Viral Metagenomics RNA DNA VMM - 9160 - v1 - Revf - 16jun2022 Minion

Introduction to the protocol
Overview of the protocol
IMPORTANT
This is a Legacy product
This kit is available on the Legacy page of the store. We are in the process of gathering data to support the upgrade of this
protocol to our latest chemistry. Further information regarding protocol upgrades will be provided on the Community as soon as
they are available over the next few months. For further information on please see the product update page.
IMPORTANT
This protocol is a work in progress, and some details are expected to change over time. Please make sure you
always use the most recent version of the protocol.
Introduction to the protocol
This protocol has been developed by Adela Alcolea-Medina, Prof. Jonathan Edgeworth and colleagues, with support from Oxford
Nanopore Technologies (Novel, rapid metagenomic method to detect emerging viral pathogens applied to human monkeypox
infections by Alcolea-Medina et al., 2022). It outlines a rapid method to perform metagenomic sequencing from extracted DNA and
RNA from routine nasopharyngeal swab samples in viral transport media to identify viral pathogens. This method has also been used
to sequence the virus currently known as mpox from skin lesion swabs (in viral transport media) of diagnosed patients, demonstrating
an alternative sample site is compatible with this protocol. However, further work is required to assess and validate different sample
sites and types.
While this protocol is available in the Nanopore Community, we kindly ask users to ensure they are citing the authors of the paper who
have been behind the development of these methods.
This method uses random hexamers and oligo-dT primers to synthesis cDNA strands from RNA within the sample. Subsequently, the
Rapid PCR Barcoding kit (SQK-RPB004) is used to amplify the DNA present from the sample alongside the cDNA strands. During
development, typically three samples per patient were pooled together after the PCR and clean-up step before sequencing the sample
on a single flow cell.
We recommend users follow their local health and safety recommendations when handling samples. Confirmed mpox samples were
used for the development of this method and were handled in a Containment Level 3 (CL3) facility.
Steps in the sequencing workflow:
Prepare for your experiment

You will need to:
Extract your DNA/RNA. An example extraction method is provided in this protocol but other options are available if preferred
Ensure you have your sequencing kit, the correct equipment and third-party reagents required
Download the software for acquiring and analysing your data
Check your flow cell to ensure it has enough pores for a good sequencing run
Library preparation
You will need to:
Prepare full-length cDNAs via reverse transcription and 2nd strand synthesis
Tagment your DNA using the Fragmentation Mix in the kit
Amplify the sample by PCR using the barcoded primers supplied in the kit
Attach the sequencing adapters supplied in the kit to the DNA ends
Prime the flow cell, and load your DNA library into the flow cell
Sequencing and analysis

You will need to:
Start a sequencing run of 48 hours using the MinKNOW software, which will collect raw data from the device and convert it into
basecalled reads.
For samples positive for mpox using the wf-mpx, after removing human/host reads, users should expect a significant part of all
their reads to be the mpox virus and the remainder of reads typically being the flora found at the sample sites.
IMPORTANT
Compatibility of this protocol
This protocol should only be used in combination with:
Rapid PCR Barcoding Kit (SQK-RPB004)

R9.4.1 flow cells (FLO-MIN106)
Flow Cell Wash Kit (EXP-WSH004)
RAP Top-Up Kit (EXP-RAP001)
Sequencing Auxiliary Vials (EXP-AUX001)
Equipment and consumables
Materials Nasopharyngeal or skin lesion swab in viral transport media

Rapid PCR Barcoding Kit (SQK-RPB004)
Consumables Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)

HL-SAN nuclease (ArcticZymes Technologies, cat #70910-202)
MagNA Pure Bacteria Lysis Buffer (Roche, cat # 04659180001)
Agencourt AMPure XP Beads (Beckman Coulter™, cat # A63881)
Freshly prepared 70% ethanol in nuclease-free water
LunaScript™ RT SuperMix Kit (NEB, cat # E3010)
Applied Biosystems™ Sequenase Version 2.0 DNA Polymerase (Thermo Fisher, cat # 15809896)
Nuclease-free water (e.g. ThermoFisher, cat # AM9937)
Qubit dsDNA HS Assay Kit (Invitrogen, Q32851)
Qubit™ Assay Tubes (Invitrogen, Q32856)
LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)
10 mM Tris-HCl pH 8.0 with 50 mM NaCl
0.2 ml PCR tubes
1.5 ml Eppendorf DNA LoBind tubes
Equipment TissueLyser LT (QIAGEN, cat # 85600)

