© 2022 The Authors Journal of Water and Health Vol 20 No 4, 727 doi: 10.2166/wh.2022.

014

Development of a qPCR assay for the detection of naturalized wastewater E. coli strains

Shuai Zhi a,b,*, Graham Bantingc and Norman F. Neumannc

a
The Affiliated Hospital of Medical School, Ningbo University, Ningbo 315200, China
b
School of Medicine, Ningbo University, Ningbo 315211, China
c
School of Public Health, University of Alberta, Room 3-57, South Academic Building, Edmonton, Alberta T6G 2G7, Canada
*Corresponding author. E-mail: zhishuaionline@163.com

SZ, 0000-0001-7179-7625

ABSTRACT

We recently demonstrated the presence of naturalized populations of Escherichia coli in municipal sewage. We wanted to develop a quan-
titative polymerase chain reaction (qPCR) assay targeting the uspC-IS30-flhDC marker of naturalized wastewater E. coli and assess the
prevalence of these naturalized strains in wastewater. The limit of detection for the qPCR assay was 3.0
108 ng of plasmid DNA template
with 100% specificity. This strain was detected throughout the wastewater treatment process, including treated effluents. We evaluated the
potential of this marker for detecting municipal sewage/wastewater contamination in water by comparing it to other human and animal mar-
kers of fecal pollution. Strong correlations were observed between the uspC-IS30-flhDC marker and the human fecal markers Bacteroides
HF183 and HumM2, but not animal fecal markers, in surface and stormwater samples. The uspC-IS30-flhDC marker appears to be a potential
E. coli-based marker for human wastewater contamination.

Key words: E. coli, naturalized, qPCR, wastewater contamination

HIGHLIGHTS

• A quantitative polymerase chain reaction assay of naturalized wastewater Escherichia coli was successfully developed with a low limit of
detection and 100% specificity.
• Strong correlations were observed between the uspC-IS30-flhDC marker and the human fecal markers Bacteroides HF183 and HumM2,
but not animal fecal markers, in surface and stormwater samples.
• The uspC-IS30-flhDC marker appears to be a potential E. coli-based marker for human wastewater contamination.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0), which permits copying, adaptation and
redistribution, provided the original work is properly cited (http://creativecommons.org/licenses/by/4.0/).

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 728

GRAPHICAL ABSTRACT

INTRODUCTION
Sewage contamination of surface water sources used for drinking, recreation, and/or irrigation is a global public health chal-
lenge (Leclerc et al. 2002; Garcia-Aljaro et al. 2019). The United States Environmental Protection Agency (U.S. EPA) has
estimated that as many as 40,000 sewer overflows occur each year in the U.S., and up to 500,000 km of coastlines, rivers,
and streams do not currently meet ambient water quality guidelines due to human and animal waste contamination (U.S.
EPA 2007a, 2007b). Sewage contamination can enter environmental waters through several routes: (i) inadequately treated
sewage discharged directly into surface water sources; (ii) combined sewer overflows (CSOs); and (iii) leaking septic tanks or
sewer lines. As human sewage may impact water bodies used for human recreation, drinking, or food production (i.e., irriga-
tion), determining the source attribution of fecal contamination in these sites is important for evaluating public health risks
(Soller et al. 2010).
Several human fecal/sewage-specific indicators have been characterized, including human-specific viruses [e.g., adeno-
virus, enterovirus, and polyomavirus (Jiang et al. 2001; van der Sanden et al. 2013; Rusinol et al. 2016)], protozoan
parasites [e.g., Cryptosporidium (Ruecker et al. 2007; Li et al. 2015)], as well as bacterial markers [Bacteroides HF183/
HumM2 and the Enterococcus esp gene (Harwood et al. 2014)]. Bacteroides markers are the most frequently used markers
in tracking fecal pollution. Bacteroides is abundant in animal gut, have a short survival time outside its host, and do not repli-
cate after they have been released into the environment (Tsai et al. 2021); therefore, the presence of human Bacteroides
markers (i.e., HF183 and HumM2) indicates a more recent human waste exposure. However, current human fecal/
sewage-specific markers have advantages and disadvantages. For example, the low concentration of certain viruses and pro-
tozoans in some water samples requires the samples to be concentrated for detection (Lee & Kim 2002; Jimenez-Clavero et al.
2005; Wilkes et al. 2009). For some markers, there is a questionable specificity due to their presence in other animal hosts. For
example, human bacterial markers such as the Bacteroides-based marker HF183 and HumM2 have been reported to cross-
react with canine feces, albeit at lower levels than found in humans (Ahmed et al. 2012; Boehm et al. 2013; Odagiri et al.
2015). Sheludchenko et al. (2011) identified several human-specific Escherichia coli single nucleotide polymorphism
(SNP) biomarkers; however, the application of this method requires performing multiple allele-specific real-time PCR,

