Development of A Universal Blocking Peptide For A Novel Class of Fluorescent Biosensors Based On Nanobodies (Master Thesis 2023)

FACULTY OF SCIENCE
Development of a universal
blocking peptide for a novel
class of fluorescent
biosensors based on
nanobodies
Robbe VAN GORP
Supervisor: Prof. Dr. Peter Dedecker Thesis presented in

Lab for Nanobiology
fulfillment of the requirements
Mentor: Silke Denis
for the degree of Master of Science
Lab for Nanobiology
in Biochemistry and Biotechnology
Academic year 2022-2023

© Copyright by KU Leuven
Without written permission of the promoters and the authors it is forbidden to reproduce or
adapt in any form or by any means any part of this publication. Requests for obtaining the
right to reproduce or utilize parts of this publication should be addressed to KU Leuven, Fac-
ulteit Wetenschappen, Celestijnenlaan 200H - bus 2100, 3001 Leuven (Heverlee), Telephone
+32 16 32 14 01.
A written permission of the promoter is also required to use the methods, products, schematics
and programs described in this work for industrial or commercial use, and for submitting this
publication in scientific contests.
Acknowledgements
With the submission of this master’s thesis, my five years as a student comes to an end. Working
for a whole year on this thesis is a great way of ending this education as it provided a real
challenge for me to perform my own independent research and solve problems . Completing a
thesis is never a one-man job. Many people were involved throughout the process and they all
deserve a special word of appreciation.
First and foremost, I would like to start by saying a massive thank you to Silke Denis for being
a great mentor. She was always ready to answer my questions, assist me with my experiments
or provide me with feedback on my thesis and presentations. Thanks to her mentorship, I
have grown as a scientist. Next, I want to thank professor Peter Dedecker for giving me the
opportunity to perform my thesis in his lab and on a topic that was of great interest to me. This
project allowed me to learn new techniques and improve my scientific skills. Thanks for all
the great feedback you provided during the labmeetings. A special word of thanks for Hana
Valenta and Vincent Van Deuren who are part of the NanoBlock project, for their expertise
and feedback on my project. I would also like to thank Iris for always providing help in the
lab. Furthermore, my gratitude extends to all other members and fellow thesis students of the
Lab for Nanobiology and 200G. Our constructive discussions but also the less scientific chats
contributed to the great atmosphere which made it a pleasure to come to the lab.
While I spend quite some time in the lab last year, there are also some important people outside
the lab environment that deserve a word of appreciation. Thank you to my best friends Quinten,
Xander and Toon for making the past five years unforgettable! Our weekly trips to Alma were
always something to look forward to so we could discuss our thesis adventures. Marie, thank
you for being such an amazing friend. Without your support I would not have been able to
have delivered this thesis. Thanks to our daily (late night) writing sessions we got through
this together. In addition, I would also like to thank all my friends from Chemika, especially
Ludwine and Alexander, for providing a very welcome distraction and creating memorable
moments. Last but certainly not least, I want to express my gratitude towards my family for
always being there, supporting me and believing in me. Thanks to their motivation throughout
the past year, I was able to deliver a thesis I can be proud of.
i
Contents
Acknowledgements i
Contents ii
List of Figures iv
List of Tables vi
List of Abbreviations vii
Summary x
Samenvatting xii
1 Introduction 1
1.1 Fluorescence: the gateway to cells . . . . . . . . . . . . . . . . . . . . . . . . 1
1.1.1 The basics of fluorescence . . . . . . . . . . . . . . . . . . . . . . . . 1
1.1.2 Fluorescent proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.1.3 Fluorescence microscopy . . . . . . . . . . . . . . . . . . . . . . . . . 3
1.2 Fluorescent biosensors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.2.1 Applications of genetically-encoded biosensors . . . . . . . . . . . . . 5
1.2.2 Architecture of genetically-encoded biosensors . . . . . . . . . . . . . 5
1.2.3 Types of genetically-encoded biosensors . . . . . . . . . . . . . . . . . 6
1.3 Antibodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
1.3.1 Conventional antibodies . . . . . . . . . . . . . . . . . . . . . . . . . 7
1.3.2 Nanobodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
1.3.2.1 Applications . . . . . . . . . . . . . . . . . . . . . . . . . . 10
1.3.2.2 Nanobody structure . . . . . . . . . . . . . . . . . . . . . . 10
1.4 Examples of nanobodies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
1.4.1 Nanobodies binding (R)FPs: LaM4 . . . . . . . . . . . . . . . . . . . 12
1.4.2 Nanobodies binding GPCRs: Nb6B9 . . . . . . . . . . . . . . . . . . 13
1.4.3 Nanobodies binding epitope tags: ALFA nanobody . . . . . . . . . . . 14
1.5 Methods to quantify protein-peptide interactions . . . . . . . . . . . . . . . . 17
1.5.1 Fluorescence polarization . . . . . . . . . . . . . . . . . . . . . . . . 18
1.5.2 Detection label-free techniques . . . . . . . . . . . . . . . . . . . . . 19
2 Project description 21
ii
CONTENTS iii
3 Materials and methods 23

3.1 General . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
3.2 Buffers and media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
3.3 Molecular biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
3.4 Protein purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
3.5 Binding assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
3.5.1 Fluorescence polarization binding assay . . . . . . . . . . . . . . . . . 28
3.5.2 Fluorescence intensity binding assay . . . . . . . . . . . . . . . . . . . 29
3.5.3 Native PAGE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
3.6 Eukaryotic cell experiments . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
3.7 Data analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
4 Results and discussion 32

4.1 Creation of nanobody mutants . . . . . . . . . . . . . . . . . . . . . . . . . 32
4.1.1 Rationale behind design of LaM4 mutant . . . . . . . . . . . . . . . . 33
4.1.2 Rationale behind design of Nb6B9 mutants . . . . . . . . . . . . . . . 33
4.1.3 Nanobody purification . . . . . . . . . . . . . . . . . . . . . . . . . . 34
4.2 Optimization of fluorescence polarization binding assay . . . . . . . . . . . . . 35
4.2.1 FITC-ALFA-Tag and FITC-GS-12 peptide concentration . . . . . . . . 36
4.2.2 Glycerol assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
4.2.3 Positive control: ALFA nanobody and ALFA-Tag . . . . . . . . . . . . 38
4.2.4 Negative control: ALFA nanobody and GS-12 peptide . . . . . . . . . 39
4.3 Evaluation of nanobody interaction with the ALFA-Tag . . . . . . . . . . . . 40
4.3.1 Interaction between (mutant) LaM4 and ALFA-Tag . . . . . . . . . . 41
4.3.2 Interaction between (mutant) Nb6B9 and ALFA-Tag . . . . . . . . . . 42
4.4 Evaluation of nanobody interactions with original targets . . . . . . . . . . . . 43
4.4.1 LaM4 binding to mCherry . . . . . . . . . . . . . . . . . . . . . . . . 43
4.4.1.1 Fluorescence intensity binding assay . . . . . . . . . . . . . . 43
4.4.1.2 Native PAGE . . . . . . . . . . . . . . . . . . . . . . . . . 44
4.4.2 Nb6B9 binding to activated β2 -adrenergic receptor . . . . . . . . . . . 45
4.4.2.1 Mutant 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
4.4.2.2 Mutant 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
5 Conclusion and future perspectives 49

5.1 Optimization of nanobody mutations . . . . . . . . . . . . . . . . . . . . . . 50
5.2 Optimization of binding assays . . . . . . . . . . . . . . . . . . . . . . . . . 51
5.3 Application in biosensors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
Bibliography 53
Appendices
A Risk assessment A. 1
B List of plasmids B. 1
C List of primers C. 1
List of Figures
1.1 Jablonski diagram . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

1.2 Structure of GFP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
1.3 Inverted fluorescence microscopy setup . . . . . . . . . . . . . . . . . . . . . 4
1.4 Different types of architectures for genetically-encoded fluorescent biosensors . 6
1.5 Antibody and scFv domain structure . . . . . . . . . . . . . . . . . . . . . . 8
1.6 Domain structure of antibody-derived molecules . . . . . . . . . . . . . . . . 9
1.7 Nb domain structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
1.8 Crystal structure of LaM4 - mCherry; Nb6B9 - β2 -AR and ALFA-Nb - ALFA-
Tag complexes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
1.9 Binding interactions of the LaM4 - mCherry complex . . . . . . . . . . . . . . 13
1.10 Binding interactions of the Nb80 - β2 -AR complex . . . . . . . . . . . . . . . 14
1.11 ALFA-Tag sequence and ALFA-Nb sequence . . . . . . . . . . . . . . . . . . 15
1.12 Binding interactions of the ALFA-Nb - ALFA-Tag complex . . . . . . . . . . . 17
1.13 Schematic overview of fluorescence polarization . . . . . . . . . . . . . . . . . 19
1.14 Schematic overview of SPR . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
1.15 Schematic overview of BLI . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
2.1 NanoBlock biosensor architecture . . . . . . . . . . . . . . . . . . . . . . . . 22
3.1 Preparation of 96-well plate for fluorescence polarization binding assay . . . . . 29
4.1 PyMol structure of ALFA nanobody residues selected to introduce in LaM4

and Nb6B9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
4.2 PyMol structure of WT-LaM4 residues selected for mutations . . . . . . . . . 33
4.3 PyMol structure of WT-Nb6B9 residues selected for mutations . . . . . . . . . 34
4.4 SDS-PAGE of LaM4, ALFA nanobody and Nb6B9 after PD10 desalting . . . . 35
4.5 FITC-ALFA-Tag fluorescence polarization measurement with increasing glyc-
erol concentrations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
4.6 Fluorescence polarization binding assay with the in-house purified ALFA Nanobody 39
4.7 Fluorescence polarization binding assay with NanoTag ALFA Nanobody . . . . 39
4.8 FITC-GS-12 peptide fluorescence polarization binding assay with in-house pu-
rified and NanoTag ALFA nanobody . . . . . . . . . . . . . . . . . . . . . . . 40
4.9 Fluorescence polarization binding assays with WT-LaM4 and mutant LaM4 . . 41
4.10 Fluorescence polarization binding assay with WT-Nb6B9 and mutant 1 Nb6B9 42
4.11 mCherry fluorescence intensity upon WT-LaM4 titration . . . . . . . . . . . . 44
4.12 CN-PAGE of WT-LaM4 and mutant LaM4 in complex with mCherry . . . . . 45
4.13 Fluorescence images of U2OS cells expressing eGFP-coupled WT-Nb6B9 . . . 46
4.14 Fluorescence images of U2OS cells expressing eGFP-coupled mutant 1 Nb6B9 47
iv
LIST OF FIGURES v
4.15 Fluorescence images of U2OS cells expressing eGFP-coupled mutant 2 Nb6B9 48
S1 Plasmid map of the pET28b expression vector with the ALFA nanobody . . . . B. 1
S2 Plasmid map of the pRSETb expression vector with the LaM4 nanobody . . . B. 2
S3 Plasmid map of the pET26b expression vector with the Nb6B9 nanobody . . . B. 2
S4 Plasmid map of the eukaryotic pcDNA3 expression vector with the eGFP cou-
pled Nb6B9 nanobody . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. 3
List of Tables
1.1 Overview of intermolecular interactions in the LaM4 - mCherry complex . . . . 12

1.2 Overview of intramolecular interactions of the ALFA-Tag side-chains . . . . . . 15
1.3 Overview of intermolecular interactions in the ALFA-Nb - ALFA-Tag complex . 16
3.1 Thermocycling conditions for PCR . . . . . . . . . . . . . . . . . . . . . . . 25
4.1 Concentration measurements of FITC-GS-12 and FITC-ALFA-Tag peptides us-

ing the absorbance at 495 nm . . . . . . . . . . . . . . . . . . . . . . . . . . 37
4.2 Concentration measurements of FITC-GS-12 and FITC-ALFA-Tag peptides us-
ing peptide bond absorbance at 205 nm . . . . . . . . . . . . . . . . . . . . . 37
S1 List of primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. 1
vi
List of Abbreviations
β2 -AR β2 -adrenergic receptor

Ab Antibody
Ag Antigen
APS Ammonium persulfate
BiFC Bimolecular fluorescence complementation
BLI Biolayer interferometry
BN-PAGE Blue-native PAGE
CDR Complementarity determining region
CN-PAGE Clear-native PAGE
(k)Da (kilo)Dalton
DMSO Dimethylsulfoxide
DNA Deoxyribonucleic acid
EDTA Ethylenediaminetetraacetic acid
ER Endoplasmic reticulum
Fab Fragment antigen-binding
Fc Fragment crystallizable region
FITC Fluorescein isothiocyanate
FOV Field of view
FP Fluorescent protein
FR Framework region
FRET Förster resonance energy transfer
GFP Green fluorescent protein
GPCR G protein-coupled receptor
H-chain Heavy chain
HCAb Heavy chain-only antibody
IgG Immunoglobulin G
L-chain Light chain
LaM Llama antibodies against mCherry
LB Luria-Bertani
MRE Molecular recognition element
MW Molecular weight
Nb Nanobody
PCR Polymerase chain reaction
POI Protein of interest
vii
LIST OF ABBREVIATIONS viii
PPIs Protein-protein interactions

RFP Red fluorescent protein
scFv Single-chain variable fragment
SD Standard deviation
sdAb Single-domain antibody
SDS Sodium dodecyl sulphate
SDS-PAGE Sodium dodecyl sulphate - polyacrylamide gel electrophoresis
SOC Super optimal broth with catabolite repression
SPR Surface plasmon resonance
TAE Tris-acetate-EDTA
TB Terrific broth
TEMED Tetramethylethylenediamine
VH Variable domain of the heavy chain
VHH Variable domain of heavy chain of heavy chain-only antibody
VL Variable domain of the light chain
WT Wild-type
LIST OF ABBREVIATIONS ix
Amino acids
Ala, A Alanine
Arg, R Arginine
Asn, N Asparagine
Asp, D Aspartate
Cys, C Cysteine
Gln, Q Glutamine
Glu, E Glutamate
Gly, G Glycine
His, H Histidine
Ile, I Isoleucine
Leu, L Leucine
Lys, K Lysine
Met, M Methionine
Phe, F Phenylalanine
Pro, P Proline
Ser, S Serine
Thr, T Threonine
Trp, W Tryptophan
Tyr, Y Tyrosine
Val, V Valine
Nucleobases
A Adenine
C Cytosine
G Guanine
T Thymine
U Uracil
Summary
Genetically-encoded fluorescent biosensors have proven to be valuable tools to study cellular

processes in a non-invasive manner. In vivo visualisation of cellular targets is essential in elu-
cidating cell signalling pathways. With fluorescence as output signal, we are able to look at
live cells in real-time with a high spatiotemporal resolution, providing dynamic information on
the intracellular environment. A wide variety of biosensor architectures exists, but their general
structure is always the same: a sensing domain for a specific target and a reporter domain.
An interesting new biosensor design is the universal NanoBlock architecture. The main im-
provement of this architecture is the use of nanobodies as a novel sensing domain. Nanobodies
are small antibody-like proteins that can bind with high affinity to their target. New nanobodies
binding other targets can be easily generated by immunizing Camelidae species, making this
biosensor widely applicable. An additional moiety of this sensing domain is the blocking pep-
tide that binds the nanobody when the target is absent. Target binding results in a displacement
of the blocking peptide and this conformational change causes a switch of the signal. In turn-
on sensors, target binding will result in fluorescence. Turn-off sensors on the other hand, are
initially fluorescent and target binding deactivates this by the induced conformational change.
Each nanobody-target pair requires a new blocking peptide. An improvement of the NanoBlock
architecture would be the introduction of a universal blocking peptide, preventing the need to
develop new blocking peptides for every nanobody-target pair. In this thesis we will focus on
the ALFA-Tag, a short α-helical peptide that binds to the ALFA nanobody with high affinity
through its complementarity determining regions but also via its framework regions. We will
examine if the ALFA-Tag can be used as a universal blocking peptide for engineered nano-
bodies, as this provides an easier solution than developing new blocking peptides. This project
aims to engineer nanobodies to incorporate affinity for the ALFA-Tag while preserving the
affinity for the original nanobody target.
Mutations were introduced in two model nanobodies, LaM4 and Nb6B9, based on the amino
acid residues of ALFA-Nb responsible for the interaction with the ALFA-Tag. Nanobody bind-
ing to the ALFA-Tag was assessed by fluorescence polarization binding assays. This assay was
first optimized using the ALFA-Nb - ALFA-Tag interaction. No observable ALFA-Tag binding
could be detected from the binding assays with the mutant nanobodies.
x
SUMMARY xi
As it is important that the blocking peptide has a lower affinity for the nanobody than the origi-
nal target, we also assessed if the introduced mutations affected this interaction. LaM4 binds
to the fluorescent protein mCherry. A first binding assay looked at the effect of binding on
fluorescence intensity of mCherry. As no effect was observable for WT-LaM4, another binding
assay was used. Native PAGE was attempted as an alternative but requires further optimiza-
tion to be able to assess LaM4 - mCherry interaction. The other mutated nanobody, Nb6B9,
has a membrane-bound activated GPCR as its target, the β2 -adrenergic receptor. Fluorescence
microscopy was employed to study the in vivo interaction using eGFP-coupled Nb6B9 mu-
tants. Binding was observed by localisation of the eGFP fluorescence towards the isoprenaline
activated receptor in the membrane.
Although no mutant LaM4 or Nb6B9 nanobody was found that binds the ALFA-Tag, the work
presented in this thesis provides a starting point for future research with new mutant nanobodies
and how these mutants can be improved. A fluorescence polarization binding assay was opti-
mized and tested for future use of identification of ALFA peptide binding. Additionally, other
binding assays were tested and evaluated for identifying the interaction between the original
target and the mutated nanobodies, which can also be employed and optimized during future
research.
Samenvatting
Genetisch-gecodeerde fluorescente biosensoren hebben bewezen waardevolle hulpmiddelen te

zijn om cellulaire processen op een niet-invasieve manier te bestuderen. In vivo visualisatie
van cellulaire targets is essentieel bij het ophelderen van signaaltransductie mechanismes. Met
fluorescentie als signaal kunnen we levende cellen in real-time bekijken met een hoge spatio-
temporele resolutie, waardoor we dynamische informatie krijgen over de intracellulaire om-
geving. Er bestaat een grote verscheidenheid aan biosensor architecturen, maar hun algemene
structuur is altijd hetzelfde: een sensordomein voor een specifiek doelwit en een reporter-
domein.
Een interessant nieuw biosensor ontwerp is de universele NanoBlock architectuur. De belang-

rijkste verbetering van deze architectuur is het gebruik van nanobodies als een nieuw sensor-
domein. Nanobodies zijn kleine antilichaam-achtige eiwitten die met hoge affiniteit aan hun
target binden. Nieuwe nanobodies die aan andere targets binden, kunnen gemakkelijk worden
gegenereerd door Camelidae-soorten te immuniseren, waardoor deze biosensor breed toepas-
baar wordt. Een extra onderdeel van dit sensordomein is het blocking peptide dat het nanobody
bindt wanneer het target afwezig is. Binding aan het target resulteert in een verplaatsing van
het blocking peptide en deze conformationele verandering veroorzaakt een wijziging van het
signaal. Bij turn-on sensoren resulteert target binding in fluorescentie. Turn-off sensoren daar-
entegen zijn aanvankelijk fluorescent en target binding deactiveert dit door de geı̈nduceerde
conformatieverandering.
Voor elk nanobody-target paar is een nieuw blocking peptide nodig. Een verbetering van de
NanoBlock architectuur zou de introductie van een universeel blocking peptide zijn, waardoor
het niet meer nodig is om voor elk nanobody-target paar nieuwe blocking peptiden te ontwik-
kelen. In deze thesis zullen we ons richten op de ALFA-Tag, een kort α-helicaal peptide dat
bindt aan het ALFA nanobody met hoge affiniteit via de complementariteitsbepalende regio’s
maar ook via de framework regio’s. We zullen onderzoeken of de ALFA-Tag gebruikt kan
worden als universeel blocking peptide voor gemanipuleerde nanobodies, aangezien dit een
eenvoudigere oplossing biedt dan het ontwikkelen van nieuwe blocking peptiden. Het doel van
dit project is om nanobodies te ontwikkelen met affiniteit voor de ALFA-Tag met behoud van
affiniteit voor het oorspronkelijke target van het nanobody.
xii
SAMENVATTING xiii
Mutaties werden aangebracht in twee test nanobodies, LaM4 en Nb6B9, gebaseerd op de