Hula mixer (gentle rotator mixer)
Thermomixer (Eppendorf, Cat# 5382000031)
Magnetic rack
Microfuge
P1000 pipette and tips
P2 pipette and tips
Ice bucket with ice
Timer
Qubit fluorometer (or equivalent for QC check)
For this metagenomic protocol, you will need to extract your RNA/DNA from the clinical sample in viral transport media
and take forward 1–5 ng high molecular weight genomic DNA into the library preparation step.
Clinical sample swabs should be collected in viral transport media to maintain the viral sample for extraction.
During development of this method, primarily nasopharyngeal swabs were tested. However, swabs from skin lesions were also found
to yield virus in patients diagnosed with mpox, suggesting swabs from multiple sites can be used with this method to detect for
presence of a virus.
Input RNA and DNA
How to QC your input DNA/RNA
It is important that the input meets the quantity and quality requirements. Using too little or too much DNA/RNA, or DNA/RNA of poor
quality (e.g. highly fragmented or containing chemical contaminants) can affect your library preparation.
For instructions on how to perform quality control of your DNA sample, please read theInput DNA/RNA QC protocol.
Chemical contaminants
DNA input
Depending on how the DNA is extracted from the raw sample, certain chemical contaminants may remain in the purified DNA, which
can effect library preparation efficiency and sequencing quality.
For further information on using DNA as input, please read the links below:
Contaminants
DNA stability - storage
DNA library stability - Ligation Sequencing Kit (SQK-LSK109)
DNA stability - freeze-thawing
DNA fragmentation
RNA input
It is important that the input RNA meets the quantity and quality requirements for highest library preparation efficiency and
sequencing quality.
For further information on using RNA as input, please read the links below.
Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase

RNA Contaminants
RNA stability
RNA Integrity Number (RIN)
Enrichment of polyadenylated RNA molecules
These documents can also be found in the DNA/RNA Handling page.
Third-party reagents
We have validated and recommend the use of all the third-party reagents used in this protocol. Alternatives have not been tested by
Oxford Nanopore Technologies.
For all third-party reagents, we recommend following the manufacturer's instructions to prepare the reagents for use.
Rapid PCR Barcoding Kit (SQK-RPB004) contents
FRM FRM FRM RAP SQB LB
RLB RLB RLB RLB RLB RLB

01 02 03 04 05 06
RLB RLB RLB RLB RLB RLB

07 08 09 10 11 12A
FRM : Fragmentation mix RLB05: Rapid barcode primer 5

RAP : Rapid adapter RLB06: Rapid barcode primer 6
SQB : Sequencing buffer RLB07: Rapid barcode primer 7
LB : Loading beads RLB08: Rapid barcode primer 8
RLB01: Rapid barcode primer 1 RLB09: Rapid barcode primer 9
RLB04: Rapid barcode primer 4 RLB12A: Rapid barcode primer 12A
Name Acronym Cap colour No. of vials Fill volume per vial (µl)
Fragmentation Mix FRM Brown 3 30
Rapid Adapter RAP Green 1 10
Sequencing Buffer SBQ Red 1 300
Loading Beads LB Pink 1 360
Rapid Barcode Primer 1-12 RLB 01-12 Clear 12 10
IMPORTANT
Please note that the Sequencing Tether (SQT) tube will NOT be used in this protocol.
Flow Cell Priming Kit (EXP-FLP002) contents
Name Acronym Cap colour No. of vial Fill volume per vial (μl)
Flush Buffer FB Blue 6 1,170
Flush Tether FLT Purple 1 200
Rapid Barcode Primer sequences
Component Sequence
RLB01 AAGAAAGTTGTCGGTGTCTTTGTG
RLB02 TCGATTCCGTTTGTAGTCGTCTGT
RLB03 GAGTCTTGTGTCCCAGTTACCAGG
RLB04 TTCGGATTCTATCGTGTTTCCCTA
RLB05 CTTGTCCAGGGTTTGTGTAACCTT
RLB06 TTCTCGCAAAGGCAGAAAGTAGTC
RLB07 GTGTTACCGTGGGAATGAATCCTT
RLB08 TTCAGGGAACAAACCAAGTTACGT
RLB09 AACTAGGCACAGCGAGTCTTGGTT
RLB10 AAGCGTTGAAACCTTTGTCCTCTC
RLB11 GTTTCATCTATCGGAGGGAATGGA
Component Sequence
RLB12A GTTGAGTTACAAAGCACCGATCAG
The RAP Top-Up Kit (EXP-RAP001) is available to provide enough reagents for another six reactions depending on how
the barcodes are used.
This kit contains reagents to be used with any remaining barcodes to load another six sequencing libraries.
RAP SQT LB SQB
RAP : Rapid adapter LB : Loading beads

SQT : Sequencing tether SQB : Sequencing buffer
Reagent Acronym Cap colour No. of vials Fill volume per vial (µl)
Rapid Adapter RAP Green 1 10
Sequencing Tether SQT Purple 1 10
Loading Beads LB Pink 1 360
Sequencing Buffer SQB Red 1 300
Computer requirements and software
MinION Mk1B IT requirements
Sequencing on a MinION Mk1B requires a high-spec computer or laptop to keep up with the rate of data acquisition. Read more in the
MinION IT Requirements document.
MinION Mk1C IT requirements
The MinION Mk1C contains fully-integrated compute and screen, removing the need for any accessories to generate and analyse
nanopore data. Read more in the MinION Mk1C IT requirements document.
Software for nanopore sequencing
MinKNOW
The MinKNOW software controls the nanopore sequencing device, collects sequencing data and basecalls in real time. You will be
using MinKNOW for every sequencing experiment to sequence, basecall and demultiplex if your samples were barcoded.
For instructions on how to run the MinKNOW software, please refer to theMinKNOW protocol.
EPI2ME (optional)
The EPI2ME cloud-based platform performs further analysis of basecalled data, for example alignment to the Lambda genome,
barcoding, or taxonomic classification. You will use the EPI2ME platform only if you would like further analysis of your data post-
basecalling.
For instructions on how to create an EPI2ME account and install the EPI2ME Desktop Agent, please refer to theEPI2ME Platform
protocol.
Check your flow cell
We highly recommend that you check the number of pores in your flow cell prior to starting a sequencing experiment. This should be
done within three months of purchasing for MinION/GridION/PromethION or within four weeks of purchasing Flongle Flow Cells. Oxford
Nanopore Technologies will replace any flow cell with fewer than the number of pores in the table below, when the result is reported
within two days of performing the flow cell check, and when the storage recommendations have been followed. To do the flow cell
check, please follow the instructions in the Flow Cell Check document.
Flow cell Minimum number of active pores covered by warranty
Flongle Flow Cell 50
MinION/GridION Flow 800

