changes,
with no further consequences of the ischemic injury on the
reproductive axis, or perhaps, that any lesion produced by the
unilateral ischemia may be compensated by the intact
contralateral cerebral hemisphere and/or takes place in areas
that are not directly involved in neuroendocrine regulation.
Thus, the observed effects of H or HI on the female
reproductive system may be mediated by the release of factors
such as opioid molecules in response to hypoxia, that in turn
affect the function of the developing hypothalamus impairing
its normal function at long-term periods (or during aging).
As normal rats age, regular estrous cycles gradually tran-
sition, to irregular estrous cycles that include 2 or more days of
estrus, followed by a chronic anovulatory state, characterized
by persistent vaginal cornification. Prior to the age-related loss
of regular estrous cycles, middle-aged rats (between 8 and
12 months of age) show altered pulsatile GnRH release (Gore
et al., 2000b; Hwang et al., 1990; Rubin and Bridges 1989),
attenuated steroid-induced or proestrous LH surge (Rubin
2000; Cooper et al., 1980), increased off-peak circulating FSH on
proestrus and estrus (DePaolo & Chappel 1986) and finally the
afternoon increase in GnRH mRNA levels on proestrous is
abolished (Gore et al., 2000a).
Due to the inter-relationship that exists among the various
levels of the reproductive axis, alterations in ovarian activity
could influence hypothalamic function, hypothalamic–pitui-
tary changes could impact the ovary, or hypothalamic alter-
ations can influence pituitary function. Whereas ovarian and
pituitary alterations undoubtedly contribute to aging of the
reproductive axis, data from numerous experimental para-
digms suggest the primary importance of the hypothalamus
in the age-related reproductive decline of female rats. (Brann
and Mahesh, 2005; Smith et al., 2005; Rubin 2000; Sopelak and
Butcher, 1982; Peng and Huang, 1972).
Our results suggest that the deficits in proestrus LH
secretion and the altered secretion pattern of FSH observed
following the exposure to neonatal hypoxia or hypoxia–
ischemia may be important causal factors in advancing the
transition phase from cyclicity to acyclicity.
The precise mechanisms resulting in diminished LH surges
during aging or reduction of the follicular reserve are still
unclear. However, our data suggest that hypoxia or hypoxia–
ischemia do not reduce follicular number since young intact,
H, or HI regularly cycling animals displayed a similar pattern
of estrogen release throughout their estrous cycles. Further-
more, even those rats that failed to exhibit normal proestrus
LH surges (presumably those that would soon become
irregularly cycling) had estrogen profiles that were similar to
those of young intact females (data not shown), suggesting
impaired neuroendocrine response to estrogen but normal
ovarian function.
GnRH neurons located in the preoptic area (PO) of the
anterior hypothalamus of rodents are the key cells regulating
the reproductive function. Changes in these cells play a critical
role in the progression of reproductive senescence (Gore and
Roberts, 1995; Rubin and Bridges, 1989). The finding that the
number and secretory processes of GnRH neurons in middle-
aged rats is normal, and yet the proestrous or steroid-induced
GnRH surges are attenuated, has led to the suggestion that the
GnRH neurons in middle-aged rats are not being properly
activated on proestrous (Neal-Perry et al., 2005; Gore and
Roberts, 1995). GnRH perikarya in the PO are under the influence
of afferent neurons from the arcuate and ventromedial
hypothalamic nuclei, collectively known as the medial basal
hypothalamus (MBH).
Our results show that H or HI produced early changes in the
expression of ER, PR and μOR, which may be involved in the
mechanisms that lead to the premature disruption of cyclicity.
There are several mechanisms by which perinatal hypoxia
 BR A IN RE S E A RCH 1 2 14 ( 20 0 8 ) 7 3 –8 3
might confer changes on µ-opioid and ovarian hormone
receptors. Endogenous opioid systems play a pivotal role in
the regulation of neural development (Hauser et al., 1989). The
first detectable opioid receptor in rodent brain appears to be
the µ-type that undergoes a gradual increase in total number
during the embryonic and postnatal period (Rius et al., 1991).
