Diatom Research

ISSN: 0269-249X (Print) 2159-8347 (Online) Journal homepage: http://www.tandfonline.com/loi/tdia20

Diversity, temporal distribution and physiology

of the centric diatom Leptocylindrus Cleve
(Bacillariophyta) from a southern hemisphere
upwelling system

Penelope A. Ajani, Linda H. Armbrecht, Oliver Kersten, Gurjeet S. Kohli &

Shauna A. Murray

To cite this article: Penelope A. Ajani, Linda H. Armbrecht, Oliver Kersten, Gurjeet S. Kohli &
Shauna A. Murray (2016): Diversity, temporal distribution and physiology of the centric diatom
Leptocylindrus Cleve (Bacillariophyta) from a southern hemisphere upwelling system, Diatom
Research, DOI: 10.1080/0269249X.2016.1260058

To link to this article: http://dx.doi.org/10.1080/0269249X.2016.1260058

Published online: 30 Nov 2016.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

http://www.tandfonline.com/action/journalInformation?journalCode=tdia20

Download by: [Ryerson University Library] Date: 30 November 2016, At: 12:41
Diatom Research, 2016
http://dx.doi.org/10.1080/0269249X.2016.1260058

Diversity, temporal distribution and physiology of the centric diatom Leptocylindrus Cleve
(Bacillariophyta) from a southern hemisphere upwelling system
PENELOPE A. AJANI1∗ , LINDA H. ARMBRECHT2 , OLIVER KERSTEN3 , GURJEET S. KOHLI1† &
SHAUNA A. MURRAY1
1 Climate Change Cluster (C3), University of Technology Sydney, Ultimo, Australia
2 Department of Biological Sciences, Macquarie University, Sydney, Australia
3 Centre for Ecological and Evolutionary Synthesis (CEES), Department of Biosciences, University of Oslo, Oslo, Norway

The marine diatom Leptocylindrus is a major component of phytoplankton blooms in coastal ecosystems and upwelling regions world-
wide, however, little is known about this genus in the southern hemisphere. Whilst Leptocylindrus danicus has been reported from
south-eastern (SE) Australia since the 1930s, there has been neither unequivocal species identification nor focused examination of the
temporal abundance of Leptocylindrus in this region. Such investigations are crucial in the context of climate change and the strengthen-
ing of the East Australian Current, which is expected to result in alterations to the seasonal abundance and distribution of Leptocylindrus
along the east Australian coast. Thus we also describe the temporal distribution of Leptocylindrus based on 50 years of records, revealing
that this diatom is a key component of the seasonal phytoplankton cycle, with greatest abundance in the austral spring and summer. Using
light and transmission electron microscopy and molecular phylogenetics based on the nuclear-encoded ITS1–5.8S–ITS2 rDNA region,
our study unambiguously revealed three species, L. danicus, Leptocylindrus convexus and Leptocylindrus aporus from 34 clonal iso-
lates from SE Australia, with the majority (82%) of strains identified as L. danicus. Furthermore, we investigated the growth, auxospore
and resting spore formation of the most commonly occurring species, L. danicus, under four temperature and irradiance scenarios. The
diatom reached maximum growth rates (μMax, 1.71 divisions day−1 ) under relatively high temperatures (25°C) and light conditions (100
μmol photons m−2 s−1 ) between days 2 and 7 of the experiment. When temperature and light regimes were reduced (18°C, 50 μmol
photons m−2 s−1 ) auxospores and resting spores were formed. The rapid growth rate and potential of L. danicus to form auxospores
are important survival mechanisms in coastal upwelling systems and likely to result in the continued success of this species in Eastern
Australia. The ecological, physiological and evolutionary response of this significant diatom group to further ocean warming should be
the focus of future investigations.
Keywords: Auxospore, climate change, East Australian Current, life cycle, phytoplankton, resting spore

Introduction
Diatoms are a highly productive and diverse class of
unicellular marine eukaryotes, performing ∼ 25% of the
world’s photosynthesis (Armbrust 2009) and generating
∼ 40% of the 45–50 metric tons of organic matter produced
by the ocean each year (Bowler et al. 2010). Diatoms also
control the biological portion of the silicon cycle in today’s
oceans and are a food source for higher trophic organ-
isms, thus maintaining important fisheries (Richardson &
Poloczanska 2008). Carbon fixed within diatoms is recy-
cled by sinking and decomposition, whilst re-suspension
occurs via upwelling and ocean currents. Crude oil deposits
are largely composed of fossilized diatoms, emphasizing
their significance in the ocean’s biogeochemical cycles
(Falkowski & Oliver 2007).
Diatoms are particularly abundant in dynamic upwelling
regions around the world (Uitz et al. 2010, Fawcett &
Ward 2011, Huang et al. 2011, Morales & Anabalon 2012).
When cold, nutrient-rich bottom water wells up into the
euphotic zone, diatoms can take up nutrients rapidly and
efficiently, with populations growing 3–4 times their nor-
mal abundance in just a few days (Zingone et al. 2010).
Towards the end of this ‘bloom period’, when water col-
umn nutrients become depleted, some diatoms form heav-
ily silicified resting spores, which sink to the bottom, and
remain dormant until conditions again become optimal for
germination (McQuoid & Hobson 1996).
The cosmopolitan, centric diatom Leptocylindrus Cleve
(Bacillariophyta, Leptocylindraceae) is a major compo-
nent of coastal phytoplankton communities and upwelling
regions worldwide (Nanjappa et al. 2013). A recent inves-
tigation in the Gulf of Naples revealed that there are
five morphologically distinct species belonging to this
genus. Key differences between the species included the

*Corresponding author. E-mail: penelope.ajani@uts.edu.au

† Present address: Singapore Centre for Environmental Life Sciences Engineering, Nanyang Technological University, Singapore

(Received 10 June 2016; accepted 1 November 2016)