Cell
PromethION Flow Cell 5000
Library preparation
RNA/DNA extraction
~135 minutes
Materials Nasopharyngeal or skin lesion swab in viral transport media
Consumables Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)

HL-SAN nuclease (ArcticZymes Technologies, cat #70910-202)
MagNA Pure Bacteria Lysis Buffer (Roche, cat # 04659180001)
Equipment TissueLyser LT (QIAGEN, cat # 85600)

Magnetic rack
Thermomixer (Eppendorf, Cat# 5382000031)
Microfuge
P2 pipette and tips
IMPORTANT
The sample extraction step must be carried out at the contaminant level of the local health and safety
recommendations.
1 Prepare the HL-SAN nuclease and MagNA Pure Bacteria Lysis Buffer according to the manufacturer's
recommendations.
2 Transfer 500 µl of the clinical sample in viral transport medium into a Lysing Matrix D 2 ml tube to bead-beat for 3
minutes at 50 oscillations/second in the TissueLyser LT.
3 Transfer 200 µl of the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
4 Add 10 µl of HL-SAN nuclease to the sample.
5 Mix well by pipetting and spin down.
6 Incubate at 37°C for 10 minutes at 1000 rpm in a thermomixer.
7 Add 200 µl of MagNA Pure Bacterial Lysis Buffer to the reaction.
8 Mix well by pipetting and spin down.
9 Incubate at room temperature for 10 minutes.
10 Resuspend the AMPure XP beads by vortexing.
11 Add 400 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.
12 Incubate on a Hula mixer (rotator mixer) for 5 minutes at room temperature.
13 Prepare 500 μl of fresh 70% ethanol in nuclease-free water.
14 Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the
magnet, and pipette off the supernatant.
15 Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing
the pellet. Remove the ethanol using a pipette and discard.
16 Repeat the previous step.
17 Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds,
but do not dry the pellet to the point of cracking.
18 Remove the tube from the magnetic rack and resuspend the pellet in 60 µl of nuclease-free water. Incubate for 2
minutes at room temperature.
19 Pellet the beads on the magnet until the eluate is clear and colourless.
20 Remove and retain 50 µl of eluate into a clean 1.5 ml Eppendorf DNA LoBind tube.
Dispose of the pelleted beads.
21 Inactivate the sample by heat-treating for 1 hour at 60°C, depending on local health and safety recommendations.
END OF STEP
Take the extracted RNA/DNA sample forward into the cDNA synthesis step.
From this point, we recommend to keep the sample on ice as much as possible to prevent nucleolytic degradation.
cDNA synthesis
~65 minutes
Materials 16 µl of extracted sample
Consumables LunaScript™ RT SuperMix Kit (NEB, cat # E3010)

Applied Biosystems™ Sequenase Version 2.0 DNA Polymerase (Thermo Fisher, cat # 15809896)
0.2 ml thin-walled PCR tubes
Equipment Microfuge
Thermal cycler
Magnetic rack
P2 pipette and tips
IMPORTANT
Keep the RNA sample on ice as much as possible to prevent nucleolytic degradation.
For further information on how to handle RNA, please see theDNA/RNA Handling tab for best practices.
1 Prepare the LunaScript™ RT SuperMix Kit and Sequenase Version 2.0 DNA Polymerase according to the
manufacturer's recommendations.
2 In a clean 0.2 ml thin-walled PCR tube, combine the reagents in the following order:
Reagent Volume
Extracted sample 16 µl
LunaScript™ RT 4 µl
SuperMix
Total 20 µl
3 Gently pipette mix and spin down the reaction.

4 Incubate the sample(s) in the thermal cycler using the following program:
Step Temperature Time Cycles
Primer annealing 25°C 2 minutes 1
cDNA synthesis 55°C 10 minutes 1
Heat inactivation 95°C 1 minute 1
Hold 4°C ∞ -
5 In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare the first Sequenase master mix by combining the reagents as
follows:
Reagent Volume per sample
5X Sequenase reaction buffer 2 µl
Nuclease-free water 7.7 µl
Sequenase Version 2.0 DNA 0.3 µl

Polymerase
Total 10 µl
6 Mix well by pipette mixing and spin down.
7 Add 10 µl of Sequenase master mix to the sample.
9 Incubate the reaction at 37°C for 8 minutes.
10 In a clean 1.5 ml Eppendorf DNA LoBind tube, prepare the second Sequenase master mix as follows:
Reagent Volume
Sequenase Dilution Buffer 0.9 µl
Sequenase Version 2.0 DNA 0.3 µl

Polymerase
Total 1.2 µl

12 Add 1.2 µl of the second Sequenase master mix to the sample.
14 Incubate the reaction at 37°C for 8 minutes.
15 Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
17 Add 45 µl of resuspended AMPure XP beads to the reaction and mix by gently pipetting.
20 Spin down the sample and pellet on a magnet until supernatant is clear and colourless. Keep the tube on the
magnet, and pipette off the supernatant.
21 Keep the tubes on the magnet and wash the beads in each well with 200 µl of freshly prepared 70% ethanol without
disturbing the pellet. Remove the ethanol using a pipette and discard.
23 Spin down and place the tubes back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds,
24 Remove the tube from the magnetic rack and resuspend the pellet in 15 µl nuclease-free water. Incubate for 2
minutes at room temperature.
25 Pellet the beads on a magnet until the eluate is clear and colourless.
Dispose of the pelleted beads.
Quantify 1 µl of each eluted sample using a Qubit fluorometer.