aminozuurresiduen van ALFA-Nb die verantwoordelijk zijn voor de interactie met de ALFA-
Tag. Binding van nanobodies aan de ALFA-Tag werd geëvalueerd met fluorescentie polarisa-
tie bindings assays. Deze assay werd eerst geoptimaliseerd met behulp van de ALFA-Nb -
ALFA-Tag interactie. Er kon geen waarneembare ALFA-Tag binding worden gedetecteerd uit
de bindings assays met de gemuteerde nanobodies.
Omdat het belangrijk is dat het blocking peptide een lagere affiniteit heeft voor het nanobody
dan het oorspronkelijke target, hebben we ook getest of de aangebrachte mutaties deze inter-
actie beı̈nvloedden. LaM4 bindt aan het fluorescerende eiwit mCherry. Een eerste bindings
assay keek naar het effect van binding op de fluorescentie-intensiteit van mCherry. Omdat er
geen effect waarneembaar was voor WT-LaM4, werd een andere bindings assay gebruikt. Als
alternatief werd native PAGE geprobeerd, maar dit vereist verdere optimalisatie om de LaM4 -
mCherry interactie te kunnen beoordelen. Het andere gemuteerde nanobody, Nb6B9, heeft een
membraangebonden geactiveerde GPCR als target, de β2 -adrenerge receptor. Fluorescentie-
microscopie werd gebruikt om de in vivo interactie te bestuderen met behulp van eGFP gekop-
pelde Nb6B9 mutanten. Binding werd waargenomen door localisatie van de eGFP fluorescentie
naar de door isoprenaline geactiveerde receptor in het membraan.
Hoewel er geen gemuteerd LaM4 of Nb6B9 nanobody werd gevonden dat aan de ALFA-Tag
bindt, biedt het werk in deze thesis een startpunt voor toekomstig onderzoek met nieuwe gemu-
teerde nanobodies en hoe deze mutanten kunnen worden verbeterd. Een fluorescentie polarisatie
bindings assay werd geoptimaliseerd en getest voor toekomstig gebruik voor identificatie van
ALFA peptide binding. Daarnaast werden andere bindings assays getest en geëvalueerd voor het
identificeren van de interactie tussen het oorspronkelijke target en de gemuteerde nanobodies.
Deze kunnen, mits optimalisatie, tijdens toekomstig onderzoek gebruikt worden.
Chapter 1
Introduction
1.1 Fluorescence: the gateway to cells
The discovery and emergence of fluorescence and fluorescent proteins had a major impact on
the research in cell biology, opening a new world of cell imaging. Fluorescence microscopy
is currently the standard method to study cellular structure and physiology. The wide range of
highly sensitive dyes and fluorescent proteins combined with the different microscopy setups
that currently exist, allow to obtain images with high contrast and spatiotemporal resolution.
An additional advantage is live-cell imaging, making fluorescence a very powerful tool that is
currently employed in a plethora of applications [1]. Areas of research in which fluorescence
is being employed include research into diseases like cancer [2, 3], diagnosis of several dis-
eases [4], drug development, etc. [5] This is a non-exhaustive list as the possible applications
with fluorescence are practically endless.
1.1.1 The basics of fluorescence
The basic principles of fluorescence rely on excitation and emission of light. Light with a shorter
wavelength is absorbed and on a nanosecond time scale, spontaneous fluorescent emission oc-
curs. Emission light typically has a longer wavelength than the excitation light. The difference
between these wavelengths is also referred to as the Stokes shift. This shift in wavelengths
makes it possible to filter out the emission light without having interference of the excitation
light [6].
Fluorescence is not the only possibility upon light absorption, other processes can also occur
and compete with fluorescence to cause a decrease in energy. The fluorescence quantum yield
ΦF describes what fraction of photons decay to the ground state via fluorescence rather than via
deactivation processes. All these processes are visually represented in the Jablonski diagram
displayed in Figure 1.1. The lowest energy level is the ground state S0 , no light excitation has
occurred. An outer shell electron goes to a higher energy level in the S1 or S2 excited singlet
states after excitation (10−15 s). Relaxation of the system can occur by vibrational relaxation
1
CHAPTER 1. INTRODUCTION 2
to a lower vibrational level and internal conversion (10−12 s). The isoenergetic internal conver-
sion is a transition from a low vibrational level to a higher vibrational level of a lower excited
state. These are a non-radiative processes that do not result in fluorescence. In the nanosecond
scale, fluorescence then occurs by the relaxation back to the ground state S0 , where different
vibrational levels can be reached, contrary to what is depicted in the figure. Phosphorescence
is the result of an isoenergetic intersystem crossing (10−10 s) from an excited singlet state to
a triplet excited state accompanied with a change of spin multiplicity. After vibrational relax-
ation to the lowest vibrational level of the triplet excited state, radiative relaxation occurs in
the form of phosphorescence. Again different vibrational levels can be reached, contrary to
what is depicted in the figure. Emission times are much longer with a time scale of micro- to
milliseconds [6, 7, 8]. The energy that is released when returning to the ground state is emitted
in the form of photons and can be calculated using the Bohr frequency condition: ∆E = hν
which can also be written in terms of wavelength h λc = ∆E. From this equation the shift in
wavelengths becomes clear [9].
Figure 1.1: Jablonski diagram. Adapted from [6].
1.1.2 Fluorescent proteins
The first fluorescent protein (FP) to be discovered was the 28 kDa Green Fluorescent Protein
(GFP) in the jellyfish Aequorea victoria in 1962 by Shimomura et al. [10]. This discovery
provided several opportunities, allowing cloning [11] and expression in prokaryotes (E. Coli)
and eukaryotes (C. elegans). Since GFP was able to be recombinantly expressed, it could be
used as a genetically-encoded marker [12]. Due to its intrinsic fluorescence, GFP can be used
as a reporter for several applications such as a marker for gene activity, protein labelling, etc.
Upon mutagenesis of GFP, new FPs were created with a shift in excitation and/or emission
wavelength, with colors ranging from yellow (YFP) to blue (BFP) . Engineering of a red FP
variant from GFP remained challenging for a long time, but a red fluorescent GFP-like DsRed
was isolated from anthozoa species in 1999 [13, 14].
All FPs have a similar structure consisting of an 11-stranded β-barrel that has a central α-
helix going through the center. The structure of GFP is displayed in Figure 1.2. The element
responsible for fluorescence is the chromophore and this is present in the center of the barrel.
Chromophore generation occurs autocatalytically starting from a tripeptide: X-Tyr-Gly with X
being any amino acid. For GFP, this chromophore consists of Ser65-Tyr66-Gly67. In blue FPs,
the Tyr residue might be interchanged for His, Phe or Trp. Structurally similar proteins that also
have a β-barrel but lack the chromophore will not fluoresce [15].
Figure 1.2: Structure of GFP (PDB: 1EMA). The central chromophore is enlarged on the
right.
Due to their easy expression, fusing an FP to the protein of interest (POI) is a commonly used
tool for in vivo imaging of cells. A range of techniques exist that employ FPs such as Förster
resonance energy transfer (FRET) and a variety of fluorescence microscopy applications [16].
The main focus in this thesis will be on applications in fluorescence microscopy.
1.1.3 Fluorescence microscopy
In order to perform fluorescence microscopy, the POI has to be coupled to a fluorescent label
or be intrinsically fluorescent. One of the advantages of fluorophores is that they can be excited
in a variety of ways including lasers as the most common approach but also LEDs and voltaic
arc lamps can be used. To obtain sufficient excited fluorophores for imaging, illumination with
high intensity is preferred. A relatively straightforward and easy to use fluorescence microscopy
setup is the inverted fluorescence microscopy configuration. This arrangement, where both the
illuminated and emitted light travels through the same objective lens, is referred to as epi-
fluorescence microscopy. This is a wide-field microscopy setup in which illumination of the
entire sample is done at the same time, without focusing on a specific point. A schematic view
of this setup is given in Figure 1.3. The correct excitation wavelength is selected by an excitation
filter. A dichroic mirror is added at a 45° angle to separate excitation and emission light. Only
the longer wavelength fluorescent emission light is able to pass through and go to the detector,
the excitation light is reflected back to the sample. If some of the excitation light still manages
to pass through the dichroic mirror, it will be removed by the emission filter before reaching
the detector, resulting in a detection of only the fluorescent emitted light [17]. An important
property to perform fluorescence microscopy is the signal-to-noise ratio. A high signal-to-noise
ratio will result in better and more detailed imaging. So an attempt should be made at both
reducing the background signal and improving the fluorescent signal [18].
Figure 1.3: Inverted fluorescence microscopy setup. Adapted from [17].
1.2 Fluorescent biosensors
Cell signalling is an enormously complex network of cascades and pathways necessary for cell
regulation. However, contrary to what is sometimes depicted in textbooks and articles, the cell
is not a static environment but highly dynamic. When studying these processes, it is important
to use high spatiotemporal resolution and minimally invasive techniques to look at in vivo cell
signalling in real-time. Fluorescence has always been an ideal tool for this due to the continu-
ously improving fluorescence microscopy modalities. First, this was done by in situ fluorescent
labelling of target proteins by fluorophore-conjugated antibodies for example. With the revo-
lution in the research towards FPs, new technologies were developed. One of the revolutions
in the imaging of cell signalling was the genetically-encoded calcium (Ca2+ ) FRET biosensor
Cameleon in 1997 [19]. Since the development of Cameleon, a plethora of improved designs for
genetically-encoded biosensors for a wide range of stimuli have emerged. Genetically-encoded
biosensors can be easily expressed in cells or even cell populations and tissues to visualise dy-
namic cell signalling pathways in a non-invasive manner. The general principle of sensors is
to transduce physical information of the target into a measurable signal [20]. Currently a wide
range of biosensors exists to allow the monitoring of ions, molecules, enzymes, changes in
conformation, signalling pathways, etc. and it only keeps on expanding [21]. While we will
focus on genetically-encoded biosensors based on fluorescence, other readout systems also ex-
ist, indicating the extreme variety in biosensors. These other signal outputs can for example be
luminescence or cell survival [22].
1.2.1 Applications of genetically-encoded biosensors
Since the main function of a genetically-encoded biosensor is to translate a specific cellular

stimulus into a measurable signal, they can have a wide range of applications for in vivo imag-
ing. Due to their high sensitivity, incredible versatility and low complexity, biosensors make
the ideal tool for use in biological research as they are easily expressed in cells, cell compart-
ments, tissues or whole organisms [23]. With the currently available biosensors, we are able
to measure dynamic cell properties like: changes in pH, protein-protein interactions, enzyme
activity, levels of ions (like Ca2+ ) and metabolites, etc. Introduction of biosensors can be done
in animal systems but also in plants [24]. Due to their ability to unravel biochemical path-
ways, biosensors are also implemented in the biomedical field as they are easily introduced in
different model organisms. Currently biosensors are used for research on cancer and tumors,
neurological disorders, inflammation and many other pathologies. Additionally, biosensors are
also being implemented for drug screening [25].
1.2.2 Architecture of genetically-encoded biosensors
Certain biosensor constructs can have an alternative structure, but we will provide the general ar-
chitecture that is used in most biosensors. Genetically-encoded biosensors (such as Cameleon)
are engineered protein systems enabled to sense a specific molecule or change in the cell envi-
ronment (chemical input signal) and transform this into a fluorescent measurable signal (optical
output signal). This results in the general architecture of genetically-encoded biosensors that is
made up of two parts: 1. sensing domain and 2. reporting domain [26].
1. Sensing domains
The sensing domain, or molecular recognition element (MRE), of the biosensor is necessary for
sensing protein-protein interactions, analyte molecules or enzymatic activity as is displayed for
FRET and intensiometric biosensors in Figure 1.4. Once the sensing domain interacts with its
target as a result of a change in the cellular environment, it will result in conformational change
that is coupled to the reporter domain to create the optical signal [27].
2. Reporter domains
The reporter domain is responsible for generating a measurable optical readout signal. This is
usually fluorescence but other readouts are also possible as mentioned above. FPs or FP do-
mains are the most commonly used reporter domains. These are fused to the sensing domain.
However, the challenge in biosensor design is to transduce the conformational change of the
sensing domain into an optical signal produced by the reporter domain, linkers between these
domains have an important influence on this [28]. Depending on the biosensor type, different
approaches exist to couple the information of the sensing domain into an optical signal gener-
ated by the reporter domain, FRET-based biosensors are an example. As FRET is dependent on
the distance between the two fluorophores, the sensor design has to incorporate this. A change
in the cellular environment resulting in the activation of the sensing domain should result in a
conformational change that alters the distance of the fluorophores. FRET-based biosensors are
ratiometric sensors as they rely on two FPs to create a signal based on FRET efficiency. Inten-
siometric sensors on the other hand, only rely on a single FP to detect changes in the cellular
environment. As a result of the conformational change in the sensing domain, the intensity of
the fluorescence emitted by the FP is altered, allowing for an optical readout [27, 29].
Figure 1.4: Different types of architectures for genetically-encoded fluorescent biosensors.

Adapted from [27].
1.2.3 Types of genetically-encoded biosensors
Generally speaking, genetically-encoded biosensors can be classified into five different cate-
gories. However, since the field of biosensors is continuously improving current designs and
developing new architectures, some exceptions may occur. These five categories are:
1. Intramolecular FRET biosensors: The two FPs that act as donor and acceptor are both
coupled to the MRE, see Figure 1.4 B and C. Changes in the cellular environment can
trigger a conformational change of the MRE resulting in an altered distance of the FPs
and consequently a different FRET efficiency. An example of an intramolecular FRET
sensor is Cameleon [19].
2. Intermolecular FRET biosensors: Like the previous group, these ratiometric based sen-
sors rely on FRET as a readout principle. The difference is that one FP is fused to a ’bait’
protein and the other FP is fused to a ’prey’ protein to study protein-protein interactions,
Figure 1.4 A. These biosensors thus consist of two separate molecules. Interaction will
again result in a change of FRET efficiency. This type of biosensor was for example used
to study G proteins [30].
3. Bimolecular fluorescence complementation (BiFC) based biosensors: Some FPs have the
ability to be split and refold into their native functional β-barrel structure. As a result,
these biosensors consist of the two parts of the FP that are each fused to the ’bait’ and
the ’prey’, see Figure 1.4 G. When the interaction between the bait protein and the prey
protein occurs it will initiate the refolding of the FP resulting in an optical signal. This
biosensor is frequently used for visualizing protein-protein interactions. An example is
the YFP [31, 32].
4. Single FP biosensors with an exogenous MRE: These are biosensors based on a single
circularly permutated FP, sensitive to a ligand or enzymatic activity. Ligand binding or
enzymatic modification will result in a change of the spectral properties of the chro-
mophore, see Figure 1.4 E and F. An example is Camgaroo [33].
5. Single FP biosensors with an endogenous MRE: FPs also have spectral changes that are
dependant on differences in the pH that acts as the endogenous MRE. Fluorescence in-
tensity will vary according to the pH in the cell. This allows for redox biosensing. An
example of a FP that is used for redox sensing is mNectarine [34].
Each specific type of biosensor has its dedicated application and is specifically tuned for that.
This resulted in biosensors being a powerful method in biological research and due to this
popularity, the toolbox will only keep on expanding. Also the simultaneous application of
several biosensors is currently being researched [27, 35, 36, 37].
1.3 Antibodies
The immune system can be divided into two different parts; the innate and the adaptive im-
munity. Antibodies (Abs) play a major role in adaptive immunity to maintain the organisms
homeostasis by recognizing and eliminating foreign pathogens from the body. Due to their high
specificity and affinity they also provide the ideal research tools [38].
1.3.1 Conventional antibodies
Antibodies are immunoglobulin proteins (MW: ∼150 kDa) that have a commonly known Y-
shaped structure. When going more into detail, antibodies are composed of two heavy (H-
chain) and two light (L-chain) polypeptide chains, making them heterotetrameric proteins. The
bottom part of the Y-shaped structure is made up of the C-terminal parts of the H-chains which
forms the crystallizable fragment (Fc). This part of the Ab can function as a target for certain
receptors to remove the antigen (Ag) bound antibody. Antigen binding by the antibody occurs
at the N-terminal part of the Ab in the antigen-binding fragment (Fab) made up of both the L-
and H-chain since here a huge sequence variability is observed [38, 39].
Antibodies have a conserved domain architecture that forms a globular protein with each do-
main having the characteristic immunoglobulin fold [40] formed predominantly of anti-parallel
β-sheets. Two Fab fragments are linked to the Fc fragment via the hinge region. Depending
on Ab isotype and class this hinge region can vary in length and flexibility. At the top of each
Fab fragment an antigen binding sites (paratopes) is present. Both L- and H-chains have a vari-
able domain, respectively VL and VH which are structurally similar domains. H-chains posses
three constant domains (CH1, CH2 and CH3) while the L-chains only have one (CL). The CL
and CH1 domains still belong to the Fab fragment, CH2 and CH3 to the Fc. Like the variable
domains, the constant domains all display three -dimensional structural similarity with each
other [41]. A schematic overview is provided in Figure 1.5.
Figure 1.5: Domain structure of an antibody and a scFv. Figure adapted from [42].
Abs have applications as FDA and EMA approved therapeutics and diagnostics for diseases
including cancer, heart disease, immune disorders etc. [43]. They have proven to be power-
ful tools for research as a result of their high affinity and high specific interaction with every
possible target. Commonly used techniques like ELISA, western blotting, ChIP etc. rely on
antibodies [44]. However, bacterial and eukaryotic production remains difficult due to their het-
erotetrameric architecture comprising of up to 15 disulphide bonds, combined with their large
MW. For use in biosensors, other and smaller antibody derived tools need to be developed [45].
Antibody-derived molecules like single domain antibodies (sdAbs) can be promising alterna-
tives. An example is the single-chain variable fragment (scFv) that is build up of the variable
domains of the heavy and light chain which are synthetically linked to form one polypeptide
chain with an Ag binding site, see Figure 1.5. While they offer a reduced size, the antigen
specificity remains. However, a lower antigen affinity is observed due to the availability of only
one paratope [46].
1.3.2 Nanobodies
Besides the universally known and commonly used conventional antibodies, other types of
antibody-like molecules have been discovered. The serum of Camelidae species (Camelus
dromedarius, Camelus bactrianus, Lama glama, Lama guanoco, Lama alpaca and Lama vicu-
gna) contains a remarkable type of Immunoglobulin G (IgG) antibody which are missing the
L-chain. These Abs are known as heavy chain-only antibodies (HCAbs). Homodimeric HCAbs
were first discovered by Hamers et al. in the serum of camels [47]. The main difference with
regular IgGs is that HCAbs lack both the L-chain and the CH1 domain. As a result, antigen
binding by HCAbs is only regulated through the variable domain of heavy chain of HCAbs
(VHH) as opposed to the paired VL and VH in heterotetrameric IgGs [48]. This monomeric
binding fragment of this sdAb is more commonly known as a nanobody (Nb). As Nbs have
a MW of around 15kDa, making them about ten times smaller in size than conventional anti-
bodies, they are much more easily expressed. In addition, they display stable folding, have a
compact structure, high thermal stability, are more resistant to pH and proteases and are highly
soluble. Thanks to these advantages, nanobodies are becoming increasingly popular for re-
search and clinical applications [42, 49]. In Figure 1.6 an overview is given of the domain
structure of HCAbs and Nbs.
Figure 1.6: Domain structure of antibody-derived molecules: (a) HCAb and (b) Nb.
Figure adapted from [42].
Nanobodies can be applied as intrabodies for applications inside live cells or they can be pro-
duced and purified for extracellular applications. Purified Nbs can be further functionalized
for the desired application. Functionalization methods include chemical cross-linking, enzyme-
mediated coupling. Coupling can be done in a random or a sequence specific manner. Different
organisms are used for Nb expression, these include bacteria (E. Coli), yeast (Pichia pastoris,
Saccharomyces cerevisiae) or even mammalian cells [49].To obtain the correct nanobody’s im-
munoglobulin fold, an optimal oxidizing environment is required due to the presence of disul-
phide bonds, as in other antibody derived molecules. When looking at intrabodies, we have to
consider the effect of the reducing cytosolic environment as this will impair disulphide bond
formation. In eukaryotes this is easily solved by localising the expression towards the mito-
chondria or the endoplasmic reticulum (ER) [50]. For expression in E. coli, the periplasmic
space1 has the optimal redox conditions. In order to popst-translationally translocate the Nb
from the cytoplasm to the periplasmic space, an N-terminal petide signal pelB is used. After
translocation periplasmic signal peptidases cleave off pelB resulting in the original N-terminus
of the nanobodies [51]. Another possibility to overcome the reducing cytoplasmic environment
is to employ mutant E. Coli strains with an optimal oxidizing environment. These strains are for
example Rosetta-gami B (DE3) or SHuffle T7 [52]. Additionally, some nanobodies like ALFA-
Nb and Nb6B9 do not require these optimal redox conditions and can be readily expressed in
the bacterial or eukaryotic cytoplasm [50, 53].
1.3.2.1 Applications
Nanobodies have been used for several applications due to their small size and monomeric
nature. They help in determining the structure of their antigen and allow studying of protein
conformational states [54]. Chromobodies are intracellularly expressed nanobodies fused to a
FP that allow to localise the antigen in the cell [55, 56]. Enzymes have also been engineered
by the introduction of Nbs as a new method of generating protein knockouts [57]. Besides
their applications in biochemical research, Nbs are also applied in the biomedical sector. A
wide range of diagnostic tests, both in vitro and in vivo, have been developed based on Nbs.
These diagnostic tests are based on an improved double-antibody sandwich (DAS)-ELISA for
the detection of several biomarkers [58]. They can for example provide an early detection
of cancer [59] or cardiovascular screening [60]. Lastly, nanobodies can also serve as novel
therapeutics. For example Nbs are used to neutralize the effect of scorpion venom [61]. The
first FDA and EMA approved nanobody therapy was Caplacizumab from the company Ablynx-
Sanofi preventing blood clot formation in patients with acquired thrombotic thrombocytopenia
purpura [62]. Several nanobody based therapies are still in clinical trial. Due to the multitude
of applications of Nbs and the advantages over conventional antibodies, nanobodies provide an
excellent tool for introduction into the biosensor architecture. Nanobodies are an ideal sensing
domain recognising any possible antigen [39].
1.3.2.2 Nanobody structure
The general structure of all Nbs is build up of an IgV fold with nine β-strands. These are
subdivided in a four- and a five-stranded β-sheet, which are connected through loops. Antigen
recognition by the Nb paratope is realised via three hypervariable domains which are called the
complementarity determining regions (CDR1-3), present on the Nb surface. These are found
in between the four more conserved framework regions (FR1-4) of the Nb, see Figure 1.7.
A conserved disulphide bridge between Cys23 and Cys94 that bridges FR1 and FR3 helps in
stabilising the CDRs [42, 49]. This disulphide bridge is however not essential in all nanobodies
as intrabodies like the ALFA-Nb and Nb6B9 are functional after expression in the reducing
cytoplasmic environment, which impairs disulphide bond formation [50, 53].
1
Space between the inner cytoplasmic membrane and the outer membrane of gram-negative bacteria.
Figure 1.7: Nb domain structure. Adapted from [49].
1.4 Examples of nanobodies
Currently, an enormous variety of nanobodies for different targets exists. In the span of this
thesis, we will put our focus on three different nanobodies. These are LaM4, Nb6B9 and the
ALFA nanobody, see Figure 1.8. They are discussed in more detail in the following paragraphs.
Figure 1.8: Crystal structure of (a) LaM4 - mCherry (PDB: 6IR1) (b) Nb6B9 - β2 -AR
(PDB: 6H7N) and (c) ALFA-Nb - ALFA-Tag (PDB: 6I2G) complexes. Nanobodies are
indicated in cyan, their targets in magenta.
1.4.1 Nanobodies binding (R)FPs: LaM4
Nanobodies binding red fluorescent proteins (RFPs) help to improve the range of applications
for fluorescent imaging. An example is the use of Llama Tag specific to the RFP mCherry to im-
age the dynamics of transcription factors in live cells with a high spatiotemporal resolution [63].
A collection of mCherry-binding nanobodies were developed by Fridy et al. These were named
llama antibodies against mCherry (LaM) [64]. We will focus on the LaM4 - mCherry complex
as it is one of the test systems we employed during this project (see Figure 1.8(a)).
Like in other nanobodies, the main binding interactions are encoded in the LaM4 CDRs. LaM4’s
CDR3 forms an α-helix with residues QRL (109-111). Several interactions are important for
the LaM4 - mCherry complex formation. The crystal structure showed that most interactions
are made by the LaM4 CDR3. Hydrogen bonds are formed between N103 and K84’; N108 and
E10’; G102 and Y38’; L101 and D81’ with mCherry residues indicated with an apostrophe. An
additional H-bond was also observed between residue R28 which is part of LaM4 CDR1 and
Q188’ of mCherry. A detailed overview of the interactions is given in Table 1.1 and Figure 1.9.
From the crystal structure it is also clear that the binding site for LaM4 is at the bottom of
mCherry β-barrel. Here we can also find both the N- and C-terminus of mCherry [65].
Table 1.1: Overview of intermolecular interactions in the LaM4 - mCherry complex.