© 2016 The International Society for Diatom Research

2 Ajani et al.
divergence of the nuclear-encoded ITS2 region of the
rDNA, and both frustule and resting spore morphology
(Nanjappa et al. 2013, Nanjappa, Audic et al. 2014). In two
of the species, Leptocylindricus danicus Cleve and Lepto-
cylindrus hargravesii Nanjappa & Zingone sexual repro-
duction is followed by the production of spine-bearing
resting spores as part of its auxosporulation process (Har-
graves 1976, Davis et al. 1980, French & Hargraves 1985,
Nanjappa et al. 2013). It has been hypothesized that this life
cycle strategy provides a competitive advantage, ensuring
that these species will survive until favourable conditions
return, that is, when water temperatures increase (seasonal
warming/mixing) and nutrients again become available
(via upwelling) (Ishizaka et al. 1987).
Leptocylindrus danicus was first reported in south-
eastern (SE) Australia in 1933 (Dakin & Colefax 1933),
and is considered an important component of the phy-
toplankton community (Hallegraeff & Reid 1986, Ajani
et al. 2014a, b). However, there has been no definitive
identification of this species in these waters and the pos-
sibility of hidden diversity exists. The aim of this study,
therefore, was to examine L. cf. danicus in SE Australia,
including species morphology and molecular phylogeny.
Furthermore, the multi-scaled temporal distribution of this
genus over the past 50 years in these waters was examined.
Expected future changes in the local oceanography of this
region with climate change, such as the strengthening of
southward flowing East Australian Current (EAC) (Ridg-
way 2007), may impact the abundance and distribution of
this genus. Thus, we investigated the growth of L. dani-
cus under differing temperature and irradiance scenarios, as
well as its potential to form auxospores and resting spores.
Based on our results, we assess the suitability of L. danicus
as a model diatom for future population connectivity and
stress response studies in upwelling regions worldwide.
Materials and methods
Study location
The SE Australian coast stretches from the sub-tropics in
the north (28°S) to temperate regions in the south (43°S),
flanked by the Tasman Sea. The region is dominated by the
EAC –the Western Boundary Current (WBC) of the South
Pacific Gyre – which transports warm water from tropi-
cal to temperate latitudes (Godfrey et al. 1980) (Figs 1–2).
The EAC flows southward along the edge of the conti-
nental shelf (7–16 Sv, Ridgway & Godfrey 1997) until
it transitions ( ∼ 30°S) and separates ( ∼ 32°S) into east-
ern and southern components (Church 1987, Ridgway &
Dunn 2003) (Fig. 2). Upstream of the separation zone,
phytoplankton investigations have focused on the sub-
tropical-temperate Coffs Harbour region (30°S) (hereafter
CH) (Armbrecht, Roughan et al. 2014, Armbrecht, Schaef-
fer et al. 2015, Armbrecht, Thompson et al. 2015), whilst
downstream, phytoplankton investigations have been cen-
tred on the Port Hacking 100 m coastal station, 8 km off
shore from Sydney (34°S) (hereafter PH100m ) (Jeffrey &
Carpenter 1974, Hallegraeff & Reid 1986, Ajani et al.
2001, Ajani et al. 2014a, b) (Fig. 1). Like other WBCs
around the world, the EAC has intensified (poleward exten-
sion of approximately 350 km) and undergone significant
warming (2.28°C/century) (Ridgway & Hill 2012). This
warming trend is expected to continue with impacts pre-
dicted for phytoplankton communities, including south-
ward shifts in species distributions, changes in the timing
of seasonal activity (phenological shifts), and possible
alterations to food web structures (Thompson et al. 2009).
Along this coastline, nine sampling sites – Coffs
Harbour (30.3°S, 153.1°E), Forster (32.2°S, 152.5°E),
Watsons Bay (33.8°S, 151.3°E), Coogee Beach (33.9°S,
151.2°E), Clovelly Beach (33.9°S, 151.26°E), Maroubra
Beach (33.9°S, 151.24°E), Port Hacking (PH25m ), Port
Hacking (PH100m ) (34.1°S, 151.2°E) and Bendalong
(35.2°S, 150.5°E) were selected for sample collection
(Table 1, Fig. 1).
Phytoplankton collection, enumeration and culture
maintenance
Non-axenic monoclonal batch cultures of Leptocylindrus
(n = 43) were established by single cell or single filament
isolation, using drawn out Pasteur pipettes (micropipettes),
from net samples (20 μm mesh size) collected at vari-
ous locations along the SE Australian coastline (Table 1,
Figs 1–2). Leptocylindrus isolates were grown in 24-well
plates containing f/2 media (Guillard 1975) and monitored
by light microscopy (LM). Once established each strain
was transferred to 50 mL culture flasks and maintained in
a constant temperature incubator at 16–18°C under a white
light flux of 60–100 μmol photon m−2 s−1 and a 12-hr light
(L):12-h dark (D) cycle. One millilitre of culture from each
strain was transferred into fresh media every two weeks to
maintain healthy and exponentially growing cultures over
the duration of the study.
Morphological examination
Morphological examination was carried out on all field
samples, as well as all exponentially growing and sex-
ually reproductive clonal cultures. A maximum magni-
fication of × 400 and a Nikon Eclipse TS100 inverted
microscope equipped with a Lumenera Infinity 3 digital
camera (Ottawa, Canada) was used for all cell isolations
and LM examination of all clones. For transmission elec-
tron microscopy (TEM) selected clonal cultures were pre-
served in Lugol’s iodine prior to cleaning using the method
of Hasle & Fryxell (1970). Once cleaned, samples were
placed on formvar-coated copper grids and loaded into a
FEI Tecnai T20 TEM (LaB6), operated at a high tension
of 120 kV and equipped with a Gatan 894 CCD 2k × 2k
 Leptocylindrus in a southern hemisphere upwelling system 3

Figs 1–2. Map of study area showing southeast Australia and the sampling locations from north to south, Coffs Harbour (white square),
Forster (black triangle) Watsons Bay inside Sydney Harbour (grey square), Coogee Beach (black square), Clovelly Beach (white triangle),
Maroubra Beach (white circle), the coastal monitoring stations PH25 m (grey circle) and PH100 m (black circle) and Bendalong (grey
triangle). Fig. 2. EAC travels south along the SE Australian coastline (study range shown by black rectangle) and is recognized by the
warm sea surface temperature. EAC ‘separation zone’ and eddy formation shown by black arrow. Image source: New South Wales Office
of Environment and Heritage.

camera. Distinctive morphometric diagnoses for the struc-
ture of Leptocylindrus were guided by French & Hargraves
(1985, 1986) and Nanjappa et al. (2013) and analysed using
Image J software (http://rsbweb.nih.gov/ij/).
Molecular characterization and phylogenetic analyses
A 10 mL subsample of cultured material from each strain
was concentrated by centrifugation at 1000g for 10 min
and frozen at − 80°C prior to DNA extraction (Table 1).
DNA extraction was conducted using the MP Biomedi-
cals FastDNA™ SPIN Kit for Soil as per manufacturer’s
protocols. The nuclear-encoded partial ITS1–5.8S–ITS2
rDNA region was amplified using the readymade PCR
mix Immomix™ (Bioline, London, UK). The primers
used to amplify the ITS1–5.8S–ITS2 rDNA from the
clonal cultures of Leptocylindrus species were ITS-for
(ATATGCTTAAATTCAGCGGGT) and ITS-rev (TTTC-
CGTAGCTGAACCTGCGG) (Murray et al. 2012). PCR
was conducted using the following cycle conditions: ini-
tial denaturation at 95°C for 10 min followed by 30 cycles
of denaturation at 95°C for 30 s, primer annealing at 55°C
for 30 s and an extension at 72°C for 1 min followed by
a final extension step at 72°C for 1 min. Amplicons were
separated on 1% w/v agarose gel stained with Gel Red™
(Biotium, Hayward, CA, USA) and visualized under UV
light. PCR products were purified using a SureClean purifi-
cation kit (Bioline) according to the manufacturer’s proto-
cols and sequenced using the external sequencing service
Macrogen Inc. (Seoul, Korea).
All steps for the phylogenetic analysis were per-
®
formed in Geneious software (Kearse et al. 2012).
4 Ajani et al.

Table 1. List of Leptocylindrus species isolated in this study including clone designation, collection location, sampling dates and
Genbank Accession number (to be advised).

Genbank
Species identification Clone designation Collection location Date sampled accession no.

Leptocylindrus danicus CH–280212–1a Coffs Harbour 28/02/2012 NA

COOG–100215–1 Coogee Beach 10/02/2015 KY008558
COOG–100215–2 Coogee Beach 10/02/2015 KY008559
BEND–150215–1 Bendalong 15/02/2015 KY008546
WAT–190215–1 Watsons Bay 19/02/2015 KY008556
PH–260215–2 Port Hacking 100 m 26/02/2015 KY008552
PH–230715–2 Port Hacking 25 m 23/07/2015 KY008541
PH–230715–3 Port Hacking 25 m 23/07/2015 KY008555
MAR091215–4 Maroubra Beach 09/12/2015 KY008543
MAR091215–12 Maroubra Beach 09/12/2015 KY008553
CLOV101215–1 Clovelly Beach 10/12/2015 KY008538
CLOV101215–2 Clovelly Beach 10/12/2015 KY008536
CLOV101215–6 Clovelly Beach 10/12/2015 KY008551
CLOV101215–7 Clovelly Beach 10/12/2015 KY008554
CLOV101215–9 Clovelly Beach 10/12/2015 KY008537
CH230116–3 Coffs Harbour 23/01/2016 KY008547
CH230116–5 Coffs Harbour 23/01/2016 KY008560
CH230116–9 Coffs Harbour 23/01/2016 KY008550
CH230116–10 Coffs Harbour 23/01/2016 KY008548
CH230116–18 Coffs Harbour 23/01/2016 KY008549
CH230116–20 Coffs Harbour 23/01/2016 KY008562
CH230116–21 Coffs Harbour 23/01/2016 KY008557
CLOV280216–2 Clovelly Beach 28/02/2016 KY008561
CLOV280216–3 Clovelly Beach 28/02/2016 KY008542
FOS180216–1 Forster Beach 18/02/2016 KY008544
FOS180216–7 Forster Beach 18/02/2016 KY008545
FOS180216–17 Forster Beach 18/02/2016 KY008539
FOS180216–25 Forster Beach 18/02/2016 KY008540
Leptocylindrus convexus PH–230715–6 Port Hacking 25 m 23/07/2015 KY008564
MAR091215–9 Maroubra Beach 09/12/2015 KY008566
MAR091215–10 Maroubra Beach 09/12/2015 KY008565
MAR091215–11 Maroubra Beach 09/12/2015 KY008567
CLOV101215–3 Clovelly Beach 10/12/2015 KY008563
Leptocylindrus aporus COOG–100215–7 Coogee Beach 10/02/2015 KY008568
a No molecular data available.