END OF STEP
Take forward 3 μl of 1–5 ng DNA forward into the tagmentation step.
TIP
Library storage recommendations
We recommend storing libraries in Eppendorf DNA LoBind tubes at-20°C for short term storage or repeated use, for example,
re-loading flow cells between washes.
For single use and long term storage of more than 3 months, we recommend storing libraries at-80°C in Eppendorf DNA
LoBind tubes.
Library preparation
~110 minutes
Materials Rapid Barcode Primers (RLB01-12A, at 10 µM)

Fragmentation Mix (FRM)
Rapid Adapter (RAP)
Consumables LongAmp Taq 2X Master Mix (e.g. NEB, cat # M0287)

10 mM Tris-HCl pH 8.0 with 50 mM NaCl (e.g. Fisher Scientific, Cat# NC1877767)
0.2 ml thin-walled PCR tubes
Equipment Microfuge
Thermal cycler
Ice bucket with ice
P2 pipette and tips
DNA tagmentation
1 Thaw the following reagents, then spin down briefly using a microfuge and mix as indicated in the table below. Then
place the reagents on ice.
Reagent 1. Thaw 2. Mix well by pipetting 3. Briefly spin down
Rapid Barcode Primers (RBL 01- At room ✓ ✓

12A) temperature
Fragmentation Mix (FRM) Not frozen ✓ ✓
Rapid Adapter Not frozen ✓ ✓
2 Prepare the LongAmp Taq 2X Master Mix according to the manufacturer's recommendations and prepare at least 20
µl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl.
3 In a 0.2 ml thin-walled PCR tube, mix the following:
Reagent Volume
1-5 ng template DNA 3 μl
Fragmentation Mix 1 μl
(FRM)
Total 4 μl
4 Mix gently by flicking the tube, and spin down.
5 In a thermal cycler, incubate the tube at 30° C for 1 minute and then at 80° C for 1 minute. Briefly put the tube on
ice to cool it down.
PCR and clean-up
6 Set up a PCR reaction as follows in a 0.2 ml thin-walled PCR tube:
Reagent Volume
Nuclease-free water 20 µl
Tagmented DNA 4 µl
RLB (01-12A, at 10 µM) 1 µl
LongAmp Taq 2X master mix 25 µl
Total 50 µl
If the amount of input material is altered, the number of PCR cycles may need to be adjusted to produce the same yield.
7 Mix gently by pipetting and spin down.
8 Amplify using the following cycling conditions:
Cycle step Temperature Time No. of cycles
Initial 95°C 3 mins 1

denaturation
Denaturation 95°C 15 secs 30
Annealing 56°C 15 secs 30
Extension 65°C 4 mins 30
Final extension 65°C 4 mins 1
Hold 4°C ∞
9 Transfer the sample to a clean 1.5 ml Eppendorf DNA LoBind tube.
11 Add 30 µl of resuspended AMPure XP beads to the reaction and mix by pipetting.
14 Spin down the sample and pellet on a magnet. Keep the tube on the magnet, and pipette off the supernatant.
15 Keep the tube on the magnet and wash the beads with 200 µl of freshly prepared 70% ethanol without disturbing
the pellet. Remove the ethanol using a pipette and discard.
17 Spin down and place the tube back on the magnet. Pipette off any residual ethanol. Allow to dry for ~30 seconds,
18 Remove the tube from the magnetic rack and resuspend pellet in 10 µl of 10 mM Tris-HCl pH 8.0 with 50 mM NaCl.
Incubate for 2 minutes at room temperature.
19 Pellet the beads on a magnet until the eluate is clear and colourless.
Dispose of the pelleted beads
Quantify 1 µl of eluted sample using a Qubit fluorometer.
21 Pool all barcoded libraries in the desired ratios to a total of 50-100 fmoles in 10 μl of 10 mM Tris-HCl pH 8.0 with 50
mM NaCl.
Adapter attachment
22 Add 1 μl of RAP to the barcoded DNA.
23 Mix gently by flicking the tube, and spin down.
24 Incubate the reaction for 5 minutes at room temperature.
END OF STEP
The prepared library is used for loading into the flow cell. Store the library on ice until ready to load.
Priming and loading the SpotON Flow Cell

~5 minutes
Materials Flow Cell Priming Kit (EXP-FLP002)

Sequencing Buffer (SQB)
Loading Beads (LB)
Consumables 1.5 ml Eppendorf DNA LoBind tubes