mCherry residues are indicated with an apostrophe. Adapted from [65].
mCherry residue LaM4 residue Interaction Distance (Å)

K84’ N103 H-bond 2.9
E10’ N108 H-bond 2.8
Y38’ G102 H-bond 2.8
D81’ L101 H-bond 3.0
Q188’ R28 H-bond 3.0
Figure 1.9: Binding interactions of the LaM4 - mCherry complex. mCherry is displayed
in magenta, LaM4’s CDR1 in blue, CDR2 in green and CDR3 in red. Figure adapted
from [65].
1.4.2 Nanobodies binding GPCRs: Nb6B9
Membrane-bound G-protein coupled receptors (GPCRs) and their cognate heterotrimeric G-

proteins are essential in cell signalling pathways. An example of such a GPCR is the β2 -
adrenoreceptor (β2 -AR), which is activated by the (nor)adrenaline agonist and other endogenous
agonists like isoprenaline. Activation of the membrane-bound β2 -AR by an extracellular agonist
leads to a conformational change that promotes intracellular Gs -protein binding and subsequent
stimulation of adenylyl cyclases. The nanobody Nb80, which shows G-protein-like behaviour
for binding the activated β2 -AR, was discovered by Rasmussen et al. [66]. Although initially
developed to stabilize the active-state B2AR structure and thus enable crystallization, Nb80
was also fused to GFP and used as a biosensor to visualize β2 -AR activation in live cells [53].
An improved version of Nb80 was generated by directed evolution to increase the affinity for
agonist-bound β2 -AR. Screening resulted in the high affinity nanobody 6B9 (Nb6B9) [67]. We
will focus on the Nb6B9 - β2 -AR complex as this is one of the test systems we employed during
this project (see Figure 1.8(b)).
The crystal structure of Nb80 shows that CDR1 and CDR3 are mainly involved in complex
formation with the β2 -AR. Most of the interactions are hydrophobic. A loop of eight residues
(Y100, G101, A102, V103, L104, Y105, E106 and Y107) from CDR3 penetrates into an hy-
drophobic pocket of the receptor. Also four CDR1 residues (F29, S30, I31 and N32) provide
stabilizing interactions for complex formation, see Figure 1.10 [66]. When comparing crystal
structures of Nb80 and Nb6B9, Nb6B9 shows a slight rotation compared to Nb80. As a result
of the directed evolution, mutations in Nb6B9 improve its complementarity to the activated β2 -
AR. The mutated CDR3 hydrophobic residues V103I and L104I display improved fitting in the
pocket of β2 -AR. In addition, mutations Y100F and T33I resulted in a loss of hydrogen bonding
between these residues while providing a more hydrophobic interaction with the receptor sur-
face. Other mutations of Nb6B9 compared to Nb80 that improved its β2 -AR affinity are: S30A,
I31L, S56T, and E106D. Nb80 residues involved in β2 -AR interaction that were not mutated in
Nb6B9 include: S27, F29, A50, H52, N58, A102 and Y105 [67].
Figure 1.10: Binding interactions of the Nb80 - β2 -AR complex. β2 -AR is displayed in
orange, Nb80’s CDR1 in cyan and CDR3 in blue. Figure adapted from [66].
1.4.3 Nanobodies binding epitope tags: ALFA nanobody
We cannot underestimate the importance of epitope tags in science. Epitope tags consisting of a
short peptide like the FLAG® tag [68], His6 -tag [69], c-myc-tag [70], etc. have been proven use-
ful for several experimental techniques like immunostaining and immunoprecipitation, protein
purification, fluorescence microscopy and others. For these applications, the tags are genetically
fused to the POI. Most of the time, tags are optimized for a specific application. For example,
the His6 -tag is a well known tag in molecular biology that is used for Ni-affinity purification
of proteins [71, 72, 73]. While epitope tags are ubiquitous in science, a universal tag does not
exist. Certain criteria should be met in order to have a good and versatile working tag system.
These include that the tag is unique in the model system, small, monomeric, soluble, devoid of
charges and is resistant to chemical fixation. In addition, the tag should also not be degraded
by proteases or have an effect on the POI. However, few of the epitope tag systems are able to
fulful these criteria. A system that could incorporate all of the above mentioned criteria could
be the ALFA-Tag, resulting in a versatile epitope tag system [74].
The artificially designed ALFA-Tag consists of a sequence of 13 amino acids (SRLEEELR-

RRLTE) forming a spontaneously folding stable α-helix (length ∼2 nm and diameter ∼1.3 nm).
The α-helical structure is stabilized by a network of intramolecular interactions in the side-
chains. An overview is given in Table 1.2. A neutral charge of the peptide was obtained by
adding the additional TE residues. When fused to a POI, a P residue is added at both ends of the
ALFA-Tag to act as helix-breakers and reduce the influence of other secondary structures. This
specific sequence was chosen as it complies with certain criteria: 1) hydrophylic, 2) uncharged
at physiological pH, 3) resistant to fixation and crosslinking, 4) forms a stable α helix 5) absent
in (eukaryotic) model systems. See Figure 1.11. As this is a very versatile tag, integration can
be done at the N-terminus, the C-terminus and even in between separately folding domains of
the POI [74, 75].
Table 1.2: Overview of intramolecular interactions of the ALFA-Tag side-chains. Residues

of the ALFA-Tag are indicated with an apostrophe. Adapted from [74].
Residues Interaction Distance (Å)

E7’-R10’ Salt bridge 2.67
E7’-R11’ Salt bridge 2.77
R9’-T13’ H-bond 3.07
L4’-L8’-L12’ Hydrophobic array
Figure 1.11: (a) ALFA-Tag sequence and (b) ALFA-Nb sequence. Adapted from [74].
Several nanobodies binding epitope tags have already been identified. These Nbs include the
NbSyn2 binding the EPEA-tag [76], the BC2-Nb binding the BC2-tag [77], the Nb-gp41 bind-
ing the Moon-tag [78], the PepNb binding the Pep-tag [79] and several others [72]. We are
interested in a nanobody that binds to the ALFA-Tag. This ALFA-Nb was generated by immu-
nizing alpacas and resulted in a high affinity complex formation with the ALFA-Tag (Kd = 26
pM). Based on crystal structures from ALFA-Nb forming a complex with the ALFA-Tag, we
can take a closer look at the different residues responsible for this high affinity interaction. The
ALFA-Tag binds parallel with the ALFA-Nb due to the interactions that occur between them.
The paratope consists of residues present in the Nb’s CDR’s and FR’s while also containing
residues from the hydrophobic cavity formed by the five-stranded β-sheet. This binding is sta-
bilized by several polar and hydrophobic interactions. Almost all residues of the 13 amino acid
core sequence are involved in the binding and stabilization of the complex. When we have a
closer look at the residues that are important for interaction, we see that hydrogen bonds are
formed at the N-terminal end of the ALFA-Tag between S2’ and E5’ and CDR2 (S57, E58,
R59 and N61) while CDR3 (D105 and V107) is also interacting with R3’. This residue is also
involved in another interaction, where both R3’ and E7’ sandwich F110 resulting in a cation-Pi
interaction. Also hydrophobic interactions are observed, the leucine residues of the ALFA-Tag,
L4’, L8’ and L12’ interact with the ALFA-Nb’s hydrophobic cavity formed by the five-stranded
β-sheet. Finally, at the C-terminal end of the ALFA-Tag there are also polar interactions. E14’
interacts with R65 through hydrogen bond formation. The last observed interaction is between
R11’ and both D112 and Y42, with Y42 being a residue of the conserved region of the Nb.
Interactions are displayed in Table 1.2 and Figure 1.12 [74]. Due to its versatility, we aim to
employ the ALFA-Tag as a universal blocking peptide for the novel NanoBlock architecture.
Table 1.3: Overview of intermolecular interactions in the ALFA-Nb - ALFA-Tag complex.

Residues of the ALFA-Tag are indicated with an apostrophe. Adapted from [74].
ALFA-Tag residue ALFA-Nb residue ALFA-Nb domain Interaction

R11’ Y42 FR2 H-bond
E5’ S57 CDR2 H-bond
S2’ E58 CDR2 H-bond
E5’ R59 CDR2 Salt bridge
E5’ N61 CDR2 H-bond
E14’ R65 FR3 Salt bridge
R3’ D105 CDR3 Salt bridge
R3’ V107 CDR3 H-bond
R3’ and E7’ F110 CDR3 Cation-Pi
R11’ D112 CDR3 Salt bridge
L4’, L8’ and L12’ Hydrophobic cavity FRs Hydrophobic
Figure 1.12: Binding interactions of the ALFA-Nb - ALFA-Tag complex. The α-helical
ALFA-Tag is displayed in blue, the ALFA-Nb in orange. The N-terminal end is always
displayed on the left, the C-terminal end on the right. ALFA-Tag residues are displayed
with an apostrophe. (a) Polar interactions at ALFA-Tag’s N-terminal end. (b) Cation-
Pi interaction. (c) Hydrophobic interactions. (d) Polar interactions at ALFA-Tag’s C-
terminal end. Adapted from [74].
1.5 Methods to quantify protein-peptide interactions
In the scope of this thesis, we are interested in techniques that are able to detect protein-peptide
interactions to quantify binding of the ALFA-Tag peptide with different nanobodies like the
ALFA nanobody, LaM4 and Nb6B9. Several techniques can be employed to study in vitro
protein-peptide interactions, including FRET and fluorescence polarization. These techniques
require labeling of peptide and/or protein with a fluorophore to achieve detection of the interac-
tion [80]. Additionally, techniques exist that do not require this fluorophore labelling of either
of the interacting partners, these are for example surface plasmon resonance (SPR) [81, 82] and
biolayer interferometry (BLI) [83].
1.5.1 Fluorescence polarization
A relatively simple technique for measuring the in vitro interaction between a protein and a
peptide is fluorescence polarization. With this technique, binding between the POI and a small
(typically smaller than 1.5 kDa), fluorescently labeled peptide or oligonucleotide can be quan-
tified. This method relies on the polarization of light. Upon excitation of the sample containing
the POI and the labeled peptide with linearly polarized light, the emission light will also be po-
larized. However, the degree of polarization of the emission light is related to the rotation of the
fluorescently labeled peptide, since it depends on the fluorophore’s rotational speed relative to
the lifetime of the excited state. To quantify this, the emitted fluorescence intensity is measured
separately in the horizontal and vertical plane (the excitation light is polarized in one of these
planes) [84, 85].
When there is binding between the peptide and the POI, the formed complex will rotate a lot
slower than free labeled peptide and the emission light will still be polarized. Emission light
will however be mostly depolarized if the POI and the labeled peptide do not form a complex
due to the rapid Brownian molecular rotation of the fluorescent peptide. As a result, fluorescent
polarization assays are easy tools to provide information on the interaction between the POI
and a peptide. Interaction results in an increase in polarization, which can be displayed in a
binding curve. The other way around, competitive binding assays will result in the decrease of
polarization signal if a competitor of the peptide binds the POI, when these three components
are simultaneously present [84, 86]. A schematic overview is given in Figure 1.13.
Polarization is calculated using Equation (1.1) with I|| the intensity of emission light parallel
to excitation light and I⊥ the intensity of the emission light perpendicular to the excitation
light. For experimental measurements, a correction factor (G factor) will take differences of the
optical components of different instruments into account to allow for comparison of the results.
This gives the corrected Equation (1.2). Polarization can also be converted to anisotropy. This
dimensionless entity can easily be calculated using Equation (1.3) [84].
I|| − I⊥
P = (1.1)
I|| + I⊥
I|| − GI⊥
P = (1.2)
I|| + GI⊥
I|| − I⊥ 2P
A= = (1.3)
I|| + 2I⊥ 3−P
Figure 1.13: Schematic overview of fluorescence polarization. Adapted from [86].
1.5.2 Detection label-free techniques
While the techniques described above are very powerful, the addition of a detection label suf-
fers from some drawbacks. It can have effects on binding interactions and lead to false nega-
tive or false positive results. In response to that, label-free detection technologies were devel-
oped including SPR and BLI. SPR can detect both strong and weak interactions in vitro. High
Throughput Screening (HTS) is not achievable with this technique, but it can for example be
used as an extra validation step for interactions measured with other techniques that are capable
of HTS [87]. Detection of binding interactions occurs in flow cells with a carboxymethylated
dextran monolayer which is covalently coupled to a gold surface, on which the ligands are im-
mobilized. The other binding partner (analyte) is present in solution in the flow cell. Different
analyte concentrations flow over the immobilized ligand to characterise binding. An increase
in refractive index due to the increased mass as a result of binding is measured as a difference
in resonance angle δθ of refracted light. The shift in this angle is converted into resonance
units (RU) which is plotted in a sensorgram were binding can be observed and quantified, to-
gether with the kinetic parameters (kon and kof f ) [81, 88, 89]. A schematic overview is given
in Figure 1.14.
Another detection label-free method for analysis of biomolecular interactions, this time based
on the interaction of white light, is BLI. A ligand is immobilized on the tip of a biosensor using
various methods like the His-tag for example. This forms the biomolecular layer. Analyte is
again in the solution in which the biosensor is placed. Different analyte concentrations are
measured to asses binding kinetics. When binding takes place, a change in interference pattern
occurs as a result of a changed optical thickness at the tip of the biosensor. Just like in SPR,
the binding can be quantified using a sensorgram where a change in wavelength is plotted over
time [83, 90]. A schematic overview is given in Figure 1.15.
Figure 1.14: Schematic overview of SPR. Top: experimental setup of the flow cell with
sensor chip. Bottom: sensorgram. Adapted form [88].
Figure 1.15: Schematic overview of BLI. Top: experimental setup of the biosensor tip.
Bottom: sensorgram. Adapted from [83].
Chapter 2
Project description
Biosensors have proven to be important tools in elucidating cellular signalling pathways and
cascades. As mentioned in Chapter 1, their design is continuously improving in order to look
at cells in a more detailed way, using fluorescence as the output signal to monitor the cellular
activity with high spatiotemporal resolution. One of these novel architectures is the NanoBlock
genetically-encoded fluorescent biosensor. With a nanobody as sensing domain, they can be
universally utilized to bind a variety of targets since new target binding nanobodies can easily
be generated. An important additional moiety of the sensing domain is the blocking peptide.
Two different responses are possible based on the used linkers. In turn-on sensors, it will pre-
vent a fluorescence signal from occurring by binding to the nanobody in absence of the target.
Introduction of the nanobody target displaces the blocking peptide, resulting in a conforma-
tional change, activating the fluorescent reporter domain. The turn-off sensor functions the
other way around. Binding of the target displaces the blocking peptide, resulting in a confor-
mational change that turns off fluorescence which was initially on in absence of the target. A
schematic overview of the NanoBlock architecture is given in Figure 2.1.
The main goal of this thesis is to optimize the NanoBlock architecture by developing nanobodies
that bind a universal blocking peptide. We will do this by mutating nanobodies to incorporate
affinity for the short and stable ALFA-Tag, which could then be used as a universal blocking
peptide. One of the main advantages of using a universal blocking peptide for biosensors is
that it results in an improved and easier to employ NanoBlock architecture since the blocking
peptide can be universally implemented. This avoids the need to develop a new blocking peptide
for every nanobody-target pair.
This project can be subdivided into two main parts to achieve this goal. For both parts we
employ two different nanobodies, LaM4 and Nb6B9, as test systems. In the first part of this
thesis, mutations are introduced into these nanobodies with the aim of obtaining interaction with
the ALFA-Tag blocking peptide. Binding interaction with the blocking peptide is assessed by
fluorescence polarization binding assays. We will optimize this assay in order to obtain accurate
and reliable results.
21
CHAPTER 2. PROJECT DESCRIPTION 22
Figure 2.1: NanoBlock biosensor architecture. (a) Turn-on sensor. (b) Turn-off sensor.
Secondly, it is also important that the mutated nanobodies maintain the high affinity interaction
with their respective original target. The original targets are mCherry for LaM4 and the acti-
vated β2 -adrenergic receptor (β2 -AR) for Nb6B9. While a certain affinity for the ALFA-Tag
blocking peptide has to be introduced by the mutations, it should not exceed the nanobody’s
affinity for its original target. This is because the main principle of this NanoBlock biosensor
architecture is that upon introduction of the nanobody target, the ALFA-Tag blocking peptide
is displaced resulting in a measurable signal. We will employ a different strategy for each test
system to check the interactions with the original target. The Nb6B9 target binds to an activated
transmembrane GPCR, the β2 -AR. GPCRs are both difficult to purify and too large, making
it impossible to use them for fluorescence polarization binding assays. Therefore we will as-
sess the interactions between mutant Nb6B9 and the β2 -AR by in vivo fluorescence microscopy
upon agonist receptor activation. LaM4’s target mCherry can be purified much more easily.
We will attempt two different binding assays, first we look at the change of mCherry’s fluores-
cence intensity upon binding to LaM4. In the second binding assay we perform native PAGE to
determine complex formation of the mutated LaM4 with mCherry.
This projects aims at developing nanobodies that are able to bind the ALFA blocking peptide
as well as their original target. To achieve this, mutants of each nanobody test system will be
assessed on binding of both the blocking peptide as well as the original target. The ultimate
goal is to identify a mutant nanobody that is able to bind both components with correct affinity,
allowing for further testing in the NanoBlock biosensor with the ALFA-Tag as the universal
blocking peptide.
Chapter 3
Materials and methods
3.1 General
Experimental work was performed with the available equipment in the Lab for Nanobiology
and the affiliated labs of the biochemistry division at KU Leuven. All the used reagents were
from Thermo Fisher Scientific or Sigma-Aldrich unless otherwise mentioned.
1000x Antibiotic stocks: Stock solutions of ampicillin (100 mg/mL), kanamycin (50 mg/mL)
and chloramphenicol (34 mg/mL) were made and aliquots were stored at -20°C.
3.2 Buffers and media
Luria-Bertani (LB) broth: Liquid bacterial growth medium used for culturing of E. Coli cells.
Medium was made by adding 25 g/L LB Broth Miller to MilliQ water. After preparation, the
medium was autoclaved for one hour before use.
Luria-Bertani (LB) agar: Solid bacterial growth medium used for culturing of E. Coli cells.
Medium was made by adding 25 g/L LB Agar Miller to MilliQ water. After preparation the
medium was autoclaved for one hour. When cooled down to ∼50°C, the correct antibiotics
(ampicillin, kanamycin, or choramphenicol) were supplied with a final concentration of 1x
antibiotic stock. Petri dishes were filled with the LB agar and stored in the fridge at 4°C after
they solidified.
Terrific broth (TB): Liquid bacterial growth medium enriched in nutrients used for culturing
of E. Coli cells. Preparation of 1L medium requires: 24 g yeast extract, 12 g tryptone and 4 mL
glycerol. These were dissolved in 900 mL MilliQ water and autoclaved. After autoclaving,
100 mL 10x phosphate buffer was added.
10x Phosphate buffer: Buffer prepared by dissolving final concentrations of 0.017 M KH2 PO4
and 0.072 M K2 HPO4 in MilliQ water. Before use, the buffer was autoclaved for one hour.
23
CHAPTER 3. MATERIALS AND METHODS 24
Super optimal broth with catabolite repression (SOC): Liquid bacterial growth medium used
during transformation of E. Coli cells. Composition: yeast extract (5 g/L), tryptone (20 g/L),
NaCl (0.583 g/L), KCl (0.186 g/L), MgCl2 (0.952 g/L) and MgSO4 (1.204 g/L) dissolved in
MilliQ water. After autoclaving, glucose (3.603 g/L) was added.
Tris-NaCl (TN) buffer (100/300) : Buffer prepared by dissolving final concentrations of