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 729

making it labor-intensive. Therefore, a ‘toolbox’ strategy, which integrates several methods, should be used as the most appro-
priate approach for identifying sources of human fecal/sewage contamination in the water environment (Santo Domingo
et al. 2007; Molina et al. 2014).
In a previous study, we have identified naturalized strains of E. coli in wastewater based on the presence of unique SNP
biomarker patterns across various intergenic regions of the E. coli genome and for which some of these strains possessed
a site-specific insertion of a transposon (IS30) in the uspC-flhDC intergenic region (Zhi et al. 2016a). This uspC-IS30-
flhDC marker has only been found in E. coli that has been isolated from wastewater treatment plants (WWTPs). It was
not observed in E. coli libraries originating from a wide range of animals (Zhi et al. 2016b, 2019). To determine the
unique presence of this marker in wastewater-related E. coli strains, we have searched its sequence against the NCBI database
in which thousands of E. coli genomes from various sources (i.e., wastewater, human, animal, food, etc.) had been deposited
by researchers across the globe. Interestingly, we found that one E. coli strain carried the uspC-IS30-flhDC marker which was
isolated from wastewater in Switzerland, while this marker was not found in E. coli from other sources during the database
search (Zhi et al. 2019). To date, we have found these naturalized wastewater strains in all 10 WWTPs in Alberta that we have
tested.
We have extensively characterized these strains both phenotypically and genetically (Zhi et al. 2016a, 2017, 2019; Wang
et al. 2020), and our data suggest that these strains have evolved to specifically live and survive in a wastewater niche (Zhi
et al. 2019). At the whole genome level, these strains are genetically distinct from enteric strains of E. coli (Zhi et al. 2019) and
possess a remarkable array of adaptations that allow them to exploit wastewater as a niche. These strains have been shown to
be 100 times more resistant to chlorine than some human E. coli strains lacking these markers (Zhi et al. 2017; Wang et al.
2020).
In addition, these naturalized wastewater strains of E. coli are better biofilm producers compared to human fecal strains
(Zhi et al. 2017), a mechanism known to be important for survival in harsh environments. Most importantly, these strains
all possess the locus of heat resistance (LHR), a transposable genetic element that imparts chlorine, heat, and oxidative resist-
ance to them (Bojer et al. 2010; Mercer et al. 2015; Wang et al. 2020). It was demonstrated that they were 100,000 times more
resistant to heat than LHR-negative strains when treated at 60 °C for 5 min. Furthermore, they possess a plethora of genes that
are important for survival in a wastewater matrix (Zhi et al. 2019). These genetic/phenotypic properties likely promote the
persistence of naturalized wastewater E. coli in the non-host environment. Collectively, our previous studies suggest that these
naturalized E. coli strains may represent excellent targets for detecting municipal sewage contamination.
In the present study, we developed a quantitative polymerase chain reaction (qPCR) assay targeting the uspC-IS30-flhDC
biomarker of these naturalized wastewater E. coli strains and evaluated the occurrence of these strains across the sewage
treatment process. We subsequently compared this E. coli-based marker against the human Bacteroides fecal contamination
markers HF183(Bernhard & Field 2000) and HumM2 (Shanks et al. 2009), in addition to other animal fecal contamination
markers (cattle, seagulls, and Canada goose), in surface/storm water sources as an exploration of the suitability of this E. coli-
based uspC-IS30-flhDC biomarker as a marker of municipal sewage contamination in the environment. The advantage of this
assay is that it can be applied to routine water quality monitoring programs that rely on E. coli as a fecal indicator bacteria
(FIB) target.

MATERIALS AND METHODS

Development of a qPCR for the detection of uspC-IS30-flhDC carrying E. coli
A TaqMan® qPCR assay was developed to detect the uspC-IS30-flhDC biomarker in naturalized wastewater strains of E. coli.
Taqman probe and its corresponding primers were designed using Primer3 (Untergasser et al. 2012). Primers and probes for
the uspC-IS30-flhDC marker are shown in Table 1. All reactions were performed in a 20 μl volume containing 5 μl of DNA
template, 10 μl of TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA), 900 nM of each primer, and
250 nM of TaqMan probe. Nuclease-free water (Invitrogen, Carlsbad, CA, USA) was used as no template control (NTC). The
cycling conditions were 95 °C for 30 s, 40 cycles of 95 °C for 3 s, and 60 °C for 30 s.
To test qPCR sensitivity, a plasmid containing the qPCR target region was constructed. Specifically, genomic DNA from a
naturalized wastewater E. coli isolate containing the uspC-IS30-flhDC marker was used as a DNA template, and the PCR was
used to amplify the uspC-IS30-flhDC intergenic region (primer set ZIS-F and ZIS-R in Table 1). The PCR product was
resolved in a 2% agarose gel in 1
TAE buffer (Promega, Madison, Wisconsin) at 140 V for 45 min and purified from the

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 730

Table 1 | PCR primers and probes used in this study

Target Primers/probes Primer and probe sequence (50 –30 ) References

HF183 HF183-F ATCATGAGTTCACATGTCCG Haugland et al. (2010)