Equipment MinION device

SpotON Flow Cell
TIP
Priming and loading a MinION flow cell
We recommend all new users watch the 'Priming and loading your flow cell' video before your first run.
1 Thaw the Sequencing Buffer (SQB), Loading Beads (LB), Flush Tether (FLT) and one tube of Flush Buffer (FB) at
room temperature before mixing the reagents by vortexing, and spin down at room temperature.
2 To prepare the flow cell priming mix, add 30 µl of thawed and mixed Flush Tether (FLT) directly to the tube of
thawed and mixed Flush Buffer (FB), and mix by vortexing at room temperature.
3 Open the MinION device lid and slide the flow cell under the clip.
Press down firmly on the flow cell to ensure correct thermal and electrical contact.
1a
Insert the flow cell into the
device under the clip and
press down firmly.
Key:
Storage buffer
Priming mix
DNA library
1b
Insert the flow cell into the
device under the clip and
press down firmly.
Optional Action
Complete a flow cell check to assess the number of pores available before loading the library.
This step can be omitted if the flow cell has been checked previously.
See the flow cell check instructions in the MinKNOW protocol for more information.
4 Slide the priming port cover clockwise to open the priming port.
IMPORTANT
Take care when drawing back buffer from the flow cell. Do not remove more than 20-30 µl, and make sure that the
array of pores are covered by buffer at all times. Introducing air bubbles into the array can irreversibly damage
pores.
5 After opening the priming port, check for a small air bubble under the cover. Draw back a small volume to remove
any bubbles:
1. Set a P1000 pipette to 200 µl
2. Insert the tip into the priming port
3. Turn the wheel until the dial shows 220-230 ul, to draw back 20-30 ul, or until you can see a small volume of buffer entering
the pipette tip
Note: Visually check that there is continuous buffer from the priming port across the sensor array.
6 Load 800 µl of the priming mix into the flow cell via the priming port, avoiding the introduction of air bubbles. Wait
for five minutes. During this time, prepare the library for loading by following the steps below.
7 Thoroughly mix the contents of the Loading Beads (LB) tubes by vortexing.
TIP
Using the Loading Beads
Demo of how to use the Loading Beads.
8 In a new tube, prepare the library for loading as follows:
Reagent Volume per flow cell
Sequencing Buffer (SQB) 34 µl
Loading Beads (LB), mixed immediately before 25.5 µl

