Fitoterapia 127 (2018) 129–137

Contents lists available at ScienceDirect

Fitoterapia
journal homepage: www.elsevier.com/locate/fitote

Evaluation of in vitro/in vivo anti-diabetic effects and identification of T

compounds from Physalis alkekengi
⁎
Xiao-Fang Hua,b,1, Qiang Zhanga,b,1, Pan-Pan Zhanga,b, Li-Juan Suna,b, , Ji-Chao Lianga,b,
⁎⁎
Susan L. Morris-Natschkec, Yong Chena,b, Kuo-Hsiung Leec,d,
a
National & Local Joint Engineering Research Center of High-throughput Drug Screening Technology, Hubei University, Wuhan 430062, China
b
Hubei Province Key Laboratory of Biotechnology of Chinese Traditional Medicine, Hubei University, Wuhan 430062, China
c
Natural Products Research Laboratories, UNC Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599-7568, USA
d
Chinese Medicine Research and Development Center, China Medical University and Hospital, Taichung 40402, Taiwan

A R T I C L E I N F O A B S T R A C T

Keywords: The aims of the present study were to assess the anti-diabetic effects of Physalis alkekengi L. (PA) in 3T3-L1 pre-
Physalis alkekengi adipocyte cells and HepG2-GFP-CYP2E1 (E47) cells and in a pre-diabetic rat model, as well as to identify the
Antioxidant active chemical constituents. The in vitro results showed that PA has a strong anti-diabetic capacity to relieve
Anti-diabetic oxidative stress and inhibit α-glucosidase activity. Mechanistic analysis also showed that ethyl acetate extracts of
CYP2E1
aerial parts and fruit of PA (PAG-EA and PAF-EA) enhanced glucose transporter 4 expression and function as well
GLUT4
as enhanced insulin sensitivity by inhibiting the expression of cytochrome P450-2E1 (CYP2E1) mRNA and
protein. In vivo, PAG-EA and PAF-EA significantly decreased the levels of fasting blood glucose and fasting
insulin, as well as total cholesterol and triglyceride, in the pre-diabetic rats. The results from insulin sensitivity
index and homeostasis model assessment-insulin resistance index along with an oral glucose tolerance test also
showed that PAG-EA and PAF-EA could significantly enhance the insulin sensitivity, which confirmed the in vitro
findings. Moreover, HPLC-ESI-QTOF-MS analysis identified flavonoids, physalins and phenolic acids as the main
plant constituents. Our findings support the ethnopharmacological use of PA fruit, along with its aerial parts, as a
strong anti-diabetic agent. The EA fraction, especially the constituent polyphenols and flavonoids, may have a
good potential to treat diabetes.

1. Introduction dehydrogenase [7,8]. Polysaccharides isolated from the fruits of PA

Physalis alkekengi L. (PA) from the family Solanaceae has long been
used as an important herbal ingredient in traditional medicine of
European and Asian countries, including Russia, China, and Japan,
while it is also enjoyed for its edible sweet-tart fruits [1] Thus, PA is a
functional food and fits into the concept of “medicine food homology”
[2], Moreover, PA is known to be rich in steroids, flavonoids, phenyl-
propanoids, N-containing compounds and miscellaneous constituents,
and to show numerous beneficial pharmacological characteristics, in-
cluding anti-diabetic, anti-inflammatory, anti-tumor, vasodilative, and
other effects (The China Pharmacopeial Convention, 2000, 2005) [3].
The anti-diabetic properties of PA have been demonstrated through
accumulated scientific evidence, including studies on the changes in
biochemical parameters and activities of antioxidant enzymes in mice
[4–6] and inhibitory activities of glycosidase and glucose 6-P
exhibit anti-diabetic potency [4,9], and calystegins isolated from the
roots of PA with structures analogous to those of glucose and galactose
block certain processes of carbohydrate metabolism via competitive
inhibition of key glucosidases and galactosidases [3]. However, most of
the scientific evaluation on PA has been carried out only with the fruits.
Also, to the best of our knowledge, the anti-diabetic activity and me-
chanism(s) of action of PA, especially its aerial parts, have been re-
ported only sporadically. The limited amount of information on the
anti-diabetic effects of PA and its active constituent(s) prompted our
present study.
Studies indicate that hyperglycemia leads to oxidative stress, free
radical increase, antioxidant defense system dysfunction and dyslipi-
demia [10] . Malondialdehyde (MDA), lactate dehydrogenase (LDH),
and catalase (CAT) are the key antioxidant enzymes that protect against
oxidative stress and tissue damage [11], and inhibition of these

⁎
Correspondence to: L-J. Sun, National & Local Joint Engineering Research Center of High-throughput Drug Screening Technology, Hubei University, Wuhan 430062, China.
⁎⁎
Correspondence to: K-H. Lee, Natural Products Research Laboratories, UNC Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599-7568, USA.
E-mail addresses: lijuansun1212@163.com (L.-J. Sun), khlee@unc.edu (K.-H. Lee).
1
Hu X.F. and Zhang Q. contributed equally to this research.