ITS1–5.8S–ITS2 rDNA sequences were examined visually
and combined with published species belonging to Lep-
tocylindrus and the closely related genus Tenuicylindrus
Nanjappa & Zingone selected from the National Center for
Biotechnology Information (NCBI) nucleotide database
http://www.ncbi.nlm.nih.gov/ (accessed 04/09/2015). Other
centric diatoms included in the analysis were Rhizosolenia
setigera Brightwell, Guinardia striata (Stolterfoth) Hasle,
Stephanopyxis turris (Greville) Ralfs and the silicoflag-
ellates, Dictyocha octonaria Ehrenberg and Dictyocha
speculum Ehrenberg, as outgroups. All selected sequences
were aligned and trimmed with the final alignment con-
taining 47 sequences of 634 bp length including gaps.
Phylogenetic analyses were performed using RAxML ver-
sion 7.2.8 (Stamatakis et al. 2006), using the Gamma + P
Invar model of rate heterogeneity to obtain the best tree
for the maximum likelihood analysis. Bootstrap analyses
were performed using 500 replicates. A Bayesian analy-
sis (MrBayes V 3.2, Ronquist & Huelsenbeck 2003) was
performed using the general time reversible (GTR) sub-
stitution model, with 1,100,000 iterations, a subsample
frequency of 200, and a burnin of 110,000, at which time
the standard deviation of split frequencies was < 0.01.
The final tree was the consensus Bayesian tree of the final
sampled 4951 trees.
Growth rate including auxospore and resting spore
formation
To investigate the growth rate of SE Australian L. dani-
cus and its potential to form auxospores and resting spores
under differing temperature and irradiance, four replicate
clones, grown from a single cell isolated off Coffs Har-
bour on 28 February 2015 (clone CH–280212–1), were
acclimated for at least seven days to one of four (labo-
ratory available) combinations of two temperatures, 25°C
and 18°C, and two irradiances, 50 and 100 μmol pho-
tons m−2 s−1 , each with a L:D cycle of 12:12 h. Once
 Leptocylindrus in a southern hemisphere upwelling system
the acclimation period was complete, four replicates of
each acclimated strain were grown under four differ-
ent treatment combinations: high light + high tempera-
ture (HLHT); low light + high temperature (LLHT); high
light + low temperature (HLLT); and low light + low
temperature (LLLT) conditions in sterile 160 mL vented
culture flasks (EasYFlasks Nunclon Nunc., Denmark) at
an initial concentration of 313 cells L−1 . The experiment
therefore had a 1 × 4 × 4 factorial design (16 experi-
ment units), with 4 replicate clones grown under the 4
treatments. In order to follow the growth of L. danicus
in the four treatments, 3 mL of unfixed subsample from
each of three experimental cultures were taken at 2–3-day
intervals and cells counted immediately under an inverted
light microscope (Leica DMI3000B, Wetzlar, Germany)
following the Utermöhl method (1958). The fourth repli-
cate was subsampled and counted at 4–5-day intervals due
to time constraints. Each subsample was allowed to settle
in an Utermöhl chamber (HydroBios Kiel, Germany) for
30 min prior to counting. A minimum of 400 ‘live’ cells
(dead cells = empty frustules) were counted per subsam-
ple. Maximum growth rates (µMax in divisions per day)
during the exponential growth phase were calculated based
on Equation (1), with LC1 and LC2 being cell numbers at
sampling time t1 and t2 .
 
ln LCLC2
1 danicus due to its auxospore and resting spore formation, a
µMax = . distinct morphological feature seen only in L. danicus and
t 2 − t1
Due to auxospore and resting spore formation in the
LLLT treatment, the counting procedure in the four repli-
cate cultures under this regime was adjusted slightly.
Short gametangial cells, and those forming enlarge-
ments/swellings on their terminal ends prior to auxospore
and resting spore formation, were counted as ‘living’ cells.
Empty frustules were again considered ‘dead’ cells. The
experiment was stopped on day 32, when cultures had
either died or were examined for the presence of aux-
ospores or resting spores.
Temporal distribution of Leptocylindrus
To examine the importance of Leptocylindrus in a southern
hemisphere upwelling system, we extracted and examined
the temporal distribution of this genus from five historical
datasets. Firstly, we extracted the seasonal distribution data
from a one-year dataset collected offshore from Coffs Har-
bour, New South Wales (Armbrecht, Roughan et al. 2014,
Armbrecht, Schaeffer et al. 2015). Secondly, we examined
the inter-annual pattern of Leptocylindrus from samples
collected monthly over an 11-year period (1998–2009)
from PH100m (Ajani et al. 2014a, b). Finally, we extracted
and examined the status of Leptocylindrus amongst the
top 20 taxa from 5 phytoplankton sampling campaigns
spanning 50 years from the same location (Ajani et al.
in press). The first dataset from Port Hacking covered the
5
sampling period April 1965 to April 1966 (Grant & Kerr
1970, Oceanographic Station List Vol. 85 & 86). The sec-
ond dataset ranged from April 1978 to April 1979. The
third sampling regime covered the period April 1997 to
April 1998 and enumerated the group of Leptocylindrus
and Cerataulina together (Ajani et al. 2001). The fourth
sampling campaign lasted from August 1998 to Decem-
ber 2009 (Ajani et al. 2014a, b). The final dataset from
Port Hacking, February 2009 to December 2012, identified
Leptocylindrus to species level (Integrated Marine Observ-
ing System (IMOS) National Reference Station PH100 m
(unpublished data)).
Results
A total of 34 clonal cultures were established from nine
locations from SE Australia from February 2012 to Febru-
ary 2016 (Table 1, Fig. 1). Twenty-eight clonal cultures
were subsequently identified as L. danicus, five as Lep-
tocylindrus convexus Nanjappa & Zingone and one as
Leptocylindrus aporus (French III and Hargraves) Nan-
jappa & Zingone. Whilst cells resembling Leptocylindrus
cf. minimus/belgicus were also observed in field samples,
these species were not the focus of this study and thus not
investigated further. Moreover, strain CH–280212–1 died
before molecular sequencing, thus we assigned it to L. cf.
L. hargravesii (see Discussion).
Leptocylindrus danicus Cleve
Vegetative cells were cylindrical and either solitary, or
forming chains with cells joined by their valve faces.
Chains were both straight and undulating, sometimes
within the same culture (Fig. 3). Cells had a diameter of
6.4–11.8 μm (mean 9.4 ± 1.3 μm) and a cell length of
17.9–59.8 μm (mean 32.9 ± 8.6 μm) (Table 2). Numerous
discoid plastids were observed ( > 6 per cell) (Fig. 4). The
mean diameter of the valve face was 8.6 ± 1.8 μm and
valve face to mantle ratio was 9.3 ± 2.6 (Table 2, Fig. 5).
Between the valve and the mantle, a surrounding row of
spaced, yet small, flaps was observed (Fig. 5). Valve areo-
lae were present (13.5 ± 1.2 areolae in 1 μm) and arranged
in radiating striae ( 8 ± 0.6 in 1 μm) (Table 2, Fig. 5). A
sub-central pore was present and observed to be adjacent,
or close to, the annulus (Fig. 5). The girdle bands were
elongated and trapezoidal (no image available).
By day ∼ 10 (after initial transfer), unequal divi-
sion of cells into one long, highly pigmented female
gametangium (egg-producing cell) and one short, weakly
pigmented male gametangium (spermatogonium) was
observed (Fig. 6). Curvature of the female gametangium
then occurred ( ∼ 1.3 of cell length, Fig. 7) in preparation
for the conjugation with the sperm (not observed). By day
∼ 17 the auxospore was formed, the cytoplasm was seen to
6 Ajani et al.