use
Nuclease-free water 4.5 µl
DNA library 11 µl
Total 75 µl
IMPORTANT
The Loading Beads (LB) tube contains a suspension of beads. These beads settle very quickly. It is vital that they
are mixed immediately before use.
9 Complete the flow cell priming:
1. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
2. Load 200 µl of the priming mix into the flow cell priming port (not the SpotON sample port), avoiding the introduction of air
bubbles.
5
Gently flip open the
SpotON
sample port cover.
10 Mix the prepared library gently by pipetting up and down just prior to loading.
11 Add 75 μl of the prepared library to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each
drop flows into the port before adding the next.
12 Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, close the priming port
and replace the MinION device lid.
9
Sequencing and data analysis
Data acquisition and basecalling
Overview of nanopore data analysis
For a full overview of nanopore data analysis, which includes options for basecalling and post-basecalling analysis, please refer to the
Data Analysis document.
How to start sequencing
The sequencing device control, data acquisition and real-time basecalling are carried out by the MinKNOW software. You will need to
have MinKNOW already installed on your computer before starting.
Data acquisition and basecalling in real-time using MinKNOW on a computer
For references, please refer to the MinKNOW protocol.
Instructions on how to carry out sequencing:
1. Double-click the MinKNOW icon on the desktop to open the MinKNOW GUI and log in with your nanopore community credentials
2. With the MinION connected to the computer select the sequencing device connected
3. On the Start homepage, select 'Start Sequencing' and complete the run parameters for the experiment
4. Provide an experiment name: we recommend using the date for the run
5. Provide a Sample ID for the run
6. Select the type of flow cell being used from the drop-down menu and continue to kit selection
7. Select the kit used to prepare the libraries: SQK-RPB004
8. Set the run time to 48 hours. However, samples positive for mpox will likely show a positive result after ~8 hours
9. Select 'Continue to Basecalling'
10. Select 'High accuracy basecalling' (HAC)
11. Check 'Barcoding' on
12. Select the output data location, format and filtering options. Output data is typically saved as FAST5 and/or FASTQ
13. Continue to 'Run Setup'
14. Start run
15. Navigate to 'Sequencing Overview' to monitor the run
Downstream analysis
Post-basecalling analysis for the mpox virus
The wf-mpx workflow provides a basic analysis of mpox sequencing data whether targeted or metagenomics.
This workflow can be performed on commandline or through EPI2ME Labs, giving users basic QC tools, a draft consensus sequence for
review, a draft assembly and SNP context.
Please note, the workflow does not perform adapter or primer trimming. This means if targeted protocols are used, there could be
artefacts at these sites.
Post-basecalling analysis for viral metagenomics
Please note that Oxford Nanopore Technologies does not currently offer a dedicated workflow for viral metagenomics analysis,
meaning users will need to use or adapt third-party tools suitable for this application. However, we do offer a wf-metagenomics
workflow but requires users to specify a custom database e.g. Kraken2 Metagenomic Virus Database.
For general post-basecalling data analysis options, please see the list below:
1. EPI2ME platform
The EPI2ME platform is a cloud-based data analysis service developed by Metrichor Ltd., a subsidiary of Oxford Nanopore
Technologies. The EPI2ME platform offers a range of analysis workflows, e.g. for metagenomic identification, barcoding, alignment,
and structural variant calling. The FastQ WIMP (Human + Viral) workflow compares sequence reads against a comprehensive corpus of
virus genome sequences. This can be used to assign sequence reads to known viruses or to provide taxonomic hints for novel virus
sequences that may be detected from metagenomics samples. The analysis requires no additional equipment or compute power, and
provides an easy-to-interpret report with the results. For instructions on how to run an analysis workflow in EPI2ME, please follow the
instructions in the EPI2ME protocol, beginning at the "Starting data analysis" step.
2. EPI2ME Labs tutorials and workflows
For more in-depth data analysis, Oxford Nanopore Technologies offers a range of bioinformatics tutorials and workflows available in
EPI2ME Labs, which are available in the EPI2ME Labs section of the Community. The platform provides a vehicle where workflows
deposited in GitHub by our Research and Applications teams can be showcased with descriptive texts, functional bioinformatics code
and example data.
For identifying viral sequence reads from metagenomic samples, we would recommend our wf-metagenomics workflow. This nextflow-
based analysis pipeline uses the kraken2 software to assign sequence reads to an organism (or virus) of origin. The bracken software
considers the kraken2 results and prepares a quantitative view of the species observed within a metagenomic sample. A few different
databases suitable for this workflow are maintained by the author and are publicly available at the Kraken 2 and Bracken indexes
page.
3. Research analysis tools
Oxford Nanopore Technologies' Research division has created a number of analysis tools, which are available in the Oxford Nanopore
GitHub repository. The tools are aimed at advanced users, and contain instructions for how to install and run the software. They are
provided as-is, with minimal support.
The marine phage scripts repository includes a collection of python scripts that have been used in the recovery, identification and
annotation of marine virus genomes from metagenomic samples. The scripts available here could be further adapted for more general
viral metagenomic requirements.
4. Community-developed analysis tools
If a data analysis method for your research question is not provided in any of the resources above, please refer to theBioinformatics
section of the Resource centre. Numerous members of the Nanopore Community have developed their own tools and pipelines for
analysing nanopore sequencing data, most of which are available on GitHub. Please be aware that these tools are not supported by
Oxford Nanopore Technologies, and are not guaranteed to be compatible with the latest chemistry/software configuration.
Ending the experiment
1 Alternatively, follow the returns procedure to flush out the flow cell ready to send back to Oxford Nanopore.
Instructions for returning flow cells can be foundhere.
Note: All flow cells must be flushed with deionised water before returning the product.
IMPORTANT
If you encounter issues or have questions about your sequencing experiment, please refer to the Troubleshooting
Guide that can be found in the online version of this protocol.
Troubleshooting
Issues during DNA/RNA extraction and library
preparation
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on theNanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email
(support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Low sample quality
Observation Possible cause Comments and actions
Low DNA purity (Nanodrop reading The DNA extraction The effects of contaminants are shown in the Contaminants
for DNA OD 260/280 is <1.8 and OD method does not document. Please try an alternative extraction method that
260/230 is <2.0–2.2) provide the required does not result in contaminant carryover.
purity
Consider performing an additional SPRI clean-up step.
Low RNA integrity (RNA integrity The RNA degraded Try a different RNA extraction method. For more info on RIN,
number <9.5 RIN, or the rRNA band during extraction please see the RNA Integrity Number document. Further
is shown as a smear on the gel) information can be found in the DNA/RNA Handling page.
RNA has a shorter than expected The RNA degraded Try a different RNA extraction method. For more info on RIN,
fragment length during extraction please see the RNA Integrity Number document. Further
information can be found in the DNA/RNA Handling page.
We recommend working in an RNase-free environment, and to

keep your lab equipment RNase-free when working with RNA.
Low DNA recovery after AMPure bead clean-up
Low DNA loss due to a 1. AMPure beads settle quickly, so ensure they are well resuspended before adding them to
recovery lower than intended the sample.
AMPure beads-to-
sample ratio 2. When the AMPure beads-to-sample ratio is lower than 0.4:1, DNA fragments of any size
will be lost during the clean-up.
Low DNA fragments are The lower the AMPure beads-to-sample ratio, the more stringent the selection against short
recovery shorter than fragments. Please always determine the input DNA length on an agarose gel (or other gel
expected electrophoresis methods) and then calculate the appropriate amount of AMPure beads to
use.
Low The wash step used DNA will be eluted from the beads when using ethanol <70%. Make sure to use the correct
recovery ethanol <70% percentage.
after end-
prep
Issues during the sequencing run
Below is a list of the most commonly encountered issues, with some suggested causes and solutions.
We also have an FAQ section available on theNanopore Community Support section.
If you have tried our suggested solutions and the issue still persists, please contact Technical Support via email
(support@nanoporetech.com) or via LiveChat in the Nanopore Community.
Fewer pores at the start of sequencing than after Flow Cell Check
Observation Possible Comments and actions