Receptor development may be influenced quantitatively by a
variety of factors in the neuronal environment. It is suggested
that exposure to drugs, prenatal stress or perinatal hypoxia
may influence the ontogenesis of brain μ-opioid receptors
(Kraczkowski and Semczuk, 2000; McDowell and Kitchen,
1987). Thus, the changes in the expression of μOR could be a
direct consequence of the hypoxic episode. It has been shown
that hypoxia induces increases of endogenous opioids (Ward-
law et al., 1981), that could lead to a homologous down
regulation of these abundant receptors in the perinatal brain
that may last several days. Since the present data showed a
marked decrease in µOR expression from female rats sub-
mitted to hypoxia on postnatal day 7, it is also possible that
the endogenous opioids released by the H or HI may mediate
the decrease of µOR through a process of downregulation, as
has been seen in rat brains exposed to exogenous opiates in
the early postnatal intervals (Tempel, 1991).
Interestingly, steroid receptors are also targets of neonatal
endorphin imprinting (Csaba and Karabelyos, 2001); and the
expression of ER α and β has been reported to be affected in
vitro by oxidative stress, that is a key component in the
unfolding of the effects of an hypoxic episode (Tamir et al.,
2002). Thus, the observed effects of H or HI on hypothalamic ER
and PR could be a consequence of the alterations in the opioid
system, a direct effect of the hypoxia, or a combination of both.
It is interesting to note that H and HI produced similar
precocious expression (advancements) of indicators of repro-
ductive senescence, although the effects of HI on MBH-PO
estrogen and µ-opioid receptor expression were more prolonged,
namely the decreases in receptor expression was observed 2 and
7 days post-injury, while in the H group they were only observed
at the 2-day time point. These results may indicate that the early
alterations in receptor expression may be the ones involved in
the advancement of reproductive senescence.
It is interesting to note that expression of the receptors,
particularly at mRNA level, showed increases at various times
posterior to the decreases observed at 48 h after H or HI. In
previous work we detected a similar wavelike pattern of
changes in the IR of synaptic proteins after the same H proce-
dure (Manzur et al., 2001) that may be associated with long-
term behavioural alterations (Valdez et al., 2007).
At present we can only speculate on the molecular
mechanisms responsible for the advance in reproductive
senescence produced by H or HI. However µOR, PR and ER α/
β have the potential to mediate the effects of environmental
factors like hypoxia and to influence programming of some of
the target systems regulating the reproductive system in the
neonatal rat. Thus, the early changes observed in the
expression of these receptors may be directly implicated in
the premature onset of reproductive senescence.
It may also be interesting to determine whether the early
decrease in the preovulatory LH surge observed in the H or HI
rats at 3–4 months of age is accompanied with changes in the
pattern of hypothalamic expression of ER, PR and µOR. At this
79
age the hypothalamic expression of the hormone receptors is
subject to daily and even hourly changes that depend on the
pattern of circulating steroid and pituitary hormones, and
thus the full characterization of these patterns requires taking
measurements at multiple time points through the estrous
cycle. This will be considered for future investigation.
However, it may be more interesting to clarify the precise
hypothalamic neuronal population in which the alterations in
µOR, PR and ER occur. This work will be challenging but will
produce much needed insight into the roles of these factors in
perinatal programming and their effects on reproductive
performance in the adult.
Clearly, any effect of neonatal hypoxia or hypoxia–ischemia
on the process of tissue differentiation and the establishment
of associated enzyme and signaling systems is likely to have a
profound effect on the subsequent function of these tissues.
In summary, we have found that in female pups, an
hypoxic episode produces a premature change in the pattern
of gonadotropin secretion to that typical of neuroendocrine
aging, namely a decrease in the LH preovulatory surge and
increase in off-peak circulating FSH that are followed by a
significant advance in the onset of constant estrus, all changes
characteristic of reproductive senescence. This is associated
with altered hypothalamic ovarian steroid and opioid receptor
expression during infancy and the prepuberal period, which
may underlie the decline in neuroendocrine rhythmicity.
