2 , 7. Subettancous fat acounmlatinn 1s essential for, a sai u b Shit ¢) Elephant 8) Kanga 2 Desmination in the liver initially pantuces SF ammonia by arginine ©) oensthine ) ura ¢) uicacid S 4 S me Ss o/Ataipighian body is composed off S we Bowman's capsule and glomerulus Y bp Pyramids and pelvis $ ) Pelvis anc medulla 3S d) Hilus and medulla > e) Nephron and medulla S - 10, Method in which ultrasonic waves are weyers up calculi is called 1) Kidney Mi iu 6) Lithotripsy ey d) Peritoneal dialysis s ) Amificial pacemaker SS Aalpit ee in exeretion in: a) C b) Earth ©) d) ©) Nursing Craze Preparation Center 4.14822222 | MERITORIOU! - 346-111-8939 Se S12 Theennicentration of Na ians in the body fluids is controlted by _ hormone -%) ADH "ss parathormone @ aldosterone 4) estrogen ©) thyroxin 2013 en shows the human urinary system. ia Wyeo\ 3 J \ fi \ if ) 7 If oY fs } elucose ) sal °) ais < 4) water . Which statement is not found in the liquid ow, person? uted tubule...by passive diffusion by selective reabsorption ultrafiltration ximal convoluted tubule...by active re-absorption Nursing Craze Preparation Center & MERITORIOUS | 021-34522222 | www. meritorious ae 0348-1 —_ Education Centre 11-3333 | fb.com/meritoriousnetworke- 15. Which of the following correctly describes the thermoregulation In hot temperature? $ , Nursing Craze Preparation Center ¢ nursing creze MEG)? v J MERIZORIO! Eci jaatit Cen re2000 1.-Funetion of the “tube feet” a) Locomotion b) Anchoring to hard surface ¢) Grabbing the prey (@ All ofthe above in Phylum: Echinodermata 1s: yan action potential in a muscle fibre causes the release of calcium tons from: Za) Actin by Myosin ¢)_ Sarcolemma arcoplasmic reticulum 2001 3. MYofibrils: 3) are found in smooth muscles b) are the smallest fibres that make up a muscle c) are crossed by transverse Y-bands d) Cannot contract 2002 As “Yertebral column isthe part of__seiai Co Axial b) Appendicular < ¢) Exoskeleton Re d) Hydrostatic 5, Z__muscle pul linn outward away from the body a) Adduetor ee Coawtucoy CA bductope Loy “ + Enters oe . Thedark band in muscle fibres are due to; a “Actin Myosin and Actin 3 W -Toc*** 4 ¢) Trophomysin d) 1-band Nursing Craze @nursing Craze MEI MERTTORIOUS2003 7. Sea star moves with the help of. ay” Peeudopodia TB Tube feet ©) Cilia 4) Flagellum ‘th of pollen tube towards ovary is an example of movement. Phototropic b) Chemotactic (c) Sensory d) Mechanical 2004 9 The muscle which rotate the wholle or part of limb at one F109 ee a) Protractor b) Retractor £) Rotractor Gd Rotator 2005 10. Positive geotropism by the YY YG) Root & b) Stem ©) Leaves 4) Flower Le pi movement i \-* a) Thermonastic b) Photonasti c) Scisnma @ Thi 2001s Ss" Rich one of the following is a voluntary muscle’ Biceps b) Cardiac ©) Stomach 4) Vessels Nursing Craze negated center Sieg Craze Centre | 0348-111-3333 | fb.com/menitoriousnet ——oo ooo & MERITORIOUS: 021-34522222 | www. meritoriou ane Eel CO)ring is the result of the activity of % ay Cork Can b) Cork Cambium and Vascular cambium ©)_Iniracalary meristem (G4) Lateral cabiam ( Vascular eambium ) 2009 14, Which of the following bones are present in the palm of hand? a) Carpals \L (b) Metacarpals ‘c) Phaalanges d) Tarsal e) Radius 15, The major sign and symptom of Microcephaly is: a) Sexual defects fe ‘py Excessive number of toes & c) Mental retardation C Se 44) Small skull in proportion to the normal body size ¢). Split in upper lip and gap in the roof of mouth NS 16. The museles attached to the bones are: ay Voluntary and smooth ss “ 4) Involuntary and smooth S @ ) Voluntary and striated &S }) Involuntary and striated Ss St hand stri ¢) Smooth and striated J SS S 2010 je's reserve of high energy phosphate by providing \ bot Phosphate eS a) Nerve impulses S Acetyl cai ATPS AGS 4), Caleiuny t aeet a) *toccyx b) sacrum c) phalanges d) cranium ~ ©) femur Nursing Craze Nursing Craze 021-34522222 init | Pheearoreene tww.moritorlous.ae@ ».com/moritorlousnetwork19. GresCth movement caused in respanse to gravitational stimulus is called: a) Nutation © b) Geotropism c) Nastic movement d) Tropic movement e) Turgor movement 20, Boriés of the skull are joined by: ay Fixed joints b) sliding joints cc) pivot joints d) hinge joints ¢) gliding joints m2 The movement of plants in response to touch stimulus is called: a) Hydrotropism b) chemotropism ¢) geotropism @-ahigmotropism ¢) phototropism ae of muscles in a human body is about: Ss #200 b) 300 ) 400 @) 500 SS Nursing Craze (© 600 S a 4 ¥ @Nursing Craze isi a physician elicits the wien reflex by tapping deep tendovis in the knee, the ‘normal response is for: iF leg to swing forward. When this happ. CB) Muscles inthe thigh are relaxing») b) Muscles in she font of the lower leg are contracting and muscles in the back of the lowerlleg are relaxing r ¢) Musclesiimrthe back of the thigh are contracting and museles in the front of the ‘thigh are relaxing. d).