100 mM Tris-HCl and 300 mM NaCl in MilliQ water. The pH was adjusted to 7.4 with 37%
HCl.
Tris-NaCl-imidazole (TNi) buffer (100/300/20) : Buffer prepared by dissolving final concen-

trations of 100 mM Tris-HCl, 300 mM NaCl and 20 mM imidazole in MilliQ water. The pH
was adjusted to 7.4 with 37% HCl.
Tris-NaCl-imidazole (TNi) buffer (100/300/40) : Buffer prepared by dissolving final concen-

trations of 100 mM Tris-HCl, 300 mM NaCl and 40 mM imidazole in MilliQ water. The pH
was adjusted to 7.4 with 37% HCl.
Tris-NaCl-imidazole (TNi) buffer (100/300/250) : Buffer prepared by dissolving final con-

centrations of 100 mM Tris-HCl, 300 mM NaCl and 250 mM imidazole in MilliQ water. The
pH was adjusted to 7.4 with 37% HCl.
Tris-EDTA-sucrose (TES) buffer: Buffer used for osmotic shock lysis protocol. Prepared by
dissolving final concentrations of 0.2 M Tris, 0.5 mM EDTA and 0.5 M sucrose in MilliQ water.
The pH was adjusted to 8.0 with 37% HCl.
Tris-acetate-EDTA (TAE) buffer: Buffer used for agarose gel electrophoresis. Prepared with
40 mM Tris-base, 20 mM acetic acid and 1 mM ethylenediaminetetraacetic acid (EDTA).
1% (w/v) agarose: Prepared by adding 10 g agarose to 1 L of 1xTAE buffer. Agarose was

dissolved by heating in the microwave and stored at 50°C.
1x Sodium dodecyl sulphate-polyacrylamide gelectrophoresis (SDS-PAGE) running buffer:

Prepared by dissolving 14.4 g/L glycine, 3 g/L Tris and 1 g SDS in MilliQ water.
3.3 Molecular biology
E. Coli strains: Different strains of E. Coli were used during the span of this thesis.
1. For transformation, the high copy number DH5α cells were employed. Genotype: F−
Φ80lacZ∆M15 ∆(lacZYA-argF) U169 recA1 endA1 hsdR17(rk − , mk + ) phoA supE44 thi-
1 gyrA96 relA1 λ− .
2. BL21 (DE3) Rosetta 2 cells were used for protein expression. Genotype: F− ompT
hsdSB (rB − mB − ) gal dcm (DE3) pLysSRARE (CamR ).
3. SHuffle T7 cells were used for protein expression. Genotype: F’ lac, pro, lacIq / ∆(ara-
leu)7697 araD193 fhuA2 lacZ::T7 gene1 ∆(phoA)PvuII phoR ahpC* galE (or U) galK
λatt::pNEB3-r1-cDsbC (SpecR ,lacIq ) ∆trxB rpsL150(StrR ∆gor ∆(malF)3.
All strains were made chemocompetent in-house as described by Inoue et al. [91]. Aliquots of
50 µL competent cells were stored at -80°C.
Transformations: Plasmid transformation started with thawing an aliquot of competent E Coli

cells on ice. 1-2 µL of plasmid DNA was added to the cell suspension and incubated on ice
for 15 minutes. The plasmid was introduced into the cells via heat shock of 45 seconds at
42°C in a hot water bad. Cells were directly put back on ice after the heat shock. After ∼3
minutes of incubation, 500 µL of SOC was added and incubated for one hour at 37°C. To obtain
single colonies, the mixture was pipetted on a pre-heated (37°C) LB agar plate supplied with
the correct antibiotic selection marker. The plate was further incubated overnight at 37°C.
Plasmid extraction: Single colonies were picked for further culturing in 4 mL LB broth sup-
plied with the correct antibiotic selection marker. These were incubated overnight at 37°C in a
shaking incubator at 180 rpm. Cells were pelleted by centrifuging 2 minutes at 15000 rpm (Ep-
pendorf 5424 R microcentrifuge). To extract the plasmid DNA, the GeneJET Plasmid Miniprep
Kit (Thermo Fisher Scientific) was used, 30 µL MilliQ water was used for elution. Plasmid
concentrations were measured with NanoDrop™ 2000 spectrophotometer (Thermo Fisher Sci-
entific). For Sanger sequencing, 15 µL of the sample was sent to LGC Genomics (Berlin,
Germany). Plasmid samples were stored at -20°C.
Polymerase chain reaction (PCR)-based mutagenesis: ’Round-the-horn site-directed muta-

genesis [92] was used to introduce mutations in the nanobodies via PCR with the Q5® High-
Fidelity 2x Master Mix protocol (NEB). Mutations were present in one or both primers, the
primer list is displayed in Table S1. Primers were designed using Benchling [93] and ordered
from Integrated DNA Technologies (IDT) as 25 nmole DNA oligos. MilliQ was added to the
primers to obtain a 100 µM concentration and they were stored at -20°C. The PCR reaction
mixture was made by pipetting 2.5 µL of both FW primer and REV primer (10 µM), 10 ng of
the template plasmid DNA and 25 µL Q5 High-Fidelity 2x Master Mix (NEB). MilliQ water
was added to obtain a final volume of 50 µL. The different steps of the PCR reaction are de-
scribed in Table 3.1. Annealing temperatures varied between 50°C and 72°c for different primer
pairs. This was calculated based on the Tm of the primers with NEB Tm calculator. After the
PCR reactions, DpnI digestion was performed by adding 1 µL DpnI to the PCR product and
incubating for 1 hour at 37°C in order to remove the DNA template.
Table 3.1: Thermocycling conditions for PCR
Step Temperature Time

Denaturation 98°C 30 seconds
Elongation, repeat for 29 cycles 98°C 5 seconds
50°C-72°C 20 seconds
72°C 20 seconds per kb
Termination 72°C 20 seconds
Hold 4°C
Agarose gel electrophoresis: Agarose gels were prepared by adding 35 mL 1% (w/v) agarose
in the plastic gel tray with 3.5 µL 10.000x GelGreen together with the comb. The GeneRuler
1 kb plus DNA ladder (5 µL) and the PCR samples were added to the gel (once solidified) to
check their quality. Before adding 10 µL of the PCR samples, 2 µL of 6xTriTrack DNA loading
dye was added. The gel was run for 25 minutes at 125V and 300 mA and visualised afterwards
with UV-light.
T4 ligation: After PCR, the blunt end DNA was ligated back into a plasmid by T4 DNA
ligation. 10 µL of PCR product was added to 6 µL MilliQ water. This was supplied with 2 µL
10x T4 ligation buffer. For ligation, 1 µL T4 DNA ligase and 1 µL T4 polynucleotide kinase
(PNK) were added, obtaining a final volume of 20 µL. The sample was incubated for 1 hour at
21°C or overnight at 4°C. Ligated PCR constructs were transformed in DH5α cells. Samples
were sent for sequencing to LGC Genomics (Berlin, Germany).
3.4 Protein purification
Bacterial expression: Nanobody expression started with a preculture volume 1/100th of the
final culture volume (example: for a final culture volume of 1 L, a preculture volume of 10 mL
is required). A single colony was picked and inoculated in the preculture (LB broth) which
was incubated overnight at 37°C. The final culture volume (TB) was supplied with the correct
selection marker (antibiotic) and the preculture was added to it for further incubation at 37°C
until the OD600 nm reached ∼0.5. When the correct OD was reached, protein production was
induced by adding 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). The culture was
further incubated overnight at 18°C to allow protein production. Lysis was done by sonication
or osmotic shock.
SHuffle T7 cells do not require IPTG induction, therefore the protocol was slightly different.
Incubation until the OD reaches ∼0.5 was done at 30°C. Afterwards overnight incubation con-
tinued at 16°C.
For Nb6B9 expression, an adapted protocol based on [67, 94] was applied as this plasmid con-
tained a pelB signal sequence. Protein production was induced by 1 mM IPTG and the culture
was then further incubated for 24 hours at 22°C. Lysis was done by osmotic shock.
Bacterial lysis: After overnight incubation, cells were harvested by centrifuging with a swing-
ing bucket rotor (Sorvall™ Legend™ X1 centrifuge) for 30 minutes at 4500 rpm and 4°C. The
pellets were resuspended in TN (100/300) by shaking and vortexing. This suspension was cen-
trifuged again with a fixed angle rotor for 15 minutes at 6000 rpm and 4°C. The supernatans
was removed and the resulting pellet was gently resuspended in 10-30 mL TNi (100/300/20).
Before lysis, a pinch (∼20 mg) of lysozyme and 1 tablet per 10 mL pellet protease inhibitor
were added. This was incubated by rotating for 30 minutes at 4°C. Two different techniques
were employed for cell lysis.
1. Lysis by sonication: Cells were lysed by applying a sonication cycle: 20 seconds soni-
cation (duty cycle 80, output control 3) followed by 30 seconds of no sonication, for a
total of 5 minutes or until the suspension was clearer and less viscous. Cell debris was
removed by centrifuging with a fixed angle rotor for 40 minutes at 8500 rpm and 4°C.
2. Lysis by osmotic shock: The pellet was gently resuspended in 4 mL TES buffer using a
pasteur pipette. The cell suspension was shaken on ice for 6 hours. Cells were lysed by
adding 8 mL 1:4 TES buffer and incubating overnight at the same conditions. Cell debris
was removed by centrifuging with a fixed angle rotor for 40 minutes at 8500 rpm and
4°C.
Ni-affinity chromatography: All proteins contained a His6 -tag allowing affinity purification
with a Ni-NTA gravity column. Ni-NTA was prepared by adding 2 mL of Ni-NTA agarose resin
(Machery-Nagel Bioanalysis™ Protino™) and a porous polyethylene filter disc to the dispos-
able column (Pierce™, 5 mL). The column was first equilibrated with two column volumes (=
∼10 mL) of TNi (100/300/20). When the equilibration buffer had flowed through, the cell
lysate was applied after filtration through a 0.22 µm Satorius Minisart™ filter attached on a sy-
ringe. Contaminating proteins were removed by washing the column with two column volumes
of TNi (100/300/20) followed by one column volume of TNi (100/300/40). The His-tagged
protein was eluded by adding 2.5 mL of TNi (100/300/250).
Desalting: As the purified protein sample was eluded with a buffer containing a high imida-
zole concentration, this had to be removed using the PD10 desalting column (Cytiva) were
the gravity protocol was used. This disposable column was first equilibrated with ∼30 mL
TN (100/300) buffer after which 2.5 mL of the protein sample was added. The nanobody was
eluded with 2.5 mL TN (100/300) buffer.
Protein concentrations were measured based on the absorbance at 280 nm using a NanoDrop™
2000 spectrophotometer. When desired, concentration was increased using VivaSpin® Turbo
centrifugal concentrators with a 10 kDa molecular weight cutoff. All purified nanobody solu-
tions were stored at 4°C or flash frozen and stored at -80°C.
SDS-PAGE: Quality of purified proteins was assessed with SDS-PAGE. 15 µL protein sample
(4 µg protein) was added to 15 µL 2x sample buffer (SDS-loading dye with dithiothreitol (DTT)
in a 4:1 ratio). This mixture was boiled for 5 minutes. 15 µL (2 µg protein) of each sample
was loaded in a well of the stacking gel using a syringe and a needle. The needle was washed
with MilliQ water after each sample application. PageRuler Prestained (Plus) protein ladder
was also added on the stacking gel and the gel tank was filled with 1x running buffer. Running
of the gel was done in two steps: first 15 minutes at 100 V, secondly 45 minutes at 200 V. Once
the gel had finished running, it was removed from the cassette and placed in a petri dish. The
gel was rinsed twice with water before staining with Coomassie Brilliant Blue for 30 minutes.
Destaining of the gel was done overnight in water with a paper towel on top. An SDS-PAGE gel
consists of a stacking gel on which the samples are loaded and a running gel were the protein
sample are separated [95].
3.5 Binding assays
3.5.1 Fluorescence polarization binding assay
FITC-ALFA-Tag peptide: The FITC-Ahx-ALFA-Tag peptide (Sequence: SRLEEELRRRLTE;

CliniSciences, Belgium) was used for nanobody binding assays. Molecular weight was 2189.39
Da. The peptide was solubilised in 50% dimethylsulfoxide (DMSO) to obtain a final concen-
tration of 1.5 mM.
FITC-GS-12 peptide: The FITC-Ahx-GS-12 peptide (Sequence: GGSGGSGGSGGS; Clini-