In the last decades the importance of prenatal and early
postnatal factors in the programming of reproductive function
has been recognized. Early hormone-neurotransmitter unba-
lances produce irreversible long-term changes in the neu-
roendocrine regulation of behaviour and reproduction (Csaba
and Karabelyos, 2001; Csaba, 2000). Thus, hypoxic episodes (H
as well as HI) could be considered as endocrine disruptors that
can result in abnormal development and impaired reproduc-
tive function.
4. Experimental procedures
4.1. Animals
Female Sprague–Dawley rats bred in our laboratory were kept
in a temperature (23 ± 1 °C) and light–dark cycle (lights on
06.00 h–20.00 h)-controlled environment and fed on a standard
laboratory diet (Cargill, Cordoba, Argentina) and tap water ad
libitum. The rats were mated on the night of proestrus and the
following day was counted as day 0 of pregnancy if sperma-
tozoa were observed in the vaginal smear. Two or three days
before the expected delivery the rats were caged individually.
Delivery was allowed to proceed normally and the day of birth
was defined as postnatal day 0 (PND0). On day 1 of lactation,
the number of pups of each litter was adjusted to eight (by
elimination of surplus males) to insure adequate and similar
nursing and maternal care. The pups were examined daily for
general good health and otherwise left undisturbed with their
mother until taken for surgery. Female pups were subjected to
hypoxia (H) or hypoxia–ischemia (HI) at PND7 as described
below. After these procedures, the surviving pups were
returned to their mothers and remained with them until
weaning at 22–23 days of age.
80 BR A IN RE S EA RCH 1 2 14 ( 20 0 8 ) 7 3 –83
All the procedures performed on the animals were in
accordance with the guidelines suggested by the NIH guide for
the Care and Use of Laboratory Animals (NIH publication No
86-23, revised 1985 and 1991) and the UK requirements for
ethics of animal experimentation (Animals Scientific Proce-
dures, Act 1986). The experiments were approved by the
institutional ethics committee.
4.2. Induction of cerebral hypoxia
Induction of hypoxia was performed as previously described
(Ezquer et al., 2006; Ezquer and Seltzer, 2003; Vannucci, 1993).
At PND7, half of the female pups from each litter were placed
in a 500-ml airtight chamber with controlled humidity and
temperature (36.5 °C) by partial submersion in a 37 °C water
bath to keep the pups warm during the procedure. A hu-
midified gas mixture of 6.5% O2 93.5% N2 was delivered into
the jar via inlet and outlet portals at an approximate flow rate
of 100 ml/min. The pups were exposed to the gas mixture for
50 min. A mortality rate of 10–20% was constant over all
experiments. Temperature was monitored during the hypoxia
period. After hypoxia, the surviving pups (H) were allowed to
recover during 15 min in the same jar, in the warm water bath,
but with the lid open. The remaining littermates (control
group) were placed in the jar for 50 min and maintained in the
same warm temperature, breathing room air.
4.3. Unilateral cerebral hypoxia–ischemia model
We used the method described by Trescher et al. (1997), with
some modifications. Briefly: PND7 female pups were sepa-
rated from their mothers and kept warm as described above.
Under sevofluorane anaesthesia, the right common carotid
artery was isolated, ligated in two places, and cut between the
ligatures. Total time of surgery was about 7 min. After the
surgical procedure, the animals were placed in the tempera-
ture-controlled container to recover during 40 min and then
were exposed to 50 min of hypoxia (HI). Hypoxia was induced
as described above. Control animals comprised littermates of
the treated pups subjected to sham surgery and placed in the
warm jar breathing room air for 50 min (CR).
4.4. Evaluation of growth, sexual maturation and estrous
cycle
The pups were inspected daily to determine the ages of hair
and teeth irruption and of eye opening. To determine growth
rates, the pups were weighed weekly and the timing of vaginal
opening for female rats was assessed by daily visual inspec-
tion from day 30 onwards. Vaginal opening reflects the
peripuberal estradiol secretion and has been used as landmark
for the progress of reproductive maturity. Immediately after
vaginal opening, ovarian cycles were assessed by examination
of daily vaginal smears, taken approximately at the same time
each morning. Animals with two or more consecutive 4- to 5-
day cycles were defined as having regular estrous cycles; those
with two or more consecutive 6- or more day cycles were
defined as having irregular estrous cycles, those showing 14
days or more of cornified vaginal smears or sequences of
several (3–5) days of cornified smears interspersed with one
day of diestrous smears were defined as persistent estrous
and those with 10 or more days of diestrous smears were
defined as persistent diestrous.