¢Museles in the back of the lower leg are contracting and muscles in the fromt of ‘the lower leg are relaxing. ¢) None of the above thigh are contracting and muscles in the back of the2 24, How many metacarpals are present in the hand? at Sp3 26 ads iS 8 2014 joints found at the vertebrae are: gliding joints ib) sliding joints ¢) partially moveable joints d) fixed joints S ¢) pivot joints ~& 2015 > 26. The diagram shows some of the muscles and bones of the Dale When musele cai Sahat happens to the arm and what happens to muscle ¥? > Nursing Craze Preparation Center Nursing Craze 034-111-3333 | Ed jucation Centre ~ 021-s4522222 | MERITORIOUS’27. The following sequence of events occurs at the neuromuscular junction. nerve impulse —+ release of V — end plate potential -» Wproduced in muscle fibre —+ X released from sarcoplasmic reticulum —+ formation of Y— muscle contraction. Which one of the following shows the correct sequence from VY? Yap a rr Fat reaviatee—|naton pea {Cac os — TRaemesin —| [iT Acetylcholine —[ Action potential | Actomyosin —T Calcium fons —| [Actomyosin | Acetyicholine | Calcium ions —_[ Action potential | [DT atcium ions —[Action potenti Acety| choline —[Aciomyosin |] [Fe [cals fons —[Astonposin [Aesyletine [Acton pss] Ss ” Vhich of the following types of cell are found in the secondary xylem of ra angiosperms? % & a) tracheids, parenchyma, fibres, collenchyma but no vessels ee b) vessels, tracheids, parenchyma, callenchyma but no fibres \) ©) vessels, tracheids, fibres, collenchyma but no parenchyma S 7 vessels, tracheids, fibres, parenchyma but no collenchy ©) vessels, fibres, parenchyma, collenchyma but no tral : _ Bert the bones in which the connecting joints a ‘moveable joints: a) Ankle b) Wrist. ©) Vertebrac SS 4) Elbow. @ Allofihe above 2016 56 SS) sais have un ex jinade up of 8) Protein e 8 Silica @/caco; $ Nursing Craze Preparation Center @Nursing Craze > MERITORIOUS | 021-34522222 0348-111-333; _~» Education Centre 3a a + 281. Which bones meet at the elbow joint and what kind of movement dé they allow? { | BONES MOVEMENT j |_| Humerus and seapuls | sting a |_2 | numerus end seapula | Back and forth ‘ of Ulna and humerus | Sliding | 0._| ving and humerus | Back and forth S&S Nursing Craze Preparation Center @Nursing Craze ee aie ee R itorious.ae | 021. Smmertonousene:| ciomtan | MERITORIOUS g>-ORDINATION ADO 2000 10 Tee pituitary gland seeretes the following except: // 4) Growth hormone \Y (fy Calcitonin ©) Prolactin 4) Oxytocin 4 Thytoid stimulating hormone levels: AE Would be mised ina person w ith hyperthyroidism lA by Would be low in patients with hyperthyroidism: ¢) Would be low in patient with hypothyroidism d)_ Would be unaffected in hypothyroidism (nce of the thyroid gland in an adult would cause an inerease a) BMR “ b) Conversion of glycogen to glucose cc) Excretion of Na” from the kidneys @ Secretion of TSH 001 4. The motor nerve cell transmits impulses from )) The effector organ to the spinal chord : by Receptor cells to the spinal chord s Z) Receptor cells to the eflector organ pinal cord to the effector organ ‘emoval of the thyroid gland in an adult would ea\ 1a) Basal metabolic rate KP b) Conversion of glycogen to glucose _e) Exeretion of Na’ from the kidney, 6 Gd) Secretion of TSH Gg eT ee oe 6./Insulin causes: !@ 4a) Increased blood sugar, b) Increased calcium @éposition in bones CO) Increased perinteability of cells to glucose 4) Increased cholesterol in blood Bee ee ee RRR DADSD pam increase in: Nursing Craze Preparation Center @Nursing Craze | MERITORIOUS: Education Centre <=. www.meritorlo fb.com/maritorlousnatwork 0348-111-3333aut SL M4. Which diagram iifustrates the distribution of wsdium and potassium jae ina section ‘af w nean-anyetinated xeon which is at resting: potential? 9 Na* high + + Nursing Craze Preparation Center @nursing Craze & MERITORIOUS | 021-34522222 | www meritorious a: we Education Centre | 0348-111-3333 | fb.com/meritoriousnetwor. 