cause
MinKNOW An air bubble After the Flow Cell Check it is essential to remove any air bubbles near the priming port before
reported a was introduced priming the flow cell. If not removed, the air bubble can travel to the nanopore array and
lower number into the irreversibly damage the nanopores that have been exposed to air. The best practice to
of pores at the nanopore array prevent this from happening is demonstrated in this video.
start of
sequencing
than the
number
reported by
the Flow Cell
Check
MinKNOW The flow cell is Stop the sequencing run, remove the flow cell from the sequencing device and insert it again,
reported a not correctly checking that the flow cell is firmly seated in the device and that it has reached the target
lower number inserted into temperature. If applicable, try a different position on the device (GridION/PromethION).
of pores at the the device
start of
sequencing
than the
number
reported by
the Flow Cell
Check
MinKNOW Contaminations The pore count during the Flow Cell Check is performed using the QC DNA molecules present
reported a in the library in the flow cell storage buffer. At the start of sequencing, the library itself is used to estimate
lower number damaged or the number of active pores. Because of this, variability of about 10% in the number of pores is
of pores at the blocked the expected. A significantly lower pore count reported at the start of sequencing can be due to
start of pores contaminants in the library that have damaged the membranes or blocked the pores.
sequencing Alternative DNA/RNA extraction or purification methods may be needed to improve the purity
than the of the input material. The effects of contaminants are shown in the Contaminants Know-how
number piece. Please try an alternative extraction method that does not result in contaminant
reported by carryover.
the Flow Cell
Check
MinKNOW script failed

cause
MinKNOW Restart the computer and then restart MinKNOW. If the issue persists, please collect theMinKNOW log
shows files and contact Technical Support. If you do not have another sequencing device availalbe, we
"Script recommend storing the flow cell and the loaded library at 4°C and contact Technical Support for further
failed" storage guidance.
Pore occupancy below 40%

Pore Not enough library was loaded Ensure you load the recommended amount of good quality library in the relevant
occupancy on the flow cell library prep protocol onto your flow cell. Please quantify the library before
<40% loading and calculate mols using tools like the Promega Biomath Calculator,
choosing "dsDNA: µg to pmol"
Pore The Ligation Sequencing Kit was Make sure to use the NEBNext Quick Ligation Module (E6056) and Oxford
occupancy used, and sequencing adapters Nanopore Technologies Ligation Buffer (LNB, provided in the sequencing kit) at
close to 0 did not ligate to the DNA the sequencing adapter ligation step, and use the correct amount of each
reagent. A Lambda control library can be prepared to test the integrity of the
third-party reagents.
Pore The Ligation Sequencing Kit was Ethanol can denature the motor protein on the sequencing adapters. Make sure
occupancy used, and ethanol was used the LFB or SFB buffer was used after ligation of sequencing adapters.
close to 0 instead of LFB or SFB at the
wash step after sequencing
adapter ligation
Pore No tether on the flow cell Tethers are adding during flow cell priming (FLT/FCT tube). Make sure FLT/FCT
occupancy was added to FB/FCF before priming.
close to 0
Shorter than expected read length
Shorter than Unwanted fragmentation Read length reflects input DNA fragment length. Input DNA can be
expected read length of DNA sample fragmented during extraction and library prep.
1. Please review the Extraction Methods in the Nanopore Community for

best practice for extraction.
2. Visualise the input DNA fragment length distribution on an agarose gel

before proceeding to the library prep.
In the image above, Sample 1 is of high molecular weight, whereas Sample

2 has been fragmented.
3. During library prep, avoid pipetting and vortexing when mixing reagents.
Flicking or inverting the tube is sufficient.
Large proportion of unavailable pores

cause
Large proportion of unavailable pores (shown as Contaminants Some contaminants can be cleared from the pores by
blue in the channels panel and pore activity plot) are present in the unblocking function built into MinKNOW. If this is
the sample successful, the pore status will change to "sequencing
pore". If the portion of unavailable pores stays large or
increases:
1. A nuclease flush using the Flow Cell Wash Kit (EXP-

WSH004) can be performed, or
2. Run several cycles of PCR to try and dilute any
The pore activity plot above shows an increasing contaminants that may be causing problems.
proportion of "unavailable" pores over time.
Large proportion of inactive pores