4.5. Evaluation of reproductive performance
At 12 weeks of age (250–300 g of body weight), regularly cycling
CR, H and HI female rats were mated by caging with proven
fertile male Sprague–Dawley rats on the night of proestrus. The
following morning copulation was confirmed by the presence
of spermatozoa in the vaginal smear, and was counted as day 0
of pregnancy. Two or three days before delivery the rats were
caged individually. The day and approximate hour of delivery
and the size and weight of the litters were recorded. On day 1 of
lactation, the number of pups of each litter was standardized to
eight. Maternal behaviour was determined by visual observa-
tion of the mothers and pups, taking into account nursing
behaviour, licking of the anogenital area of the pups, crouch-
ing, nest building and the presence of milk in the pups'
abdomen. Lactational performance was assessed by weekly
weighing of the litters and determination of the mortality rate.
4.6. Determination of hormone concentrations
In order to determine the pattern of hormonal secretion
during the cycle, 8–10 rats of each experimental group, at 3 and
8 months of age, were bled by the tail vein under sevofluorane
anaesthesia twice (at 12:00 h and 19:00 h) on proestrus and
estrus days and at 12.00 h on the other days of the cycle. The
blood samples were allowed to clot at room temperature and
the serum separated by centrifugation and stored at −30 °C
until used. LH, PRL and FSH were measured by double
antibody radioimmunoassay, using materials provided by Dr.
A.F. Parlow and the NHPP (National hormone and Pituitary
Program, Harbor—UCLA Medical Center, Torrance, CA USA).
The hormones were radio-iodinated using the chloramine T
method and purified by passage through Sephadex G75. The
results were expressed in terms of the rat LH RP-3, PRL RP-3 or
FSH RP-3 standard preparations. Assay sensitivity was 0.5 µg/l
serum and the inter- and intra-assay coefficients of variation
were less than 10% for all hormones.
Serum progesterone and estradiol concentrations in sera
were measured by radioimmunoassay using commercial kits
for total hormones (DSL-3400 and DSL 4800 double antibody
radioimmunoassay respectively; from Diagnostic Systems
Laboratories, Webster, TX). Assay sensitivities were less than
10 and 1 fmol/tube respectively and the inter- and intra-assay
coefficients of variations were less than 10% for both steroids.
4.7. Brain tissue sampling
At 48 h, 7 days (d), 30 d, 8 months (mo) and 18 mo after injury,
groups of 12 (6 for RNA preparation and 6 for protein homogenate
preparation) CR, H or HI rats were sacrificed by decapitation, the
brains were rapidly removed and cut into 200 µm coronal thick
sections on a slicer (Rodent Brain Matrix RBM-400C, ASI
Instruments Inc.). The sections were collected onto glass
microscope slides and immediately frozen. A block of tissue
comprising the mediobasal hypothalamus (which includes the
arcuate nucleus, anteroventricular paraventricular nucleus and
 BR A IN RE S E A RCH 1 2 14 ( 20 0 8 ) 7 3 –8 3
Table 1 – Primer sequences and reaction conditions used in the PCR amplification of the various cDNAs
cDNA Primers 5′-3′ Number of cycles
ERα S aattctgacaatcgacgccag 30
ERα AS gtgcttcaacattctccctcctc
ERβ S aaagccaagagaaacggtgggcat 25
ERβ AS gccaatcatctgcaccagttcctt
µOR S acctggctcctggctcaactt 25
µOR AS tggacccctgcctgtattttg
PR S cccacaggagtttgtcaagctc 30
PR AS taacttcagacatcatttccgg
β-actin S cgtgggccgccctaggcacca 25
β-actin AS ttggccttagggttcagagggg
All reactions were carried out with the following cyclic parameters: 95 °C for 1 min, 62 °C for 1 min and 72 °C for 1 min.
All the reactions were terminated with a 5 min extension at 72 °C.
median eminence) and preoptic area (MBH-PO) was microdis-
sected and processed for RNA or total protein extraction.