Sciences, Belgium) was used as a negative control for nanobody binding assays. Molecular
weight was 1325.27 Da. The peptide was solubilised in 50% DMSO to obtain a final concen-
tration of 2 mM.
Peptide concentrations: Peptide concentrations were determined by measuring the UV/Vis

absorbance spectrum of FITC on the NanoDrop™ 2000 spectrophotometer. Spectra were ob-
tained at for peptide samples in a tenfold and hundredfold dilution in TN (100/300) at pH 9.
Additionally, absorption of the peptide bond at 205 nm was also used to determine the pep-
tide concentration. Concentration was measured using the A205 program that measures the
absorbance at 205 nm on the NanoDrop™ 2000 spectrophotometer.
NanoTag WT-ALFA Nb: A camelid sdAb unlabeled anti-ALFA nanobody (NanoTag Biotech-
nologies) was used as a control for the binding assay experiments. Molecular weight was
16.0 kDa with a molar extinction coefficient at 280 nm of 18638 M−1 cm−1 . 250 µL of 50%
glycerol was added to 250 µg lyophilized unconjugated sdAb. Aliquots were stored at -80°C.
Fluorescence polarization binding assay: Binding assays were performed using the same
protocol for all nanobodies. FITC-ALFA-Tag concentrations were kept constant at 50 nM. The
purified nanobody was titrated using a twofold dilution series ranging from 0 nM to 500 nM.
Dilutions were made in TN (100/300). 50 µL nanobody and 50 µL FITC labelled ALFA-Tag
were pipetted in a chimney 96 Flat Black well plate (Greiner) to obtain a final volume of 100 µL
in each well. Since nanobodies have the tendency to foam, all pipetting was done by reverse
pipetting. All samples were made in triplicate and loaded on the 96-well plate as displayed in
Figure 3.1.
Fluorescence polarization was measured using the platereader (Tecan Spark) which was pre-
cooled to 20°C. Before measuring, the plate was shaken for 20 seconds using the orbital shak-
ing program with an amplitude of 3.5 in order to mix the components. The plate was measured
three times using a kinetic loop. Excitation wavelength for FITC was set to 490 nm with a
bandwidth of 15 nm. Emission wavelength for FITC was set to 525 nm with a bandwidth of
15 nm. The z-position was always calculated from well A1 containing 50 µL FITC-ALFA-Tag
and 50 µL TN (100/300). Binding curves were made in GraphPad Prims by plotting the flu-
orescence polarization in function of the nanobody concentration. Error bars representing the
standard deviation (SD) were generated based on the triplicate samples that were averaged over
the three measurements.
To obtain absolute fluorescence polarization values, G-factor calibration was required to correct
for the difference in sensitivity of parallel and perpendicular fluorescence polarized light which
is inherent to the instrument [84]. Based on measurements with 1 µM and 10 µM of FITC-
ALFA-Tag and also 1 µM free FITC without any attached peptide to have maximal polarization
in all directions due to the free rotation, a G-factor of 1.557 was calibrated for the fluorescence
polarization binding assays. The G-factor was calibrated from well A1 containing only FITC-
(ALFA-Tag) and the blank G1 containing TN (100/300).
Figure 3.1: Preparation of 96-well plate for fluorescence polarization binding assay. In
blue is the triplicate twofold dilution series (0 nM - 500 nM) for the WT-nanobody. In
red is the triplicate twofold dilution series (0 nM - 500 nM) for the mutant nanobody.
50 µL of FITC-ALFA-Tag was added with a final concentration of 50 nM to each well.
G1 is the blank sample with 100 µL TN (100/300).
3.5.2 Fluorescence intensity binding assay
Fluorescence intensity was measured to determine complex formation with mCherry. mCherry
concentrations were kept constant at 50 nM and 100 nM for independent measurements. The
purified LaM4 nanobody was titrated using a twofold dilution series ranging from 0 nM to
500 nM. Dilutions were made in TN (100/300). 50 µL LaM4 and 50 µL mCherry were pipetted
in a chimney 96 Flat Transparent well plate (Greiner) to obtain a final volume of 100 µL in each
well. Samples were added in triplicate. For all assays, triplicates were made.
Fluorescence intensity was measured from the bottom of the transparent plate using the plate-
reader (Tecan Spark) which was precooled to 20°C. Before measuring, the plate was shaken for
20 seconds using the orbital shaking program with an amplitude of 3.5 in order to mix the com-
ponents. The plate was measured three times using a kinetic loop. Excitation wavelength for
mCherry was set to 587 nm with a bandwidth of 7.5 nm. Emission wavelength for mCherry was
set to 610 nm with a bandwidth of 7.5 nm. The z-position was always calculated from well A1
containing 50 µL mCherry and 50 µL TN (100/300). Binding curves were made in GraphPad
Prims by plotting the fluorescence intensity in function of the nanobody concentration. Error
bars representing the SD were generated based on the triplicate samples that were averaged over
the three measurements.
3.5.3 Native PAGE
Clear-native PAGE (CN-PAGE): A CN-PAGE gel was used to asses complex formation of
intact, non-denatured proteins. Also a stacking and a running gel were made. In essence the
protocol is identical to the one for SDS-PAGE with the elimination of the anionic SDS deter-
gent. The mixture of the proteins for analysis of interaction was added to the 2x sample buffer
consisting of 62.5 mM Tris-HCl (pH 6.8), 25% glycerol and 1% bromophenol blue. 15 µL of
this sample was applied on the CN-PAGE gel. The 1x CN-PAGE running buffer was made up
of 25 mM Tris and 192 mM glycine, with a pH around 8.3 which was not adapted. Running
of the CN-PAGE gel was done in two steps: first 15 minutes at 100 V and 1000 mA; secondly
45 minutes at 200 V and 1000 mA. Once the gel had finished running it was removed from the
cassette and placed in a petri dish. The gel was rinsed twice with water before staining with
Coomassie Brilliant Blue for 30 minutes. Destaining of the gel was done in water with a paper
towel on top.
1. CN-PAGE running gel: For a 10% acrylamide running gel, 1.995 mL MilliQ water was
added to 1.7 mL 30% acrylamide mix and 1.25 mL 1.5 M Tris (pH 8.8). The final com-
ponents that were added are 50 µL 10% APS and 5 µL TEMED to obtain a final volume
of 5 mL which is sufficient for pouring one gel. A layer of isopropanol was pipetted on
top when the gel was polymerizing to remove air bubbles and protect it from oxygen.
2. CN-PAGE stacking gel: The stacking gel was added on top of the solidified running gel.
For the stacking gel, 0.605 mL MilliQ water was added to 0.134 mL 30% acrylamide mix
and 0.25 mL 1.5 M Tris (pH 8.8). The final components that were added are 10 µL 10%
APS and 1 µL TEMED to obtain a final volume of 1 mL which is sufficient for pouring
one gel. A comb was added to form the wells for addition of the samples.
After addition of APS and TEMED, the gel was immediately poured as these components
cause polymerization. Gels were stored at 4°C in 1x CN-PAGE running buffer when not
used immediately.
Blue-native PAGE (BN-PAGE): BN-PAGE was done with the commercial precast Criterion™
TGX™ gel (BioRad, United States). This gel had an acrylamide concentration gradient ranging
from 4% - 20% and was placed in the dedicated Criterion™ gel system for running. The tank
and the top compartment were filled with 1x BN-PAGE running buffer (20x BN-PAGE Running
Buffer diluted in MilliQ water, Invitrogen). Wells were washed by pipetting the 1x BN-PAGE
running buffer into the wells. 5x BN-PAGE Sample Buffer (BN-PAGE SB) was added to the
samples, with a final concentration of 1x BN-PAGE SB. 4 ug of the protein sample was added
to each well after which 2 mL 20x BN-PAGE Cathode Buffer Additive (Invitrogen) was added
to the top compartment. The gel was run for 10 minutes at 120 V and 1000 mA after which the
top compartment was cleaned several times with MilliQ water and refilled with 1x BN-PAGE
running buffer. Running of the gel was continued for one hour at 120 V and 1000 mA.
3.6 Eukaryotic cell experiments
Eukaryotic cells: U2OS cells (U-2 OS, HTB-96™, American Type Culture Collection (ATCC))
were grown in DMEM (+++, 10% (w/v) FBS - Glutamax - Gentamicine) medium in an incu-
bator at 37°C with 5% CO2 . For imaging, always 70000 cells per 35 mm dish were used.
Transfection: Transfection of the U2OS cells with eukaryotic expression plasmids was done
by preparing a transfection mixture. This contained 1 µg plasmid DNA, 6 µL Fugene (Promega)
per 1 µg plasmid DNA, supplied with DMEM (—) to a final volume of 100 µL. Before addition
of the DNA, Fugene and DMEM were combined, vortexed and incubated for 5 minutes. After
addition of the plasmid DNA, there was another 15 minutes of incubation before adding 100 µL
of the transfection mix to the cells. For co-transfection with two plasmids, 100 µL of both
transfection mixtures were added to the cells. The dishes were placed in the incubator for 48
hours before imaging.
Imaging: Imaging of the eukaryotic cells was done on the ’Lumencor’ microscope. This is a
home-built setup for wide-field fluorescence imaging that consists of an Olympus IX-71 mi-
croscope with 10x UplanSApo objective (Olympus), a Lumencor lightsource (spectraX model)
and a Hamamatsu ORCA-Flash4.0LT detector.
Before imaging, cells were washed twice with 1 mL PBS, after which 1 mL HBSS + Ca2+ was
added for imaging. An image was acquired every 30 seconds for several field of views (FOVs)
in each dish, programmed using IgorPro. The used light source was cyan with a LED power of
10% for scanning the sample and selecting the FOVs, actual imaging was done using a power
of 40%, with an exposure time of 150 ms. The microscopy setup used a Lumencor 485/25x
excitation filter, ZT488rdc dichroic mirror (Chroma) and ET525/30m emission filter (Chroma).
After imaging for 5 minutes, the β2 -AR was activated by adding 12.5 µL isoprenaline (400 µM).
This was followed by an additional 10 minutes of imaging.
3.7 Data analysis
Primer design and sequence analysis was done using the online software Benchling [93]. Nano-
body mutations and target interactions were visualised with the PyMol software [96]. Data
from binding assays was analysed with GraphPad Prism version 8.0.1 for Windows (Graph-
Pad Software, USA). Imaging data from fluorescence microscopy was edited with the ImageJ
software [97].
Chapter 4
Results and discussion
4.1 Creation of nanobody mutants
The main objective of this thesis is to introduce an affinity for the ALFA-Tag in both LaM4 and
Nb6B9 nanobodies, which serve as the test systems for this project. Mutations to obtain this
ALFA-Tag affinity were designed by aligning the model nanobodies with the ALFA nanobody
in PyMol and selecting the residues that we wanted to introduce into LaM4 and Nb6B9, see
Figure 4.1. The mutations were then introduced via ’Round-the horn-site directed mutagen-
esis [92]. For the continuation of this thesis, LaM4 residues will be denoted with L , Nb6B9
residues with N and ALFA nanobody residues with A .
Figure 4.1: PyMol structure of ALFA nanobody (cyan) residues selected to introduce in
LaM4 and Nb6B9, displayed in blue. ALFA-Tag displayed in magenta (PDB: 6I2G).
32
CHAPTER 4. RESULTS AND DISCUSSION 33
4.1.1 Rationale behind design of LaM4 mutant
The mutations that were introduced in LaM4 to achieve affinity for the ALFA-Tag, changed the
WT-LaM4 residues SWSGGATNYAD (Figure 4.2) into the mutant residues SERGNA-MYRE.
Mutations W54EL , S55RL , G57NL and A62RL changed the WT-Nb6B9 residues to mutant
residues that are involved in the binding of the ALFA-Tag. W54EL , S55RL , G57NL correlate
to ALFA nanobody CDR2 residues while A62RL correlates to the R65A residue of the FR3.
N60ML and D63EL mutations were also included as the correlating M63A and E64A residues
are also present in this ALFA nanobody sequence. As mentioned in Table 1.3, other interactions
are also involved in the binding of ALFA-Nb to the ALFA-Tag. However, since these are mainly
located in LaM4’s CDR3, it was not possible to include these as CDR3 residues are important
for mCherry binding [65].As a result, this mutation left the important LaM4 binding interacting
residues unaltered.
Figure 4.2: PyMol structure of WT-LaM4 residues for mutations (blue). Residues were
chosen based on alignment with the ALFA nanobody. LaM4 (cyan) binding to mCherry
(magenta) (PDB: 6IR1).
4.1.2 Rationale behind design of Nb6B9 mutants
Two different Nb6B9 mutants were created. WT-Nb6B9 residues HSGGTTN (Figure 4.3) were
changed to SERGNAM in the first mutant. Like the mutations introduced in LaM4, the ALFA-
Nb’s CDR2 residues involved in binding the ALFA-Tag are introduced via H52SN , S53EN ,
G54RN and T56NN . The other mutations T57AN and N58MN were also included as they
correlate to A62A and M63A residues in the ALFA nanobody sequence. In this mutant, the
ALFA-Nb R65A of FR3 was not introduced. However, Nb6B9 residues H52N , T56N and N58N
that are involved in the binding of the target β2 -AR were altered by this mutation. Nb6B9’s
CDR3 residues were left unaltered as these are mainly involved in the binding of β2 -AR [67].
The second mutant introduced HERGNAN residues in Nb6B9 in the same location as the first
mutant (Figure 4.3). This left the H52N and N58N residues that are important for interaction
with the β2 -AR unaltered. Mutation T56N was kept as this corresponds to N61A residue in-
volved in the binding of the ALFA-Tag.
Figure 4.3: PyMol structure of WT-Nb6B9 residues selected for mutations (blue).
Residues were chosen based on alignment with the ALFA nanobody. Nb6B9 (cyan) bind-
ing to β2 -AR (magenta) (PDB: 6H7N).
4.1.3 Nanobody purification
ALFA-Nb and both WT and mutant LaM4 were purified from SHuffle T7 cells as described in
Chapter 3, see Figure 4.4(a) and (b). The resulting concentration was sufficient for fluorescence
polarization binding assay.
Expression and purification of WT-Nb6B9 containing a His6 -tag and pelB sequence was first
attempted in BL21 (DE3) Rosetta 2 cells using lysis by sonication. The resulting yield of the
WT-Nb6B9 was relatively low with only 8.95 µM after PD10 desalting. To improve this yield,
SHuffle T7 cells were used for both the WT and the first mutant, also employing the lysis by
sonication method. While the yield increased (WT: 44.42 µM and Mut1: 37.17 µM), the SDS-
PAGE gel showed two bands at roughly the same height where we expect Nb6B9 (14.2 kDa),
see Figure 4.4(b). Since the pelB sequence directs the Nb6B9 to the E. coli periplasm, a different
purification protocol was employed that used osmotic shock as a method of lysis. This method
is used for the extraction of periplasmic proteins from gram-negative bacteria by increasing the
permeability of the outer membrane which results in lysis upon a decrease in osmotic strength
of the solution [67, 94, 98]. As this is a milder approach than sonication, it could improve
the purification results. Expression and purification of WT and both mutants was again done in
BL21 (DE3) Rosetta 2 cells which did result in a lower yield after PD10 desalting (WT: 7.95 µM
and Mut1: 10.06 µM). These concentrations are still high enough to perform the polarization
binding assays. On the SDS-PAGE in Figure 4.4(c), no additional bands were visible on the
same height of Nb6B9 as was the case with the SHuffle cells. Additional faint bands were still
present at larger MW.
Figure 4.4: SDS-PAGE of LaM4, ALFA nanobody and Nb6B9 after PD10 desalting. (a)
WT and mutant LaM4 purified using lysis by sonication (part of the gel was removed in
this figure). (b) ALFA nanobody and both WT and mutant 1 NB6B9 purified using lysis
by sonication protocol. (c) WT and mutant 1 Nb6B9 purified using lysis by osmotic shock
for the WT and the mutant nanobody. PageRuler Prestained Plus was used as protein
ladder for (a) and (b), PageRuler Prestained protein ladder for (c).
Purification of Nb6B9 mutant 2 was also done using the osmotic shock protocol however, it was
not successful. No protein was detected with the absorbance measurements at 280 nm and no
bands were visible on SDS-PAGE. A possible explanation for this lower nanobody yield could
be that the introduced mutation results in an impairment of the expression or folding. In order
to verify if the mutation is responsible for the reduced yield, another attempt at purification
can be made, using a different lysis technique like sonication for example while simultaneously
purifying WT-Nb6B9.
4.2 Optimization of fluorescence polarization binding

assay
Nanobody-peptide interactions were analysed via a fluorescence polarization binding assay

where we titrated the nanobody to a constant concentration of FITC labelled peptide. This
assay was first optimized using the ALFA-Nb to make sure that fluorescence polarization is a
suitable method for evaluating the binding interaction of the mutated nanobodies.
4.2.1 FITC-ALFA-Tag and FITC-GS-12 peptide concentration
During the preparation of the peptide solutions, there were some problems with dissolving the
lyophilized peptide as it was not completely sollubillized. Therefore, we verified the actual
concentration of the peptides we used for the binding assays. For the binding assays we always
based our calculations for preparation of the 96-well plate on the theoretical concentrations
based on the added volume of 50% DMSO. Two different methods were employed to improve
the accuracy of the actual peptide concentration. First, the absorbance of FITC at 495 nm was
measured. As a second approach, the absorbance of the peptide bond at 205 nm was used to
determine the peptide concentration.
FITC absorbance at 495 nm
Both peptides are coupled to FITC, which provides an additional opportunity to determine the
peptide concentrations. FITC has a maximum extinction coefficient of ϵ = 76000 molLcm at
495 nm for pH 9. However, this extinction coefficient is dependent on the pH of the solution.
Additionally, when FITC is conjugated to a peptide or another moiety, ϵ can decrease by 10%
to about 68400 molLcm [99, 100]. This allows us to calculate the concentration based on the
absorption of the peptide FITC label. From the FITC absorbance spectrum, A495 was used to
calculate the peptide concentration via Beer-Lambert’s law.
We measured the peptide concentrations using the maximum extinction coefficient ϵ of FITC
and the lower ϵ of peptide conjugated FITC. This resulted in a concentration range in which we
expect the actual peptide concentration. When we look at the measured peptide concentrations
in Table 4.1, we can see that the actual concentration of FITC-ALFA-Tag (∼0.3 mM) is around
five times smaller than the theoretical prepared peptide concentration of 1.5 mM. While this is
a lower concentration than anticipated, binding assays were always performed with a constant
concentration. For the fluorescence binding assays with the FITC-ALFA-Tag, the actual added
concentration will thus be around 10 nM instead of the 50 nM which was calculated based on
the theoretical peptide concentration based on the addition of 50% DMSO. In contrast to the
ALFA-Tag, the concentration ranges of the FITC-GS-12 peptide are approaching the theoretical
prepared concentration of 2 mM for both the tenfold and hundredfold dilutions. The actual
FITC-GS-12 peptide concentrations in fluorescence binding assays will thus approach 50 nM.
Peptide bond absorbance at 205 nm
Protein and peptide concentrations are usually determined based on the absorption at 280 nm of
Trp and Tyr amino acid residues. If these residues are not present in the peptide, concentration
can also be determined based on the absorbance of the peptide bond at 205 nm [101]. Since both
the FITC-ALFA-Tag and the FITC-GS-12 peptide are devoid of these amino acid residues, this
method provides an alternative to measure the peptide concentration to increase the accuracy
of the actual concentration that was used during the polarization binding assays. The obtained
concentrations are displayed in Table 4.2. For the ALFA-Tag peptide, these results correspond
to the obtained concentration using the FITC absorption at 495 nm. We can therefore conclude
Table 4.1: Concentration measurements of FITC-GS-12 and FITC-ALFA-Tag peptides

using on the absorbance at 495 nm. Peptide concentrations are calculated using Beer-
Lambert’s law with l = 1 mm.
Peptide Dilution A495 ϵ ( molL cm ) Concentration (mM)

FITC-Ahx-ALFA-Tag 1/10 0.243 68400 0.342
1/10 0.243 76000 0.308
1/100 0.021 68400 0.307
1/100 0.021 76000 0.276
FITC-Ahx-GS-12 1/10 1.680 68400 2.456
1/10 1.680 76000 2.211
1/100 0.167 68400 2.442
1/100 0.167 76000 2.197
that the actual ALFA-Tag concentration that was used during the binding assays was five times
smaller than the theoretical assumed concentration of 1.5 mM. For the GS-12 peptide, there
is a slight deviation of the obtained concentration using the 495 nm absorbance. However,
this concentration is still approaching the theoretical concentration of 2 mM. Additionally, the
absorption measurement at 495 will provide a more accurate result since different dilutions were
tested.
Table 4.2: Concentration measurements of FITC-GS-12 and FITC-ALFA-Tag peptides

using peptide bond absorbance at 205 nm. Concentration were determined using the
A205 program on the NanoDrop 2000 spectrophotometer which measures absorbance at
205 nm.
Peptide MW (Da) Concentration (mM)

FITC-Ahx-ALFA-Tag 2189.39 0.311
FITC-Ahx-GS-12 1325.27 1.382
4.2.2 Glycerol assay
Before starting the binding assays with the mutant nanobodies, a test system was set up to verify
if both the FITC-ALFA-Tag peptide (sequence: SRLEEELRRRLTE) and the equipment for
fluorescence polarization binding assays are suitable for measuring the binding, while not being
affected by the nanobody. We did this by using an increasing glycerol concentration to limit
the rotational speed of the tag. The viscous glycerol can simulate the reduced mobility of the
fluorescent tag which occurs during nanobody binding, resulting in an increased polarization.
This increase in polarization was also observed as can be seen in Figure 4.5. The trend is not
observed in at a lower glycerol concentration, below 10%. This can be attributed to the fact that
pipetting small glycerol concentrations can lead to errors.
Figure 4.5: FITC-ALFA-Tag fluorescence polarization measurement with increasing glyc-

erol concentrations. Error bars represent the SD.
4.2.3 Positive control: ALFA nanobody and ALFA-Tag
Besides the glycerol assay, we also wanted to assess if the in-house purified ALFA nanobody
could provide a good positive control for ALFA-Tag binding in the fluorescence polarization
measurements. The high affinity interaction between the ALFA-Nb and its target the ALFA-
Tag are an ideal control for the polarization binding assays of the mutated nanobodies. Due to
this high affinity interaction (Kd = 26 pM) [74], a sigmoidal binding curve should result from
fluorescence polarization binding assays. As we can see in Figure 4.6, the resulting binding
curve is not sigmoidal contrary to what we expected. However, polarization still increases with
about 80 mP, so we can still assume binding occurs between the ALFA-Nb and the ALFA-Tag.
The final three datapoints show a significant deviation of the observed trend. We are currently
unable to explain why this decrease in fluorescence polarisation is occurring.
Since the obtained binding curve with the ALFA-Nb was not as we expected, we wanted to
check if this was related to the ALFA-Nb or the fluorescence polarization method. To reduce
any influences of the purification process, we bought the commercially available pre-purified
NanoTag ALFA-Nb. In Figure 4.7 we can see the sigmoidal binding curve of the NanoTag
ALFA nanobody with the FITC labeled ALFA-Tag. Upon increase of the nanobody concentra-
tion there is an increase in the measured polarization signal which saturates at a concentration
of about 250 nM added nanobody to the ALFA-Tag. At 500 nM there is a slight decrease in the
polarization.
Figure 4.6: Fluorescence polarization binding assay with the in-house purified ALFA
Nanobody. Fluorescence polarization (mP) is plotted in function of nanobody concentra-
tion (nM). Error bars represent the SD.
Figure 4.7: Fluorescence polarization binding assay with NanoTag ALFA Nanobody. Flu-
orescence polarization (mP) is plotted in function of nanobody concentration (nM). Error
bars represent the SD.
4.2.4 Negative control: ALFA nanobody and GS-12 peptide
As a negative control for the binding assays with the ALFA-Tag, another FITC labeled peptide,
GS-12 (sequence: GGSGGSGGSGGS), was used which should not be binding to the ALFA
nanobody or any other nanobody. Since we do not expect any form of binding interaction
between the nanobody and the fluorescent tag, the polarization signal needs to remain constant.
This is also what we observed in the binding assay, see Figure 4.8. The fluorescence polarization
signal remains constant at around 225 mP to 228 mP upon titration of both the in-house purified
and the NanoTag ALFA-Nb. With this negative control assay we can identify how a polarization
assay looks like if no interaction is occurring between the nanobody and the tag. This will help
us to interpret the results of the binding assays of the mutated nanobodies.
Figure 4.8: FITC-GS-12 peptide fluorescence polarization binding assay with in-house
purified and NanoTag ALFA nanobody. Fluorescence polarization (mP) is plotted in
function of nanobody concentration (nM).
With the results of these binding assays and the glycerol assay, we can conclude that fluores-
cence polarization binding assays are a suitable method for evaluating the interactions of the
mutated LaM4 and Nb6B9 nanobodies with the ALFA-Tag.
4.3 Evaluation of nanobody interaction with the