19, Pituitary gland is controlled by which of the following: a Adrenal cortex / b) ACTH (@ Hipothalamus ~@) Cytoxin 2009 20. The Prolactin hormone responsible for activation of mammary glands to start , lucing milk is a hormone of: A ) Pituitary gland b) Pancreas ¢) Thyroid gland d) Thymus gland ©) Adrenal gland 2010 Kérenal gland is located: a) Atthe side of the kidney {8} On the top of each kidney ) On lower side of the liver d) At the end of the pancreas ¢) Near the gall bladder in 2. are the cells that separate rsa each other and form myelin , AS ° | cig - ¢) Nissi substance dierus during labor and release of milk from the mammary )sématotropin Qe" FSH (Follicle Stimulating Hormone) > Nursing Craze Preparation center @Nursing Craze: ee & MERITORIOUS | 021-34522222 | www.meritorious.a ae Education Centre 0348-111-3333 | fb.com/meritoriousnetwor20 eng 24. Deficient production of hormones Py adrenal glands result in: 1a) Cushing's syndrome 6) Addison's disease ¢) Diabetes Mellitus d) Goiter ©) Epilepsy 2012 25, Thé region where the impulse moves from one neuron to another is called a) Axon “by Dendrites yo) Synapses “d) Thalamus ©) Cerebellum 26. The 6p) parathormone a £O) aldosterone tS) d) estrogen S$ e) thyroxin & 2013 S 27. What are the function of the inter, motor and serio ina reflex response? OSs | ZINTER NEURON | MOTOR NED ION SORY NEURON | [ A/{Te connect neurons | To conducttanpuses to [To conduct impulses | \| Z| within the central the eff im the from the receptor to the. | fous system. | central nervous system | neurons To receive stimulus the central nervous ‘To conduct impulses To connect neurons from the receptor to the | within the central central nervous system nervous system, cage pulses from‘thie feceptor to the dV hervous system To conduct impulses To conduct impulses the effector Preparation Center @Nursing Craze Gioia | Mucaton Contre ww.meritorious .com/moritoriousnatworka a + 281. Which bones meet at the elbow joint and what kind of movement dé they allow? { | BONES MOVEMENT j |_| Humerus and seapuls | sting a |_2 | numerus end seapula | Back and forth ‘ of Ulna and humerus | Sliding | 0._| ving and humerus | Back and forth S&S Nursing Craze Preparation Center @Nursing Craze ee aie ee R itorious.ae | 021. Smmertonousene:| ciomtan | MERITORIOUS g>-ORDINATION ADO 2000 10 Tee pituitary gland seeretes the following except: // 4) Growth hormone \Y (fy Calcitonin ©) Prolactin 4) Oxytocin 4 Thytoid stimulating hormone levels: AE Would be mised ina person w ith hyperthyroidism lA by Would be low in patients with hyperthyroidism: ¢) Would be low in patient with hypothyroidism d)_ Would be unaffected in hypothyroidism (nce of the thyroid gland in an adult would cause an inerease a) BMR “ b) Conversion of glycogen to glucose cc) Excretion of Na” from the kidneys @ Secretion of TSH 001 4. The motor nerve cell transmits impulses from )) The effector organ to the spinal chord : by Receptor cells to the spinal chord s Z) Receptor cells to the eflector organ pinal cord to the effector organ ‘emoval of the thyroid gland in an adult would ea\ 1a) Basal metabolic rate KP b) Conversion of glycogen to glucose _e) Exeretion of Na’ from the kidney, 6 Gd) Secretion of TSH Gg eT ee oe 6./Insulin causes: !@ 4a) Increased blood sugar, b) Increased calcium @éposition in bones CO) Increased perinteability of cells to glucose 4) Increased cholesterol in blood Bee ee ee RRR DADSD pam increase in: Nursing Craze Preparation Center @Nursing Craze | MERITORIOUS: Education Centre <=. www.meritorlo fb.com/maritorlousnatwork 0348-111-33331“The menstrual staye lasts for: ay 1 to S days by 14 t0 16 days ©) 250 2K days d) Ho TK days, anus 8,_Feniilization in mammals takes place in, \- a) Uterus b) Ovary ©) Vagina (4) Fallopian tube 200s 9, In eptklit inflorescence the flowers are: Ye Motile \ 6) Sessile ©) Stalked 4) Branched 10. Some plants form embryo without fertilization i called: s ey Apomixis by Epimixis e ©) Apomixes 4). Endomisis s ee diploid egg ts formed W rn a) Parthenogenesis < Nursing Craze "Oueden —_— — 8 MERITORIOUS 021-34522222 | www.meritoriou Education Centre 0348-111-3333 | fb.com/meritoriousne1“The menstrual staye lasts for: ay 1 to S days by 14 t0 16 days ©) 250 2K days d) Ho TK days, anus 8,_Feniilization in mammals takes place in, \- a) Uterus b) Ovary ©) Vagina (4) Fallopian tube 200s 9, In eptklit inflorescence the flowers are: Ye Motile \ 6) Sessile ©) Stalked 4) Branched 10. Some plants form embryo without fertilization i called: s ey Apomixis by Epimixis e ©) Apomixes 4). Endomisis s ee diploid egg ts formed W rn a) Parthenogenesis < Nursing Craze "Oueden —_— — 8 MERITORIOUS 021-34522222 | www.meritoriou Education Centre 0348-111-3333 | fb.com/meritoriousne45, Mfc the parts of the Bunyan Iain