https://doi.org/10.1016/j.fitote.2018.02.015
Received 3 January 2018; Received in revised form 5 February 2018; Accepted 10 February 2018
Available online 12 February 2018
0367-326X/ © 2018 Elsevier B.V. All rights reserved.
X.-F. Hu et al.
protective mechanisms results in enhanced sensitivity to free radical
induced abnormal glycolipid metabolism. In recent years, studies have
suggested that diabetes mellitus (DM) causes cytochrome P450-2E1
(CYP2E1) overexpression, which could lead to oxidative stress [12].
Meanwhile, increased GLUT4 expression in cell plasma membranes
following insulin stimulation is closely associated with the enhanced
glucose uptake of adipocytes and skeletal muscle cells [13], and im-
paired GLUT4 function/expression in insulin target tissues is well
documented in DM. Furthermore, according to a recent study, CYP2E1
impairs GLUT4 gene expression and function via NF-E2-related factor 2
(NRF2) [13].
The antioxidant potential of many plant extracts has been linked to
their anti-diabetic activity [14] Therefore, the present study was per-
formed to evaluate the possible anti-diabetic effects of PA by analyzing
antioxidant status in 3T3-L1 adipocytes and E47 cells, as well as eval-
uating inhibition of α-glucosidase and enhancement of insulin sensi-
tivity in 3T3-L1 adipocytes. Efforts were also made to confirm the
findings in vivo in high-fat diet (HFD)-induced pre-diabetic rats by
analyzing the glucose lowering capacity, insulin sensitivity and re-
storation of lipid profile. Finally, the plant constituents were identified
by HPLC-ESI-QTOF-MS.
2. Material and methods
2.1. Chemicals and cell lines
2,2-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), 4-ni-
trophenyl p-diglucopyranoside (4-NPGP), α-glucosidase, isobutyl-1-
methylxanthine (IBMX), dexamethasone, and 3-(4,5-dimethylthiazol-2-
yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from
Sigma-Aldrich (USA). MDA, LDH, and CAT kits were purchased from
the Nanjing Jiancheng Bioengineering Institute. Insulin, the total anti-
oxidant capacity (T-AOC) assay kit with FRAP method, and ROS kit
were purchased from the Beyotime Institute of Biotechnology (China).
Fetal bovine serum (FBS), high-glucose Dulbecco's modified Eagle's
medium (DMEM), and penicillin-streptomycin were purchased from
Gibco (Australia). The GLUT4 and CYP2E1 primary antibodies were
purchased from Affinity (USA). The β-actin primary antibody was
purchased from Santa-Cruz Biotechnology (USA). Heparin was pur-
chased from Wanbang BioPharma. Sodium carboxy methyl cellulose
(Na-CMC) and D-Glucose were purchased from Sinopharm Chemical
Reagent Co. Ltd. (Shanghai, China). One Touch®Ultra Easy and blood
sugar test papers were purchased from Johnson & Johnson Medical Ltd.
(China). Total cholesterol (TC), triglyceride (TG), insulin (INS) and
glycated serum protein (GSP) test kits were obtained from MDL Biotech
Co., Ltd. (Beijing, China). HPLC grade acetonitrile was purchased from
J. T. Baker Pharmaceuticals Company (Phillipsburg, NJ), and analytical
grade formic acid was purchased from Sinopharm Chemical Reagent
Co. Ltd. (Shanghai, China). Ultrapure water was produced by a Milli-Q
Water Purification System (Milfold, MA). 3T3-L1 cells were purchased
from CCTCC (China), and HepG2-GFP-CYP2E1 (E47) cells were pro-
vided by HANBIO (China).
2.2. Animals and ethics statement
Male SD rats (90–110 g) were obtained from Hunan SJA Laboratory
Animal Co., Ltd. (Hunan, China). The animals were treated in ac-
cordance with the “Principles of Laboratory Animal Care” (WHO 1985).
The regular chow and high-fat diet (HFD, 10% lard, 18% sucrose, 5%
yolk powder, 2% cholesterol, 0.5% sodium cholate and 64.5% basal
diet) were obtained from WQJX Bio-Technology Co., Ltd. (Wuhan,
China). The rats were kept in an environmentally controlled breeding
room (temperature: 20 ± 2 °C, humidity: 60 ± 5%, 12 h light/dark
cycle). All rats had free access to tap water.
130
Fitoterapia 127 (2018) 129–137
2.3. Plant materials
The PA herbal plants were collected during October 2015 in
Xianning, Hubei Province, China. The materials were identified by
Professor Jianqiang Li (Wuhan Botanical Garden, Chinese Academy of
Sciences, P.R. China), and deposited in the Hubei Province Key
Laboratory of Biotechnology of Chinese Traditional Medicine
(PA20151025).
2.4. Preparation of crude extracts
Dry plant and fruit of PA (above-ground 7 kg and fruit 3 kg) were
extracted repeatedly, each time with 2.5 L of 75% ethanol at 60 °C, 3 h
for three times. Then, the extracts were merged and concentrated by
rotary evaporator to obtain the residues. The residues was extracted
with continuous liquid - liquid extraction with petroleum ether (PE)
and ethyl acetate (EA), then we can get the residual water extract (AQ),
giving six PA extracts (PE of ground 108.74 g, EA of ground (EAG-PA)
136.58 g, AQ of ground 746.57 g, PE of fruit 18.83 g, EA of fruit (EAF-
PA) 87.00 g, and AQ of fruit 298.52 g).
2.5. In vitro anti-oxidation and anti-diabetic capacity of PA extract
2.5.1. ABTS assay
ABTS radical cation (ABTS) was produced by reacting ABTS solution
(7 mM) with 2.45 mM potassium persulfate and allowing the mixture to
stand in the dark at room temperature for 14 h before use. In this study,
ABTS solution was diluted with PBS to an absorbance of 0.70 ± 0.02 at
630 nm and equilibrated at 25 °C. Then, 1 mL of diluted ABTS solution
was added to 10 μL (0.02 mg/mL) of the sample or vitamin C (VC,
0.02 mg/mL), and a decrease in the absorbance at 630 nm was recorded
by iMark 384 Microplate Reader (Berthold Technoligies, Germany)
after 5 min for the six extracts of PA. The percentage inhibition of ABTS
by the samples was calculated, and the results were expressed as the
ratio with the result with VC.
2.5.2. FRAP assay
The FRAP assay measures the change in absorbance at 570 nm due
to the formation of a blue-colored Fe-II-tripyridyltriazine compound
from the colorless oxidized Fe-III form by the action of electron-do-
nating antioxidants. The experiment was carried out according to the
kit's instructions. The FRAP reagent was freshly prepared and warmed
to 37 °C. 5 μL of standard solution at a range of concentrations or tested
sample was added to the FRAP reagent (180 μL) for 5 min at 37 °C. The
change in absorbance was calculated to derive the FRAP value ex-
pressed as μM Fe-II equivalents per milligram of extract.
2.5.3. α-Glucosidase inhibition assay
The α-glucosidase inhibitory effect was assayed by measuring the
release of 4-nitrophenol from 4-NPGP. The assay medium contained
0.1 M sodium phosphate buffer (pH 6.8), 2 mM 4-NPGP, 0.1 U of α-
glucosidase (from yeast) and PAG-EA AND PAF-EA in the range of 0.01
to 10 μg/mL in the assay mixture in a total volume of 1.18 mL for 5 min.
The assay was started by the addition of 4-NPGP, and after 20 min of
incubation, the absorbance at 405 nm was measured on an iMark 384
Microplate Reader (Berthold Technoligies, Germany). Acarbose was
used as a standard. The minimal half-inhibitory concentration (IC50)
was calculated from the linear regression equation. The percent in-
hibition of radicals was calculated using the following formula:
%inhibition = A control − A sample/A control × 100
X.-F. Hu et al.
2.6. Anti-diabetic capacity of PAG-EA and PAF-EA in 3T3-L1 cells and E47
cells
2.6.1. Cell viability assay
3T3-L1 cells and E47 cells were seeded in 96-well plates and in-
cubated for 24 h. Thereafter, the medium (DMEM, 10% FBS) was re-
placed with fresh medium containing various concentrations of PAG-EA
and PAF-EA (0.01, 0.1, 1, 10 μg/mL in 3T3-L1 cells and 0.05, 0.5, 5 μg/
mL in E47 cells) or DMSO for another 24 h incubation. At the end of the
incubation period, the medium was decanted and MTT dye solution
(200 μL, 0.5 mg/mL in PBS) was added to each well, after which the
plates were incubated for 4 h at 37 °C. Then, 150 μL of DMSO was added
to dissolve/extract tetrazolium dye. The relative cell viability was cal-
culated by determining the absorbance at 570 nm, and the group with
DMSO was used as the control.
2.6.2. Activity of cellular antioxidant enzymes
Cells were seeded in 6-well plates at a density of 105 cells/well and
incubated for 24 h. Subsequently, the medium was replaced with fresh
medium containing various concentrations of PAG-EA and PAF-EA,
DMSO or vitamin E (VE), and the cells were incubated for 24 h prior to
exposure to 1.5 mmol/L H2O2 for 4 h. The groups were as follows: A:
negative control (without H2O2 and with DMSO), B: Model (1.5 mM
H2O2 and DMSO), C: 0.1 μg/mL PAG-EA and PAF-EA, D: 1 μg/mL PAG-
EA and PAF-EA, E: 10 μg/mL PAG-EA and PAF-EA, F: positive control
(0.02 μg/mL VE). After the medium was removed, the cells were sus-
pended in 10 mM PBS (pH 7.4). The medium was used for the mea-
surement of LDH. The lysates were centrifuged at 4000 rpm at 4 °C for
10 min, and the antioxidant enzymes (ROS, CAT and MDA) were
measured from the supernatants using commercially available assay
kits. Compared to the 3T3-L1 cells, E47 cells were sued without H2O2
treatment, and the concentrations of PAG-EA and PAF-EA were 0.05,
0.5 and 5 μg/mL.
2.6.3. 3T3-L1 pre-adipocytes differentiated into 3T3-L1 adipocytes
3T3-L1 pre-adipocyte cells were grown in high-glucose DMEM
supplemented with 10% FBS and 1% penicillin-streptomycin. Prior to
the experiments, the cell suspensions were seeded onto 6-well plates
and grown for up to two days. Then, the cells were subjected to the first
differentiation medium (DMEM, 10% FBS, 1 mM IBMX, 1.7 mM insulin,
and 10 μM DEX) starting on day 0 for two days. The medium was then
replaced with the second differentiation medium (DMEM, 10% FBS and
1.7 mM insulin) for two additional days. The growth medium was re-
plenished every two days. 3T3-L1 adipocytes and 3T3-L1 pre-adipo-
cytes were washed with PBS and fixed with 10% formalin for 1 h at
room temperature. Then, the cells were washed with 2.4 mL of 60%
isopropanol and stained with Oil Red O for 10 min at room tempera-
ture. Images of each dish were captured using a microscope (Alpha
Innotech, USA). The mature adipocytes were used for the subsequent
experiments.
2.6.4. RNA isolation and real-time PCR
After the incubation of cells with PAG-EA and PAF-EA extracts
(0.01, 1, 10 μg/mL in 3T3-L1 cells and 0.05, 0.5, 5 μg/mL in E47 cells)
for 48 h, the total RNA was isolated from 3T3-L1 adipocytes and E47
cells using TRIzol reagent and reversed transcribed to cDNA using
SuperScript™ III Reverse Transcriptase (BIO-RAD, USA). Real-time PCR
was carried out in a CFX Connect™ Real-Time System (BIO-RAD, USA).
The mRNA expression levels of CYP2E1 and GLUT4 were normalized
using β-actin as an internal control. The primers were as follows:
CYP2E1-R CAAGTAGAGTGCCAGGCAAGG
CYP2E1-F GGGGACATTCCTGTGTTCCAG
GLUT4-R GTTTTGCCCCTCAGTCATTCTC
GLUT4-F CTTCCTTCTATTTGCCGTCCTC
131
Fitoterapia 127 (2018) 129–137
2.6.5. SDS-PAGE and western blot
After the incubation of cells with PAG-EA and PAF-EA in (0.01, 1,
10 μg/mL in 3T3-L1 cells and 0.05, 0.5, 5 μg/mL in E47 cells) for 48 h,
the cells were split in RIPA lysis buffer containing 1% protease inhibitor
on ice. The total protein concentrations were determined using the
Pierce™ BCA Protein Assay Kit. Each sample (40 μg) was separated with
10% SDS-PAGE and transferred onto PVDF membranes. The mem-
branes were incubated overnight at 4 °C with antibodies against
CYP2E1, GLUT4 and β-actin. The membranes were then incubated for
1.5 h with the secondary antibody. The protein bands were visualized
with the ECL reagent, followed by a brief exposure using photographic
film; β-actin was an internal control.
2.7. In vivo prevention in pre-diabetes of PAG-EA and PAF-EA
2.7.1. Experimental plan
In this experiment, a total of 32 rats were used and divided into four
groups of 8 rats. All test samples were dissolved with 0.5% CMC-Na. NC
Group: normal rats administered 0.5% CMC-Na and regular chow daily;
MOD Group: normal rats administered 0.5% CMC-Na and HFD daily; FP
Group: normal rats administered PAF-EA (300 mg/kg, b.wt.) and HFD
daily; GP Group: normal rats administered PAG-EA (300 mg/kg, b.wt.)
and HFD daily. A detailed experimental plan (flow diagram) for the 4-
week in vivo study is given below:
2.7.2. Biochemical assays
The body weights of all rats were measured. All biochemical para-
meters were determined after the animals were fasted overnight, and
blood samples were collected from the eyepit of all rats. Then, the
samples were centrifuged at 3000 ×g for 10 min at 4 °C to obtain the
serum for the measurement of fasting blood glucose (FBG) using a
glucometer (Abott, USA), while TC, TG, GSP and fasting insulin (FINS)
levels were assayed with an ELISA kit. All above indicators were mea-
sured on days 10, 20, and 28.
2.7.3. Insulin sensitivity analysis by calculating ISI, HOMA-IR, AUC during
OGTT
Insulin sensitivity index (ISI) and insulin resistance (HOMA-IR) are
based on FBG and FINS, whereas area under the curve (AUC) is derived
from an oral-glucose tolerance test (OGTT). All animals were fasted
overnight and their serum glucose response to the oral administration
of a solution of 20% glucose (2 g/kg) determined on day 28. Tail blood
samples were taken before (time 0) and 30, 60, and 120 min after ad-
ministration of glucose. Animals were not anesthetized for this proce-
dure [15].
ISI = 1/(FBG∗FINS)
HOMA − IR = FBG ∗FINS/22.5
AUC = 0.25 × FBG 0 min + 0.5 × FBG 30 min + 0.75 × FBG 60 min
+ 0.5 × FBG 120 min
2.7.4. Determination of the total phenolic content
The total phenolic content was determined using the Folin-Ciocalteu
method with some modifications. Briefly, 0.1 mL of PA extract was
mixed with 1 mL of the Folin-Ciocalteu working solution (diluted ten-
fold) and incubated at room temperature for 5 min; then, 1 mL of
Na2CO3 solution (0.1 g/mL) was added to the mixture. After incubation
for 90 min at room temperature, the absorbance of six extracts of PA
X.-F. Hu et al. Fitoterapia 127 (2018) 129–137