4.8. RNA extraction and RT-PCR
Total RNA was isolated from microdissected MBH-PO from CR,
H and HI rats with TriZol (GIBCO-BRL), according to the
manufacturer's instructions. Integrity of the isolated total
RNA was examined by 1% agarose gel electrophoresis, and
RNA concentration was determined by the ultraviolet light
absorbance at 260 nm. Reverse transcription (RT) was carried
out using 10 μg of total RNA from the MBH-PO of each rat. RT
was performed at 37 °C for 60 min using 200 U of Moloney
murine leukemia virus reverse transcriptase (GIBCO-BRL).
Aliquots of the reverse transcription reaction were amplified
with specific primers (Table 1). For the PCR amplification,
specific oligonucleotide primers (0.5 μM each) were incubated
with 5 μl of cDNA template in a 35 μl PCR reaction mixture
containing 1.5 mM MgCl2, 25 mM KCl, 10 mM Tris–HCl, pH 9, 1 μl
of deoxynucleotides (1 mM each), and 1 unit of Taq polymerase
(Invitrogen). All the products were analyzed in the linear range
of the RT-PCR amplification process (see Table 1 for specific
conditions of each amplification). RNA samples were assayed
for DNA contamination by PCR without the prior reverse tran-
scription. The amplicons were separated on 1.5% agarose gels
containing 0.5 mg/ml ethidium bromide and photographed with
a Polaroid camera. Band intensities of RT-PCR products were
quantified using the NIH Image software; relative levels of
mRNA were calculated as the ratio of signal intensity for the
target genes relative to β-actin cDNA. The results are expressed
as % of the respective controls for each postnatal day.
4.9. Western blot
For Western blots the tissues were placed in buffer (0.1 M NaCl,
0.01 M Tris–Cl, pH 7.6, plus 0.001 M EDTA pH 8, with a protease
inhibitor mix consisting of 1 mM PMSF, 2 µg/ml aprotinin, 2 µg/
ml leupeptin and 2 µg/ml pepstatin A) and homogenized.
Aliquots were removed to determine protein content, and the
remaining tissue was denatured with SDS (1% final concen-
tration) and β-mercaptoethanol (1% final concentration) and
stored at − 70 °C until the assay.
Sodium dodecyl sulfate-polyacrylamide gel electrophor-
esis (12%) was performed as described by Laemmli (1970). In
81
Quantity of cDNA added (ng) Product Gene bank accession
100 345 bp NM012689
100 204 bp NM012754
30 569 bp NM013071
50 325 bp NM0228471
30 243 bp BC063166
brief, 10 μg of protein was loaded per lane. Molecular weight
markers were run in parallel. Electrophoresis was performed
at 100 V for 90 min and electrotransferred overnight (~ 16 h) at
30 V onto 0.2 μm pore diameter nitrocellulose membranes
(HybondTM C Amersham Life Science). Then, the membranes
were rinsed in PBS buffer containing 0.1% Tween 20 (PBS–T)
pH 7.4, blocked for 2 h with 3% BSA and 2% horse serum
(Sigma) in PBS–T and incubated for 2 h at room temperature
in primary serum anti-µ-opioid receptor (rabbit polyclonal,
1/1000, Santa Cruz Biotechnology Inc.), anti-progesterone
receptor (rabbit polyclonal, 1/1000, Santa Cruz Biotechnology
Inc.) or anti-estrogen receptor (affinity purified antibody to rat
estrogen receptor peptide NFCHD-NIH, Bethesda, MD) in block-
ing solution. After three washes in PBS–T, the membranes were
incubated for 1 h at room temperature with horseradish
peroxidase-conjugated secondary antisera (1/3000 goat anti-
rabbit—Dako Cytomation) in blocking solution. After three
washes in PBS–T, specific receptor bands were detected by
chemiluminescence (ECL™, Amersham) using X-OMAT-LS
(Kodak) film and then quantified by densitometry using digi-
tal image processing by the NIH Image 1.6/ppc freeware
program.