Figs 3–9. Micrographs of stages in the life cycle of L. danicus from SE Australian coastal waters. All images are of strain PH–260215–2.
Fig. 3. Typical vegetative chain-forming cells in girdle view. Fig. 4. Numerous plastids per cell. Fig. 5. Transmission electron micrograph
of valve showing inner, lighter area and valve mantle (darker marginal area), row of spaced, yet small, flaps (top inset, arrowhead) and
central annulus with sub-central pore (bottom inset, arrowhead) either adjacent or very close to the annulus. Figs 6–7. Unequal division
of cells into one long, highly pigmented, female gametangium and one short, weakly pigmented, male gametangium (spermatogonium).
Fig. 8. Formation of an auxospore, cytoplasm contraction and release of resting spore from parent cell. Fig. 9. Resting spores. Scale bars
represent: 40 μm (Fig. 3), 20 μm (Figs 4, 6–8), 1 μm (Fig. 5).

contract (Fig. 8), and a heavily silicified resting spore with although swelling of individual cells was noted on/after
numerous spines was freed from the auxospore (Fig. 9). day ∼ 14. No auxospores or resting spores were observed.

Leptocylindrus convexus Nanjappa & Zingone
Cells were cylindrical and solitary or in straight chains
joined together at their valve faces (Fig. 10). Cells had
a diameter of 10.0–12.7 μm (mean 11.6 ± 0.5 μm) and
a cell length of 22.6–137.9 μm (mean 49.0 ± 22.6 μm)
(Table 2). Plastids were few and usually elongated and
located in the centre of the cell (Figs 10–11). The mean
diameter of the valve face was 6.0 ± 0.6 μm, and valve
face to mantle ratio was 4.0 ± 1.0 (Table 2). Between the
valve and the wide mantle, a continuous ring of flaps was
observed (Fig. 12). Valve areolae were present ( 10.4 ± 1.0
in 1 μm), arranged in radiating striae (6.8 ± 1.0 in 1 μm)
(Table 2, Fig. 10). No sub-central pore was observed
(Fig. 10 inset). Sexual reproduction was not observed
Leptocylindrus aporus (French & Hargraves) Nanjappa
& Zingone
Cells were cylindrical and only observed as solitary cells
(Fig. 13). Cells were comparatively narrower, with a diam-
eter of 2.6–10.6 μm (mean 5.1 ± 2.3) and a cell length
of 11.5–64.2 μm (mean 29.7 ± 12.6) (Table 2). Plastids
were few to many and ovoid in shape (Fig. 13). The mean
diameter of the valve face was 6.0 ± 1.3 μm and valve
face to mantle ratio was 5.6 ± 0.5 (Table 2). Between the
valve and the mantle, a ring of distinct and spaced tri-
angular flaps was observed (Fig. 14). Valve areolae were
present (11 ± 0.6 in 1 μm ) and arranged in radiating striae
( 7.9 ± 0.9 in 1 μm) (Table 2, Fig. 14). The annulus was
small with no sub-central pore (Fig. 14 inset). Although
 Leptocylindrus in a southern hemisphere upwelling system 7

Table 2. Main morphological characters (Nanjappa et al. 2013) of the clonal cultures of Leptocylindrus from SE Australian waters
using both light and TEM.

LM TEM
Cell Valve
Cell diameter Cell length Valve face Valve face to Valve areolae Striae (in 1 μm,
Species (μm) (μm) diameter (μm) mantle ratio (in 1 μm) edge)

Leptocylindrus danicus 6.4–11.8 17.9–59.8 4.9–11.6 5.1–14.9 12–17 7–9

9.4 ± 1.3 32.9 ± 8.6 8.6 ± 1.8 9.3 ± 2.6 13.5 ± 1.2 8 ± 0.6
(n = 55) (n = 82) (n = 21) (n = 21) (n = 16) (n = 16)
Leptocylindrus convexus 10.0–12.7 22.6–137.9 4.8–7.2 2.8–6.2 9–13 6–9
11.6 ± 0.5 49.0 ± 22.6 6.0 ± 0.6 4.0 ± 1.0 10.4 ± 1.0 6.8 ± 1.0
(n = 71) (n = 83) (n = 20) (n = 20) (n = 16) (n = 16)
Leptocylindrus aporus 2.6–10.6 11.5–64.2 4.5–8.4 4.8–6.2 10–12 7–9
5.1 ± 2.3 29.7 ± 12.6 6.0 ± 1.3 5.6 ± 0.5 11 ± 0.6 7.9 ± 0.9
(n = 20) (n = 38) (n = 9) (n = 9) (n = 7) (n = 7)

Note: data are given as minimum and maximum range (above), and mean, ± SD (below).

Figs 10–12. Micrographs of L. convexus from SE Australian coastal waters. Fig. 10. Light micrograph of typical vegetative chain-form-
ing cells in girdle view (strain MAR091215–10). Fig. 11. Plastids concentrated towards the centre of each cell (strain CLOV–101215–3).
Fig. 12. Transmission electron micrograph of valve showing wide mantle and continuous ring of flaps (indicated by arrow). Inset showing
central annulus and absence of sub-central pore (strain MAR–091215–9). Scale bars represent 40 μm (Fig. 11), 20 μm (Fig. 10), 1 μm
(Fig. 12).

no gametes or spores were observed, cell extrusion into an positioned on a slightly longer branch than the L. dani-
auxospore-like sphere was observed (not illustrated). cus strains (Fig. 15). Similarly, L. convexus and L. aporus
strains from SE Australia grouped with all other similarly
identified sequences from the Gulf of Naples.

Molecular phylogeny
The ITS1–5.8S–ITS2 sequences of all strains of Lepto-
cylindrus from SE Australia (Table 1) were > 98% similar
to all other Leptocylindrus strains from Genbank (all from
the Gulf of Naples, Italy). Furthermore, all Leptocylindrus
sequences were well supported as a monophyletic group,
and together formed a sister clade to the closely related
genus Tenuicylindrus (Fig. 15). The 28 L. danicus strains
from SE Australia, in turn, formed a well-supported clade
with the Gulf of Naples strains, including their closest mor-
phological relative L. hargravesii, although the latter was
Leptocylindrus cf. danicus growth rate and
auxospore/resting spore formation
Leptocylindrus danicus cultures from SE Australia
exposed to high temperature conditions (HLHT µMax
1.64 ± 0.02, LLHT µMax 1.71 ± 0.11) showed a similar
growth rate to each other, as did the cultures grown under
low temperature conditions (HLLT µMax 1.15 ± 0.03,
LLLT µMax 1.27 ± 0.04) (Figs 16–17). Cultures grown
under high temperature conditions, however, grew sig-
nificantly faster in the exponential growth phase, and
8 Ajani et al.