ALFA-Tag
To assess if an affinity for the ALFA-Tag was introduced by mutating nanobodies LaM4 and
Nb6B9, fluorescence polarization binding assays were performed. We expect an increase in
polarization upon increasing the nanobody concentration to a constant FITC-ALFA-Tag pep-
tide concentration, which should result in a sigmoidal binding curve like we observed for the
NanoTag ALFA-Nb binding to the ALFA-Tag.
4.3.1 Interaction between (mutant) LaM4 and ALFA-Tag
LaM4 was the first nanobody we mutated to increase the ALFA-Tag affinity. Polarization bind-
ing assays were performed for both the WT-LaM4 and the mutant LaM4. ALFA-Tag binding is
not expected for WT-LaM4, so this serves as the negative control. In the resulting binding as-
says, Figure 4.9, a sigmoidal binding curve is observed for neither WT nor mutant LaM4. Like
we expected, no binding is observed for the WT as the polarization remains relatively constant.
There is no significant increase in polarization which would indicate the binding of the ALFA-
Tag to WT-LaM4. Compared to the negative control assay of GS-12 peptide in combination
with ALFA-Nb, the fluorescence polarization fluctuates more when nanobody concentration is
increased, with a larger SD. During the preparation of the 96-well plates for the polarization
measurements, pipetting errors could occur. This resulted in larger error bars for some data
points in the binding assays. An additional control assay using the GS-12 peptide with the
WT-Nb6B9 can provide additional information.
The mutant LaM4 shows a similar binding curve as the WT nanobody. There is no overall
increase of the fluorescence polarization upon nanobody titration to the FITC-labeled ALFA-
Tag. Consequently, we can assume that no binding or very low affinity binding is occurring
between the ALFA-Tag and the mutant LaM4. To improve binding, the introduced mutations
requires re-evaluation so higher affinity binding with the blocking peptide can be achieved.
Currently, the mutations only introduced the interacting residues of ALFA-Nb CDR2 and FR3.
Figure 4.9: Fluorescence polarization binding assays with WT-LaM4 and mutant LaM4.
Fluorescence polarization (mP) is plotted in function of nanobody concentration (nM).
Error bars represent the SD.
4.3.2 Interaction between (mutant) Nb6B9 and ALFA-Tag
Mutant 1
Fluorescence polarization binding assays were performed for both the WT and the mutated
nanobody. ALFA-Tag binding is not expected for the WT-Nb6B9 (negative control) while affin-
ity for the ALFA-Tag was introduced in the mutant Nb6B9. In Figure 4.10 we can see that the
resulting binding curves are quite similar to the results of the LaM4 binding assays. For WT-
Nb6b9, the fluorescence polarization values remain on a quite consistent level upon increasing
nanobody concentration. However, the final three datapoints show a slight deviation from this.
A sigmoidal binding curve is not observed, as we would expect since binding of the ALFA-Tag
with WT-Nb6B9 should not occur.
Nb6B9 mutant 1 displays a similar binding curve. There is no significant increase in fluores-
cence polarisation, which we would expect in case of binding to the ALFA-Tag. Also here, the
final four polarization values deviate from the constant level of the curve. As this binding curve
shows high similarity with the curve for WT-Nb9B9, we can assume that there is no interaction
between mutant 1 Nb6B9 and the ALFA-Tag. Additional mutations or changes to the current
mutations have to be made in order to achieve an interaction with the ALFA-tag.
Figure 4.10: Fluorescence polarization binding assay with WT-Nb6B9 and mutant 1
Nb6B9. Fluorescence polarization (mP) is plotted in function of nanobody concentration
(nM). Error bars represent the SD.
Mutant 2
A first adaptation of the mutant was made by reverting the H52SN and N58MN mutations that
were introduced in mutant 1. H52N and N58N are important residues in the binding of the
β2 -AR. While the introduced N58MN mutation in mutant 1 is not involved in the binding of
the ALFA-Tag, H52SN mutation is correlated to the S57A residue involved in binding of the
ALFA-Tag. So reverting this mutation can have an effect on the ALFA-Tag binding. However,
due to the problems with the purification of the mutant 2 Nb6B9, we were not able to perform a
binding assay. A new purification is required so we can assess if the adapted mutations resulted
in ALFA-Tag binding.
4.4 Evaluation of nanobody interactions with

original targets
While the main goal is to introduce affinity for the ALFA-Tag, the binding affinity for the
nanobody’s original target should not be impaired by this. We will check if the high affinity
binding interactions to the original targets persist in the mutated nanobodies.
4.4.1 LaM4 binding to mCherry
LaM4’s original binding target mCherry can be easily purified and was kindly provided by Dr.
Anaı̈s Bourges. Two different binding assays were used in an attempt to identify if the intro-
duced mutations impacted LaM4’s ability to bind mCherry. Further optimization is required
based on the current results.
4.4.1.1 Fluorescence intensity binding assay
Since the target is a red fluorescent protein, the first binding assay measured the effect on
mCherry fluorescence intensity upon LaM4 titration. During complex formation, fluorescence
intensity can increase (dequenching) or decrease (quenching) as a result of photophysical ef-
fects [102].
The effect of increasing LaM4 concentration on the fluorescence intensity of a 50 nM and

100 nM mCherry concentration was measured. The binding assay was first performed using
WT-LaM4 as this is the positive control where complex formation is expected. In Figure 4.11,
we can see that upon increase in WT-LaM4 concentration, the fluorescence intensity does not
significantly increase or decrease. For the mCherry concentration of 100 nM, the intensity
values are larger due to the higher concentration and fluctuate a bit more. However, no trend
can be observed that allows us to identify an interaction between LaM4 and mCherry. Binding
of LaM4 to mCherry has a minimal effect on the chromophore environment [65]. As this
fluorescence intensity measurement is not able to provide positive results for the WT-LaM4
interaction with mCherry, where interaction is expected, another binding assay was tested for
mutated LaM4.
Figure 4.11: mCherry fluorescence intensity upon WT-LaM4 titration. Intensity mea-
surements were performed from the bottom of the plate. Error bars represent the SD.
4.4.1.2 Native PAGE
A second binding assay that was used to assess if the interaction between mutant LaM4 and
mCherry was retained was native PAGE. Native PAGE is a method that can be used to iden-
tify protein-protein interactions. Colorless native PAGE or clear-native PAGE (CN-PAGE) is
a type of electrophoresis where, unlike in SDS-PAGE, the protein mobility relies on the in-
trinsic protein charge, as well as size and conformation. This allows to identify protein com-
plexes [103, 104]. We tried to use CN-PAGE to detect mutant LaM4 - mCherry complexes.
In Figure 4.12, we can see that the proteins did not migrate to the end of the gel. A possible
explanation for this could be that the pI of the complex was too close to the pH of the native
PAGE gel, resulting in very little migration towards the positively charged anode. Lane 1 and
8 contains eGFP that forms a weak homodimer with a MW of 26.9 kDa. Since this is a weak
dimer, we can observe two bands. Lane 2 and 9 contains dTomato, another homodimer with
a MW of 27 kDa but with a different pI value resulting in a different migration on the native
PAGE gel. Multiple bands are visible, possibly due to impurities. In lane 3 is WT-LaM4 mixed
with mCherry and in a higher concentration in lane 5. Mutant LaM4 mixed with mCherry is in
lane 4 and in a higher concentration in lane 6. We can clearly observe a difference between the
mCherry added to WT-LaM4 and mutant LaM4. For mutant LaM4 in mixed with mCherry, two
separate bands are visible, while for the WT-LaM4 these bands are more close together. This
might indicate that a heterodimer complex forms with the WT-LaM4. However, the introduced
mutations can also result in a different electrophoretic mobility of LaM4. Since we have no
data of uncomplexed WT-LaM4, mutant LaM4 and mCherry, we cannot compare these results
to identify if complex formation occurred.
Figure 4.12: CN-PAGE of WT-LaM4 and mutant LaM4 in complex with mCherry. Lane
1: 2 µg dTomato. Lane 2: 2 µg eGFP. Lane 3: 2 µg WT-LaM4 - mCherry (1:1 ratio).
Lane 4: 2 µg mutant LaM4 - mCherry (1:1 ratio). Lane 5: 4 µg WT-LaM4 - mCherry
(1:1 ratio). Lane 6: 4 µg mutant LaM4 - mCherry (1:1 ratio). Lane 7: no sample loaded.
Lane 8: 2 µg dTomato. Lane 9: 2 µg eGFP.
In an attempt to improve the results of the CN-PAGE, a commercial precast Criterion™ TGX™
blue-native PAGE (BN-PAGE) gradient gel was employed to assess the LaM4 - mCherry com-
plex formation. This gradient gel allows to have a better separation based on the size of the
proteins. BN-PAGE differs from CN-PAGE in the used cathode buffer which contains the an-
ionic Coomassie Brilliant Blue dye to add a negative charge shift on the protein surface. This
will result in an improved migration towards the anode, independent of the protein pI [104, 105].
This gel did not properly run with no visible bands on the gel. Consequently, complex formation
cannot be identified from these results. Since the LaM4 is a small protein it could be advised to
use a gel with higher acrylamide concentration to obtain a better separation based on size.
4.4.2 Nb6B9 binding to activated β2 -adrenergic receptor
Since the β2 -AR is a GPCR, purification is very challenging [106] which makes in vitro binding
assays difficult. An alternative method to assess if the introduced mutations in Nb6B9 impaired
the ability to interact with the activated β2 -AR, is to look at the interaction in vivo using fluo-
rescence microscopy. To achieve this, the same mutated nanobodies were introduced in a new
vector (pcDNA3) that can be used for expression in eukaryotic U2OS cells. An important differ-
ence in comparison to the prokaryotic expression vector is that enhanced GFP (eGFP) was fused
to the N-terminus of Nb6B9, which allows for visualisation with fluorescence microscopy. The
mutation bearing plasmids were transfected into U2OS cells. Additionally, a plasmid containing
the β2 -AR was co-transfected to obtain overexpression of the receptor. Receptor activation by
the agonist isoprenaline (also named isoproterenol) will cause a conformational change [107].
If cytoplasmic eGFP-Nb6B9 binds to the activated receptor, a localisation of the fluorescence
to the membrane will be visible.
WT-Nb6B9 is expected to bind to the activated receptor, so this was used as a positive control for
imaging of the mutated nanobodies. An additional negative control for each imaging experiment
was a cell dish without overexpression of the receptor. As we can see in the representative
FOV from this dish in Figure 4.13(a), no fluorescence membrane localisation occurs when the
receptor is not co-transfected. Different FOV’s were obtained from the cells that overexpressed
the β2 -AR, Figure 4.13(b)-(d). Here we can observe a localisation of the fluorescence towards
the membrane of the cells after receptor activation by isoprenaline addition. This indicates
binding of the eGFP fused WT-Nb6B9 to the membrane-bound receptor. Localisation is not
visible in all cells. This can possibly be the result of failed co-transfection of the receptor.
(a) Control (b) (c) (d)
Figure 4.13: Fluorescence images of U2OS cells expressing eGFP-coupled WT-Nb6B9.

Top row: before isoprenaline induction. Bottom row: after isoprenaline induction. Images
(a) are from a control lacking the β2 -AR. Images (b)-(d) are different FOVs from cells
overexpressing the β2 -AR.
4.4.2.1 Mutant 1
If the introduced mutations did not affect the binding with the receptor, isoprenaline receptor
activation will cause a localisation of the eGFP fluorescence towards the membrane as observed
for the WT-Nb6B9. As negative control, cells without co-transfected receptor were imaged.
The representative FOV in Figure 4.14(a) shows no localisation of the fluorescence towards
the membrane. The fluorescent images in Figure 4.14(b)-(d) display the interaction between
cells transfected with mutant 1 Nb6B9 and the β2 -AR. For the first mutant, we could observe
this fluorescence localisation towards the membrane in the different FOVs that were selected,
meaning that the mutation did not have an effect on the binding of the mutant Nb6B9 with its
original target.
Figure 4.14: Fluorescence images of eGFP-coupled mutant 1 Nb6B9. Top row: before
isoprenaline induction. Bottom row: after isoprenaline induction. Images (a) are from
a control lacking the β2 -AR. Images (b)-(d) are different FOVs from cells overexpressing
the β2 -AR.
4.4.2.2 Mutant 2
In the negative control without overexpressed receptor, no localisation was observed, see the
representative FOV in Figure 4.15(a). While expression and purification in prokaryotic cells
was unsuccessful, eGFP fluorescence was visible indicating that expression of eGFP coupled
mutant 2 Nb6B9 was achieved in U2OS cells. However, it was more difficult to find cells where
isoprenaline-induced localisation of the fluorescence was visible compared to mutant 1 Nb6B9,
while they did have the same transfection efficiency. This can possibly be do to the effect of
the introduced mutations. In some FOVs, cells showed localisation of the fluorescence towards
the membrane, see Figure 4.15(b)-(d). However, this not as clearly observable as in the WT-
Nb6B9 or in mutant 1. When looking at the movie of all 30 images taken of the FOV, it is more
evident to see which cells display the localisation of the fluorescence. While interaction of the
mutant 2 Nb6B9 with the activated β2 -AR was observed in some cells, this experiment should
be repeated to identify whether the introduced mutations affect receptor binding. A limitation
of this method however, is that we are not able to quantify binding affinity for this complex. It
is possible that introduction of the mutations reduced Nb6B9’s affinity for the β2 -AR, but not
to such an extend that binding did not occur anymore.
Figure 4.15: Fluorescence images of U2OS cells expressing eGFP-coupled mutant 2

Nb6B9. Top row: before isoprenaline induction. Bottom row: after isoprenaline in-
duction. Images (a) are from a control lacking the β2 -AR. Images (b)-(d) are different
FOVs from cells overexpressing the β2 -AR.
Chapter 5
Conclusion and future perspectives
The main goal of this thesis was to engineer nanobodies to incorporate affinity for the ALFA-
Tag. In combination with such nanobodies, the ALFA-Tag could be used as a universal blocking
peptide in the novel NanoBlock biosensors. This would make the architecture even more gen-
eral, preventing the need to develop a new blocking peptide for every nanobody-target pair.
First, we assessed the binding of this potential universal blocking peptide to mutants of our two
model nanobodies: LaM4 and Nb6B9. After successful mutagenesis, the mutated nanobodies
were purified and subjected to fluorescence polarization binding assays.
This binding assay was first optimized to check if this could be employed on our test sys-
tems. Optimization was done by determining the optimal settings (G-factor for example) for
the Tecan Spark platereader, measuring the FITC-labeled peptide concentrations and perform-
ing a glycerol assay to determine independently of the mutant nanobody whether fluorescence
polarization using the FITC-ALFA-Tag is a suitable method to identify binding interactions.
Additionally, a positive control assay was performed where we compared ALFA-Tag binding
with in-house purified and commercially available ALFA nanobody. Finally, a negative control
was performed with the GS-12 peptide and the ALFA nanobody to determine a binding curve
when no interaction is expected. Once we had optimized the assay, it was applied to measure
the binding of the ALFA-Tag with the mutated nanobodies.
LaM4 and Nb6B9 mutants did not display an increase in fluorescence polarization, indicating
that no binding is occurring with the ALFA-Tag. While we were not successful in creating
a mutant that was able to achieve this binding with the ALFA-Tag, further improvement of
the current mutations can possibly achieve this interaction. We can however conclude that
fluorescence polarization binding assays provide a good method for assessing the interaction of
the ALFA-Tag and the mutated nanobodies. While the current binding curves of mutant LaM4
and Nb6B9 were noisy, additional controls with the GS-12 peptide can verify if this is possibly
related to the specific nanobodies by comparing to the GS-12 - ALFA nanobody binding curve.
As a second part of this thesis, binding of the nanobodies with their original target was ex-
amined. LaM4 - mCherry complex formation was assessed with two different binding assays.
mCherry fluorescence intensity measurements were not suitable for identifying this interaction
as no change in mCherry fluorescence intensity was observed while increasing WT-LaM4 con-
49
CHAPTER 5. CONCLUSION AND FUTURE PERSPECTIVES 50
centration. An alternative was to use native PAGE. This assay is a promising alternative but
requires optimization. The current results could not indicate a binding between mCherry and
mutant LaM4 due to lack of controls and insufficient migration on the native PAGE gel. For
Nb6B9 a different approach, based on live-cell fluorescent imaging, was employed. Isopre-
naline activation of the β2 -AR resulted in a localisation of eGFP-coupled Nb6B9 towards the
membrane, which could be observed using fluorescence microscopy. The two mutated nanobod-
ies that were tested, displayed localisation of fluorescence, while this was less clear for mutant
2. We assume that the introduced mutations in mutant 2 affected the negatively affected the
interaction whit the activated receptor, leading to less cells where binding could be observed by
the localisation of the fluorescence.
To conclude, we were not able to engineer nanobodies binding a universal ALFA blocking pep-
tide for implementation in the NanoBlock biosensor architecture. Based on the work presented
in this thesis however, further research can be conducted to reach this goal as we provided and
validated methods that can be employed for follow-up research.
5.1 Optimization of nanobody mutations
Mutagenesis of LaM4 introduced the CDR2 and FR3 residues of the ALFA nanobody involved
in ALFA-Tag binding with mutations W54EL , S55RL , G57NL and A62RL . Additional mu-
tations included N60ML and D63EL , these are not involved in the binding of the ALFA-Tag
but are present in the ALFA nanobody CDR2 and were incorporated to maintain the ALFA
nanobody structure. Two different mutants were assessed in Nb6B9. In the first mutant, the
same residues were introduced (H52SN , S53EN , G54RN , T56NN , T57AN and N58MN ) as in
LaM4 with the exception of the ALFA nanobody’s R65A and E66A . As H52N , T56N and N58N
are residues involved in binding of the activated β2 -AR, mutations H52SN and N58MN were
reverted back to the WT-Nb6B9 residues in mutant 2. However, H52N correlates to ALFA-
Nb’s S57A residue which is a serine residue involved in the ALFA nanobody interaction of the
ALFA-Tag. Further improvements of the Nb6B9 mutations could include incorporation of the
ALFA-Nb’s R65A and E66A residues. This will result in the same introduced residues as in
LaM4, however, binding of the ALFA-Tag was also not observed in mutant LaM4 bearing these
residues. As mentioned in Table 1.3, other residues outside the ALFA-Nb CDR2 and FR3 are
also involved in the binding of the ALFA-Tag.
Further adjustments of the mutations could incorporate these ALFA-Nb’s residues with Y42A
of FR2 being an easy modification, since this will not interfere with the binding of the nanobody
targets due to it being outside of the CDRs. Additionally, ALFA-Nb residues D105A , V107A ,
F110A and D112A of the CDR3 are also important in ALFA-Tag binding. However, when
introducing the ALFA-Nb’s CDR3 residues in LaM4 or Nb6B9, it is important to not eliminate
the CDR3 interactions of these nanobodies with their original targets which are present in this
region.
5.2 Optimization of binding assays
While we always used the same ALFA-Tag concentration throughout all fluorescence polar-
ization binding assays, peptide concentration measurements based on both FITC and peptide
absorbance indicated that the actual used concentration was five times lower than expected
(∼10 nM). Additional measurements with an actual ALFA-Tag concentration of 50 nM can be
performed to assess if a change in the binding curves occurs and to also have identical concen-
trations as in the negative control with the GS-12 peptide.
Since the fluorescence polarization binding curves for the ALFA-Tag binding with both WT-
LaM4 and WT-Nb6B9 fluctuate a lot in contrast to the negative control performed with the
GS-12 peptide binding the ALFA nanobody, additional measurements can be performed to
assess if this could be related to the purification of the nanobodies for example. While no
binding is expected for all these assays, we can compare if the GS-12 peptide binding to the
WT-nanobodies also results in the same fluctuation of fluorescence polarization as was observed
by binding to the ALFA-Tag.
The other binding assays, used to determine the interactions between the mutant nanobodies
and their target, can also be improved. Assessing the mutant LaM4 - mCherry interaction using
CN-PAGE can be adapted by varying the pH and the acrylamide concentration of the gel to
assess if this results in a better separation of the bands. Additionally, uncomplexed samples
should be added as controls to be able to identify complex formation based on the migration
in the gel. Additionally, the gel can be put under blue light to check which band contains the
mCherry fluorescence.
When we obtain sigmoidal binding curves for the optimized mutated nanobodies, binding inter-
action with the ALFA-Tag can be quantified by fitting the obtained curve to determine the Kd .
This can be useful to assess the affinity of the occurring interaction as it is important that this
binding has a lower affinity than the interaction with the original target.
If the mutations are optimized and ALFA-Tag is binding with the mutant nanobody, a com-
petitive inhibition fluorescence polarization binding assay can be applied to test if the original
target is able to displace the ALFA-Tag blocking peptide. This is what we want to achieve in
the NanoBlock architecture. However, this method can only be applied to the LaM4 nanobody
as the Nb6B9 target, β2 -AR, suffers from the previously mentioned limitations that prevent it
from using it in a fluorescence polarization binding assay. Since LaM4’s target mCherry is also
fluorescent and can therefore influence with the FITC fluorescence, a non-fluorescent (mutated
chromophore) version of mCherry, dark mCherry (dmCherry) should be used. Upon titration of
dmCherry to a constant concentration of mutant LaM4 and FITC-ALFA-Tag, a decrease in po-
larization should be observed as a result of ALFA-Tag displacement by dmCherry as we expect
that dmCherry has a higher affinity for mutant LaM4. This binding can then again be quantified
by fitting the obtained curve to determine the Kd .
5.3 Application in biosensors
Once an optimized mutant nanobody has been developed, it can be introduced in the NanoBlock
biosensor architecture for additional testing. Both the GCaMP and the SplitFAST architectures
can be used to test the effect of the universal ALFA blocking peptide. If initial ALFA-Tag
interaction has too high affinity, mutant ALFA blocking peptides having a lower affinity inter-
action with the ALFA nanobody are available to optimize blocking peptide displacement and
the resulting signal output upon target binding.
Bibliography
[1] Vasilis Ntziachristos. Fluorescence imaging: Overview and applications in biomedical