4.10. Statistical analysis
For each set of values, the mean and standard error of the
mean were calculated and compared using one-way analysis
of variance (ANOVA) with the statistical computer analysis
system GraphPad Prism. When ANOVA revealed statistical
differences, we applied the statistical post-hoc analysis of
Bonferroni. Significance was set at the p < 0.05 level. Since no
differences were found between the controls groups, sham H
and sham HI, for graphing and statistical purposes these two
groups were pooled and shown as control (CR).
Acknowledgments
This work has been supported by grants PIP 5795 from
CONICET (National Investigation Council of Science and
Technology, Argentina) and PMT-PICT 06877 from the Agencia
de Promoción Científica y Tecnológica, Argentina. ME, GAJ and
AMS are Career Scientists from CONICET, and SRV has
fellowships from CONICET.
82 BR A IN RE S EA RCH 1 2 14 ( 20 0 8 ) 7 3 –83
REFERENCES
Becu-Villalobos, D., Gonzalez, I.A., az-Torga, G., Hockl, P., Libertun,
C., 1997. Brain sexual differentiation and gonadotropins
secretion in the rat. Cell. Mol. Neurobiol. 17, 699–715.
Bern, H.A., Edery, M., Mills, K.T., Kohrman, A.F., Mori, T., Larson, L.,
1987. Long-term alterations in histology and steroid receptor
levels of the genital tract and mammary gland following
neonatal exposure of female BALB/cCrgl mice to various doses
of diethylstilbestrol. Cancer Res. 47, 4165–4172.
Bernert, G., Hoeger, H., Mosgoeller, W., Stolzlechner, D., Lubec, B.,
2003. Neurodegeneration, neuronal loss, and neurotransmitter
changes in the adult guinea pig with perinatal asphyxia.
Pediatr. Res. 54, 523–528.
Bossenmeyer-Pourie, C., Lievre, V., Grojean, S., Koziel, V., Pillot, T.,
Daval, J.L., 2002. Sequential expression patterns of
apoptosis- and cell cycle-related proteins in neuronal response
to severe or mild transient hypoxia. Neuroscience 114,
869–882.
Brann, D.W., Mahesh, V.B., 2005. The aging reproductive
neuroendocrine axis. Steroids 70, 273–283.
Butterfield, D.A., Howard, B.J., LaFontaine, M.A., 2001. Brain
oxidative stress in animal models of accelerated aging and the
age-related neurodegenerative disorders, Alzheimer's disease
and Huntington's disease. Curr. Med. Chem. 8, 815–828.
Chakraborty, T.R., Gore, A.C., 2004. Aging-related changes in
ovarian hormones, their receptors, and neuroendocrine
function. Exp. Biol. Med. 229, 977–987.
Cooper, R.L., Conn, P.M., Walker, R.F., 1980. Characterization of the
LH surge in middle-aged female rats. Biol. Reprod. 23, 611–615.
Csaba, G., 1980. Phylogeny and ontogeny of hormone receptors:
the selection theory of receptor formation and hormonal
imprinting. Biol. Rev. Camb. Philos. Soc. 55, 47–63.
Csaba, G., 1994. Phylogeny and ontogeny of chemical signaling:
origin and development of hormone receptors. Int. Rev. Cytol.
155, 1–48.
Csaba, G., 2000. Hormonal imprinting: its role during the evolution
and development of hormones and receptors. Cell Biol. Int. 24,
407–414.
Csaba, G., 2008. Hormonal imprinting: phylogeny, ontogeny,
diseases and possible role in present-day human evolution.
Cell Biochem. Funct. 26, 1–10.
Csaba, G., Karabelyos, C., 2001. The effect of a single neonatal
treatment (hormonal imprinting) with the antihormones,
tamoxifen and mifepristone on the sexual behavior of adult
rats. Pharmacol. Res. 43, 531–534.
DePaolo, L.V., Chappel, S.C., 1986. Alterations in the secretion and
production of follicle-stimulating hormone precede
age-related lengthening of estrous cycles in rats. Endocrinology
118, 1127–1133.
Dobbing, J., Sands, J., 1979. Comparative aspects of the brain
growth spurt. Early Hum. Dev. 3, 79–83.
du Plessis, A.J., Volpe, J.J., 2002. Perinatal brain injury in the
preterm and term newborn. Curr. Opin. Neurol. 15, 151–157.