was measured at 750 nm, and the results were expressed as gallic acid
equivalents (GAE) per gram of sample (mg GAE/g).
2.8. HPLC-ESI-QTOF-MS analysis
The PAG-EA AND PAF-EA was dissolved in 1 mL of 50% aqueous
acetonitrile followed by filtration through a 0.4 μm filter. The chro-
matographic separation was performed on an HPLC system (Agilent
1200, USA) equipped with an online degasser, a quaternary solvent
delivery system, an autosampler and a diode-array detector (DAD). An
analytical Eclipse XD-C18 column (5 μm, 4.6 × 150 mm) was used with
a flow rate of 1.0 mL/min and a column oven temperature of 35 °C. The
chromatograms were monitored at 254 nm. The mobile phase consisted
of A (acetonitrile) and B (0.1% formic acid in H2O), with the gradient
varying from 5% A to 18% A in the first 10 min and then to 24% for
10 min and 50% for up to 50 min. High-resolution mass spectra were
acquired in negative ion mode on a micrOTOF-Q mass spectrometer
(Bruker Daltonics, Germany) equipped with an Apollo electrospray ion
(ESI) source. The parameters included a nebulizer nitrogen gas pressure
of 0.8 bar, dry gas with a flow rate of 8.0 L/min and temperature of
200 °C; the capillary voltage was set to +4000 V, and the endplate
offset was set to 500 V. The MS data were recorded with a range of m/z
100–1600.
2.9. Statistical analyses
The changes in parameters between different treatment groups were
determined by a one-way ANOVA, and the values are expressed as the
mean ± SD. An analysis of variance followed by Tukey's post hoc test
was used to test for differences among the treatment groups, at least
three repetitions. The level of significance was uniformly set at
p < 0.05.
3. Results
3.1. Anti-oxidation and anti-diabetic capacity of PA extracts in vitro
EA and PAF-EA extracts showed significant α-glucosidase inhibitory
capacity (IC50 = 2.90 μg/mL and 4.04 μg/mL) comparable to that of the
known standard inhibitor acarbose (IC50 = 4.28 μg/mL).
3.2. Anti-diabetic capacity of PAG-EA and PAF-EA in 3T3-L1 cells and E47
cells
3.2.1. The effect of PAG-EA and PAF-EA on 3T3-L1 cell and E47 cell
viability
After the incubation of 3T3-L1 cells and E47 cells with the PAG-EA
and PAF-EA extracts for 24 h, there was no evidence of cytotoxicity to
the cells (Fig. 1), with a slight induction in 3T3-L1 cells (Fig. 1A). In
addition, DMSO was not cytotoxic to 3T3-L1 or E47 cells at a final
concentration of 0.1%.
3.2.2. Protection of PAG-EA and PAF-EA against H2O2-induced oxidative
damage in 3T3-L1 cells and CYP2E1-induced oxidative damage in E47 cells
The levels of ROS, LDH, and MDA increased, while that of CAT
decreased in 3T3-L1 cells after treatment with H2O2 (Fig. 2), as well as
in E47 cells with CYP2E1 overexpression [16] Treatment with PAG-EA
and PAF-EA decreased the levels of ROS, LDH, and MDA and increased
those of CAT in a concentration-dependent manner in both 3T3-L1 and
E47 cells (Figs. 2 and 3, respectively), and the effects were better than
those of VE. Moreover, the return of the enzymes to normal levels when
cells were treated with the PAG-EA and PAF-EA extracts indicated that
EA extracts of PA may relieve oxidative stress and provide protection
from oxidative damage resulting from H2O2 or CYP2E1 overexpression.
3.2.3. Effects of PAG-EA and PAF-EA on CYP2E1 and GLUT4 levels
In our study, 3T3-L1 pre-adipocyte cells differentiated into mature
adipocytes after 12 days. The mature adipocyte cells exhibited large
numbers of lipid droplets upon staining with the fat-soluble dye oil red
O (Fig. 4A). Treatment of the mature cells with PAG-EA and PAF-EA
extracts led to significant and concentration-dependent reductions in
the CYP2E1 mRNA and protein levels (Fig. 4B). However, the extract-
treated cells showed increased GLUT4 mRNA expression and protein
levels (Fig. 4C).

