GURU TEG BAHADUR PUBLIC SCHOOL

Name: Rupam Samanta

Class: XII
Section: C
Roll no: 25
AISSCE Roll no:
Subject: Biology
Topic: Lac Operon
Session: 2023-2024
CERTIFICATE
This is to certify that RUPAM SAMANTA, a bonafide student of
Guru Teg Bahadur Public School, of class-XII, sec-C has
successfully completed the Investigatory Project of Biology(044)
during the year 2023-2024 for the partial fulfilment of the
AISSCE as per CBSE guidelines.

Principal’s signature: __________________

Subject teacher’s signature: __________________

External Examiner’s signature:__________________

Subject: BIOLOGY (044)

 ACKNOWLEDGEMENT

I would like to express my heartiest gratitude to my biology

teacher, Mr G. Biswas for guiding immensely throughout the
course of project record.
Constructive and constant motivation has been responsible for the
successful completion of my project.
I express my deep regards to our respected principal madam, Mrs
Sutapa Acharya who always encouraged me and took interest in
my project record.
I would like to express my gratitude to my subject teacher, lab
attendant sir and my parents for their motivation and support.
Lastly, I would like to thank my group members for their help and
support. All of their support made this project fruitful.
 INDEX

Sl. No. Contents Page No.

1 Introduction 04

2 Structure of Lac Operon 05

3 First mechanism 07

4 Second mechanism 10

5 Lactose analogs 13

6 Classification of the regulatory mutants 15

7 Multimeric nature of repressor and the 16

complex operator

8 Jacob and Monod’s experiment 17

9 Conclusion 20

10 References 21

INTRODUCTION
In the intricate world of molecular biology, the Lac Operon stands
as a classic example of how living organisms precisely control the
expression of their genes. It is an essential element in the study of
gene regulation, offering profound insights into the mechanisms
that govern the turning on and off of specific genes. At the centre
of this genetic control panel lays the bacterium Escherichia coli
(E. coli), a workhorse of scientific research and a model organism
for understanding fundamental biological processes.
The Lac Operon is a set of genes that code for proteins involved
in the metabolism of Lactose, a sugar found in many
environments where E. coli thrives. This Operon is like a genetic
switchboard that allows E. coli to respond to its surroundings and
adapt to changing nutritional conditions. When Lactose is present,
it can efficiently metabolize it to produce energy. When Lactose
is scarce or absent, it's more energy-efficient for E. coli to repress
the genes responsible for Lactose metabolism. This dynamic
ability to fine-tune gene expression

STRUCTURE OF LAC OPERON

The Lac Operon is a well-known example of a gene regulation

system in prokaryotic organisms, specifically in the bacterium
Escherichia coli (E. coli). It consists of a set of genes that are
 involved in the metabolism of Lactose, a sugar commonly found
in E. coli's natural habitat. The Lac Operon allows E. coli to
efficiently adapt to varying Lactose concentrations in its
environment.

Various Parts of Lac Operon:

 Gene Components: The Lac Operon is comprised of three

primary structural genes and an operator and promoter region.
These genes include:

i. LacZ: Encodes β-gaLactosidase, an enzyme responsible for

breaking down Lactose into its constituent sugars, glucose,
and galactose.
ii. LacY: Encodes Lactose permease, a membrane protein that
facilitates the entry of Lactose into the bacterial cell.
iii. LacA: Encodes transacetylase, which is involved in
detoxifying certain derivatives of Lactose.

 Regulatory Elements:

i. Operator (O): This region of the Operon is where a

repressor protein can bind. When the repressor binds to the
operator, it prevents the transcription of the structural genes.
ii. Promoter (P): The promoter region is where RNA
polymerase binds to initiate transcription.
iii. Repressor Protein (LacI): The Lac Operon is normally
turned off, or repressed, by a repressor protein called LacI.
 LacI binds to the operator, blocking RNA polymerase from
transcribing the structural genes.

FIRST MECHANISM

This mechanism involves the regulation of the Operon based on

the presence or absence of Lactose, and it is referred to as
"induction."
This uses an intracellular regulatory protein also called the
Lactose repressor to hinder production of ß-gaLactosidase in the
absence of Lactose.
The repressor gene produces repressor, which binds to the
operator. This blocks the action of RNA polymerase, thereby
preventing transcription.

I. Lactose present (Induction):

 When Lactose is present in the bacterial environment, it can be
transported into the cell by the LacY gene product (permease).
 Inside the cell, some of the Lactose is converted into
alloLactose by the LacZ gene product (beta-gaLactosidase).
AlloLactose is an inducer molecule.
 AlloLactose binds to the LacI repressor protein, causing a
conformational change. This prevents

the repressor from binding to the operator region of the Lac

Operon.
 As a result, RNA polymerase can now bind to the promoter
region and transcribe the structural genes (LacZ, LacY, and
LacA), leading to the production of the necessary enzymes for
Lactose utilization.

This first control mechanism allows the Lac Operon to be turned

on when Lactose is present, making it available for the bacterium
to use as an energy source.
II. Lactose absent (Repression):

 When Lactose is absent, the LacI repressor protein binds to the

operator region of the Lac Operon, blocking RNA polymerase
from binding to the promoter.
 This repression mechanism keeps the Lac Operon in a "turned
off" state in the absence of Lactose, conserving cellular
resources
 As a result, in the absence of Lactose, the Lac Operon is
effectively turned off, and the genes responsible for Lactose
metabolism are not transcribed or expressed.