HF183-R CGTAGGAGTTTGGACCGTGT
HF183-P FAM-CTGAGAGGAAGGTCCCCCACATTGGA-NFQMGB
HumM2 HumM2-F CGTCAGGTTTGTTTCGGTATTG Shanks et al. (2010)
HumM2-R TCATCACGTAACTTATTTATATGCATTAGC
HumM2-P FAM-TATCGAAAATCTCACGGATTAACTCTTGTGTACGC-TAMRA
uspC-IS30-flhDC ZIS-F CAGACCGAGAAAGACACTGAA This study
ZIS-R TGTACTGCATTCCCCGTATT
ZIS-P FAM-TTGAAAGGGGTGTTGCATTGACAGA-TAMRA
CGO1 CGO1-F GTAGGCCGTGTTTTAAGTCAGC Fremaux et al. (2010)
CGO1-R AGTTCCGCCTGCCTTGTCTA
CGO1-P FAM-CCGTGCCGTTATACTGAGACACTTGAG-TAMRA
CowM3 CowM3-F CCTCTAATGGAAAATGGATGGTATCT Shanks et al. (2008)
CowM3-R CCATACTTCGCCTGCTAATACCTT
CowM3-P2 FAM-GGAAAGCAGGAACTTA-NFQMGB This study
LeeSG LeeSG-F AGGTGCTAATACCGCATAATACAGAG Lee et al. (2013)
LeeSG-R ATCTGCCACTCCATTGCCG
LeeSG-P FAM-TTCTCTGTTGAAAGGCGCTT-NFQMGB
FAM, 6-carboxyfluorescein; NFQMGB, non-fluorescent quencher minor grove binder.

gel using a QIAquick Gel Extraction Kit (QIAGEN, Inc., Valencia, CA). The amplicon was cloned using a TOPO® TA Clon-
ing Kit according to manufacturer’s instructions (Invitrogen, Inc., Carlsbad, CA). The isolation of recombinant plasmid DNA
was performed using the QIAprep Miniprep Kit (QIAGEN, Inc., Valencia, CA). The presence of the correct insert was con-
firmed by PCR screening and DNA sequencing of the cloned inserts. DNA sequencing was performed by the Applied
Genomic Core (TAGC) facilities at the University of Alberta, Edmonton, Canada.
qPCR sensitivity was tested using cloned plasmid DNA constructs. The concentration of plasmid was quantified using a
Qubit® 2.0 Fluorometer (Invitrogen, Carlsbad, CA). The length of the plasmid is 3,908 bp without the insertion of the
uspC-IS30-flhDC marker. The constructed plasmid copy number was converted from its concentration based on its molecular
weight (Prediger 2017). Ten-fold serial dilutions, in replicates of 12, of plasmid DNA were made and the uspC-IS30-flhDC
marker amplified by the qPCR. The 10-fold serial dilutions of plasmid ranged from 100,000 to 0.1 copies/μl. The limit of detec-
tion [with 95% confidence intervals (LOD95)] was calculated using the method developed by Wilrich & Wilrich (2009). The
specificity of the qPCR was tested against 70 wastewater E. coli strains (41 uspC-IS30-flh positive and 29 uspC-IS30-flh nega-
tive), which had been confirmed by sequencing of the intergenic uspC-flhDC region in a previous study (Zhi et al. 2016a).

Determining the source specificity of the uspC-IS30-flhDC marker in sewage/wastewater, surface water,
and groundwater
To determine the specificity of the naturalized strains to sewage and wastewater, we compared their occurrence in wastewater
against E. coli-contaminated surface water and groundwater samples across Alberta. One hundred ml of water were pro-
cessed for E. coli using the Colilert® presence/absence test according to standard operating procedures in the Alberta
Provincial Laboratory for Public Health (ProvLab), Edmonton, Alberta, Canada. ProvLab is the centralized water testing
facility in Alberta, which is accredited to the International Standard Organization (ISO) 17025 requirements. In total, 71
E. coli-positive surface water samples and 57 E. coli-positive groundwater samples that were submitted to ProvLab for routine
testing from July 2015 to November 2015 were included in this study. Seventy-six wastewater samples (post-grit, secondary-
treated, and UV-treated) were collected at two WWTPs located in Calgary, Alberta from February 2015 to May 2015. The
wastewater samples were shipped to ProvLab on ice and cultured by Colilert® for 24 h upon arrival. From all Colilert® cul-
ture-positive water samples incubated for 24 h, 1 ml of culture liquid was removed from the vessel after vigorous mixing and
centrifuged at 5,000
g for 10 min to collect bacterial pellets, and DNA was extracted by using a DNeasy Blood & Tissue kit

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 731

(QIAGEN, Inc., Valencia, CA). The qPCR conditions for detecting the uspC-IS30-flhDC marker in these samples were the
same as those outlined in the previous section.
The existence of PCR inhibitors in these water samples was tested by the amplification of an internal control (IAC) as
described by Deer et al. (2010). Specifically, the 198 bp DNA sequence was synthesized and cloned by Integrated DNA Tech-
nologies (IDT). The generated internal control plasmid DNA was transformed into E. coli and purified using a QIAprep
Miniprep Kit (QIAGEN, Inc., Valencia, CA). Each qPCR of the PCR inhibition test contained 12.5 μl of TaqMan® Fast
Advanced Master Mix (Applied Biosystems, Foster City, CA), 400 nM of each primer, 100 nM of TaqMan probe, 5 μl of
DNA template, 5 μl of internal control (100 copies/5 μl), and molecular biology grade water to a total volume of 25 μl. For
the IAC reference sample, the 5 μl DNA template was replaced by 5 μl molecular biology grade water. The cycling conditions
were 50 °C for 2 min, 95 °C for 30 s, 40 cycles of 95 °C for 3 s, and 60 °C for 30 s. The qPCR threshold was set to 0.2. DNA
extracts were considered inhibited if their IAC Ct value was 3 cycles higher than the Ct value of the IAC reference sample.