3.1.1. Total antioxidant capacity of PA extracts

3.3. Prevention of pre-diabetes of PAG-EA and PAF-EA in HFD induced pre-
High antioxidant activity can improve the level of resistance in DM.
diabetes rats
Therefore, we assessed the antioxidant capacity of the six PA extracts
using the ABTS assay. With ratios of 1.6 and 1.2, respectively, relative
3.3.1. Effects of PAG-EA and PAF-EA treatment on body weight
to VC, the PAG-EA and PAF-EA extracts had better free radical
The body weight/time progressions of the four rat groups are shown
scavenging capacity compared with the PE and AQ extracts (Table 1).
in Table 2. While the mean weights of the MOD group were higher than
those of the NC group after 20 and 28 days, the differences were not
3.1.2. Oxidation-reduction potential of PA extract significant. After 20 days oral administration, the mean body weight
From the FRAP results, the PAG-EA and PAF-EA extracts also had was slightly decreased in PAF-EA treated rats and more significantly
strong oxidation-reduction potentials at 1.20 μM and 0.69 μM equiva- decreased in PAG-EA treated rats compared to the MOD group. How-
lents of Fe-II, respectively (Table 1). ever, the lower weight was still similar to that in the NC group, in-
dicating that PAG-EA and PAF-EA extracts could be safe to a certain
3.1.3. α-Glucosidase inhibitory potential of PA extract extent.
IC50 values were calculated using a linear regression plot. The PAG-
3.3.2. Effects of PAG-EA and PAF-EA on FBG and lipid profile
Table 1 In MOD group rats, the FBG level was increased statistically com-
Anti-oxidant capacity, contents of total phenolics of in various extracts of Physalis alke- pared with the NC group after 20 days (p < 0.01), while the admin-
kengi.
istration of PAG-EA and PAF-EA produced markedly decreased FBG
Sample ABTS (fold of VC) FRAP (mM Fe-II) Total phenolics content (mg levels compared with the MOD group after 28 days (p < 0.05).
GAE/g) Meanwhile, the lipid profiles of TC and TG in the MOD group were
significantly higher than those in the NC group (p < 0.05). Reductions
VC 1 – –
Fe-II – 1 –
of 14.7% in TC and 4.10% in TG were observed in PAF-EA treated rats
PAG-PE 0.81 ± 0.13 0.67 ± 0.08 218.99 ± 1.13 compared with MOD rats after 28 days. In PAG-EA treated rats, even
PAG-EA 1.66 ± 0.049 1.22 ± 0.15 360.83 ± 5.11 larger reductions of 18.2% and 8.7% in TC and TG levels, respectively,
PAG-AQ 0.65 ± 0.11 0.53 ± 0.17 130.42 ± 2.76 were seen after 28 days (Table 2).
PAF-PE 0.57 ± 0.087 0.32 ± 0.18 271.81 ± 3.54
PAF-EA 1.21 ± 0.10 0.71 ± 0.15 283.23 ± 2.32
PAF-AQ 0.33 ± 0.046 0.64 ± 0.16 141.98 ± 1.12 3.3.3. Effects of PAG-EA and PAF-EA on GSP and FINS levels
GSP is regarded as a good measure of long-term (2–3 weeks) glucose