Fisted ander Column Lyvitt the functions givens © under Column IL Choose the answer which gives the correet combination of alphabets of the two columns an HT (Bunetions) ay iny Ample | Posture and balance Contra of sleep and wakening Retley actions Column T a) Avr. Beg, Ce p. De oN b) Avr, Bes, Coq, Det (ay 1. Be p. Cog. Der Wy An Beg. Ce pee / ew < ‘i n an Ave following sequence of events occurs al the new arwnitig. a yetion. ‘J Nerve impulse -» release of V > end plate ran W proxtuced in muscle fibre» ou fon of Yoo mie Je contraction: X released from sarcoplasmic reticulum Which one of the following show sere sequenge from VY Uterus ) Placenta d) Umbilical cord ¢) Vagina 2011 20, All of the following are sexually transmitted diseases except: Syphilis 'b)_ Gonorrhoea \ CEP Alzheimer’ disease 4d) Genital Herpes ©) AIDSL~ 21. Ami ‘itesis is performed between the: 3716" and 18” week of gestation ire b) I"and 2™ week of gestation Ie vo 6 ©) 30 and 32 week of gestation S d) 37% and 38” week of gestation & ¢) After the delivery of the baby 2012 22. Germ cells give rise to: S ree s b) head ad E® eggs and sperms S 4) hands > ¢) all body parts Na B.A ‘contains =a ° S- ing except: A seed coat b) Anepicoty! Gy Abrestges Py ie “Development Regeneration d) Blastulation Gastrulati . ” Nursing Craze Preparation Center nursing Craze pp eg ere g& MERITORIOUS 021-34522222 | www.meritori ape Education Centre | 9348-111-3333 | fb.com/meritoriou201s 235. Male and female sea urchins release theit sperm and gus into the water where fertilization takes plave. How can their reproduction be described? 4) asexual reproduction which results in genetically dissimilar offypring hy asextal reproduction which results in genetically identical offspring: fg) sexual reproduction which results in genetically dissimilar offspring d) sexual reproduction which results in genetically identical offspring. 26. Whema fetus is in the uterus, what carries oxygen away from the placenta’? LAY The amniotic uid by The amniotic sac ) The lining of the uterus d) The umbilical cord . 201s 27. The diagfam shows part of a flower afler it has been pollinated. S$ BS Which row correctly isnot the labeled structures? S Nursing Craze Preparation Center Nursing Craze MERITORI nw torlou 021-34522222 ‘b.com/moritoriousnatwork | 0348-111-33332 38. The Romane labelled Nin the diagrams often used it over-the-counter diagnostic ne when ovulation has eveutred. This hormone is: i g 2 Z = 2 = 3 2 2 * 2 = 3 Uterine % Unning v hormone levels 7 aa 21 days of cycle a) estrogen b) progesterone 3} fsu LH €) Testosterone RS ay 29: Based on the peak leves of hormone 2, on what Go is ovilation most likely to occur? a) Day 21 CB Day 14 c) Day 12 4) Day 25 fe) Day 28 the corpus luteum after ovulation has occurred b) progesterone,’ Sted by the ovary after ovulation has occurred ©) estrogen, sectdied by the corpus luteum after ovulation has occurred 4d) estrogeii.ssereted by the ovary after ovulation has occurred Secreted by the follicle before ovulation occurs. Nursing Craze Preparation Center @nursing Craze en & MERITORIOUS 021-34522222 | WWW.meritorious.ae SS Education Centre | 348-111-3333 | {b.com/meritoriousnetwork2018 Fe “Refering to sexual reproduction, human are: 9) Hermaphrpdites (SY Viviparous c) Ovipraous d) Self-fertilized 32 Which of the following is divided by fission? a) Viruses b) Viroids C)Bacteria d) Fungus Nursing Craze Gurseoeehap 2004 1. The proportion of different alleles of a gene in a populat a) Allele frequency b) Genetic drift ‘ <) Gene frequency d) Allelomorph 2008 2 “Lamarck identified evolution as: _/© 3), Natural selection 4 (0) Acquired characters ©) Disuse / use of organs d) Mutation Theory jon is termed as: Nursing Craze 2006 Preparation Center 3, The tife was evolved first: Oise Cos SS (a) Oneanh ® i) In water VS ¢) Insky &) On the hill 208 ye Ke ; ine a) Devaries _b) Darwin (GP Lamarck, 4) Weisman S ws s S.Adentify the inoorrect sta it Charles Darwin's Theory a) The ingifidual of: ve variations among them b) Theré isalways atendency of over reproduction in a species ual ehianges +e) Yast grad result in the origin of a new species | d)/Favorabl 57 Intra s survive and unfavorable will be exterminated ition occurs between different species and inter-specific ‘occurs among the individuals in a species. www.meritor ous fb.com/meritoriousnetwor! 021-34522222 | MEI | 0348-111-3333 ioe201 6. In the commercial manufacture of insulin, a human gene is inserted into which of these? 