research. In Genomic and Personalized Medicine, Vol 1, pages 524–531. Elsevier Aca-
demic Press Inc, 2009.
[2] Shimon Gross and David Piwnica-Worms. Spying on cancer: Molecular imaging in vivo
with genetically encoded reporters. Cancer Cell, 7(1):5–15, 2005.
[3] Georges A. Wagnières, Willem M. Star, and Brian C. Wilson. In Vivo Fluorescence Spec-
troscopy and Imaging for Oncological Applications. Photochemistry and Photobiology,
68(5):603–632, 1998.
[4] Laura Marcu. Fluorescence lifetime techniques in medical applications. Annals of
Biomedical Engineering, 40(2):304–331, 2012.
[5] Edward B. Brown, Robert B. Campbell, Yoshikazu Tsuzuki, Lei Xu, Peter Carmeliet,
Dai Fukumura, and Rakesh K. Jain. In vivo measurement of gene expression, angiogen-
esis and physiological function in tumors using multiphoton laser scanning microscopy.
Nature Medicine, 7(7):864–868, 2001.
[6] Jeff W. Lichtman and José Angel Conchello. Fluorescence microscopy. Nature Methods,
2(12):910–919, 2005.
[7] Luis A. Bagatolli. Fluorescence spectroscopy: Basic foundations and methods. In An-
alytical Techniques in the Pharmaceutical Sciences, pages 29–59. Springer New York,
NY, 2016.
[8] Zuzana Limpouchová and Karel Procházka. Theoretical principles of fluorescence
spectroscopy. In Fluorescence Studies of Polymer Containing Systems, pages 91–149.
Springer International Publishing, Cham, 2016.
[9] Ionita C. Ghiran. Introduction to fluorescence microscopy. In Light Microscopy: Meth-
ods and Protocols, pages 93–136. Humana Press, Totowa, NJ, 2011.
[10] Osamu Shimomura, Frank H. Johnson, and Yo Saiga. Extraction, purification and prop-
erties of aequorin, a bioluminescent protein from the luminous hydromedusan, aequorea.
Journal of Cellular and Comparative Physiology, 59(3):223–239, 1962.
[11] Douglas C. Prasher, Virginia K. Eckenrode, William W. Ward, Frank G. Prendergast, and
Milton J. Cormier. Primary structure of the Aequorea victoria green-fluorescent protein.
Gene, 111(2):229–233, 1992.
53
BIBLIOGRAPHY 54
[12] Martin Chalfie, Yuan Tu, Ghia Euskirchen, William W. Ward, and Douglas C. Prasher.
Green fluorescent protein as a marker for gene expression. Science, 263(5148):802–805,
1994.
[13] Mikhail V. Matz, Arkady F. Fradkov, Yulii A. Labas, Aleksandr P. Savitsky, Andrey G.
Zaraisky, Mikhail L. Markelov, and Sergey A. Lukyanov. Fluorescent proteins from
nonbioluminescent Anthozoa species. Nature Biotechnology, 17(12):1227–1227, 1999.
[14] Jörg Wiedenmann, Franz Oswald, and Gerd Ulrich Nienhaus. Fluorescent proteins for
live cell imaging: Opportunities, limitations, and challenges. IUBMB Life, 61(11):1029–
1042, 2009.
[15] G. Ulrich Nienhaus and Jörg Wiedenmann. Structure, dynamics and optical properties
of fluorescent proteins: Perspectives for marker development. ChemPhysChem, 10(9-
10):1369–1379, 2009.
[16] Britta Seefeldt, Robert Kasper, Thorsten Seidel, Philip Tinnefeld, Karl Josef Dietz, Mike
Heilemann, and Markus Sauer. Fluorescent proteins for single-molecule fluorescence
applications. Journal of Biophotonics, 1(1):74–82, 2008.
[17] J. Vangindertael, R. Camacho, W. Sempels, H. Mizuno, P. Dedecker, and K. P.F. Janssen.

An introduction to optical super-resolution microscopy for the adventurous biologist.
Methods and Applications in Fluorescence, 6(2), 2018.
[18] Siet M. J. L. van den Wildenberg, Bram Prevo, and Erwin J. G. Peterman. A brief intro-
duction to single-molecule fluorescence methods. In Single Molecule Analysis: Methods
and Protocols, pages 93–113. Springer New York, NY, 2018.
[19] Atsushi Miyawaki, Juan Llopis, Roger Heim, J. Michael Mccaffery, Joseph A. Adams,
Mitsuhiko Ikura, and Roger Y. Tsien. Fluorescent indicators for Ca 2 + based on green
fluorescent proteins and calmodulin. Letters to nature, 388(28):882–887, 1997.
[20] Eric C. Greenwald, Sohum Mehta, and Jin Zhang. Genetically encoded fluorescent
biosensors illuminate the spatiotemporal regulation of signaling networks. Chemical
Reviews, 118(24):11707–11794, 2018.
[21] Amy E. Palmer, Yan Qin, Jungwon Genevieve Park, and Janet E. McCombs. Design and
application of genetically encoded biosensors. Trends in Biotechnology, 29(3):144–152,
2011.
[22] Jian Zhang, Qingxiao Pang, Qi Wang, Qingsheng Qi, and Qian Wang. Modular tun-
ing engineering and versatile applications of genetically encoded biosensors. Critical
Reviews in Biotechnology, 42(7):1010–1027, 2022.
[23] Wolf B. Frommer, Michael W. Davidson, and Robert E. Campbell. Genetically encoded
biosensors based on engineered fluorescent proteins. Chem. Soc. Rev., 38(10):2833–
2841, 2009.
[24] Sylvie Lalonde, David W. Ehrhardt, and Wolf B. Frommer. Shining light on signaling
and metabolic networks by genetically encoded biosensors. Current Opinion in Plant
Biology, 8(6):574–581, 2005.
BIBLIOGRAPHY 55
[25] Vera S. Ovechkina, Suren M. Zakian, Sergey P. Medvedev, and Kamila R. Valetdinova.
Genetically encoded fluorescent biosensors for biomedical applications. Biomedicines,
9(11):1–22, 2021.
[26] Toon Van Thillo, Vincent Van Deuren, and Peter Dedecker. Smart genetically-encoded
biosensors for the chemical monitoring of living systems. Chemical Communications,
59(5):520–534, 2023.
[27] Benjamien Moeyaert and Peter Dedecker. Genetically encoded biosensors based on in-
novative scaffolds. International Journal of Biochemistry and Cell Biology, 125:105761,
2020.
[28] Yusuke Nasu, Yi Shen, Luke Kramer, and Robert E. Campbell. Structure- and
mechanism-guided design of single fluorescent protein-based biosensors. Nature Chem-
ical Biology, 17(5):509–518, 2021.
[29] Robert E. Campbell. Fluorescent-Protein-Based Biosensors: Modulation of Energy

Transfer as a Design Principle. Analytical Chemistry, 81(15):5972–5979, 2009.
[30] C. Janetopoulos, T. Jin, and P. Devreotes. Receptor-mediated activation of heterotrimeric

G-proteins in living cells. Science, 291(5512):2408–2411, 2001.
[31] Tom K. Kerppola. Bimolecular fluorescence complementation (BiFC) analysis as a probe

of protein interactions in living cells. Annual Review of Biophysics, 37:465–487, 2008.
[32] Chang Deng Hu, Yurii Chinenov, and Tom K. Kerppola. Visualization of interactions
among bZIP and Rel family proteins in living cells using bimolecular fluorescence com-
plementation. Molecular Cell, 9(4):789–798, 2002.
[33] Geoffrey S. Baird, David A. Zacharias, and Roger Y. Tsien. Circular permutation and re-
ceptor insertion within green fluorescent proteins. Proceedings of the National Academy
of Sciences of the United States of America, 96(20):11241–11246, 1999.
[34] Danielle E. Johnson, Hui Wang Ai, Peter Wong, James D. Young, Robert E. Campbell,
and Joseph R. Casey. Red fluorescent protein pH biosensor to detect concentrative nu-
cleoside transport. Journal of Biological Chemistry, 284(31):20499–20511, 2009.
[35] Andreas Ibraheem and Robert E. Campbell. Designs and applications of fluorescent
protein-based biosensors. Current Opinion in Chemical Biology, 14(1):30–36, 2010.
[36] Haley J. Carlson and Robert E. Campbell. Genetically encoded FRET-based biosensors
for multiparameter fluorescence imaging. Current Opinion in Biotechnology, 20(1):19–
27, 2009.
[37] Claire Demeautis, François Sipieter, Julien Roul, Catherine Chapuis, Sergi Padilla-Parra,
Franck B. Riquet, and Marc Tramier. Multiplexing PKA and ERK1&2 kinases FRET
biosensors in living cells using single excitation wavelength dual colour FLIM. Scientific
Reports, 7(2016):1–14, 2017.
[38] Shikha Sharma, Hannah Byrne, and Richard J. O’Kennedy. Antibodies and antibody-
derived analytical biosensors. Essays in Biochemistry, 60(1):9–18, 2016.
BIBLIOGRAPHY 56
[39] Serge Muyldermans. Applications of Nanobodies. Annual Review of Animal Biosciences,

9:401–421, 2021.
[40] R. J. Poljak, L. M. Amzel, H. P. Avey, B. L. Chen, R. P. Phizackerley, and F. Saul.

Three dimensional structure of the Fab’ fragment of a human immunoglobulin at 2.8 Å
resolution. Proceedings of the National Academy of Sciences of the United States of
America, 70(12):3305–3310, 1973.
[41] Eduardo A. Padlan. Anatomy of the antibody molecule. Molecular Immunology,

31(3):169–217, 1994.
[42] Serge Muyldermans. Nanobodies: Natural single-domain antibodies. Annual Review of

Biochemistry, 82(1):775–797, 2013.
[43] Anna M. Wu and Peter D. Senter. Arming antibodies: Prospects and challenges for
immunoconjugates. Nature Biotechnology, 23(9):1137–1146, 2005.
[44] Paula Quintero-Ronderos, Maria-Teresa Arango, John Castiblanco, Nidia E. Correa, and
Gladis Montoya-Ortı́z. Analysis of proteins and antibodies. In Autoimmunity: From
Bench to Bedside, pages 793–812. El Rosario University Press, Colombia, 2013.
[45] Serge Muyldermans. A guide to: generation and design of nanobodies. FEBS Journal,
288(7):2084–2102, 2021.
[46] Dirk Saerens, Gholamreza Hassanzadeh Ghassabeh, and Serge Muyldermans. Single-
domain antibodies as building blocks for novel therapeutics. Current Opinion in Phar-
macology, 8(5):600–608, 2008.
[47] T. Hamers-Casterman, C. Atarchouch, S. Muyldermans, G. Robinson, C. Hamers, E. Ba-

jyana Songa, N. Bendahman, and R. Hamers. Naturally occurring antibodies devoid of
light chains. Nature, 363(6428):446–448, 1993.
[48] S. Muyldermans, T. N. Baral, V. Cortez Retamozzo, P. De Baetselier, E. De Genst,

J. Kinne, H. Leonhardt, S. Magez, V. K. Nguyen, H. Revets, U. Rothbauer, B. Stijle-
mans, S. Tillib, U. Wernery, L. Wyns, Gh. Hassanzadeh-Ghassabeh, and D. Saerens.
Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Im-
munopathology, 128(1-3):178–183, 2009.
[49] Teresa R. Wagner and Ulrich Rothbauer. Nanobodies – Little helpers unravelling intra-
cellular signaling. Free Radical Biology and Medicine, 176:46–61, 2021.
[50] Teresa R. Wagner and Ulrich Rothbauer. Nanobodies Right in the Middel: Intrabodies as
Toolbox to Visualize and Modulate Antigens in the Living Cell. Biomolecules, 10(12):1–
19, 2020.
[51] Christopher K. Kariuki and Stefan Magez. Improving the yield of recalcitrant Nanobod-
ies® by simple modifications to the standard protocol. Protein Expression an Purifica-
tion, 185:105906, 2021.
[52] Ario de Marco. Recombinant expression of nanobodies and nanobody-derived im-

munoreagents. Protein Expression and Purification, 172:105645, 2020.
BIBLIOGRAPHY 57
[53] Roshanak Irannejad, Jin C. Tomshine, Jon R. Tomshine, Michael Chevalier, Jacob P.
Mahoney, Jan Steyaert, Søren G. F. Rasmussen, Roger K. Sunahara, Hana El-samad,
Bo Huang, and Mark Von Zastrow. Conformational biosensors reveal GPCR signalling
from endosomes. Nature, 495(7442):534–540, 2013.
[54] Tomasz Uchański, Els Pardon, and Jan Steyaert. Nanobodies to study protein conforma-
tional states. Current Opinion in Structural Biology, 60:117–123, 2020.
[55] Ulrich Rothbauer, Kourosh Zolghadr, Sergei Tillib, Danny Nowak, Lothar Schermelleh,
Anja Gahl, Natalija Backmann, Katja Conrath, Serge Muyldermans, M. Cristina Car-
doso, and Heinrich Leonhardt. Targeting and tracing antigens in live cells with fluores-
cent nanobodies. Nature Methods, 3(11):887–889, 2006.
[56] Marit A. de Beer and Ben N.G. Giepmans. Nanobody-Based Probes for Subcellular
Protein Identification and Visualization. Frontiers in Cellular Neuroscience, 14:1–16,
2020.
[57] Emmanuel Caussinus, Oguz Kanca, and Markus Affolter. Fluorescent fusion protein
knockout mediated by anti-GFP nanobody. Nature Structural and Molecular Biology,
19(1):117–122, 2012.
[58] Dongyang Li, Christophe Morisseau, Cindy B. Mcreynolds, Thomas Duflot, Jérémy
Bellien, Rashed M. Nagra, Ameer Y. Taha, and Bruce D. Hammock. Development of
Improved Double-Nanobody Sandwich ELISAs for Human Soluble Epoxide Hydrolase
Detection in Peripheral Blood Mononuclear Cells of Diabetic Patients and the Prefrontal
Cortex of Multiple Sclerosis Patients. Analytical Chemistry, 92(10):7334–7342, 2020.
[59] Lieven Huang, Gunter Reekmans, Dirk Saerens, Jean Michel Friedt, Filip Frederix, Lau-
rent Francis, Serge Muyldermans, Andrew Campitelli, and Chris Van Hoof. Prostate-
specific antigen immunosensing based on mixed self-assembled monolayers, camel an-
tibodies and colloidal gold enhanced sandwich assays. Biosensors and Bioelectronics,
21(3):483–490, 2005.
[60] Alexis Broisat, Sophie Hernot, Jakub Toczek, Jens De Vos, Laurent M. Riou, San-
drine Martin, Mitra Ahmadi, Nicole Thielens, Ulrich Wernery, Vicky Caveliers, Serge
Muyldermans, Tony Lahoutte, Daniel Fagret, Catherine Ghezzi, and Nick Devoogdt.
Nanobodies targeting mouse/human VCAM1 for the nuclear imaging of atherosclerotic
lesions. Circulation Research, 110(7):927–937, 2012.
[61] Issam Hmila, Dirk Saerens, Rahma Ben Abderrazek, Cécile Vincke, Naima Abidi, Za-
karia Benlasfar, Jochen Govaert, Mohamed El Ayeb, Balkiss Bouhaouala-Zahar, and
Serge Muyldermans. A bispecific nanobody to provide full protection against lethal
scorpion envenoming. FASEB Journal, 24(9):3479–3489, 2010.
[62] Flora Peyvandi, Marie Scully, Johanna A. Kremer Hovinga, Spero Cataland, Paul Knöbl,
Haifeng Wu, Andrea Artoni, John-Paul Westwood, Magnus Mansouri Taleghani, Bernd
Jilma, Filip Callewaert, Hans Ulrichts, Christian Duby, and Dominique Tersago. Capla-
cizumab for Acquired Thrombotic Thrombocytopenic Purpura. New England Journal of
Medicine, 374(6):511–522, 2016.
BIBLIOGRAPHY 58
[63] Jacques P. Bothma, Matthew R. Norstad, Simon Alamos, Hernan G. Garcia, Jacques P.
Bothma, Matthew R. Norstad, Simon Alamos, and Hernan G. Garcia. LlamaTags: A Ver-
satile Tool to Image Transcription Factor Dynamics in Live Embryos. Cell, 173(7):1810–
1822, 2018.
[64] Peter C. Fridy, Yinyin Li, Sarah Keegan, Mary K. Thompson, Ilona Nudelman, Jo-
hannes F Scheid, Marlene Oeffinger, Michel C. Nussenzweig, David Fenyö, Brian T.
Chait, and Michael P. Rout. A robust pipeline for rapid production of versatile nanobody
repertoires. Nature Medicine, 11(12):1253–1264, 2014.
[65] Ziying Wang, Long Li, Rongting Hu, Peiyu Zhong, Yiran Zhang, Shihao Cheng,
He Jiang, Rui Liu, and Yu Ding. Structural insights into the binding of nanobodies LaM2
and LaM4 to the red fluorescent protein mCherry. Protein Science, 30(11):2298–2309,
2021.
[66] Søren G. F. Rasmussen, Hee-jung Choi, Juan Jose Fung, Els Pardon, Paola Casarosa,
Pil Seok Chae, Brian T. Devree, Daniel M. Rosenbaum, Foon Sun Thian, Tong Sun
Kobilka, Andreas Schnapp, Ingo Konetzki, Roger K. Sunahara, Samuel H. Gellman,
Alexander Pautsch, Jan Steyaert, William I. Weis, and Brian K. Kobilka. Structure of a
nanobody-stabilized active state of the β 2 adrenoceptor. Nature, 469:175–181, 2011.
[67] Aaron M. Ring, Aashish Manglik, Andrew C. Kruse, Michael D. Enos, William I. Weis,
K. Christopher Garcia, and Brian K. Kobilka. Adrenaline-activated structure of β 2 -
adrenoceptor stabilized by an engineered nanobody. Nature, 502(7472):575–579, 2013.
[68] T.P. Hopp, K.S. Prickett, V.L. Price, R.T. Libby, C.J. March, D.P. Cerretti, D.L. Urdal,
and P.J. Conlon. A short polypeptide marker sequence useful for recombinant protein
identification and purification. Bio-technology, 6(10):1204–1210, 1988.
[69] E. Hochuli, H. Döbeli, and A. Schacher. New metal chelate adsorbent selective for
proteins and peptides containing neighbouring histidine residues. Journal of Chromatog-
raphy A, 411:177–184, 1987.
[70] G.I. Evan, G.K. Lewis, G. Ramsay, and J.M. Bishop. Isolation of monoclonal-antibodies
specific for human c-myc proto-oncogene product. Molecular and Cellular Biology,
5(12):3610–3616, 1985.
[71] Jonathan W. Jarvik and Cheryl A. Telmer. Epitope tagging. Annual Review of Genetics,
32(1):601–618, 1998.
[72] Benedikt Jedlitzke and Henning D. Mootz. A Light-Activatable Photocaged Variant of

the Ultra-High Affinity ALFA-Tag Nanobody. ChemBioChem, 23(12):8–12, 2022.
[73] Dipayan Akhuli and Aileen Sara Viji. ALIBY : ALFA Nanobody-Based Toolkit for
Imaging and Biochemistry in Yeast. mSphere, 7(5):1–13, 2022.
[74] Hansjörg Götzke, Markus Kilisch, Markel Martı́nez-carranza, Shama Sograte-idrissi,