Correlation between the uspC-IS30-flhDC marker and other human/animal fecal contamination source-tracking
markers in water
Ninety-three water samples collected from various surface water and storm water systems in southern Alberta, Canada, were
used to compare the correlation between the uspC-IS30-flhDC marker and two human markers of fecal sewage pollution
(Bacteroides HF183 and HumM2). Additional animal fecal contamination markers [cow (CowM3), seagull (LeeSG), and
Canada goose (CGO1)] were also tested. The probe for the CowM3 assay was redesigned using the Primer Express software
(Applied Biosystems, Foster City, CA) based on a previous assay by Shanks et al. (2008). The primers and probes used for all
markers are provided in Table 1.
Water samples (100 ml) were filtered onto 0.4 μm polycarbonate filters followed by DNA extraction using a PowerWater®
DNA Isolation Kit (Mo Bio Inc., Carlsbad, CA) according to the manufacturer’s instructions. The final volume of DNA extrac-
tion was 100 μl. All qPCRs were performed in a 20 μl volume containing 5 μl of templates and 10 μl of TaqMan® Fast
Advanced Master Mix (Applied Biosystems, Foster City, CA). The final primer and probe concentrations for each qPCR
are shown in Supplementary Material, Table S1. Nuclease-free water (Invitrogen, Carlsbad, CA, USA) was used as NTC.
The cycling conditions for qPCR of all markers were 95 °C for 30 s, 40 cycles of 95 °C for 3 s, and 60 °C for 30 s. These
water samples were also tested for the existence of PCR inhibitors using the IAC control as described in the previous section.

Statistical analyses
Statistical tests were performed using R software Version 3.0.0. Cohen’s kappa test was used to compare the association
between the marker uspC-IS30-flhDC and other human and animal makers. A value of p , 0.05 was considered statistically
significant.

RESULTS AND DISCUSSION

Determination of LOD and standard curve construction of a qPCR assay targeting the uspC-IS30-flhDC marker
in E. coli
A qPCR for the detection of the uspC-IS30-flhDC was developed based on our previous study (Zhi et al. 2016a). The qPCR
was designed to target the site-specific location of the IS30 element in the uspC-flhDC intergenic region by targeting the for-
ward primer in the uspC gene, while the reverse primer targeted the IS30 sequence. The qPCR amplicon size was 150 bp.
A typical standard curve, based on plasmid copy numbers ranging from 500,000 to 5, is shown in Supplementary Material,
Figure 1. The LOD with 95% confidence (LOD95) for the qPCR was 3.0
108 ng of plasmid DNA template, with a 95%
confidence interval (CI95) of 1.7
108–6.0
108 ng. This qPCR was tested against 70 E. coli isolates that were either nega-
tive or positive for the uspC-IS30-flhDC marker, as characterized in our previous study (Zhi et al. 2016a). All 41 E. coli strains
possessing the uspC-IS30-flhDC marker were positive by qPCR, whereas all 29 E. coli strains lacking this marker were nega-
tive by the qPCR assay. In general, our uspC-IS30-flhDC qPCR assay was able to detect the naturalized wastewater E. coli
strains at a low LOD with 100% specificity and sensitivity.

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 732

Determination of the prevalence of the uspC-IS30-flhDC marker in sewage/wastewater, surface water, and
groundwater
The presence of naturalized strains of E. coli possessing the uspC-IS30-flhDC marker was tested in 76 wastewater samples
(post-grit removal as well as primary, secondary, and UV-treated), 71 E. coli-contaminated surface water samples, and 57
E. coli-contaminated groundwater samples in order to evaluate the specificity of the uspC-IS30-flhDC qPCR assay to
E. coli populations found in wastewater (as opposed to populations found in groundwater and surface water in general).
For this comparison, E. coli-cultured (Colilert®) samples from each of these sources were used for comparison. No PCR
inhibitors were observed in these water samples as demonstrated by the PCR inhibition test.
As shown in Table 2, 89% (68/76) of the E. coli-cultured wastewater samples (treated and untreated) were positive for the
uspC-IS30-flhDC marker by the qPCR. Among these wastewater samples, 100% of untreated sewage [post-grit removal (31/
31)], 100% of primary-treated wastewater (21/21), 92% of secondary-treated wastewater (23/25), and 70% of UV-treated
wastewater (14/20) samples were culture positive for the uspC-IS30-flhDC marker (Table 2). By comparison, only 4% of
the 71 E. coli culture-positive surface water samples were also positive by the uspC-IS30-flhDC qPCR, and only 5% of the
57 E. coli culture-positive groundwater samples were also found to be positive by the uspC-IS30-flhDC qPCR.
Compared to the high prevalence of the uspC-IS30-flhDC marker in wastewater samples, the much lower prevalence of the
marker in E. coli-contaminated surface water and groundwater sources provides additional evidence to our previous findings
that the uspC-IS30-flhDC marker-positive E. coli strains might preferentially survive and live in the wastewater environment
(Zhi et al. 2016a). Moreover, in the surface and groundwater samples that were positive for the uspC-IS30-flhDC marker, we
could not exclude the possibility of the contamination of these water sources with wastewater/sewage, as some surface water
sites were known to be downstream of WWTPs and storm drains from urban centers, and it is possible that private ground-
water samples may have been impacted by septic systems.
The 57 E. coli culture-positive groundwater drinking well samples were collected through routine water quality monitoring
programs in the province of Alberta. Although the sample size may initially seem small, the overall prevalence of E. coli-con-
taminated groundwater wells in the province of Alberta (in any given year) is only about 2–3% (Invik et al. 2017). Thus, it is
estimated that .1,900 groundwater wells were screened by routine public health testing (i.e., culture-based detection of E. coli
using in Colilert®) in order to identify the 57 wells contaminated with E. coli. Using Bacteroides-based assays (HF183 and
HumM2) to evaluate human fecal pollution in these same samples would have required all 1,900 groundwater wells to be
filtered, DNA extracted and subject to qPCR for each of the targets – a costly endeavor. The distinct advantage of the
uspC-IS30-flhDC qPCR assay is that it can be performed on E. coli culture-positive samples only creating a very cost-efficient
screening process to identify groundwater or surface water sources contaminated with human sewage/wastewater. For these
reasons, the uspC-IS30-flhDC marker appears to be a promising E. coli-based marker for human wastewater contamination.