Figs 13–14. Micrographs of L. aporus from SE Australian coastal waters. Fig. 13. Light micrograph of typical vegetative cell in girdle
view with plastids shown as many and ovoid in shape (strain COOG101215–7, scale bar = 20 μm). Fig. 14. Transmission electron
micrograph of valve showing mantle and ring of distinct and spaced triangular flaps (indicated by arrow). Insets showing central annulus
and absence of sub-central pore (strain COOG101215–7, scale bar = 1 μm).

entered senescence earlier than cultures exposed to low
temperature conditions ((Table 3, Fig. 17). Under high and
low temperature conditions, L. cf. danicus reached µMax
between days 2–7 and days 5–10, with the highest and low-
est µMax found in the LLHT and HLLT treatments, respec-
tively (Table 3, Fig. 17). Under high and low temperature
conditions the experiment lasted 16 and 32 days, respec-
tively (Fig. 17). The high temperature cultures entered
senescence at this time with no sign of auxospore or resting
spore formation, whilst the low temperature cultures con-
tinued to grow until they either died or formed auxospores
and resting spores. The latter was observed in all four repli-
cate cultures of the LLLT treatment. Deformation of L. cf.
danicus cells (onset of sexual reproduction) under low tem-
perature conditions towards the end of the experiment (and
preceding resting spore formation in LLLT cultures) com-
plicated our counting procedure, resulting in relatively high
variations in cell numbers after day 18 (Fig. 17).
Temporal distribution of Leptocylindrus
Monthly averaged cell counts of Leptocylindrus from
Coffs Harbour May 2011–Sept 2012 showed peak cell
densities from November to February with a maximum cell
density of 59,241 cells L−1 in February 2012 (Armbrecht,
Schaeffer et al. 2015) (Fig. 18a). The weekly distribu-
tion of Leptocylindrus over an 11-year period (1998–2009)
from PH100m shows a seasonal signal, with a temporal win-
dow of highest cell abundances occurring from late austral
spring (max cell concentration 4203 cells L−1 , 12 Novem-
ber 1998) through to summer/early autumn (Fig. 18b),
similar to the seasonal window of L. convexus and L. dan-
icus observed in the Gulf of Naples (Nanjappa, D’ippolito
et al. 2014). The inter-annual pattern of Leptocylindrus
at this location was highly variable. Nevertheless, with
the exception of 2 (1999, 2001), all years experienced
periods with cell concentrations exceeding 500 cells L−1 ,
and in 8 of those years (1998, 2002–2006, 2008 and
2009) cell densities approached or exceeded 1000 cells L−1
(Fig. 18c).
Examination of five phytoplankton sampling cam-
paigns spanning 50 years from PH100m identified this
genus, or species belonging to this genus, to be amongst
the top 20 most abundant species across all campaigns
(Fig. 19). Whilst these data are heterogeneous, and dif-
ferences in collection methods vary across sampling cam-
paigns preventing direct comparison of absolute cell
abundances across years, Leptocylindrus was invariably
 Leptocylindrus in a southern hemisphere upwelling system 9

Fig 15. Phylogenetic analysis of centric diatoms, outgroups (Dicytocha spp.) and all Leptocylindrus strains (highlighted) from SE Aus-
tralia based on a Bayesian analysis of the ITS1–5.8S–ITS2 rRNA gene region. Support values are ML bootstrap values based on the
GTR model of rate heterogeneity, 500 bootstraps and Bayesian Posterior probability values (ML/PP). All Leptocylindrus sequences are
labelled by species identification, strain numbers and Genbank accession numbers. All other sequences are labelled by species identifi-
cation and Genbank accession numbers. Sequences generated during this study are in bold. See Supplementary Table 1 for details of all
other Leptocylindrus strains used in this analysis.
10 Ajani et al.

Table 3. Average maximum growth rate (μMax ) of Leptocylindrus danicus (clone CH–280212–1) grown under
HLHT, LLHT, HLLT and LLLT conditions, including one standard deviation from the mean. The last three columns
show the p-values determined by one-way analysis of variance (Tukey HSD), comparing differences between means
of µMax (n = 3) under each treatment.

Average µMax SD µMax HLHT LLHT HLLT

HLHT 1.64 0.02

LLHT 1.71 0.11 0.505
HLLT 1.15 0.03 < 0.001 < 0.001
LLLT 1.27 0.04 < 0.001 < 0.001 0.158

Figs 16-17. Graph showing abundances of L. danicus under

different growth regimes. Fig. 16. Light micrograph of L. dan-
icus from Coffs Harbour (Scale bar = 10 μm). This clone died
before its molecular sequence could be determined. Fig. 17.
Average abundance of ‘live’ L. danicus (clone CH–280212–1)
under four different temperatures and irradiances (n = 3–4 for all
measurements).

abundant. It was the second most abundant taxon from

April 1965 to April 1966; ninth most abundant during
the second sampling campaign from April 1978 to April
1979; grouped with Cerataulina spp., the sixth most abun-
dant taxon during the April 1997 to April 1998 sampling
regime; as L. danicus was the seventh most abundant dur-
ing the fourth sampling campaign from August 1998 to
December 2009; and finally, was the second most abundant
taxon February 2009 to December 2012.

Discussion
In a recent reappraisal of Leptocylindrus by Nanjappa et al.
(2013), strains isolated from the Gulf of Naples (40.80°N,
14.25°E) were examined using both morphological and
molecular markers. Five species were identified, two new
species L. hargravesii and L. convexus were described,
and L. danicus var. apora was raised to species level
(L. aporus). Ultrastructural differences in a fifth species,
L. belgicus Meunier, resulted in the erection of a new genus
Tenuicylindrus, with its first member being Tenuicylindrus
belgicus (Meunier) Nanjappa & Zingone. Leptocylindrus
minimus Gran, another species was not found in the Gulf of
Naples (Nanjappa et al. 2013). Leptocylindrus hargravesii
was described as being morphologically very similar to L.
danicus, differing only in the number of areolae in 1 μm.
Leptocylindrus danicus has 18–30 areolae in 1 μm com-
pared to 10–14 in 1 μm in L. hargravesii. The sub-central
pore is adjacent to the annulus in L. danicus in ‘at least in
Fig 18. Graphs showing temporal variation in cell densities of
Leptocylindrus. (a) Monthly averaged cell counts of Leptocylin-
drus from Coffs Harbour, May 2011–September 2012, showing
peak cell densities from November 2011–February 2012. Discrete
bottle samples, data pooled 0–90 m (Armbrecht, Schaeffer et al.
2015). (b) Weekly distribution of L. danicus abundance for each
sampling occasion over 11 years (1998–2009) from coastal sta-
tion PH100 m, showing seasonal/temporal window of high cell
concentrations from mid-November to mid-March. n = 113, 50
m vertical net haul – 20 μm mesh (Ajani et al. 2014a, b). (c)
Inter-annual distribution of Leptocylindrus using the same dataset
showing high variability but high abundance across most years.
 Leptocylindrus in a southern hemisphere upwelling system 11

Fig 19. Graphs showing the top 20 taxa from PH100 m revealing Leptocylindrus (indicated by the stars) as a dominant component of
the phytoplankton community in each sampling campaign. (a) Grant & Kerr (1970) (Oceanographic Station List Vol. 85 & 86), sampling
dates April 1965 to April 1966, n = 24, discrete bottle samples, data pooled for 0–50 m. (b) Hallegraeff (1981) and Hallegraeff & Reid
(1986), sampling dates April 1978 to April 1979, n = 36, discrete bottle samples, data pooled for 0–50 m. (c) Ajani et al. (2001), sampling
dates April 1997 to April 1998, n = 49, 100 m vertical net haul – 37 μm mesh. (d) Ajani et al. (2014a, b), sampling dates August 1998
to December 2009, n = 113, 50 m vertical net haul – 20 μm mesh. (e) IMOS National Reference Station PH100 m (unpublished data);
sampling dates February 2009 to December 2012, n = 44, discrete bottle samples, data pooled for 0–50 m.