132
X.-F. Hu et al.
intolerance [17,18]; therefore, GSP was measured on days 10, 20 and
28 with a glucometer, while insulin was measured with an ELISA kit.
Although GSP decreased from 38.03 nmol/mL to 36.72 nmol/mL and
35.15 nmol/mL after PAG-EA and PAF-EA treatment, respectively, on
day 28, the differences between groups were not significant. Further-
more, after 28 days, PAG-EA and PAF-EA significantly decreased FINS
from 17.12 mIU/L to 14.46 mIU/L in the FP group and 13.99 mIU/L in
the GP group compared with the MOD group (Table 2).
133
Fitoterapia 127 (2018) 129–137
Fig. 1. Effects of PAG-EA and PAF-EA on the proliferation
of 3T3-L1 and E47 cells. The cell viability was analyzed
using an MTT assay after treatment with PAG-EA and PAF-
EA or DMSO for 24 h. (A) Cell viability in 3T3-L1 cells after
treatment with PAG-EA AND PAF-EA (0.01, 0.1, 1, and
10 μg/mL). (B) Cell viability in E47 cells after treatment
with PAG-EA AND PAF-EA (0.05, 0.5, and 5 μg/mL). The
results are expressed as the mean ± SD. *p < 0.05 and
**p < 0.01 represent statistical significance against the
control.
Fig. 2. Effects of PAG-EA and PAF-EA on the antioxidant
enzymatic activities in H2O2-induced 3T3-L1 cells. The ac-
tivities of LDH, ROS, MDA and CAT were measured by
appropriate assay kits after treatment with DMSO (model
control), PAG-EA and PAF-EA (0.1, 1, and 10 μg/mL), or VE
(0.02 μg/mL, positive control) for 24 h incubation prior to
exposure to 1.5 mmol/L H2O2 for 4 h. The negative control
was not exposed to H2O2. (A) PAG-EA and (B) PAF-EA
protect against H2O2-induced oxidative damage in 3T3-L1
cells. *p < 0.05, **p < 0.01 and ***p < 0.001 represent
statistical significance against the positive control.
#p < 0.05, ##p < 0.01 and ###p < 0.001 represent
statistical significance against the negative control.
The effect of PAG-EA and PAF-EA on insulin sensitivity was de-
termined by using three mathematical indices ISI, HOMA-IR, and AUC
during OGTT (Fig. 5). ISI values directly reflect the insulin sensitivity
status in an individual rat. A decreased ISI value, representing lowered
insulin sensitivity, was observed in pre-diabetic rats (1.3 vs.1.8,
p < 0.01). After 28 days of PAG-EA and PAF-EA supplementation, the
ISI values were increased significantly (FP group 1.6 vs. 1.3, p < 0.05
and GP group 1.9 vs. 1.3, p < 0.05). Increased HOMA-IR values in pre-
Fig. 3. Effects of PAG-EA and PAF-EA on antioxidant en-
zymatic activities in E47 cells. The activities of LDH, ROS,
MDA and CAT were measure by appropriate assay kits after
treatment with DMSO (negative control), PAG-EA and PAF-
EA (0.05, 0.5, and 5 μg/mL), or VE (0.02 μg/mL, positive
control) for 24 h incubation. CYP2E1 overexpression leads
to ROS and LDH up-regulation and CAT down-regulation.
(A) PAG-EA and (B) PAF-EA reduced oxidative stress.
*p < 0.05 or **p < 0.01 represents statistical significance
against the negative control.
X.-F. Hu et al.
Fig. 4. (A) 3T3-L1 preadipocytes were successfully differentiated into adipocytes. (B) Expression levels of CYP2E1 protein and mRNA were reduced after treatment with PAG-EA and PAF-
EA for 48 h in E47 cells. (C) PAG-EA and PAF-EA significantly increased the GLUT4 protein and mRNA expression after 48 h. The CYP2E1 and GLUT4 mRNA values are represented as a
fold change. *p < 0.05 and **p < 0.01 represent statistical significance against the control.
diabetic rats (3.56 vs. 2.25, p < 0.01) suggested higher insulin re-
sistance. The HOMA-IR values in the PAG-EA and PAF-EA-treated rats
were significantly lower than that in the pre-diabetic rats after 28 days
(FP group 2.57 vs. 3.56, p < 0.05 and GP group 2.31 vs. 3.56,
p < 0.05). To provide an additional measure of pre-diabetes control,
AUC was calculated for OGTT results on day 28 for all treatment
groups. AUC values were significantly increased in pre-diabetic rats as
compared to their normal counterparts (13.07 vs. 11.42, p < 0.01).
Treatment with PAG-EA and PAF-EA, especially in the GP group, led to
significantly decreased AUC values as compared to pre-diabetic coun-
terparts (12.47 vs. 13.07, p < 0.05), showing improved insulin sensi-
tivity.
3.4. Total phenolic content of PA extract
Based on numerous scientific studies, phenolic compounds found in
many plants possess high antioxidant activity [19,20]. This study found
high total phenolic content in PA extracts, especially the EA extracts
with 0.036 and 0.030 mg GAE/g for PAG-EA and PAF-EA, respectively
(Table 1).
3.5. Analysis of the compounds in PAG-EA and PAF-EA
The compounds in the PAG-EA and PAF-EA extracts were analyzed
134
Fitoterapia 127 (2018) 129–137
by HPLC-ESI-QTOF-MS. The main peaks were detected, and the peak
numbers, retention time, mass spectral data, and identification of the
compounds are listed in Table 3. The main compound types in the PAG-
EA and PAF-EA were identified as flavonoids, in addition to smaller
amounts of phenolic acids, physalins, and other components.
4. Discussion
Free-radical-initiated reactions induce a wide variety of patholo-
gical effects, such as DM, carcinogenesis, and atherosclerosis. Thus,
antioxidants with free-radical-scavenging activities may play a sig-
nificant role in the prevention and therapeutics of DM. Our results show
that, among the three solvent fractions of PA, the EA extracts had the
most beneficial antioxidant effects based on their ABTS free radical
scavenging ability and strong oxidation-reduction potential.
Meanwhile, because α-glucosidase retards the digestion and ab-
sorption of dietary carbohydrates, this enzyme is also an effective target
for the treatment for DM [21]. In this study, the PAG-EA and PAF-EA
extracts significantly inhibited α-glucosidase activity, indicating their
possible usefulness for better glucose management.
However, many natural compounds that show antioxidant effects in
vitro may exert a pro-oxidant effect in cultured cells or in vivo. Thus,
when antioxidant activities are found in vitro using chemical-based
methods, the effects must be verified next in cultured cells. Oxidative
X.-F. Hu et al. Fitoterapia 127 (2018) 129–137