Correlation between the uspC-IS30-flhDC marker and other human/animal fecal contamination source-tracking
markers in water
The qPCR inhibition test of the 93 surface and stormwater samples showed no qPCR inhibition. As a potential marker for
municipal sewage contamination, we also evaluated how the uspC-IS30-flhDC E. coli marker compared with the human
fecal contamination marker HF183 and the HumM2 in 93 surface water and stormwater samples. In addition, we assessed

Table 2 | Prevalence of the uspC-IS30-flhDC marker by qPCR in E. coli-positive surface water, drinking water, and wastewater samples
cultured by Colilert®

E. coli-positive water sample sources Number of samples Marker-positive samples (%)

Wastewater 31 31 (100%)
• Untreated (post-grit) or primary-treated wastewater
• Secondary-treated wastewater 25 23 (92%)
• UV-treated wastewater 20 14 (70%)
Surface water 71 3 (4%)
Drinking water (groundwater) 57 3 (5%)

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 733

Table 3 | Comparison of various microbial source-tracking markers for the detection of sewage contamination in environmental water
samples (n ¼ 93) (surface water and stormwater samples)

uspC-IS30-flhDC

Source Marker Positive Negative p-values

Human HF183 Positive 16 41 0.002

Negative 1 35
HF183 (.4,200 copies/100 ml) Positive 13 1 4.7
1015
Negative 4 75
HumM2 Positive 15 21 3.5
106
Negative 2 55
HumM2 (.2,800 copies/100 ml) Positive 11 1 1.8
1012
Negative 6 75
Animal LeeSG (seagull) Positive 5a 22 1.00
Negative 12 54
CGO1 (Canada goose) Positive 1a 10 0.40
Negative 16 66
CowM3 (cow) Positive 1a 1 0.24
Negative 16 75
a
These samples were also positive for human HF183 and M2 markers.

relationships between the uspC-IS30-flhDC E. coli marker and a variety of animal fecal source-tracking markers in these
same samples. The results are shown in Table 3.
The percentage of surface and storm water samples that were positive for HF183 and HumM2 was 61.3% (57/93) and
38.7% (36/93), respectively. By comparison, only 18.3% (17/93) of the samples were positive for uspC-IS30-flhDC. However,
among the 17 uspC-IS30-flhDC-positive samples, 16 out of 17 were positive for HF183 and 15 of 17 were also positive for
HumM2. All 15 samples that were HumM2/HF183 positive were also positive for uspC-IS30-flhDC. Statistical analysis
demonstrated a significant correlation (p , 0.05) between the uspC-IS30-flhDC marker and HF183 and HumM2 markers,
suggesting that there are good agreements between these markers in detecting human fecal contamination (Table 3).
Boehm et al. (2015) performed a microbial risk assessment and determined that recreational waters whose HF183 and
HumM2 markers’ concentrations were above 4,200 and 2,800 copies/100 ml, respectively, were considered unacceptable
by U.S. EPA’s criteria for controlling the risk of gastrointestinal illness. When we compared uspC-IS30-flhDC-positive
samples with those containing greater than 4,200 copies of human HF183 per 100 ml of water – the upper value of which
is considered important for human health risk assessments for swimming in sewage contaminated waters (Boehm et al.
2015) – the discordance between the HF183 and the uspC-IS30-flhDC markers decreased substantially, to only 5.4%
(5/93), and with the statistical p-value decreasing considerably (Table 3). Similarly, at a human health risk target of 2,800
copies/100 ml for the human Bacteroides HumM2 target (Boehm et al. 2015), the discordance between the HumM2 and
the uspC-IS30-flhDC markers decreased from 24.7% (23/93) to 7.5% (7/93) and was also accompanied by a substantial
decrease in the p-value (Table 3). This suggests that the uspC-IS30-flhDC marker may be an extremely valuable tool for
screening water of unacceptable health risk in some situations.
These 93 water samples were also tested for three additional animal markers [cow (CowM3), seagull (LeeSG), and Canada
goose (CGO1)] (Table 3). Two water samples were found positive for the CowM3 marker. One of the two samples was posi-
tive for uspC-IS30-flhDC, but this same sample was also positive for HF183 and HumM2, suggesting that the water sample
contained fecal contamination originating from both human/wastewater and cattle. Among the 27 seagull positive samples,
five samples were positive for uspC-IS30-flhDC, but these same five samples were also positive for HF183 and four were posi-
tive for the HumM2 marker, suggesting that these samples contained both seagull and human/wastewater fecal
contamination. In the 11 samples for which the Canada goose marker was observed, only one sample was positive for
uspC-IS30-flhDC, and this sample was also positive for both human HF183 and HumM2. Overall, statistical analysis
(Table 3) showed that no agreement was observed between uspC-IS30-flhDC and the cow marker CowM3 (p ¼ 0.24), seagull
marker LeeSG (p ¼ 1), and the Canada goose marker COG1 (p ¼ 0.40) in detecting human fecal contaminations.
At present, several human fecal/sewage-specific indicators have been characterized, including human-specific viruses [e.g.,
adenovirus, enterovirus, and polyomavirus (Jiang et al. 2001; van der Sanden et al. 2013; Rusinol et al. 2016)], protozoan