Ezquer, M., Seltzer, A.M., 2003. c-fos and tyrosine hydroxylase
expression after an excitotoxic lesion on the nigrostriatal
system: a study on the effects of hypoxia used as a
preconditioning stimulus. Exp. Neurol. 183, 523–531.
Ezquer, M.E., Valdez, S.R., Seltzer, A.M., 2006. Inflammatory
responses of the substantia nigra after acute hypoxia in
neonatal rats. Exp. Neurol. 197, 391–398.
Gibson, D.F., Roberts, S.A., Evans, G.S., 1991. Changes in the
hormone dependency of epithelial cell proliferation in the
genital tract of mice following neonatal oestrogen treatment.
Eur. J. Cancer 27, 1295–1301.
Gore, A.C., Roberts, J.L., 1995. Regulation of gonadotropin-releasing
hormone gene expression in the rat during the luteinizing
hormone surge. Endocrinology 136, 889–896.
Gore, A.C., Oung, T., Yung, S., Flagg, R.A., Woller, M.J., 2000a.
Neuroendocrine mechanisms for reproductive senescence in
the female rat: gonadotropin-releasing hormone neurons.
Endocrine 13, 315–323.
Gore, A.C., Yeung, G., Morrison, J.H., Oung, T., 2000b. Neuroendocrine
aging in the female rat: the changing relationship of
hypothalamic gonadotropin-releasing hormone neurons and
N-methyl-D-aspartate receptors. Endocrinology 141, 4757–4767.
Gray-Nelson, K., Sakai, K., Eitzman, B., Steel, T., McLachlan, J.A.,
1994. Exposure to diethylstilbestrol during a critical
developmental period of the mouse reproductive tract leads to
persistent induction of two estrogen-regulated genes. Cell
Growth Differ. 5, 595–606.
Hauser, K.F., McLaughlin, P.J., Zagon, I.S., 1989. Endogenous opioid
systems and the regulation of dendritic growth and spine
formation. J. Comp. Neurol. 281, 13–22.
Hwang, C., Pu, H.F., Hwang, C.Y., Liu, J.Y., Yao, H.C., Tung, Y.F.,
Wang, P.S., 1990. Age-related differences in the release of
luteinizing hormone and gonadotropin-releasing hormone in
ovariectomized rats. Neuroendocrinology 52, 127–132.
Kraczkowski, J.J., Semczuk, M., 2000. [Sex and changes in mu-opioid
receptor density under hypoxia]. Ginekol. Pol. 71, 927–930.
Laemmli, U.K., 1970. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
Manzur, A., Sosa, M., Seltzer, A.M., 2001. Transient increase in rab
3A and synaptobrevin immunoreactivity after mild hypoxia in
neonatal rats. Cell. Mol. Neurobiol. 21, 39–52.
McDowell, J., Kitchen, I., 1987. Development of opioid systems:
peptides, receptors and pharmacology. Brain Res. 434, 397–421.
Mills, R.H., Romeo, H.E., Lu, J.K., Micevych, P.E., 2002. Site-specific
decrease of progesterone receptor mRNA expression in the
hypothalamus of middle-aged persistently estrus rats. Brain
Res. 955, 200–206.
Mirzahosseini, S., Karabelyos, C., Dobozy, O., Csaba, G., 1996. Changes
in sexual behavior of adult male and female rats neonatally
treated with vitamin D3. Hum. Exp. Toxicol. 15, 573–576.
Nagao, T., Yoshimura, S., Saito, Y., Nakagomi, M., Usumi, K., Ono,
H., 2001. Reproductive effects in male and female rats from
neonatal exposure to p-octylphenol. Reprod. Toxicol. 15,
683–692.
Neal-Perry, G.S., Zeevalk, G.D., Santoro, N.F., Etgen, A.M., 2005.
Attenuation of preoptic area glutamate release correlates with
reduced luteinizing hormone secretion in middle-aged female
rats. Endocrinology 146, 4331–4339.
Otoya, R.E., Seltzer, A.M., Donoso, A.O., 1997. Acute and
long-lasting effects of neonatal hypoxia on (+)-3-[125I]MK-801
binding to NMDA brain receptors. Exp. Neurol. 148, 92–99.