Table 2 are important in evaluating the effects on free-radical-scavenging ac-

Effects of PAG-EA and PAF-EA on body weight, FBG, TC, TG, GSP, FINS in serum (n = 8). tivity and guarding against superoxide toxicity [19,23]. In this study,
when 3T3-L1 cells, which are widely used to study the relationship
Experimental 10 day 20 day 28 day
group between obesity, insulin resistance and type 2 DM [19], were exposed
to 1.5 mmol/L H2O2 for 4 h, the activities of MDA and LDH in the
Body weight (g) medium decreased, while that of CAT increased. This result is con-
NC 215.24 ± 13.37 275.58 ± 17.10 302.67 ± 17.94
sistent with the literature findings suggesting that H2O2 leads to oxi-
MOD 206.11 ± 12.66 289.34 ± 18.85 311.98 ± 18.13
FP 200.50 ± 8.02 283.98 ± 18.10 300.68 ± 11.95 dative stress [24]. In addition, multiple studies have demonstrated the
GP 197.36 ± 13.13 271.94 ± 10.99* 296.23 ± 9.29* significance of increased CYP2E1 expression in inducing oxidative
FBG (mmol/L)
stress [25]; consequently, E47 cells, which overexpress CYP2E1, are
NC 5.90 ± 0.50 4.25 ± 0.41 4.22 ± 0.45 used frequently in oxidative studies [26,27]. Therefore, in this research
MOD 5.68 ± 0.63 5.80 ± 0.45## 4.95 ± 0.46## on the anti-diabetic activity of PA, both oxidative stress models (3T3-L1
FP 5.31 ± 0.63 5.70 ± 0.47 4.36 ± 0.50* cells induced by H2O2 and E47 cells with overexpressed CYP2E1) were
GP 5.53 ± 0.59 5.67 ± 0.39 4.36 ± 0.49*
used. After the cells interacted with the PAG-EA and PAF-EA extracts,
TC (nmol/mL) the oxidative markers returned to the normal levels in both models.
NC 67.80 ± 11.91 65.64 ± 12.17 71.98 ± 9.36
These results indicate that PAG-EA AND PAF-EA might relieve the
MOD 67.78 ± 9.02 66.51 ± 8.66 86.11 ± 7.90#
FP 65.49 ± 6.16 67.82 ± 4.62 73.42 ± 11.33* oxidative stress associated with DM.
GP 64.51 ± 10.36 65.77 ± 8.35 70.41 ± 12.61* Because the PAG-EA and PAF-EA extracts showed both significant
TG (mIU/mL)
antioxidant capacity and α-glucosidase inhibitory activity, the next
NC 158.25 ± 12.78 160.47 ± 12.42 143.00 ± 16.69 studies probed the anti-diabetic mechanism of PAG-EA and PAF-EA.
MOD 182.91 ± 11.97# 176.28 ± 11.93 178.73 ± 5.71# First, the successful differentiation of 3T3-L1 pre-adipocytes into adi-
FP 152.38 ± 18.32* 159.90 ± 18.59 171.49 ± 8.50 pocytes (Fig. 5) was confirmed and was consistent with the literature
GP 131.25 ± 10.34** 141.77 ± 12.37** 163.23 ± 11.02*
[28] In the diabetic state, insulin resistance can ultimately decrease the
GSP (nmol/mL) translocation of GLUT4 from the vesicles to the cell membranes, as
NC 34.05 ± 5.84 35.06 ± 7.36 34.56 ± 4.68
observed by many researchers in STZ-induced diabetic rats [29].
MOD 34.79 ± 3.56 38.52 ± 3.65 38.03 ± 3.18
FP 32.56 ± 5.18 34.65 ± 5.88 36.72 ± 8.63
Therefore, increased GLUT4 expression in cell plasma membranes fol-
GP 31.43 ± 3.14 33.89 ± 4.62 35.15 ± 3.17 lowing insulin stimulation is closely associated with the enhanced
FINS (mIU/L)
glucose uptake in adipocytes and skeletal muscle cells. In addition,
NC 12.09 ± 1.58 13.48 ± 2.05 12.25 ± 1.86 enhanced CYP2E1 activity can promote insulin resistance in vitro and in
MOD 15.21 ± 1.80# 17.88 ± 1.19# 17.12 ± 1.66## vivo [30]. Studies also have suggested that increased ketones and other
FP 13.23 ± 1.17* 14.54 ± 1.29* 14.46 ± 1.52* small organic molecules in diabetes act as inducers of CYP2E1 [31].
GP 13.03 ± 0.68* 14.31 ± 1.51* 13.99 ± 1.74*
Interestingly, DM results in a state of increased ROS and CYP2E1 pro-
The values are expressed as mean ± SD, #p < 0.05, ##p < 0.01 represent statistical
duction, as well as decreased GLUT4 expression and function [32].
significance against the NC group; *p < 0.05, **p < 0.01 represent statistical sig- Furthermore, CYP2E1 impairs GLUT4 gene expression and function
nificance against MOD group. using NRF2 as a mediator [13]. In this study, PAG-EA and PAF-EA
significantly reduced the levels of CYP2E1 mRNA and protein but in-
stress is associated with DM and occurs due to the excessive generation creased the level of GLUT4. Based on this result, the PAG-EA and PAF-
of reactive oxygen species (ROS) [19], which can also enhance insulin EA extracts might enhance GLUT4 expression and function by in-
sensitivity [22]. Damage is also associated with the inactivation of hibiting the expression of CYP2E1 mRNA and protein.
endogenous anti-oxidant enzymes, such as MDA, LDH and CAT, which In studies on animals, rats fed long term with a HFD had sig-
nificantly higher FBG and FINS compared to normal animals in

Fig. 5. Effects of PAG-EA and PAF-EA on (A) ISI and (B)

HOMA-IR after 28 day treatment in various rats, (C) blood
glucose concentration after oral 20% glucose (2 g/kg) and
(D) the AUC of OGTT in pre-diabetic rats. The values are
expressed as mean ± SD (n = 8). *p < 0.05, **p < 0.01
represent statistical significance against the MOD group;
#p < 0.05, ##p < 0.01 represent statistical significance
against the NC group.

135
X.-F. Hu et al. Fitoterapia 127 (2018) 129–137

preventive trials, as well as exhibited the symptoms characteristic of

PubChem CID

12,310,830
14,158,103

44,258,009

15,596,585
insulin resistance [33]. The pre-diabetic rats in our model also showed

5,280,805

5,280,804

5,282,102
5,280,441

5,317,750

4,873,003

5,280,443
431,071
the same symptoms, while the HFD-induced pre-diabetic rats treated
with PAG-EA and PAF-EA exhibited lowered FBG and FINS in associa-
fruit tion with lipid metabolism. Furthermore, insulin sensitivity in vivo was

fruit
fruit
fruit
fruit
fruit
fruit

fruit
fruit
fruit

fruit
fruit
enhanced in PAG-EA and PAF-EA treated pre-diabetic rats, as reflected
by increased ISI and decreased HOMA-IR and AUC values. Collectively,
ground,

ground,
ground,
ground,
ground,
ground,
ground,

ground,
ground,
ground,

ground,
ground,
ground

ground

ground
the in vivo results confirmed the in vitro results in mature adipocytes and
fruit
fruit

fruit

E47 cells.
Source

of
of
of
of
of
of
of
of
of
of
of
of
of
of
of
of
of
of
Phenolic compounds, including flavonoids, are important anti-
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
EA
oxidants in many plants, and our results indicated that PA extracts have
Quercetin 3-(6-rhamnosylglucoside)

a high total phenolic content. The EA extracts, which displayed the

Kaempferol 3-(6-acetylgalactoside)
Quercetin 3-(6″-acetylglucoside)

highest antioxidant activity, have particularly high amounts of phenolic

Chrysoeriol apiosylglucoside

compounds, consistent with previously reported results [34,35]. An

5-p-Coumaroylquinic acid

Isorhamnetin 3-glucoside
Aromadendrol glucoside

analysis by HPLC-ESI-QTOF-MS characterized the main components as

Quercetin 3-O-glucoside

Kaempferol 3-glucoside
Chrysoeriol glucoside

flavonoids, along with physalins, phenolic acids, and other compound

5-Caffeoylquinic acid

7-O-methylorobol
types. The PAG-EA and PAF-EA extracts contain essentially the same
constituents, while the PAG-EA extract contains more polyphenols and
Physagulin F
Compound

Physalin D
Coroloside

flavonoids than the PAF-EA extract. Interestingly, based on the above

Glycitein

Apigenin
Vitexin

pharmacological activity results in vitro and in vivo, the anti-diabetic

capacity of the ground parts (PAG) was better than that of only the fruit
(PAF). Polyphenols and flavonoids could be active anti-diabetic com-
Molecular formular

ponents of PA [36]. Specifically, according to the known compounds

identified, apigenin may regulate glucose and lipid metabolism [37];
C21H21O11
C22H21O12
C27H29O16
C27H29O15
C21H19O12
C22H21O11
C21H19O11
C21H19O10
C23H21O13
C23H21O12

C28H31O11
C35H53O12

quercitrin can potentially be a possible source of new drugs for the

C16H17O9
C16H17O8

C16H11O5

C30H39O9

C16H11O6
C15H9O5

treatment of T2-DM [38].