4) a chromosome of a human cell by a protein molecule in a yeast cell C@) the DNA of a bacterium “d) the nucleic acid ina virus 2018 The technique used for identification of erimitials is called a) Cloning C9) DNA fingerprinting ©) Restriction analysis 4) polymorphism “e) Gene sequencing ae In recombinant DNA technology, the copies of recombinant nef? a) Restriction enzyme b) Ligase ©) Selection of host with DNA {@). Muhiplication of host with rDNA 9. Which of the following is the manipulatic 4) Grafting ) Tissue culture b) C2 cenetis ethnecring 4) Cell culture iC material for practical. purpose: Nursing Craze Preparation Center Nursing CrazeTopic: Chapter N B OTECHNOLOGY 2008 1, Bacteria takes (NA in the presence of a) NaQle d) Nach by HC. UH wee Chloride eg ew Which enzyme is used to eut DNA into small pieces: a) DNA polymerase b) Vector (GF Restriction enzyme d) DNA ligase 2010 3. A typeof asexual reproduction in which individual resembles exactly to the ege donor _isealled: a) Regeneration b) Budding Y a& ‘ c)_Parthenogenesis 2 A) Cloning S ©). Fission & iSease in which patients passed urine veri black on exposure to, called: A - Sie Og ¢) Sickle cell anaemia oan se bn we 5. The procéss of repfacing Or supplementing the defective allele with a functional _Atormal allele, as ; Ma fe Nursing Craze Preparation Center @nNursing Craze a &p MERITORIOUS: 021-34522222 | www.moritorious.ae _— Education Centre | 348-111-3333 | tb.com/meritoriousnetwork2000 i. Which of the following is an example of discontinuous variation: AN Range of height of pea plants 30-50 cm Y J. bottspring including 2 males and 3 females ¢) Pea plants gown in darkness are yellow d) Adult human weight ranges from 50-95 kg 2001 2. When hybrids are crossed the genotype of the offspring is: ea il Ae 12:1 : e a Nursing Craze Preparation Center 2002 @Nursing Crass, 3, he possible result of crossing between heterozygous (T 9 and homozygous AEH this: x ae CH) 50% tall and 50% Dwarh y ahs a b) 100% tall ia ©) 100% Dwarf d) 75% tall and 25% dwarf Soto of gene in chromosomes to remain to; ther a) Crossing over b) Synapsis cc) Terminalization Ss G) Linkage & | s 2006 5, man with blood group" ‘a woman with blood group "B", child can have: a) Aand B b) Band AB ‘ ce) AandAB * @ A,B, AB and oe 6._In population 36% people have "Blue Eyes’; allele frequency for blue is: 36% ), a ae rk www.meritorlo fb.com/meritoriousne! 021-34522222 * wiovrag | MERITORIOUS~ © Grvap is wniversal donor bevauye aay Ithas both A and 1 antigens GD No antigens )- Aantigen @) Rantigen & Skin color, height and intelligence vary in different people due to: a) Pieiotropy d) Episasis TP) Polygenic inheritance d) Crossing over 9. When phenotypically tall plant is erase! with pure dwarf plant what cross is this: (ay Test by Monohy brid! ©) Dihybrid @) Multiple cross gS 10, Which of the following best explains the reason ‘that Ahmed, Ali, Alia, and are not display symptoms of hemophilia, even though their father, Sand. i Sand. isa bemophitiae? ~ a) hemophilia is an X-linked disorder, and Saad can only pass ot hromosome GY hemophilia is an) linked disorder, and even though Ali hemophiliacs X chromosome from Saad, Sara gave thems ¢) hemophilia isa Y-linked disorder, and therefore ca splayed in females d) hemophilia isa Y-linked disorder, and Nhmed waite esha received a ial N chromosome, just have received an X chromosome from Saad )_ bemophiliaiis an X-tinked disorder, and oh Abiived and Ali received a bemophiliac X chromosome from S ave them a normal \ chromasame 11. Af one of Ali's daughters marries 3 _ What is the probability that one of their children will digplay sy ophitia? €) 100% S ° Nursing Craze 021-34522222 www itorious ae 0348-111-3333 | fb com/manitoriousnetwork Meritorious Ed ucation cant12, Which of the follow ing individuals are heterozygous for hemop ay” Saad, Ahmed, and Ali 1b) Ahmed, Ali, Alia, and Ayestia ). Saal and Sara a Alia and Ayesha a) Ahmed and Ali 13, The law of Dominance is illustrated in the garden pea by ‘a) Homozygous tall x heterozygous tall a b) Heterozygous tall x heterozygous tall ©) Homozygous tall x homozygous tall @)_ Pure short x pure short ® Jomozygous tall x pure short 200 14. Ifthe new bom babies get mixed up ina hospital, how could you determine their parentage from the information given below? (zee! Tyo iN) : Baby Type B Mrs. Ali Type A SY Mr. Ali Type AB Cy Mrs.Ahmad Type A S MrAhmad — Type A x a) Baby | is the child of Mr. and Mrs.Ali ao Baby Il isthe child of Mr, and M ©) Baby ILis the child of Mr. and, @) Both Baby I and i ce) iakute te 15. Hemophilia i © soil ia saa “inked, recessive allele, Id of Mr. and Mrs.Ahmad Two parents have yi son and a hemaphitiae daughter {ikely penotype of the parents? y ¢) None of the above Nursing Craze Preparation Center www.metita {b.com/meritoriou:i he allele for wrinkled 7 ants, the allele for round seeds (R) is dominant to U e : me © rand the allele for yellow seeds (Y) is dominant to the allele for green seeds ~ 4g). A doubly heterozygous, round, yellow-seeded plant is crossed with a green. wrinkled seeded plant. What percentage of the Fi generation are recombinants? fe. m WE \ 217 Enthrablastosisfotalis scurs when a), Mother is R" positive and baby is R" negative. Coy” Mother is R® negative and baby is RP positive ‘¢) Both mother and baby are R negative 4) Both mother and baby are R* positive €) Allofthe above statements are true 2oz 18, The genotype of normal male humans is apdeXX = When & Mack female was mated with a ginger of black male and tortoise-shell fernale kittens be expected in the F: generation? male: 2 tontoise-shell females wer male: { tortoise-shell fernale: 1 Black female Trortoise-shell female: | ginger female d) Lbisg¥apiale: 1 tortoise-shell female: 1 ginger female! | black female ) bg males: | tortoise-shell female: | black female Nursing Craze Preparation Center @Nursing Craze MERITORIOUS | 021-34522222 | www.meritorious & Education Centre | 0348-111.3333 | fb.com/mentotiousnetworka sessive wi inant phenotype of character P and the rect 20 Apron a i har pure Ta Phere Oe otype arrcharacter P and the dominant phenotype of Q. The offspring 0 ia ees eet ae Sith a double homozygous recessive for P and Qand the following results obtained: 35 were phenotypically domninant for P and rece $ were phenotypically dominant for both P and Q. 4 were phenotypically recessive for both P and Q. 24 were phenotypically recessive for P and dominant for Q. ssive for Q. Which one of the following types of inheritance is illustrated by these results? cA) -#éne linkage of Pand Q 3) independent segregation of P and Q ) Mendelian dihybrid inheritance d) multiple alleles cc) polygenic inheritance 2014 21. Flower color is controlled by a single pair of alleles. The allele for red floyeh : re dominant to the allele for white flowers. ‘ A plant homozygous for red flowers is crossed with a plant homozy. 20H for white flowers. All the resulting plants have red flowers (FI generation)@ “2” When the FI generation are crossed with cach other, 18 plantgareabiained. 12 plants have red flowersand 6 have white flowers (F2 generation). %~ s What ay, ; Sar : expected in the F2 generation and whatrAtie has been obtained? Ca pected ratio red towhite obtained rim fed to white a) It ate b) A gor oe ie 3 (oF aS! the male is the homogametic ‘sex. A male bird showing the recessive trait was ‘with a female showing the dominant trait af'a characteristic poverned by a pair 2 Sef 2 Nursing Craze Preparation Center @Nursing Craze2018 23, The diagram shows the inheritance of hemophilia in a family hey to phenotype: CO normal femsic OQ hacnophiliae formats D. norms! mate haemoanilise male ; . & i bee 2 NYO Ss RS RSS < Nursing Craze Preparation Center Nursing Craze & MERITORIOUS 021-34522222 | www.meritorious ae on Education Centre | 248-111-3333 | fb.com/meritoriousnetworkste a certain substarice: The fe for the inability 1 20le 224 The faiy woe shows te i allele forthe obitty to taste this taste it ability to inheritance of the dominant to the alle’ bstance by fier ewrnn Ast generation Daud nd generation o 3rd generation vey BBL represents a male ‘taster’ @ represents a female ‘taster’ 7ygous dominant for one character and ~The other animal is heterozygous for both a ee Nursing Craze Preparation Center Nursing Craze www.meritorlo fb.com/meritoriousnet 021-3452: tletananaa | MERITORIOUS: & ‘e reau 26. In the pedigree of a family shown below, brown eyes are indicated as C)and blue ey@s — . Jawaria and Juhi are twins, From this chart, it can be determined that: Tahir Maryam Jawaria Juhi a) Tahjrarid Mary are homozygous for brown e waria and Juhi are identical twins S ) Juhi is heterpzygous for blue eyes ee ‘dF Buhi is homozygous for blue eyes eo ¢) Jawaria and Saad are tomon dy TOWN eyss a S SE ss Se € Nursing Craze @ursing CrazeJ. domeions I crossing a), Pachytene 17” Ay, Diplotone “ey Aygotene d) Diakinesis (Ad One extra chromasaune “by One less chromosome ) Two extra chromosome d) Two lest chiramoweune 2004 nS / ay Manosomic SBD Trisomic c) Disomic d) Nullisomie 4. A division without formatise of spindle is oy Mitosis eZ by Meiosis } Amitosis ) Kary hinesis 2008 $. An mitosis the no. of chy ) On “by on ce) 12n d) none ‘ ('¢ www.meritorious.ae fb.com/meritoriousnetwork V ver takes place in 2. The person with Down's syndrome has 3. The condition in which there is ome extra chromanaene ts stage nes in daughter celld hse e/ fy J ue 021-34522222 0348-111-3333 } y mitotic divisions produce 12 cells" ria T , Nursing Craze Preparation Center Nursing Craze | MERITORIOUS f45 7. Reduction shivision in Meivsts is " oth Anaphinse 1 Sb Anaphae ©) Diukinesis W) Diplotene What does not take place in meiosis: A Chromosome multiplied on) of chromosomes, () “Mroduction of hormones ) Production of enzymes Ss 20 % 1 wut sub-stige of: Ss ws Teenie Se S C® Prophave | 6 d) Metaphase i. Ss e) All of the above ombination of XXY oi results in: fe #' Down’ wis syndrome Nursing Craze Preparation Center Nursing craze sis pete a TE i spree @ MERITORIOUS | 021-34522222 | www.meritoric ® Education Centre | 020-111-3333 | fo.com/mortoriousses of mitosis! 201d Logr@everts shown below ceur during different pha’ 1. spiralization of DNA 1 i Hydration of DNA Ii, centromeres split IV, centromeres attach to spindle fibres V, DNA replicatey Which one ofthe following correetly identifies each of the phases described? interphase prophase metaphase anaphase telophase 4 " uM Vv v. oI v Vv " MW v \ V Mm Wl & au Vv I im v S ov Vv \ " nm a & Nursing Craze Preparation Center Nursing Craze 21-248a7202 Race US lon Centr:aaa 13, The diagrams below show chromosomes in 2 cell undergoing wittet and i ¢ ox! ——— undergoing meiosis. Which of the following names the stapes. of Greisiee: correstiy? Nursing Craze Preparation Center & MERITORIOUS | ozt-seszzzz2 a me@ritorices 2 } oaee-191-2233 Ban Education Centre17. The dimers dheewrs 4 celi' pt anaphase | ef rmetcmit AIS {GC g-«x \ ml ) AFA if wer ——— Which dingrart shores a normal gamete that ‘could be produced from this cell? Nursing Craze Preparation Center Nursing Craze MERITORIOUS | 021-34522222 | www.meritorious.i eau Centre | 0346-111-3333 | fb.com/meritoriousnatwo18, During whieh stage of meiosis do centromeres divide? 'a) Prophase ! 7 Metaphase | —Prophase It Vie ‘Metaphase I f oe X contains 24 chromosomes. It divides By mitosis to produce cells Y and Z. a) 12 24 46 d) 48 ee a): Milosis ion known as crossing-over occurs during: P Meiosis {Soy Geographic distribution 4) Active transport Nursing Craze Preparation Center Chins www.meritorious. =. MERIT {b.com/meritoriousnetwork erence Edi aro! lous’ ceaton tone, oe2000 complementary mRNA for the DNA triplet GAT would read: ow a) CTA — bPcua ©) CTG dy CTC 2001 following may cause mutation: a) Malaria b) Tuberculosis (©) Ultra violet rays d) Colchicines ich one of the following is not immediately essential for protein synthesis? ATP b) Enzyme Glucose Ss d) mRNA SY 2002 - ‘a)_ Single bond (8) Double bond ©) Triple bond d) Covalent bond aS 5. Thetotal Autosomes in human . ee : S 6. The results, staged isjunction are: a) ‘syfidrome ‘Tilmmer Syndrome ‘liiefelter syndrome AIL of the abave e2F Beet « . Y& Nursing Craze Preparation Center @Nersing Craze g& MERITORIOUS | 021-34522222 | www.meritorious.a S& Education Centre | 9348-111-3333 | {o.com/meritoriousnetwor‘Questions 1\""" 14. T¢fieteell 16 comtain the diploid number of chromosomes is: a 2 (3 4 86 0% 15, a-éale gamete containing the monoploid (haploid) number oFeirefnosomes is (7p 2 < x “by 3 4 ds 8 2018 16 uring the formation of an ovum, poftetisjunction of the sex chromosomes occurred. The ovum was then fertilized bynemal, Y-bearing sperm cell. Which one of the following shows the sex chromospme complement of the resulting zygote? 8) XO eo Nursing Craze Preparation Center Nursing Craze ww.meritorious.ae 1.com/meritoriousnetwork 021-34522222 | MERITO) , 0348-111-3333 | ddueahion retoned &zoos 4. The-tiumber of chromosomes in man is: 2 at th by 4 fey 46 d f 2007 8. ation of MRNA from DNA is called: % a). Translation by’ Transcription c) Genetics d) Mutation _ 9/n sickle cell anemia: a > a) Valine is replaced by Glutamic acid (°by) Glutamic acid is replaced by Valine ¢) Glutamic acid is replaced by Adenine -* 4) B-chain is replaced by Valine“ Ss . g 19 Which of the following is replaced by thymine? Ss Ca Uri SS) b) Cytosine & cS eae s carbon of pentase 12. In atypical ruc irogenous base is attached to Nursing Craze Preparation Center @Nursing Craze www.moritorlo e fb.com/meritoriousne ork lowes | MERITORIOUS gpOL 1A Aathty abu fy Hetor ehvoriatin ©) Nucleowome d) Super coils ©) None of the above: 2012 are ented 14, Cells thom a