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 734

parasites [e.g., Cryptosporidium (Ruecker et al. 2007; Li et al. 2015)], as well as bacterial markers [Bacteroides HF183/
HumM2 and the Enterococcus esp gene (Harwood et al. 2014)]. However, each of these markers has advantages and disad-
vantages. For example, the low concentration of certain viruses and protozoans in some water samples requires the samples
to be concentrated for detection (Lee & Kim 2002; Jimenez-Clavero et al. 2005; Wilkes et al. 2009). For some markers, there
is a questionable specificity due to their presence in other animal hosts. For example, human bacterial markers such as the
Bacteroides-based marker HF183 and HumM2 have been reported to cross-react with canine feces, albeit at lower levels than
found in humans (Ahmed et al. 2012; Boehm et al. 2013; Odagiri et al. 2015). Therefore, a ‘toolbox’ strategy, which integrates
several methods, has been proposed as the most appropriate approach for identifying sources of human fecal/sewage con-
tamination in the water environment (Santo Domingo et al. 2007; Molina et al. 2014). Our results have demonstrated that
the qPCR assay of the uspC-IS30-flhDC marker might be a potential tool in detecting human fecal/wastewater contami-
nation. At present, culture-based assays for E. coli remain the gold standard for microbial water quality testing. Therefore,
our qPCR method for detecting naturalized wastewater E. coli from cultured samples is easily adaptable to current regulatory
monitoring programs. This provides the added advantage of determining whether human sewage is contaminating the water
source.
Although we have demonstrated that uspC-IS30-flhDC-positive E. coli strains seem specifically adapted to and survive in
wastewater through the extensive NCBI online database search and testing again a local library of 780 E. coli strains from 15
animal hosts (Zhi et al. 2016a, 2019), future study is still needed to extensively evaluate the presence of this uspC-IS30-flhDC
marker in non-human sewage contaminated samples. For instance, non-human fecal material (i.e., cattle, chicken, and dog)
could be used to determine the true negative rate of this maker before integrating this marker in routine analysis of human
wastewater contamination.
In summary, we have developed a qPCR assay targeting the uspC-IS30-flhDC marker of naturalized wastewater E. coli. The
uspC-IS30-flhDC marker showed strong correlation to the human fecal markers Bacteroides HF183 and HumM2, but not
animal fecal markers in surface and stormwater samples. The uspC-IS30-flhDC marker appears to be a promising E. coli-
based marker for human wastewater contamination and adaptable to routine water quality monitoring programs using E.
coli as FIB.

ACKNOWLEDGEMENTS
We would like to thank the Environmental Microbiology staff at the Provincial Laboratory for Public Health (Calgary), in
particular Lorraine Ingham, for overseeing the water sample analysis for routine E. coli culture and the pre-analytical proces-
sing of these samples for alternative markers. We would also like to thank Dr Norma Ruecker, Dr Theingi Maw, Jennifer
Berwanger, and the rest of the City of Calgary Water Quality Services for organizing the sampling of WWTPs at the City
of Calgary and performing culture-based quantitation of E. coli from wastewater samples.

FUNDING
This work was supported by Alberta Innovates, the City of Calgary, the Natural Sciences and Engineering Research Council
(NSERC), the Canadian Foundation for Innovation (CFI), the National Natural Sciences Foundation of China (No.
82073514), and the Natural Science Foundation of Ningbo (No. 202003N4114).

CONFLICTS OF INTERESTS
The authors declare that they have no competing interests.

DATA AVAILABILITY STATEMENT

All relevant data are included in the paper or its Supplementary Information.

REFERENCES

Ahmed, W., Masters, N. & Toze, S. 2012 Consistency in the host specificity and host sensitivity of the Bacteroides HF183 marker for sewage
pollution tracking. Letters in Applied Microbiology 55, 283–289.
Bernhard, A. E. & Field, K. G. 2000 Identification of nonpoint sources of fecal pollution in coastal waters by using host-specific 16S ribosomal
DNA genetic markers from fecal anaerobes. Letters in Applied Microbiology 66, 1587–1594.