This repression mechanism ensures that the resources of the

bacterial cell are not wasted on producing unnecessary enzymes
for Lactose metabolism when there is no Lactose available as a
potential energy source.
 SECOND MECHANISM

The second control mechanism of the Lac Operon is indeed a

response to glucose levels in the bacterial environment. This
mechanism ensures that the Lac Operon is only expressed when
glucose is scarce and Lactose is available as an alternative energy
source.

I. Glucose Present:

 When glucose is present in the bacterial environment, it is the

preferred energy source for the bacterium. High levels of
glucose repress the expression of the Lac Operon.
 Glucose metabolism leads to a decrease in the intracellular
concentration of cyclic AMP (cAMP), which is required for the
activation of the CAP (catabolite activator protein) protein.
 Without sufficient cAMP, the CAP protein is not activated, and
it cannot effectively bind to a specific site near the Lac
promoter.

 The absence of the CAP-cAMP complex results in reduced

RNA polymerase binding to the Lac promoter, leading to
decreased expression of the Lac Operon.

II. Glucose Absent:

 When glucose is scarce or absent, the intracellular
concentration of cAMP increases.
 High levels of cAMP lead to the activation of the CAP protein.
 The CAP-cAMP complex binds to a specific site near the Lac
promoter, enhancing the binding of RNA polymerase to the
promoter.
 The Lac Operon is transcribed at a higher rate when the CAP-
cAMP complex is bound. This ensures that the bacterium uses
Lactose as an energy source only when glucose is not readily
available.

This second control mechanism allows the Lac Operon to be

regulated in response to the presence or absence of glucose,
ensuring that the bacterium optimally utilizes available energy
sources. When glucose is abundant, the Lac Operon is repressed,
and Lactose is not utilized as an energy source.
Depiction of role of glucose with the help of diagram:

LACTOSE ANALOGS
A number of Lactose derivatives or analogs have been described
that are:

 Isopropyl-ß-D-thio-galactoside (IPTG)

 Phenyl-ß-D-galactose (phenyl-Gal)
 ONPG (Orthonitrophenol)

 A-gal (5-bromo-4-chloro-3-indolyl-ß-D-gaLactoside)
 CLASSIFICATION OF THE
REGULATORY MUTANTS

To analyze regulatory mutants of the Lac Operon, Jacob

developed a system by which is a second copy of the Lac genes
could be introduced into a single cell. This experiment, in which
genes or gene clusters are tested pair wise, is called a
‘complementation test’.
 MULTIMERIC NATURE OF REPRESSOR
AND THE COMPLEX OPERATOR

 The Lac repressor is a protein tetramer, where all four

identical components are 360 amino acids in length.

 When associated into its active tetramer form, the repressor

has a molecular weight of 154, 520 Daltons.

 The repressor protein binds to a palindromic sequence of

DNA on the Lac promoter at the NH2 terminus.

 In this molecule, the DNA is bound to a 21 basepair

symmetric DNA duplex
(GAATTGTGAGCGCTCACAATT).
 JACOB AND MONOD’S EXPERIMENT

The experimental microorganism used by Francois Jacob and

Jacques Monod was the common laboratory bacterium, E. coli.

 The key idea is that proteins are not synthesized when they
are not needed.

 During World War

11, Monod was
testing the effects
of combinations of
sugars as nutrient
sources for E. coli.
He found that bacteria grown with two different sugars often
displayed two phases of growth.
Monod's diauxic growth curve can be summarized as follows:

1) Lag Phase:
 Bacteria will initially use the preferred carbon source (e.g.,
glucose) for growth. This phase is called the first lag
phase.
 During the first lag phase, while bacteria adapt to the
environment, they don't utilize the alternative carbon
source (e.g., Lactose) effectively.

2) Log Phase:
 During this stationary phase, the bacteria undergo
metabolic changes to prepare for the utilization of the
alternative carbon source (Lactose).
 In this phase, the bacteria begin to consume the previously
unused carbon source (Lactose) more effectively.

3) Second Lag Phase: As the second log phase progresses,

there may be a temporary slowdown in growth (a second lag
phase) as the bacteria adapt to the utilization of the alternative
carbon source more efficiently.

4) Stationary Phase: Finally, the bacterial population enters

the stationary phase once again, indicating that the available
carbon source (Lactose) is being depleted.
This growth pattern is an example of how bacteria regulate gene
expression to adapt to changing environmental conditions, which
can have important implications in various biological and
industrial processes.
 CONCLUSION

The Lac Operon project has provided valuable insights into the
regulation of gene expression in E.coli and the intricate
mechanisms underlying Lactose metabolism. Through a series of
experiments and analyses, we have uncovered key findings that
shed light on the dynamic control of the Lac Operon. Our
research demonstrated the dual regulatory mechanisms that
govern the Lac Operon's response to Lactose and glucose levels.
Moreover, our study highlights the importance of gene regulation
in bacterial survival and resource management. The diauxic
growth observed in our experiments exemplifies how bacteria
efficiently transition between carbon sources to optimize their
growth and energy production.
 REFERENCES

For the completion of my project, I have taken help from the

mentioned sources:

 www.researchgate.net

 NCERT Biology- XIII

 Principles of Biochemistry by Lehninger

 www.geeksforgeeks.org

 www.openstax.org