bacterial clone were grown for many generations on a medivm in which _AIF the nitrogen compounds contained only the isetope nitrogen 18 (UN). Adenine —— comprised 36% of the nitrogen bases present. A sample of these bacteria was transferred to a medium in which the only nitrogen source was !4 and was provided With conditions suitable for axexual reproduction, What wav the percentage of guanine cli, the DNA? Cay 14% b) 18% ©) 28% d) 36% ©) 64% 15 Pom has pairs of chromosome, aw 23 b) 40 Coy 500 oe Ss 16, Aff anti-codon is the seq a) complementary st b) complement the nitrogenous bases on the INA which codes for one amino acid, OfMRNA which codes for one amino acid. here the amino acid is sttached which recognizes the appropriate sequence of bases on the mR lecule which instructs the ribosomes to initiate protein synthesis Nursing Craze Preparation Center @Nursing Craze MERITORIOUS | 021-34522222 | wav & Education Centre | 0340-111.3343 mimeritodoustenee {b.com/meritoriousnetworlJ 10 find the number of of the results are 4p was analyzed leotide: strands. Son A WO base pair to asigon piece af DN 1 af the polynue sin eae below scrandt cs Ae = Strand 2 lt _ al 1"? How many nucleotides containing guanine were present in strat a 2 3 ed do 18. ive different amine acids (numbered 1-5 below) form the following sequence in part fa poly rertie chain: 1-2-3-4-2. Messenger fo (mRNA) codons w Amino acid 1 UGU Aminoacid 2 GAU Amino acid 3 CAC Aminoacid 4 UAG Aminoacid 5 AAG hich corresponds to these amino acids are “— Fo Which one of the following DNA base sequences couldy prac the code for the given \ section of polypeptide? a) ACACTTGIGATGCTATTCGTG b) ACACUAGUGAUGCUAUUCGUG ¢) ACACTAGTGATGCTAAACGTSS) CB) ATACTAGIGATCCTATTC %) CACATCUTUCTUATCT! ee ‘The phzyme used todiatie DNA is: Nursing Craze Preparation Center @Nursing Craze 021-34522222 thowiiois | Euucaton Centre Itorlo ‘Comimeritoriousno ork=U. Sew Dom babies are screened for the presence of high levels of the am: oO acid pheny in the blood, which indicates the hereditary disease pheny!kctonuria P; color is also the indication of sufferers from this disease. The following series of reactions occurs in normal metabolism. enzyme 1 enzyme 2 enzymes protein —_> phenylalanine > rrrosine > other metabolites engine 4 melanin Which enzyme is lacking in persons with phenylketonuria? a) 1 2 ce) 3 a s annie ees normal and sickle cell hemoglobin a ‘Norma! hemoglobin sickle cell hemoglobin the - pro - glu ~ glu thr — pro—val-glu oe Uh % : formation of this part 3) UGC ee c& 4d) GAG SF 22. Which of the fe ‘statements, sorrectly describes homologous chron ae Sin a) They during meiosis —— together by centromeres ‘chromatids of the same chromosome QgGeta totinentateriety similar members with same set of genes Sgn meee ges us | 021-34522222 Education Centre | 0348-111-3333fibed from the DYN 20) 2 Which of the following RRNA sequences would be transe sequence ATGCCTAGGAC? it og ay TACGGATCCTG aye ne Ay UAGCGAUCCUG tae WA . K c CH 9) AUGCCLAGE yay UACGGAUCCUG Sey GCAUUCGAAGU 24, The below diagram illustrates 29-8 sath Has a 1" ub bi ur ry maou oe an &E SC Bh 19 20 2 a) Hemophitla b) Phenytketonuria ¢) Sickle coll anemia Down's Syndrom on Genetic information, in thd DNA is encoded as re a) Deoxyribosestipats Ali 2 AL 2 Ribbose sugaty”” wenge ot itrogenous bases ’ Sewers phosphate group Nursing Craze Preparation Center Nursing Craze 021-34522222 0348-111-3333 tree www,meritoriou fo. ‘com/meritorlousnatwarkTopic: Chapter NO.5 GROWTH AND DEVELOPMENT 2000 1. Mesoderm gives rise 10: a) Lens of the eye 8) Teeth enamel \ gativer Gican 2002 2,,7_____ germinal layer give raise all the body muscles: a) Ectoderm by Endoderm /®) Mesoderm ‘d) Chorion 3 The science of aging is called: a) Ethonology @® Gerontology <) Embryology d) Genetics 2003 i foderm give rise to _____ 4. b) Vascular system © Nervous system d) Digestive system Soit faging is called ‘paca oS ee » Entomology SS” (Ce) Gerontology S & @) Parasitolony ~ 6. Acfording way Mick the aging is due t Cell fithetion 10 loss of Nursing Craze Preparation Center Nursing Craze MERITORIOUS & Education Centre ..x. (021-34522222 0348-111-3333 www.meritorlous oriousnetwork3s 2008 7. In chick embrya,the space between two layers is: ‘oelome Hlastocoe! ~~ @) Primitive Streak dy Gasrocoel 201 Aen localization is a consequence of 44) Fertilization $ by) Cleavage > ¢) Morula ws d) Blastula Oo ¢) Gastrula & egg of a chick is laid at which ae ing stages? a) os Cb) blastula ¢) cleavage d) morula ¢) “Ss ay/ - x Nursing Craze @ursing Craze