In conclusion, PAG-EA and PAF-EA extracts exhibited significant
anti-diabetic activity in vitro and in vivo. Our results indicate that PA, a
1, 481.188 7, 179.165 8, 453.185 9, 193.084 8, 135.044 4

functional food and medicine food homology, could exhibit anti-dia-

betic activity. The in vitro effects included reduction of oxidative stress,
inhibition of α-glucosidase, and enhancement of insulin sensitivity with
3, 439.288 2, 179.056 5, 161.045 2, 113.024 8

reduced CYP2E1 expression and enhanced GLUT4 expression/function.

Furthermore, in vivo studies also suggested that PAG-EA and PAF-EA
extracts have anti-diabetic potential, as reflected by controlled hy-
269.043 9, 259.058 9, 243.062 2, 179.030 0

perglycemia and improved insulin sensitivity in pre-diabetic rats.

Meanwhile, PAG-EA and PAF-EA extracts were also found to improve
dyslipidemia. The main active components of PA could be flavonoids,
physalins, phenolic acids, and other components based on analysis by
Peak Numbers, Spectral Properties, and Identities of the Compounds in Samples of PAG-EA and PAF-EA.

163.035 8, 145.026 1, 119.046 6

These compounds were identified based on data in the Human Metabolite Database (www.hmdb.ca).

HPLC-ESI-QTOF-MS. While most prior therapeutic evaluations have

been carried out only with the fruit of PA, the current study included
the aerial parts of PA. Thus, this work expands the present knowledge
285.034 5, 269.040 5

283.019 0, 179.000 5
227.031 9, 151.000 7

167.029 7, 111.010 5

6, 353.173 5

on the pharmacological activities of this plant and highlights its po-

tential applications to improve antioxidant status, manage blood glu-
cose, inhibit insulin resistance, and improve dyslipidemia.
151.000 0

7
196.049
497.177
517.238
465.225

Conflict of interest
1,
1,

6,

2,
3,
4,

2,

6,
7,
6,
4,
5

4
3
Fragment ions (m/z)

The authors declare no conflicts of interest.

161.017
173.040
287.054
300.020
300.022
284.031
271.021
299.052
255.021
269.041
300.024
285.039
240.038
515.187
619.345
483.238
133.028
240.036

Acknowledgments
9,
2,
2,
9,
0,
8,
4,
6,
7,
2,
1,
6,
9,
6,
5,
5,
6,
2,
191.053
191.049
431.101
315.047
343.042
299.050
300.023
446.082
284.027
311.051
461.105
329.046
268.033
525.177
647.339
525.247
151.002
284.026

This work was supported by The National Natural Science

Foundation of China (No. 31400304, 81400791) and Cooperation be-
tween Industry and Academia Education Project of Ministry of
3
3
9
3
6
6
7
4
7
3
2
3
6
6
7
4
0
6
353.087
337.092
449.108
477.103
609.145
593.150
463.087
461.108
447.092
431.097
505.098
489.103
283.060
543.186
665.353
543.259
269.045
299.055

Education (201601031002). The authors thanks Dr. Hongbing Liu of

the National Center for Magnetic Resonance in Wuhan, Wuhan Institute
Cal.

of Physics and Mathematics, Chinese Academy of Sciences, for his en-

7
8
1
4
4
7
6
4
8
5
7
2
8
0
8
2
5
0

thusiastic help with the LC-ESI-QTOF-MS experiments and data ana-

353.082
337.089
449.108
477.101
609.148
593.144
463.088
461.102
447.090
431.094
505.101
489.103
283.055
543.183
665.353
543.259
269.040
299.050
[M-H]−

lysis.

Reference
11.3
11.5
13.3
14.5
14.9
15.4
16.3
16.8
18.4
18.5
22.0
24.9
27.1
29.8
30.2
30.8
31.1
9.2
Rt

[1] H. Yang, S. Han, D. Zhao, G. Wang, Adjuvant effect of polysaccharide from fruits of
Peak no.

Physalis alkekengi L. in DNA vaccine against systemic candidiasis, Carbohydr.

Table 3

Polym. 109 (2014) 77–84.

10
11
12
13
14
15
16
17
18

[2] Y. Hou, J.G. Jiang, Origin and concept of medicine food homology and its
1
2
3
4
5
6
7
8
9