80% of the observed valves’, but ‘never adjacent’ to the
annulus (and sometimes at the valve margin) in L. har-
gravesii (Nanjappa et al. 2013). The two species differed
in the ITS–1 and ITS–2 regions of their rDNA, showing
base changes at ∼ 29 positions, and 4 hemi-compensatory
base changes in the ITS–2 secondary structure (Nanjappa
et al. 2013).
The diagnostic characteristics of L. convexus and L.
aporus observed in this study, the first reports from the
southern hemisphere, agree closely with the descriptions of
Nanjappa et al. (2013). Similarly, L. danicus differed little
from Cleve’s (1889) original description or from amended
12 Ajani et al.
descriptions (Gran, 1915, French & Hargraves, 1986). Lep-
tocylindrus danicus cells from SE Australia were cylindri-
cal, contained numerous plastids and formed long chains.
They also formed spiny resting spores via auxosporulation.
Using electron microscopy, Hargraves (1976) reported
a sub-central pore external to the valve hyaline ring which
was also observed in SE Australian strains. Addition-
ally, L. danicus from SE Australia was morphologically
and molecularly similar to L. danicus from Mediterranean
waters (Nanjappa et al. 2013). Leptocylindrus danicus was
also, however, morphologically similar to L. hargravesii
from Naples, with SE Australian strains of L. danicus
showing some shared morphological features with L. har-
gravesii. The number of areolae per 1 μm in L. danicus
from SE Australia was 12–17 (13.5 ± 1.2), intermediate
between that reported for L. hargravesii and L. danicus by
Nanjappa et al. (2013). Moreover, the radiating striae of
L. danicus in SE Australian strains did not always reach
the mantle (Fig. 3), a feature described only from L. har-
gravesii, not L. danicus, from Naples (Nanjappa et al.
2013).
Nanjappa et al. (2013) considered that the subtle mor-
phological features of the valve were consistently different
between L. danicus and L. hargravesii from Naples, and
combined with genetic profiling, supported the hypothe-
sis that these strains belong to different species. On the
other hand, our findings raise some uncertainty, at least on
a morphological level, over the discrimination between L.
danicus and L. hargravesii. Whilst we made no attempt
to quantify inter-clone variability, the uncertainty about
L. danicus and L. hargravesii clearly warrants further
examination.
Whilst all clones selected for experimentation were
observed to form auxospores and resting spores under
reduced light and temperature conditions, these clones died
before molecular confirmation could be undertaken, pre-
venting any clear discrimination between L. danicus and L.
hargravesii. However, due to the absence of L. hargravesii
in this region to date, we designated these clones as L.
danicus, although we cannot rule out that they may be L.
hargravesii. In any case, both species have demonstrated
rapid growth rates and resting spore formation under nutri-
ent depletion (Nanjappa et al. 2013), suggesting that they
are functionally similar in the marine ecosystem.
As observed in our study, stages in the life history of L.
danicus, that is, vegetative cell growth followed by sexual
reproduction including auxospore and resting spore for-
mation, have also been reported by Davis et al. (1980),
Verity (1982), French & Hargraves (1985, 1986) and Nan-
jappa et al. (2013). The maximum growth rate of 1.71
divisions day−1 (at 25°C) (this study) is slightly lower than
other published growth rates for this species. Verity (1982)
reported a growth rate of 2.7 divisions day−1 (20°C) whilst
French & Hargraves (1986) reported a growth rate of 2.07
divisions day−1 (15°C). All these growth rates, including
this study, are towards the high end of a range of growth
rates for a variety of phytoplankton species grown over
several temperature and light regimes (0.14 to 3.0 divi-
sions day−1 , Ichimi et al. 2012). The rapid growth rates of
L. danicus observed in our study are similar to those seen
in other diatoms (Edwards et al. 2015), supporting the fact
that coastal diatoms can grow rapidly and quickly build up
biomass under favourable conditions.
Auxospore and resting spore formation in L. dan-
icus has been observed in cultured strains (Hargraves
1976, French & Hargraves 1986), controlled experimen-
tal systems (Davis et al. 1980, French & Hargraves 1985)
and from natural ocean sediments (Ishizaka et al. 1987,
Ishikawa et al. 2011). Under experimental conditions, aux-
ospore formation was induced by temperatures between
2°C and 15°C, but not 20°C (French & Hargraves 1985),
and reduced nutrient levels ( < 0.5 mM nitrate) (Davis
et al. 1980). Field studies also suggest that resting spores
of L. danicus can form rapidly in response to nutrient
depletion in coastal waters (Ishizaka et al. 1987). Resting
spores sink from the euphotic layer to the sediments where
they survive in cold, dark conditions, becoming the ‘seed’
population for future blooms (McQuoid & Hobson 1996,
Ishikawa et al. 2011).
In the current study, we report the onset of sexual repro-
duction at ∼ day 10 in our monoclonal cultures. This was
also observed in our growth rate experiments, where strains
of L. danicus kept at 18°C, grew more slowly than those
kept at 25°C, but also commenced auxospore formation
after this time. Conversely, cultures kept at 25°C showed
higher growth rates, but died before auxospores or resting
spores were observed ( ∼ day 16). In the light of the docu-
mented triggers for the onset of sexual reproduction in L.
danicus, we hypothesize that sexual reproduction in strains
of L. danicus from SE Australia was most likely induced by
a combination of low temperature (18°C), nutrient deple-
tion and high cell densities. However, we believe that,
with summer sea surface temperatures in eastern Australia
already at 22°C, and a 2.6°C increase in ocean tempera-
ture predicted by the end of the twenty-first century (Lough
2009), our 25°C experimental treatment reflects a realistic
projection for this region. Nevertheless, since our exper-
iment involved only four experimental treatments (two
different light and two different temperature regimes), addi-
tional experiments are required to determine the optimal
growth conditions for L. danicus. It will be necessary to
manipulate additional environmental variables (photope-
riod, salinity nutrients, pH, etc.) add more temperature
treatments (between 18°C and 25°C), and additional clones
to examine intra-species variation, Additionally, field stud-
ies to examine the ecological significance of resting spores,
including the optimal conditions for survival, transport and
germination, would allow for a deeper understanding of the
life cycle and population dynamics of this diatom.
Our findings have important implications for the
success and persistence of Leptocylindrus in coastal
 Leptocylindrus in a southern hemisphere upwelling system
phytoplankton communities. In upwelling systems world-
wide, a fast growth rate and the potential to form aux-
ospores and resting spores, are clear advantages to survival.
With the increasing strength of boundary currents world-
wide and higher frequency in upwelling events (Snyder
et al. 2003 and references therein), L. danicus may be a
clear ecological winner. On the other hand, decreasing sil-
icate concentrations and ocean warming, as reported for
SE Australia (Thompson et al. 2009), might counteract