cause
Large proportion of inactive/unavailable pores Air bubbles Air bubbles introduced through flow cell priming and
(shown as light blue in the channels panel and have been library loading can irreversibly damage the pores.
pore activity plot. Pores or membranes are introduced Watch the Priming and loading your flow cell video for
irreversibly damaged) into the flow best practice
cell
Large proportion of inactive/unavailable pores Certain Known compounds, include polysaccharides, typically
compounds associate with plant genomic DNA.
co-purified
with DNA 1. Please refer to the Plant leaf DNA extraction
method.
2. Clean-up using the QIAGEN PowerClean Pro kit.
3. Perform a whole genome amplification with the
original gDNA sample using the QIAGEN REPLI-g kit.
Large proportion of inactive/unavailable pores Contaminants The effects of contaminants are shown in the
are present in Contaminants Know-how piece. Please try an
the sample alternative extraction method that does not result in
contaminant carryover.
Reduction in sequencing speed and q-score later into the run
Reduction in For Kit 9 chemistry (e.g. SQK-LSK109), fast fuel consumption Add more fuel to the flow cell by following
sequencing is typically seen when the flow cell is overloaded with library the instructions in the MinKNOW protocol. In
speed and q- (please see the appropriate protocol for your DNA library to future experiments, load lower amounts of
score later into see the recommendation). library to the flow cell.
the run
Temperature fluctuation
cause
Temperature The flow cell Check that there is a heat pad covering the metal plate on the back of the flow cell. Re-insert the
fluctuation has lost contact flow cell and press it down to make sure the connector pins are firmly in contact with the device.
with the device If the problem persists, please contact Technical Services.
Failed to reach target temperature
MinKNOW The instrument was MinKNOW has a default timeframe for the flow cell to reach the target temperature.
shows placed in a location that Once the timeframe is exceeded, an error message will appear and the sequencing
"Failed to is colder than normal experiment will continue. However, sequencing at an incorrect temperature may lead
reach target room temperature, or a to a decrease in throughput and lower q-scores. Please adjust the location of the
temperature" location with poor sequencing device to ensure that it is placed at room temperature with good
ventilation (which leads ventilation, then re-start the process in MinKNOW. Please refer to this FAQ for more
to the flow cells information on MinION Mk 1B temperature control.
overheating)
Guppy – no input .fast5 was found or basecalled
No input .fast5 input_path did not point to The --input_path has to be followed by the full file path to the .fast5 files to be
was found or the .fast5 file location basecalled, and the location has to be accessible either locally or remotely
basecalled through SSH.
No input .fast5 The .fast5 files were in a To allow Guppy to look into subfolders, add the--recursive flag to the
was found or subfolder at the input_path command
basecalled location
Guppy – no Pass or Fail folders were generated after basecalling
No Pass or Fail The -- The --qscore_filtering flag enables filtering of reads into Pass and Fail folders inside the
folders were qscore_filtering output folder, based on their strand q-score. When performing live basecalling in MinKNOW,
generated after flag was not a q-score of 7 (corresponding to a basecall accuracy of ~80%) is used to separate reads
basecalling included in the into Pass and Fail folders.
command
Guppy – unusually slow processing on a GPU computer
Unusually slow The --device flag The --device flag specifies a GPU device to use for accelerate basecalling. If not included in
processing on a wasn't included the command, GPU will not be used. GPUs are counted from zero. An example is --device
GPU computer in the command cuda:0 cuda:1, when 2 GPUs are specified to use by the Guppy command.

Viral Metagenomics RNA DNA VMM - 9160 - v1 - Revf - 16jun2022 Minion

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Viral Metagenomics RNA DNA VMM - 9160 - v1 - Revf - 16jun2022 Minion

Uploaded by

Copyright:

Available Formats

Introduction to the protocol

Overview of the protocol

This is a Legacy product

Introduction to the protocol

Steps in the sequencing workflow:

Prepare for your experiment

Sequencing and analysis

Compatibility of this protocol

This protocol should only be used in combination with:

Rapid PCR Barcoding Kit (SQK-RPB004)

Equipment and consumables

Materials Nasopharyngeal or skin lesion swab in viral transport media

Consumables Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)

Equipment TissueLyser LT (QIAGEN, cat # 85600)

Input RNA and DNA

How to QC your input DNA/RNA

Polyadenylation of non-poly(A) transcripts using E. coli poly(A) polymerase

These documents can also be found in the DNA/RNA Handling page.

Rapid PCR Barcoding Kit (SQK-RPB004) contents

FRM FRM FRM RAP SQB LB

RLB RLB RLB RLB RLB RLB

RLB RLB RLB RLB RLB RLB

FRM : Fragmentation mix RLB05: Rapid barcode primer 5

Fragmentation Mix FRM Brown 3 30

Rapid Adapter RAP Green 1 10

Sequencing Buffer SBQ Red 1 300

Loading Beads LB Pink 1 360

Rapid Barcode Primer 1-12 RLB 01-12 Clear 12 10

Flow Cell Priming Kit (EXP-FLP002) contents

Flush Buffer FB Blue 6 1,170

Flush Tether FLT Purple 1 200

Rapid Barcode Primer sequences

RAP SQT LB SQB

RAP : Rapid adapter LB : Loading beads

Rapid Adapter RAP Green 1 10

Sequencing Tether SQT Purple 1 10

Loading Beads LB Pink 1 360

Sequencing Buffer SQB Red 1 300

Computer requirements and software

MinION Mk1B IT requirements

MinION Mk1C IT requirements

Software for nanopore sequencing

Check your flow cell

Flow cell Minimum number of active pores covered by warranty

Flongle Flow Cell 50

MinION/GridION Flow 800

PromethION Flow Cell 5000

Materials Nasopharyngeal or skin lesion swab in viral transport media

Consumables Lysing Matrix D, 2 ml tube (MP Biomedical, cat # 116913050-CF)

Equipment TissueLyser LT (QIAGEN, cat # 85600)

4 Add 10 µl of HL-SAN nuclease to the sample.

5 Mix well by pipetting and spin down.

6 Incubate at 37°C for 10 minutes at 1000 rpm in a thermomixer.

7 Add 200 µl of MagNA Pure Bacterial Lysis Buffer to the reaction.

8 Mix well by pipetting and spin down.

9 Incubate at room temperature for 10 minutes.

10 Resuspend the AMPure XP beads by vortexing.

13 Prepare 500 μl of fresh 70% ethanol in nuclease-free water.

16 Repeat the previous step.

Dispose of the pelleted beads.

Materials 16 µl of extracted sample

Consumables LunaScript™ RT SuperMix Kit (NEB, cat # E3010)

3 Gently pipette mix and spin down the reaction.