Abirami Rajavel, Thomas Schlichthaerle, Niklas Engels, Ralf Jungmann, Pål Stenmark,
Felipe Opazo, and Steffen Frey. The ALFA-tag is a highly versatile tool for nanobody-
based bioscience applications. Nature Communications, 10:1–12, 2019.
BIBLIOGRAPHY 59
[75] Fei Jin, Cheng Shen, Yao Wang, Mengqi Wang, Minxuan Sun, and Motoyuki Hattori.
Fluorescence-detection size-exclusion chromatography utilizing nanobody technology
for expression screening of membrane proteins. Communications Biology, 4(366):1–14,
2021.
[76] Erwin J. De Genst, Tim Guilliams, Joke Wellens, Elizabeth M. O. Day, Christopher A.
Waudby, Sarah Meehan, Mireille Dumoulin, Shang-te Danny Hsu, Nunilo Cremades,
Koen H. G. Verschueren, Els Pardon, Lode Wyns, Jan Steyaert, John Christodoulou,
and Christopher M. Dobson. Structure and Properties of a Complex of α-Synuclein and
a Single-Domain Camelid Antibody. Journal of Molecular Biology, 402(2):326–343,
2010.
[77] Michael B. Braun, Bjoern Traenkle, Philipp A. Koch, Felix Emele, Frederik Weiss,
Oliver Poetz, Thilo Stehle, and Ulrich Rothbauer. Peptides in headlock – a novel high-
affinity and versatile peptide-binding nanobody for proteomics and microscopy. Scientific
Reports, 6(1):1–10, 2016.
[78] Sanne Boersma, Deepak Khuperkar, Bram M. P. Verhagen, Stijn Sonneveld, Jonathan B.
Grimm, Luke D. Lavis, and Marvin E. Tanenbaum. Multi-Color Single-Molecule Imag-
ing Uncovers Extensive Heterogeneity in mRNA Decoding. Cell, 178(2):458–472, 2019.
[79] Bjoern Traenkle, Sören Segan, Funmilayo O. Fagbadebo, Philipp D. Kaiser, and Ulrich
Rothbauer. A novel epitope tagging system to visualize and monitor antigens in live cells
with chromobodies. Scientific Reports, 10(1):14267, 2020.
[80] Yuling Yan and Gerard Marriott. Analysis of protein interactions using fluorescence
technologies. Current Opinion in Chemical Biology, 7(5):635–640, 2003.
[81] Matthew A. Cooper. Label-free screening of bio-molecular interactions. Analytical and

Bioanalytical Chemistry, 377(5):834–842, 2003.
[82] Benjamin A. Shoemaker and Anna R. Panchenko. Deciphering protein-protein inter-

actions. Part I. Experimental techniques and databases. PLoS Computational Biology,
3(3):0337–0344, 2007.
[83] Azmiri Sultana and Jeffrey E. Lee. Measuring protein-protein and protein-nucleic
acid interactions by biolayer interferometry. Current Protocols in Protein Science,
79:19.25.1–19.25.26, 2015.
[84] Nathan J. Moerke. Fluorescence Polarization (FP) Assays for Monitoring Peptide-
Protein or Nucleic Acid-Protein Binding. Current Protocols in Chemical Biology,
1(1):1–15, 2009.
[85] Ana M. Rossi and Colin W. Taylor. Analysis of protein-ligand interactions by fluores-
cence polarization. Nature Protocols, 6(3):365–387, 2011.
[86] Lih Feng Cheow, Ramya Viswanathan, Chee Sing Chin, Nancy Jennifer, Robert C. Jones,
Ernesto Guccione, Stephen R. Quake, and William F. Burkholder. Multiplexed analysis
of protein-ligand interactions by fluorescence anisotropy in a microfluidic platform. An-
alytical Chemistry, 86(19):9901–9908, 2014.
BIBLIOGRAPHY 60
[87] Badreddine Douzi. Protein–protein interactions: Surface plasmon resonance. In Bacte-

rial Protein Secretion Systems: Methods and Protocols, pages 257–275. Springer New
York, NY, 2017.
[88] Zaneta Nikolovska-Coleska. Studying protein-protein interactions using surface plasmon

resonance. In Protein-Protein Interactions: Methods and Applications, pages 109–138.
Springer New York, NY, 2015.
[89] Tord Berggård, Sara Linse, and Peter James. Methods for the detection and analysis of
protein-protein interactions. Proteomics, 7(16):2833–2842, 2007.
[90] Stephen R. Martin, Andres Ramos, and Laura Masino. Biolayer interferometry: Protein–
rna interactions. In Protein-Ligand Interactions: Methods and Applications, pages 351–
368. Springer US, New York, NY, 2021.
[91] Hiroaki Inoue, Hiroshi Nojima, and Hiroto Okayama. High efficiency transformation of
Escherichia coli with plasmids. Gene, 96(1):23–28, 1990.
[92] Sean Moore. ’round-the-horn site-directed mutagenesis - OpenWetWare, 2018. https:

//openwetware.org/wiki/%27Round-the-horn_site-directed_mutagenesis,
accessed on 09.06.2023.
[93] Benchling, 2022. https://benchling.com.
[94] Lan Huong Tran, Geert Jan Graulus, Cécile Vincke, Natalia Smiejkowska, Anne Kindt,
Nick Devoogdt, Serge Muyldermans, Peter Adriaensens, and Wanda Guedens. Nanobod-
ies for the Early Detection of Ovarian Cancer. International Journal of Molecular Sci-
ences, 23(22):1–15, 2022.
[95] Sambrook, J.F. Molecular cloning: a laboratory manual, 2001. Cold Spring Harbour
Laboratory Press.
[96] Schrödinger, LLC. The PyMOL molecular graphics system, version 1.8, November
2015.
[97] Caroline A. Schneider, Wayne S. Rasband, and Kevin W. Eliceiri. NIH Image to ImageJ:
25 years of image analysis. Nature Methods, 9(7):671–675, 2012.
[98] Yu-Cheng Chen, Li-An Chen, Shu-Jen Chen, Ming-Chung Chang, and Teh-Liang Chen.
A modified osmotic shock for periplasmic release of a recombinant creatinase from Es-
cherichia coli. Biochemical Engineering Journal, 19(3):211–215, 2004.
[99] M. Powell. Effect on quantifying a fluorescein labeled oligonucleotide using absorbance

at 260nm - BioSynthesis, 2013. https://www.biosyn.com/faq/effect-on-quant
ifying-a-fluorescein-labeled-oligonucleotide-using-absorbance-at-2
60nm.aspx, accessed on 17.05.2023.
[100] Nectarios Klonis and William H. Sawyer. The Thiourea Group Modulates the Fluores-
cence Emission Decay of Fluorescein-labeled Molecules. Photochemistry and Photobi-
ology, 77(5):502, 2003.
BIBLIOGRAPHY 61
[101] R. K. Scopes. Measurement of protein by spectrophotometry at 205 nm. Analytical

Biochemistry, 59(1):277–282, 1974.
[102] Aaron R. Hieb, Sheena D’Arcy, Michael A. Kramer, Alison E. White, and Karolin Luger.
Fluorescence strategies for high-throughput quantification of protein interactions. Nu-
cleic Acids Research, 40(5):1–13, 2012.
[103] Ilka Wittig and Hermann Schägger. Advantages and limitations of clear-native PAGE.
Proteomics, 5(17):4338–4346, 2005.
[104] Ilka Wittig and Hermann Schägger. Native electrophoretic techniques to identify protein-
protein interactions. Proteomics, 9(23):5214–5223, 2009.
[105] Ilka Wittig, Hans Peter Braun, and Hermann Schägger. Blue native PAGE. Nature
Protocols, 1(1):418–428, 2006.
[106] Steven Lavington and Anthony Watts. Lipid nanoparticle technologies for the study of G
protein-coupled receptors in lipid environments. Biophysical Reviews, 12(6):1287–1302,
2020.
[107] Dean P. Staus, Laura M. Wingler, Ryan T. Strachan, Soren G.F. Rasmussen, Els Pardon,
Seungkirl Ahn, Jan Steyaert, Brian K. Kobilka, and Robert J. Lefkowitz. Regulation of
β2-Adrenergic Receptor Function by Conformationally Selective Single-Domain Intra-
bodies. Molecular Pharmacology, 85(3):472–481, 2014.
Appendices
Appendix A
Risk assessment
General
Before starting experimental work in the laboratory, a mandatory safety training was followed.
During this training the basic labrules were mentioned and important safety protocols were ex-
plained (location of emergency exits and emergency (eye) shower, what to do in case of fire,
etc.). To ensure a safe lab environment, general guidelines must be followed like wearing the
correct personal protection equipment (PPE): a labcoat when entering the lab, nitrile gloves
when required for the experiment and protective goggles when there is a risk of splashing liq-
uids. Additionally, no eating or drinking in the lab is allowed and disinfection of the surfaces
using 70% ethanol after finishing the experiments. When exiting the lab, hands need to be
washed with soap.
Biological risks
The biological risk during this project was minimal, therefore all general molecular biology
experiments could be carried out in a L1 laboratory. The used strains of E. Coli were non-
pathogenic. Experiments involving eukaryotic cells were performed in a UV sterilized laminar
flow cabinet that was present in a L2 biosafety laboratory. All biological contaminated waste
was disposed in CORDI boxes.
Chemical risks
Ethidium bromide (EtBr, E4+) is a highly toxic reagent that was used for staining of DNA on
agarose gels. Gloves were disposed directly after working with EtBr which was only handled
in a predefined space. For preparation of an SDS-PAGE gel, several toxic reagents were used:
acrylamide (E4) is carcinogenic; SDS (E4+) is harmful for aquatic organisms; APS (E3) can
A. 1
APPENDIX A. RISK ASSESSMENT A. 2
be irritating for the skin and when inhaled; TEMED (E3) is toxic when swallowed and inhaled.
Consequently, SDS-PAGE gels were made under the fume hood with dedicated pipettes and
while wearing gloves. Highly flammable compounds like ethanol, SDS, TEMED and Ni-NTA
agarose were kept away from heat sources. Handling of concentrated HCl and NaOH for pH
adjustments of buffer preparations was done under the fume hood while wearing gloves.
Physical risks
A mandatory laser safety training was attended before starting fluorescence microscopy exper-
iments to explain risks that lasers can have, such as causing eye damage. UV-protective glasses
were worn when using UV light for visualization of DNA on agarose gels. A sound-proof
cabinet was placed around the sonicator used for cell lysis as this process creates damaging
high-frequency sound waves. Needles and scalpels were disposed in a designated container.
Appropriate cold resistant gloves were worn when handling liquid nitrogen for flash freezing of
nanobody aliquots.
Appendix B
List of plasmids
Figure S1: Plasmid map of the pET28b expression vector with the ALFA nanobody. Used
for expression of ALFA nanobody.
B. 1
APPENDIX B. LIST OF PLASMIDS B. 2
Figure S2: Plasmid map of the pRSETb expression vector with the LaM4 nanobody.
Used for expression of both WT-LaM4 and mutant LaM4.
Figure S3: Plasmid map of the pET26b expression vector with the Nb6B9 nanobody.
Used for expression of both WT-Nb6B9 and mutant Nb6B9.
APPENDIX B. LIST OF PLASMIDS B. 3
Figure S4: Plasmid map of the eukaryotic pcDNA3 expression vector with the eGFP
coupled Nb6B9 nanobody. Used for eukaryotic expression of both eGFP coupled WT-
Nb6B9 and eGFP coupled mutant Nb6B9.
Appendix C
List of primers
Table S1: List of primers. Primer sequences are displayed from 5’ end to 3’ end. Uppercase
bases indicate primer overhang used to introduce mutations in the template plasmid using
the ’Round-the horn-site directed mutagenesis method [92]. Lowercase bases indicate the
primer part annealing to the template
Primer name Primer sequence

pET28b-ALFA Nb FW gaagttcagttacaagagagtgg
pET28b-ALFA Nb REV gaacagaacttccaggcc
LaM4 Mut FW GCCATGTATAGGGAAagcgcaaaaggtcgttttac
LaM4 Mut REV GTTTCCCCTTTCgctaattgctgcaacaaattcacgttc
Nb6B9 Mut1 FW AGCGAACGCGGCAACGCGATGtatgccaactccgtgaag
Nb6B9 Mut1 REV aatagctgcgaccaactcg
Nb6B9 Mut2 FW GAACGCGGCAACGCGaactatgccaactccgtgaagggc
Nb6B9 Mut2 REV atgaatagctgcgaccaactcg
C. 1
Biochemistry, Molecular and Structural Biology
Celestijnenlaan 200G - box 2403
3001 LEUVEN, BELGIË
tel. + 32 16 32 04 32
fax + 32 16 37 20 20
www.kuleuven.be

Development of A Universal Blocking Peptide For A Novel Class of Fluorescent Biosensors Based On Nanobodies (Master Thesis 2023)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Development of A Universal Blocking Peptide For A Novel Class of Fluorescent Biosensors Based On Nanobodies (Master Thesis 2023)

Uploaded by

Copyright:

Available Formats

FACULTY OF SCIENCE

Supervisor: Prof. Dr. Peter Dedecker Thesis presented in

Academic year 2022-2023

List of Abbreviations vii

3 Materials and methods 23

4 Results and discussion 32

5 Conclusion and future perspectives 49

1.1 Jablonski diagram . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

2.1 NanoBlock biosensor architecture . . . . . . . . . . . . . . . . . . . . . . . . 22

3.1 Preparation of 96-well plate for fluorescence polarization binding assay . . . . . 29

4.1 PyMol structure of ALFA nanobody residues selected to introduce in LaM4

4.15 Fluorescence images of U2OS cells expressing eGFP-coupled mutant 2 Nb6B9 48

1.1 Overview of intermolecular interactions in the LaM4 - mCherry complex . . . . 12

3.1 Thermocycling conditions for PCR . . . . . . . . . . . . . . . . . . . . . . . 25

4.1 Concentration measurements of FITC-GS-12 and FITC-ALFA-Tag peptides us-

β2 -AR β2 -adrenergic receptor

PPIs Protein-protein interactions

Genetically-encoded fluorescent biosensors have proven to be valuable tools to study cellular

Genetisch-gecodeerde fluorescente biosensoren hebben bewezen waardevolle hulpmiddelen te

Een interessant nieuw biosensor ontwerp is de universele NanoBlock architectuur. De belang-

Mutaties werden aangebracht in twee test nanobodies, LaM4 en Nb6B9, gebaseerd op de

1.1 Fluorescence: the gateway to cells

1.1.1 The basics of fluorescence

Figure 1.1: Jablonski diagram. Adapted from [6].

1.1.2 Fluorescent proteins

1.1.3 Fluorescence microscopy

Figure 1.3: Inverted fluorescence microscopy setup. Adapted from [17].

1.2 Fluorescent biosensors

1.2.1 Applications of genetically-encoded biosensors

Since the main function of a genetically-encoded biosensor is to translate a specific cellular

1.2.2 Architecture of genetically-encoded biosensors

Figure 1.4: Different types of architectures for genetically-encoded fluorescent biosensors.

1.2.3 Types of genetically-encoded biosensors

1.3.1 Conventional antibodies

1.3.2.2 Nanobody structure

Figure 1.7: Nb domain structure. Adapted from [49].

1.4 Examples of nanobodies

1.4.1 Nanobodies binding (R)FPs: LaM4

Table 1.1: Overview of intermolecular interactions in the LaM4 - mCherry complex.

mCherry residue LaM4 residue Interaction Distance (Å)

1.4.2 Nanobodies binding GPCRs: Nb6B9

Membrane-bound G-protein coupled receptors (GPCRs) and their cognate heterotrimeric G-

1.4.3 Nanobodies binding epitope tags: ALFA nanobody

The artificially designed ALFA-Tag consists of a sequence of 13 amino acids (SRLEEELR-

Table 1.2: Overview of intramolecular interactions of the ALFA-Tag side-chains. Residues

Residues Interaction Distance (Å)

Table 1.3: Overview of intermolecular interactions in the ALFA-Nb - ALFA-Tag complex.

ALFA-Tag residue ALFA-Nb residue ALFA-Nb domain Interaction

1.5 Methods to quantify protein-peptide interactions

1.5.1 Fluorescence polarization

Figure 1.13: Schematic overview of fluorescence polarization. Adapted from [86].

1.5.2 Detection label-free techniques

Materials and methods

3.2 Buffers and media

Tris-NaCl (TN) buffer (100/300) : Buffer prepared by dissolving final concentrations of

Tris-NaCl-imidazole (TNi) buffer (100/300/20) : Buffer prepared by dissolving final concen-

Tris-NaCl-imidazole (TNi) buffer (100/300/40) : Buffer prepared by dissolving final concen-

Tris-NaCl-imidazole (TNi) buffer (100/300/250) : Buffer prepared by dissolving final con-

1% (w/v) agarose: Prepared by adding 10 g agarose to 1 L of 1xTAE buffer. Agarose was

1x Sodium dodecyl sulphate-polyacrylamide gelectrophoresis (SDS-PAGE) running buffer:

3.3 Molecular biology

Transformations: Plasmid transformation started with thawing an aliquot of competent E Coli

Polymerase chain reaction (PCR)-based mutagenesis: ’Round-the-horn site-directed muta-