the success of silicic acid-requiring diatoms in this region.
The physiological and genetic response of diatoms to these
changing conditions remains largely unknown. Further-
more, the adaptation of diatoms to environmental change is
unlikely to be uniform within a species, as apparently cos-
mopolitan diatom populations can be highly diverse and
genetically structured (Koester et al. 2013). Within a pop-
ulation, selection will act to determine the frequency of
specific genotypes in relation to their response to envi-
ronmental perturbation. Before the genetic response of a
species to a particular environmental forcing can be deter-
mined, intraspecific diversity must be taken into account
(Balloux & Lugon-Moulin 2002, Bowler et al. 2010).
Whilst biological processes such as selection and life
cycles clearly influence population standing stock, physi-
cal processes also influence population dispersal. Oceano-
graphic features such as currents and density gradients
facilitate or restrict the transport of pelagic organisms. For
SE Australia, there is evidence that the EAC strongly influ-
ences population connectivity in other marine organisms,
such as sea urchins and kelp (Banks et al. 2007, Coleman
et al. 2011), in this region, Therefore, baseline information
on the spatial and temporal genetic variability of ecological
relevant phytoplankton species such as L. danicus needs to
be determined.
Whilst community structure varied across our 50-year
dataset, differences in sampling methodologies (nets ver-
sus discrete bottle samples), species incursions into the
region (Trichodesmium erythraeum Ehrenberg ex Gomont
and Bacteriastrum spp. Shadbolt, Ajani et al. 2014a)
and changes systematics and identification criteria, mean
that the temporal distribution of Leptocylindrus needs to
be interpreted with caution. Despite this however, it is
clear that Leptocylindrus has been, and continues to be, a
dominant component of this southern hemisphere coastal
upwelling system. It is relatively easy to identify, collect,
isolate and grow. It is therefore likely to be a suitable model
organism for population connectivity and stress response
investigations, which may provide critical insights to the
adaptive capacity of organisms to changing ocean condi-
tions.
Acknowledgements
Certain aspects of the experimental work undertaken in this study
were conducted at the Sydney Institute of Marine Sciences (Con-
tribution no. 189). We would like to thank Leanne Armand,
13
Moninya Roughan, David Raftos, Ruth Jakobs, Ulysse Bove and
Amanda Scholes for assistance with these parts of the study.
We would also like to thank Drew Allen, Anthony Richardson,
Alex Coughlan and Gustaaf Hallegraeff for assistance with the
Port Hacking historical datasets. We would also like to thank
Katie McBean from The University of Technology Sydney for
assistance with transmission electron microscopy.
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
PA would like to thank the University of Technology Sydney
Chancellor’s Postdoctoral Fellowship scheme for funding. LHA
was funded by Macquarie University (Higher Degree Research
Fund).
Supplemental data
Supplemental data for this article can be accessed here
10.1080/0269249X.2016.1260058.
References
A JANI , P.A., A LLEN , A.P., I NGLETON , T. & A RMAND , L.
2014a. A decadal decline in relative abundance and a shift in
microphytoplankton composition at a long-term coastal sta-
tion off southeast Australia. Limnology and Oceanography
59: 519–531.
A JANI , P.A., A LLEN , A.P., I NGLETON , T. & A RMAND , L.
2014b. Erratum: a decadal decline in relative abundance and
a shift in phytoplankton composition at a long-term coastal
station off southeast Australia. Limnology and Oceanogra-
phy 59: 2240–2242.
A JANI , P., H ALLEGRAEFF , G., A LLEN , D., C OUGHLAN , A.,
R ICHARDSON , A.J., A RMAND , L., I NGLETON , T. &
M URRAY, S.A. (in press). Establishing baselines: a review
of eighty years of phytoplankton diversity and biomass
in southeastern Australia. Oceanography Marine Biology
Annual Review 54: 387–412.
A JANI , P., L EE , R., P RITCHARD , T. & K ROGH , M. 2001.
Phytoplankton dynamics at a long-term coastal station off
Sydney, Australia. Journal of Coastal Research 34: 60–73.
A RMBRECHT, L.H., R OUGHAN , M., R OSSI , V., S CHAEF -
FER , A., D AVIES , P.L., WAITE , A.M. & A RMAND , L.K.
2014. Phytoplankton composition under contrasting oceano-
graphic conditions: upwelling and downwelling (Eastern
Australia). Continental Shelf Research 75: 54–67.
A RMBRECHT, L.H., S CHAEFFER , A., R OUGHAN , M. &
A RMAND , L.K. 2015. Interactions between seasonality and
oceanic forcing drive the phytoplankton variability in the
tropical-temperate transition zone (similar to 30 degrees
S) of Eastern Australia. Journal of Marine Systems 144:
92–106.
A RMBRECHT, L.H., T HOMPSON , P.A., W RIGHT, S.W., S CHA -
EFFER , A., R OUGHAN , M., H ENDERIKS , J. & A RMAND ,
L.K. 2015. Comparison of the cross–shelf phytoplankton
distribution of two oceanographically distinct regions off
Australia. Journal of Marine Systems 148: 26–38.
14 Ajani et al.
A RMBRUST, E.V. 2009. The life of diatoms in the world’s
oceans. Nature 459: 185–192.
B ALLOUX , F. & L UGON -M OULIN , N. 2002. The estimation
of population differentiation with microsatellite markers.
Molecular Ecology 11: 155–165.
B ANKS , S.C., P IGGOTT, M.P., W ILLIAMSON , J.E., B OVE , U.,
H OLBROOK , N.J. & B EHEREGARAY, L.B. 2007. Oceanic
variability and coastal topography shape genetic structure in
a long-dispersing sea urchin. Ecology 88: 3055–3064.
B OWLER , C., VARDI , A. & A LLEN , A.E. 2010. Oceanographic
and biogeochemical insights from diatom genomes. Annual
Review Marine Science 2: 333–365.
C HURCH , J.A. 1987. East Australian current adjacent to the
Great Barrier Reef. Australian Journal of Marine and Fresh-
water Research 38: 671–683.
C LEVE , P.T. 1889. Pelagisk Diatomeer från Kattegat. In: Det
Videnskabelige Udbytte af Kanonbaaden ‘Hauchs’ Togter
i de Danske Have Indefor Skagen, I. Aarene 1883–86 (Ed.
by C.G.J. P ETERSEN), pp. 53–56. Andr. Fred. Høst & Sons
Forlag, Kjøbenhavn.
C OLEMAN , M.A., R OUGHAN , M., M ACDONALD , H.S., C ON -
NELL , S.D., G ILLANDERS , B.M., K ELAHER , B.P. &
S TEINBERG , P.D. 2011. Variation in the strength of con-
tinental boundary currents determines continent-wide con-
nectivity in kelp. Journal of Ecology 99: 1026–1032.
D AKIN , W.J. & C OLEFAX , A. 1933. The marine plankton of
the coastal waters of New South Wales. 1. The chief plank-
tonic forms and their seasonal distribution. Proceedings of
the Linnean Society of New South Wales 58: 186–222.
D AVIS , C.O., H OLLIBAUGH , J.T., S EIBERT, D.L.R., T HOMAS ,
W.H. & H ARRISON , P.J. 1980. Formation of resting spores
by Leptocylindrus danicus (Bacillariophyceae) in a con-
trolled experimental ecosystem. Journal of Phycology 16:
296–302.
E DWARDS , K.F., T HOMAS , M.K., K LAUSMEIER , C.A. &
L ITCHMAN , E. 2015. Light and growth in marine phyto-
plankton: allometric, taxonomic, and environmental varia-
tion. Limnology and Oceanography 60: 540–552.
F ALKOWSKI , P.G. & O LIVER , M.J. 2007. Mix and match: how
climate selects phytoplankton. Nature Review Microbiology
5: 813–819.
F AWCETT, S.E. & WARD , B.B. 2011. Phytoplankton succes-
sion and nitrogen utilization during the development of
an upwelling bloom. Marine Ecology Progress Series 428:
13–31.
F RENCH , F.W. & H ARGRAVES , P.E. 1985. Spore formation
in the life–cycles of the diatoms Chaetoceros diadema and