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 735

Boehm, A. B., Van De Werfhorst, L. C., Griffith, J. F., Holden, P. A., Jay, J. A., Shanks, O. C., Wang, D. & Weisberg, S. B. 2013 Performance of
forty-one microbial source tracking methods: a twenty-seven lab evaluation study. Water Research 47, 6812–6828.
Boehm, A. B., Soller, J. A. & Shanks, O. C. 2015 Human-associated fecal quantitative polymerase chain reaction measurements and simulated
risk of gastrointestinal illness in recreational waters contaminated with raw sewage. Environmental Science & Technology Letters 10,
270–275.
Bojer, M. S., Struve, C., Ingmer, H., Hansen, D. S. & Krogfelt, K. A. 2010 Heat resistance mediated by a new plasmid encoded Clp ATPase,
ClpK, as a possible novel mechanism for nosocomial persistence of Klebsiella pneumoniae. Public Library of Science One 5, e15467.
Deer, D. M., Lampel, K. A. & Gonzalez-Escalona, N. 2010 A versatile internal control for use as DNA in real-time PCR and as RNA in real-
time reverse transcription PCR assays. Letters in Applied Microbiology 50, 366–372.
Fremaux, B., Boa, T. & Yost, C. K. 2010 Quantitative real-time PCR assays for sensitive detection of Canada goose-specific fecal pollution in
water sources. Applied and Environmental Microbiology 76, 4886–4889.
Garcia-Aljaro, C., Blanch, A. R., Campos, C., Jofre, J. & Lucena, F. 2019 Pathogens, faecal indicators and human-specific microbial source-
tracking markers in sewage. Journal of Applied Microbiology 126, 701–717.
Harwood, V. J., Staley, C., Badgley, B. D., Borges, K. & Korajkic, A. 2014 Microbial source tracking markers for detection of fecal contamination
in environmental waters: relationships between pathogens and human health outcomes. FEMS Microbiology Reviews 38, 1–40.
Haugland, R. A., Varma, M., Sivaganesan, M., Kelty, C., Peed, L. & Shanks, O. C. 2010 Evaluation of genetic markers from the 16S rRNA
gene V2 region for use in quantitative detection of selected Bacteroidales species and human fecal waste by qPCR. Systematic and
Applied Microbiology 33, 348–357.
Invik, J., Barkema, H. W., Massolo, A., Neumann, N. F. & Checkley, S. 2017 Total coliform and Escherichia coli contamination in rural well
water: analysis for passive surveillance. Journal of Water and Health 15, 729–740.
Jiang, S., Noble, R. & Chu, W. 2001 Human adenoviruses and coliphages in urban runoff-impacted coastal waters of Southern California.
Applied and Environmental Microbiology 67, 179–184.
Jimenez-Clavero, M. A., Escribano-Romero, E., Mansilla, C., Gomez, N., Cordoba, L., Roblas, N., Ponz, F., Ley, V. & Saiz, J. C. 2005 Survey of
bovine enterovirus in biological and environmental samples by a highly sensitive real-time reverse transcription-PCR. Applied and
Environmental Microbiology 71, 3536–3543.
Leclerc, H., Schwartzbrod, L. & Dei-Cas, E. 2002 Microbial agents associated with waterborne diseases. Critical Reviews in Microbiology 28,
371–409.
Lee, S. H. & Kim, S. J. 2002 Detection of infectious enteroviruses and adenoviruses in tap water in urban areas in Korea. Water Research 36,
248–256.
Lee, C., Marion, J. W. & Lee, J. 2013 Development and application of a quantitative PCR assay targeting Catellicoccus marimammalium for
assessing gull-associated fecal contamination at Lake Erie beaches. The Science of the Total Environment 454–455, 1–8.
Li, N., Neumann, N. F., Ruecker, N., Alderisio, K. A., Sturbaum, G. D., Villegas, E. N., Chalmers, R., Monis, P., Feng, Y. & Xiao, L. 2015
Development and evaluation of three real-time PCR assays for genotyping and source tracking Cryptosporidium spp. in water. Applied
and Environmental Microbiology 81, 5845–5854.
Mercer, R. G., Zheng, J., Garcia-Hernandez, R., Ruan, L., Ganzle, M. G. & McMullen, L. M. 2015 Genetic determinants of heat resistance in
Escherichia coli. Frontiers in Microbiology 6, 932.
Molina, M., Hunter, S., Cyterski, M., Peed, L. A., Kelty, C. A., Sivaganesan, M., Mooney, T., Prieto, L. & Shanks, O. C. 2014 Factors affecting
the presence of human-associated and fecal indicator real-time quantitative PCR genetic markers in urban-impacted recreational
beaches. Water Research 64, 196–208.
Odagiri, M., Schriewer, A., Hanley, K., Wuertz, S., Misra, P. R., Panigrahi, P. & Jenkins, M. W. 2015 Validation of Bacteroidales quantitative
PCR assays targeting human and animal fecal contamination in the public and domestic domains in India. The Science of the Total
Environment 502, 462–470.
Prediger, E. 2017 Calculations: Converting from Nanograms to Copy Number. Available from: https://sg.idtdna.com/pages/education/
decoded/article/calculations-converting-from-nanograms-to-copy-number. Accessed 28 February 2022.
Ruecker, N. J., Braithwaite, S. L., Topp, E., Edge, T., Lapen, D. R., Wilkes, G., Robertson, W., Medeiros, D., Sensen, C. W. & Neumann, N. F.
2007 Tracking host sources of Cryptosporidium spp. in raw water for improved health risk assessment. Applied and Environmental
Microbiology 73, 3945–3957.
Rusinol, M., Moriarty, E., Lin, S., Bofill-Mas, S. & Gilpin, B. 2016 Human-, ovine-, and bovine-specific viral source tracking tools to
discriminate between the major fecal sources in agricultural waters. Food and Environmental Virology 8, 34–45.
Santo Domingo, J. W., Bambic, D. G., Edge, T. A. & Wuertz, S. 2007 Quo vadis source tracking? Towards a strategic framework for
environmental monitoring of fecal pollution. Water Research 41, 3539–3552.
Shanks, O. C., Atikovic, E., Blackwood, A. D., Lu, J., Noble, R. T., Domingo, J. S., Seifring, S., Sivaganesan, M. & Haugland, R. A. 2008
Quantitative PCR for detection and enumeration of genetic markers of bovine fecal pollution. Applied and Environmental Microbiology
74, 745–752.
Shanks, O. C., Kelty, C. A., Sivaganesan, M., Varma, M. & Haugland, R. A. 2009 Quantitative PCR for genetic markers of human fecal
pollution. Applied and Environmental Microbiology 75, 5507–5513.