136
X.-F. Hu et al.
application in modern functional foods, Food Funct. 4 (2013) 1727–1741.
[3] A.L. Li, B.J. Chen, G.H. Li, M.X. Zhou, Y.R. Li, D.M. Ren, H.X. Lou, X.N. Wang,
T. Shen, Physalis alkekengi L. var. franchetii (Mast.) Makino: an ethnomedical,
phytochemical and pharmacological review, J. Ethnopharmacol. 210( (2018)
260–274.
[4] Y. Guo, S.J. Li, J.X. Li, Z.Y. Ren, F. Chen, X.W. Wang, Anti-hyperglycemic activity of
polysaccharides from calyx of Physalis alkekengi var. franchetii Makino on alloxan-
induced mice, Int. J. Biol. Macromol. 99( (2017) 249–257.
[5] A.I. Hassan, M.A.M. Ghoneim, A possible inhibitory effect of Physalis (Physalis
pubescens L.) on diabetes in male rats, World Appl. Sci. J. 21 (5) (2013) 681–688.
[6] N. Sanchooli, Antidiabetic properties of Physalis alkekengi extract in alloxan-in-
duced diabetic rats, Res. J. Pharm. Biol. Chem. Sci. 2 (3) (2011) 168–173.
[7] N. Asano, A. Kato, K. Oseki, H. Kizu, K. Matsui, Calystegins of Physalis alkekengi
var. francheti (Solanaceae). Structure determination and their glycosidase in-
hibitory activities, Eur. J. Biochem. 229 (2) (1995) 369–376.
[8] M. Vessal, Z. Mostafavi-Pour, F. Kooshesh, Age and sex dependence of the effects of
an aqueous extract of Physalis alkekengi fruits on rat hepatic glucose 6-P dehy-
drogenase activity, Comp. Biochem. Physiol. B Biochem. Mol. Biol. 111 (4) (1995)
675–680.
[9] H. Tong, Z. Liang, G. Wang, Structural characterization and hypoglycemic activity
of a polysaccharide isolated from the fruit of Physalis alkekengi L, Carbohydr. Polym.
71 (2008) 316–323.
[10] R. Govers, Molecular mechanisms of GLUT4 regulation in adipocytes, Diabete
Metab. 40 (6) (2014) 400–410.
[11] B. Huang, H. Ke, J. He, X. Ban, H. Zeng, Y. Wang, Extracts of Halenia elliptica
exhibit antioxidant properties in vitro and in vivo, Food Chem. Toxicol. 49 (1)
(2011) 185–190.
[12] A.C. Valencia-Olvera, J. Morán, R. Camacho-Carranza, O. Prospéro-García,
J.J. Espinosa-Aguirre, CYP2E1 induction leads to oxidative stress and cytotoxicity
in glutathione-depleted cerebellar granule neurons, Toxicol. in Vitro 28 (7) (2014)
1206–1214.
[13] M. Armoni, C. Harel, M. Ramdas, E. Karnieli, CYP2E1 impairs GLUT4 gene ex-
pression and function: NRF2 as a possible mediator, Horm. Metab. Res. 46 (7)
(2014) 477–483.
[14] B. Horváth, P. Mukhopadhyay, G. Haskó, P. Pacher, The endocannabinoid system
and plant-derived cannabinoids in diabetes and diabetic complications, J. Pathol.
180 (2) (2012) 432–442.
[15] K. Raun, P. von Voss, C.F. Gotfredsen, V. Golozoubova, B. Rolin, L.B. Knudsen,
Liraglutide, a long-acting glucagon-like peptide-1 analog, reduces body weight and
food intake in obese candy-fed rats, whereas a dipeptidyl peptidase-IV inhibitor,
vildagliptin, does not, Diabetes 56 (1) (2007) 8–15.
[16] K.J. Woodcroft, M.S. Hafner, R.F. Novak, Insulin signaling in the transcriptional and
posttranscriptional regulation of CYP2E1 expression, Hepatology 35 (2002)
263–273.
[17] L. Kennedy, T. Mehl, W. Riley, T. Merimee, Non-enzymatically glycosylated serum
protein in diabetes mellitus: an index of short-term glycaemia, Diabetologia 21 (2)
(1981) 94–98.
[18] K. Rodriguez-Capote, K. Tovell, D. Holmes, J. Dayton, T.N. Higgins, Analytical
evaluation of the Diazyme glycated serum protein assay on the siemens ADVIA
1800: comparison of results against HbA1c for diagnosis and management of dia-
betes, J. Diabet. Sci. Technol. 9 (2) (2015) 192–199.
[19] J. Singh, P. Kakkar, Modulation of liver function, antioxidant responses, insulin
resistance and glucose transport by Oroxylum indicum stem bark in STZ induced
diabetic rats, Food Chem. Toxicol. 62( (2013) 722–731.
[20] X. Xu, F. Li, X. Zhang, Z. Wu, D. Li, In vitro synergistic antioxidant activity and
identification of antioxidant components from Astragalus membranaceus and
Paeonia lactiflora, PLoS One (5) (2014) e96780.
137
Fitoterapia 127 (2018) 129–137
[21] J. Yan, G. Zhang, J. Pan, Y. Wang, α-Glucosidase inhibition by luteolin: kinetics,
interaction and molecular docking, Int. J. Biol. Macromol. 64( (2014) 213–223.
[22] K. Loh, H. Deng, A. Fukushima, T. Tiganis, Reactive oxygen species enhance insulin
sensitivity, Cell Metab. 10 (4) (2009) 260–272.
[23] Y. Zhao, N. Lu, H. Li, Y. Zhang, Z. Gao, Y. Gong, High glucose induced human
umbilical vein endothelial cell injury: involvement of protein tyrosine nitration,
Mol. Cell. Biochem. 311 (2008) 19–29.
[24] F. Wang, S. Zhao, F. Li, B. Zhang, Y. Qu, T. Sun, T. Luo, D. Li, Investigation of
antioxidant interactions between Radix Astragali and Cimicifuga foetida and
identification of synergistic antioxidant compounds, PLoS One 9 (1) (2014) e87221.
[25] T. Ahn, C.H. Yun, D.B. Oh, Tissue-specific effect of ascorbic acid supplementation
on the expression of cytochrome P450 2E1 and oxidative stress in streptozotocin-
induced diabetic rats, Toxicol. Lett. 166 (1) (2006) 27–36.
[26] M.L. Chen, S.P. Ip, S.H. Tsai, K.M. Ko, C.T. Che, Biochemical mechanism of Wu-Zi-
Yan-Zong-Wan, a traditional Chinese herbal formula, against alcohol-induced oxi-
dative damage in CYP2E1 cDNA-transfected HepG2 (E47) cells, J. Ethnopharmacol.
128 (1) (2010) 116–122.
[27] D. Wu, X. Wang, R. Zhou, A. Cederbaum, CYP2E1 enhances ethanol-induced lipid
accumulation but impairs autophaghy in HepG2 E47 cells, Biochem. Biophys. Res.
Commu. 402 (1) (2010) 116–122.
[28] C.H. Zhang, R.Y. Yu, Y.H. Liu, X.Y. Tu, J. Tu, Y.S. Wang, G.L. Xu, Interaction of
baicalin with berberine for glucose uptake in 3T3-L1 adipocytes and HepG2 he-
patocytes, J. Ethnopharmacol. 151 (2) (2014) 864–872.
[29] M. Koren-Gluzer, M. Aviram, T. Hayek, Paraoxonase1 (PON1) reduces insulin re-
sistance in mice fed a high-fat diet, and promotes GLUT4 overexpression in myo-
cytes, via the IRS-1/Akt pathway, Atherosclerosis 229 (1) (2013) 71–78.
[30] H.T. Yao, P. Lin, Y.W. Chang, C.T. Chen, M.T. Chiang, L. Chang, Y.C. Kuo, H.T. Tsai,
T.K. Yeh, Effect of taurine supplementation on cytochrome P450 2E1 and oxidative
stress in the liver and kidneys of rats with streptozotocin-induced diabetes,
Toxicology 47 (7) (2009) 1703–1709.
[31] N. Shimojo, T. Ishizaki, S. Imaoka, Y. Funae, S. Fujii, K. Okuda, Changes in amounts
of cytochrome P450 isozymes and levels of catalytic activities in hepatic and renal
microsomes of rats with streptozocin-induced diabetes, Biochem. Pharmacol. 46
(1993) 621–627.
[32] Y. Shen, Y. Zhao, D. Zheng, X. Chang, S. Ju, L. Guo, Effects of orexin A on GLUT4
expression and lipid content via MAPK signaling in 3T3-L1 adipocytes, J. Steroid
Biochem. Mol. Biol. 138( (2013) 376–383.
[33] E.W. Kraegen, P.W. Clark, A.B. Jenkins, E.A. Daley, D.J. Chisholm, L.H. Storlien,
Development of muscle insulin resistance after liver insulin resistance in high-
fat–fed rats, Diabetes 40 (11) (1991) 1397–1403.
[34] Y.R. Liu, W.G. Li, L.F. Chen, B.K. Xiao, J.Y. Yang, L. Yang, C.G. Zhang, R.Q. Huang,
J.X. Dong, ABTS+ scavenging potency of selected flavonols from Hypericum per-
foratum L. by HPLC-ESI/MS QQQ: Reaction observation, adduct characterization
and scavenging activity determination, Food Res. Int. 58 (2014) 47–58.
[35] C. López-Alarcón, A. Denicola, Evaluating the antioxidant capacity of natural pro-
ducts: a review on chemical and cellular-based assays, Anal. Chim. Acta 763 (2013)
1–10.
[36] T. Matsui, T. Ueda, T. Oki, K. Sugita, N. Terahara, K. Matsumoto, α-Glucosidase
inhibitory action of natural acylated anthocyanins. 1. Survey of natural pigments
with potent inhibitory activity, J. Agric. Food Chem. 49 (4) (2001) 1948–1951.
[37] B. Ren, W. Qin, F. Wu, S. Wang, C. Pan, L. Wang, B. Zeng, S. Ma, J. Liang, Apigenin
and naringenin regulate glucose and lipid metabolism, and ameliorate vascular
dysfunction in type 2 diabetic rats, Eur. J. Pharmacol. 15 (773) (2016) 13–23.
[38] D.G. Semaan, J.O. Igoli, L. Young, E. Marrero, A.I. Gray, E.G. Rowan, In vitro anti-
diabetic activity of flavonoids and pheophytins from Allophylus cominia Sw. on
PTP1B, DPPIV, alpha-glucosidase and alpha-amylase enzymes, J. Ethnopharmacol.
5 (203) (2017) 39–46.