Leptocylindrus danicus. Journal of Phycology 21: 477–483.
F RENCH , F.W. & H ARGRAVES , P.E. 1986. Population-
dynamics of the spore-forming diatom Leptocylindrus dani-
cus in Narragansett Bay, Rhode Island. Journal of Phycology
22:411–420.
G ODFREY, J.S., C RESSWELL , G.R., G OLDING , T.J., P EARCE ,
A.F. & B OYD , R. 1980. The separation of the East Aus-
tralian Current. Journal of Physical Oceanography 10:
430–440.
G RAN , H.H. 1915. The Plankton production in the North Euro-
pean Waters in the spring of 1912. Bureau du Conseil
permanent international pour l’exploration de la mer, Paris.
142 pp.
G RANT, B.R. & K ERR , J.D. 1970. Phytoplankton numbers and
species at Port Hacking station and their relationship to the
physical environment. Australian Journal of Marine and
Freshwater Research 21: 35–45.
G UILLARD , R.R.L. 1975. Culture of phytoplankton for feeding
marine invertebrates. In: Culture of marine invertebrate ani-
mals (Ed. by W.L. S MITH & M.H. C HANLEY), pp. 26–60.
Plenum Press, New York.
H ALLEGRAEFF , G. M. 1981. Seasonal study of phytoplankton
pigments and species at a coastal station off Sydney: Impor-
tance of diatoms and the nanoplankton. Marine Biology 61:
107–118.
H ALLEGRAEFF , G.M. & R EID , D.D. 1986. Phytoplankton
species successions and their hydrological environment at
a coastal station off Sydney. Australian Journal of Marine
and Freshwater Research 37: 361–377.
H ARGRAVES , P.E. 1976. Studies on marine plankton diatoms. 2.
Resting spore morphology. Journal of Phycology 12: 118–
128.
H ASLE , G.R. & F RYXELL , G.A. 1970. Diatoms: cleaning and
mounting for light and electron microscopy. Transactions of
the American Microscopy Society 89: 469–474.
H UANG , B.Q., X IANG , W.G., Z ENG , X.B., C HIANG , K.P.,
T IAN , H.J., H U , J., L AN , W.L. & H ONG , H.S. 2011.
Phytoplankton growth and microzooplankton grazing in a
subtropical coastal upwelling system in the Taiwan Strait.
Continental Shelf Research 31: S48–S56.
I CHIMI , K., K AWAMURA , T., YAMAMOTO , A., TADA , K. &
H ARRISON , P.J. 2012. Extremely high growth rate of the
small diatom Chaetoceros salsugineum isolated from an
estuary in the eastern Seto Inland Sea, Japan. Journal of
Phycology 48: 1284–1288.
I SHIKAWA , A., K ITAMI , S., I SHII , K., N AKAMURA , T. &
I MAI , I. 2011. Resting stage cells of diatoms in deep
waters in Kumano-Nada, central part of Japan. Plankton and
Benthos Research 6: 206–209.
I SHIZAKA , J., K AICHI , M. & TAKAHASHI , M. 1987. Rest-
ing spore formation of Leptocylindrus danicus (Bacillario-
phyceae) during short time-scale upwelling and its signifi-
cance as predicted by a simple model. Ecological Research
2: 229–242.
J EFFREY, S.W. & C ARPENTER , S.M. 1974. Seasonal succession
of phytoplankton at a coastal station off Sydney. Australian
Journal of Marine and Freshwater Research 25: 361–369.
K EARSE , M., M OIR , R., W ILSON , A., S TONES -H AVAS , S.,
C HEUNG , M., S TURROCK , S., B UXTON , S., C OOPER ,
A., M ARKOWITZ , S., D URAN , C., T HIERER , T., A SH -
TON , B., M EINTJES , P. & D RUMMOND , A. 2012. Geneious
Basic: an integrated and extendable desktop software plat-
form for the organization and analysis of sequence data.
Bioinformatics 28: 1647–1649.
K OESTER , J.A., S WANSON , W.J. & A RMBRUST, E.V. 2013.
Positive selection within a diatom species acts on putative
protein interactions and transcriptional regulation. Molecu-
lar Biology and Evolution 30: 422–434.
L OUGH , J.M. 2009. Temperature. In: A marine climate change
impacts and adaptation report card for Australia 2009 (Ed.
by E.S. P OLOCZANSKA , A.J. H OBDAY & A.J. R ICHARD -
SON ), 24 pp, NCCARF Publication 05/09, ISBN 978-1-
921609-03-9.
 Leptocylindrus in a southern hemisphere upwelling system
M CQUOID , M.R. & H OBSON , L.A. 1996. Diatom resting stages.
Journal of Phycology 32: 889–902.
M ORALES , C.E. & A NABALON , V. 2012. Phytoplankton
biomass and microbial abundances during the spring
upwelling season in the coastal area off Concepcion, central-
southern Chile: variability around a time series station.
Progress in Oceanography 92–95: 81–91.
M URRAY, S.A., G ARBY, T., H OPPENRATH , M. & N EILAN ,
B.A. 2012. Genetic diversity, morphological uniformity
and polyketide production in dinoflagellates (Amphidinium,
Dinoflagellata). PLoS ONE 7: e38253.
N ANJAPPA , D., A UDIC , S., R OMAC , S., K OOISTRA , W.H.C.F.
& Z INGONE , A. 2014. Assessment of species diversity
and distribution of an ancient diatom lineage using a
DNA metabarcoding approach. PLoS ONE 9(8): e103810.
doi:10.1371/journal.pone.0103810.
N ANJAPPA , D., D’ IPPOLITO , G., G ALLO , C., Z INGONE , A. &
F ONTANA , A. 2014. Oxylipin diversity in the diatom fam-
ily Leptocylindraceae reveals DHA derivatives in marine
diatoms. Marine Drugs 12: 368–384.
N ANJAPPA , D., K OOISTRA , W.H.C.F. & Z INGONE , A. 2013.
A reappraisal of the genus Leptocylindrus (Bacillariophyta),
with the addition of three species and the erection of Tenui-
cylindrus gen. nov. Journal of Phycology 49: 917–936.
R ICHARDSON , A.J. & P OLOCZANSKA , E.S. 2008. Ocean sci-
ence – under-resourced, under threat. Science 320: 1294–
1295.
R IDGWAY, K.R. 2007 Long-term trend and decadal vari-
ability of the southward penetration of the East Aus-
tralian Current. Geophysical Research Letters 34, L13613.
doi:10.1029/2007GL030393.
R IDGWAY, K.R. & D UNN , J.R. 2003. Mesoscale structure of
the mean East Australian Current system and its relationship
with topography. Progress in Oceanography 56: 189–222.
R IDGWAY, K.R. & G ODFREY, J.S. 1997. Seasonal cycle of the
East Australian Current. Journal of Geophysical Research –
Oceans 102: 22921–22936.
15
R IDGWAY, K. & H ILL , K. 2012. East Australian current.
In: A marine climate change impacts and adaptation
report card for Australia. (Ed. by E.S. P OLOCZAN -
SKA , A.J. H OBDAY & A.J. R ICHARDSON ), 13 pp,
http://www.oceanclimatechange.org.au. ISBN: 978–0–643–
10928–5.
R ONQUIST, F. & H UELSENBECK , J. P. 2003. MrBayes 3:
Bayesian phylogenetic inference under mixed models.
Bioinformatics 19: 1572–1574.
S NYDER , M.A., S LOAN , L.C., D IFFENBAUGH , N.S. & B ELL ,
J.L. 2003. Future climate change and upwelling in the
Californian Current. Geophysical Research Letters 30(15):
1823. doi:10.1029/2003GL017647.
S TAMATAKIS , A. 2006. RAxML-VI-HPC: Maximum likelihood-
based phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22: 2688–2690.
T HOMPSON , P.A., B AIRD , M.E., I NGLETON , T. & D OBLIN ,
M.A. 2009. Long-term changes in temperate Australian
coastal waters: implications for phytoplankton. Marine
Ecology Progress Series 394: 1–19.
U ITZ , J., C LAUSTRE , H., G ENTILI , B. & S TRAMSKI , D.
2010. Phytoplankton class-specific primary production in
the world’s oceans: seasonal and interannual variability from
satellite observations. Global Biogeochemical Cycles 24:
GB3016. doi:10.1029/2009GB003680.
U TERMÖHL , H. 1958. Zur Vervollkommnung der quantitativen
Phytoplankton–Methodik. Mitteilung Internationale Vere-
inigung fuer Theoretische unde Amgewandte Limnologie 9:
1–38.
V ERITY, P.G. 1982. Effects of temperature, irradiance, and
daylength on the marine diatom Leptocylindrus danicus
Cleve 4. Growth. Journal of Experimental Marine Biology
and Ecology 60: 209–222.
Z INGONE , A., P HLIPS , E.J. & H ARRISON , P.J. 2010. Multi-
scale variability of twenty–two coastal phytoplankton time
series: a global scale comparison. Estuarine and Coasts 33:
224–229.