Pearigen, P., Gwinn, R., Simon, R.P., 1996. The effects in vivo of
hypoxia on brain injury. Brain Res. 725, 184–191.
Peng, M.T., Huang, H.H., 1972. Aging of
hypothalamic–pituitary–ovarian function in the rat. Fertil.
Steril. 23, 535–542.
Rhind, S.M., Rae, M.T., Brooks, A.N., 2003. Environmental
influences on the fetus and neonate-timing, mechanisms of
action and effects on subsequent adult function. Domest.
Anim. Endocrinol. 25, 3–11.
Rius, R.A., Barg, J., Bem, W.T., Coscia, C.J., Loh, Y.P., 1991. The
prenatal development profile of expression of opioid peptides
and receptors in the mouse brain. Brain Res. Dev. Brain Res. 58,
237–241.
Robertson, C.M., Morris, D., Wheler, H., Grace, M.G., 1990. Neonatal
encephalopathy: an indicator of early sexual maturation in
girls. Pediatr. Neurol. 6, 102–108.
Rubin, B.S., 2000. Hypothalamic alterations and reproductive aging
in female rats: evidence of altered luteinizing hormone-releasing
hormone neuronal function. Biol. Reprod. 63, 968–976.
Rubin, B.S., Bridges, R.S., 1989. Alterations in luteinizing
hormone-releasing hormone release from the mediobasal
hypothalamus of ovariectomized, steroid-primed middle-aged
 BR A IN RE S E A RCH 1 2 14 ( 20 0 8 ) 7 3 –8 3
rats as measured by push–pull perfusion. Neuroendocrinology
49, 225–232.
Smith, R.G., Betancourt, L., Sun, Y., 2005. Molecular endocrinology
and physiology of the aging central nervous system. Endocr.
Rev. 26, 203–250.
Sopelak, V.M., Butcher, R.L., 1982. Contribution of the ovary versus
hypothalamus-pituitary to termination of estrous cycles in
aging rats using ovarian transplants. Biol. Reprod. 27,
29–37.
Tamir, S., Izrael, S., Vaya, J., 2002. The effect of oxidative stress on
ERalpha and ERbeta expression. J. Steroid Biochem. Mol. Biol.
81, 327–332.
Tekes, K., Hantos, M., Csaba, G., 2004. Single neonatal treatment
with beta-endorphin (hormonal imprinting) extremely
enhances nocistatin level of cerebrospinal fluid in adult rats.
Life Sci. 74, 1993–1997.
Tempel, A., 1991. Visualization of mu opiate receptor
downregulation following morphine treatment in neonatal rat
brain. Brain Res. Dev. Brain Res. 64, 19–26.
83
Trescher, W.H., Ishiwa, S., Johnston, M.V., 1997. Brief
post-hypoxic-ischemic hypothermia markedly delays
neonatal brain injury. Brain Develop. 19, 326–338.
Valdez, S.R., Patterson, S.I., Ezquer, M.E., Torrecilla, M., Lama, M.C.,
Seltzer, A.M., 2007. Acute sublethal global hypoxia induces
transient increase of GAP-43 immunoreactivity in the striatum
of neonatal rats. Synapse 61, 124–137.
Vannucci, R.C., 1993. Experimental models of perinatal
hypoxic–ischemic brain damage. APMIS Suppl. 40, 89–95.
Vannucci, R.C., Vannucci, S.J., 2005. Perinatal hypoxic-ischemic brain
damage: evolution of an animal model. Dev. Neurosci. 27, 81–86.
Wardlaw, S.L., Stark, R.I., Daniel, S., Frantz, A.G., 1981. Effects of
hypoxia on beta-endorphin and beta-lipotropin release in fetal,
newborn, and maternal sheep. Endocrinology 108, 1710–1715.
Wise, P.M., 1984. Estradiol-induced daily luteinizing hormone and
prolactin surges in young and middle-aged rats: correlations
with age-related changes in pituitary responsiveness and
catecholamine turnover rates in microdissected brain areas.
Endocrinology 115, 801–809.