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest
 Journal of Water and Health Vol 20 No 4, 736

Shanks, O. C., White, K., Kelty, C. A., Sivaganesan, M., Blannon, J., Meckes, M., Varma, M. & Haugland, R. A. 2010 Performance of PCR-
based assays targeting Bacteroidales genetic markers of human fecal pollution in sewage and fecal samples. Environmental Science and
Technology 44, 6281–6288.
Sheludchenko, M. S., Huygens, F. & Hargreaves, M. H. 2011 Human-specific E. coli single nucleotide polymorphism (SNP) genotypes
detected in a South East Queensland waterway, Australia. Environmental Science and Technology 45, 10331–10336.
Soller, J. A., Schoen, M. E., Bartrand, T., Ravenscroft, J. E. & Ashbolt, N. J. 2010 Estimated human health risks from exposure to recreational
waters impacted by human and non-human sources of faecal contamination. Water Research 44, 4674–4691.
Tsai, K., Hoffmann, V., Simiyu, S., Cumming, O., Borsay, G. & Baker, K. K. 2021 Bacteroides microbial source tracking markers perform
poorly in predicting Enterobacteriaceae and enteric pathogen contamination of cow milk products and milk-containing infant food.
Frontiers in Microbiology 12, 778921.
Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B. C., Remm, M. & Rozen, S. G. 2012 Primer3–new capabilities and interfaces.
Nucleic Acids Research 40, e115.
U.S. EPA 2007a Protocol for Developing Nutrient TMDLs. U.S. EPA, Washington, DC, USA.
U.S. EPA 2007b Protocol for Developing Pathogen TMDLs. U.S. EPA, Washington, DC, USA.
van der Sanden, S. M., Koopmans, M. P. & van der Avoort, H. G. 2013 Detection of human enteroviruses and parechoviruses as part of the
national enterovirus surveillance in the Netherlands. European Journal of Clinical Microbiology & Infectious Diseases 32, 1525–1531.
Wang, Z., Fang, Y., Zhi, S., Simpson, D. J., Gill, A., McMullen, L. M., Neumann, N. F. & Ganzle, M. G. 2020 The locus of heat resistance
confers resistance to chlorine and other oxidizing chemicals in Escherichia coli. Applied and Environmental Microbiology 86,
e02123–19.
Wilkes, G., Edge, T., Gannon, V., Jokinen, C., Lyautey, E., Medeiros, D., Neumann, N., Ruecker, N., Topp, E. & Lapen, D. R. 2009 Seasonal
relationships among indicator bacteria, pathogenic bacteria, Cryptosporidium oocysts, Giardia cysts, and hydrological indices for surface
waters within an agricultural landscape. Water Research 43, 2209–2223.
Wilrich, C. & Wilrich, P. T. 2009 Estimation of the POD function and the LOD of a qualitative microbiological measurement method.
Journal of AOAC International 92, 1763–1772.
Zhi, S., Banting, G., Li, Q., Edge, T. A., Topp, E., Sokurenko, M., Scott, C., Braithwaite, S., Ruecker, N. J., Yasui, Y., McAllister, T., Chui, L. &
Neumann, N. F. 2016a Evidence of naturalized stress-tolerant strains of Escherichia coli in municipal wastewater treatment plants.
Applied and Environmental Microbiology 82, 5505–5518.
Zhi, S., Li, Q., Yasui, Y., Banting, G., Edge, T. A., Topp, E., McAllister, T. A. & Neumann, N. F. 2016b An evaluation of logic regression-based
biomarker discovery across multiple intergenic regions for predicting host specificity in Escherichia coli. Molecular Phylogenetics and
Evolution 103, 133–142.
Zhi, S., Banting, G. S., Ruecker, N. J. & Neumann, N. F. 2017 Stress resistance in naturalised waste water E. coli strains. Journal of
Environmental Science & Engineering 12, 42–50.
Zhi, S., Banting, G., Stothard, P., Ashbolt, N. J., Checkley, S., Meyer, K., Otto, S. & Neumann, N. F. 2019 Evidence for the evolution, clonal
expansion and global dissemination of water treatment-resistant naturalized strains of Escherichia coli in wastewater. Water Research
156, 208–222.

First received 15 January 2022; accepted in revised form 30 March 2022. Available online 12 April 2022

Downloaded from http://iwaponline.com/jwh/article-pdf/20/4/727/1044261/jwh0200727.pdf

by guest