Effects of hydrogen-rich water on antioxidant

capacity, meat quality and cecum mic robiota of

broiler chickens
He Zhu
Nanjing Agriculture University
Haiyan Yang
Shanghai Jiao Tong University
Wen Yao
Nanjing Agriculture University
Weijiang Zheng (  zhengweijiang@njau.edu.cn )
Nanjing Agriculture University

Research Article

Keywords: Hydrogen-rich water, Broiler, Growth performance, Antioxidant capacity, Meat quality, Cecum
microbiota

Posted Date: July 5th, 2023

DOI: https://doi.org/10.21203/rs.3.rs-3127640/v1

License:   This work is licensed under a Creative Commons Attribution 4.0 International License.
Read Full License

Page 1/26
Abstract
Background: Hydrogen-rich water, which contains a high concentration of dissolved hydrogen gas,
exhibits numerous advantageous properties, including anti-inflammatory, antioxidant, and metabolic
regulatory functions. Its exceptional biosafety renders it highly promising for implementation in
agricultural production, particularly in light of the growing concern for food safety. The aim of this study
was to evaluate the effects of drinking hydrogen-rich water on broiler growth performance, antioxidant
capacity, meat quality, and cecum microbiota, with the objective of assessing its potential as a beneficial
component in broiler production. Broilers were provided either hydrogen-rich water or regular taping water
throughout the experimental period of 1 to 42 days. On day 42, six birds from each treatment group were
selectively chosen for slaughter and subsequent dissection.

Results: The results indicated that the administration of hydrogen-rich water had no significant effect on
the growth performance of broilers. However, compared to the control group, the broilers receiving
hydrogen-rich water group exhibited significantly higher levels of serum total antioxidant capacity (T-
AOC) and superoxide dismutase activity (T-SOD). Moreover, the hydrogen-rich water group displayed
significantly lower levels of reactive oxygen species (ROS) and malondialdehyde (MDA) in the liver, along
with significantly higher catalase activity (CAT) compared to the control group. Regarding meat quality,
the hydrogen-rich water group showed a significantly lower shearing force of chicken breast compared to
the control group. Additionally, the proportions of leucine, lysine, and essential amino acids in chicken
breast meat were significantly higher in the hydrogen-rich water group. Conversely, the percentage of
undecanoic acid in chicken breast meat was significantly lower in the hydrogen-rich water group
compared to the control group. Furthermore, the percentages of palmitoleic acid, oleic acid, erucic acid, γ-
Linolenic acid, α-Linolenic acid, and monounsaturated fatty acids in chicken breast meat were
significantly higher in the hydrogen-rich water group compared to the control group. In terms of cecum
microbiota, no significant differences were observed between the two groups in terms of α diversity, β
diversity, and phylum species composition. However, at the genus level, the relative abundance of
Mediterraneibacter, Kineothrix, Roseburia, Stenotrophomonas, and Proteobacteria_Unclassifiedin the
hydrogen-rich water group was significantly higher compared to the control group. On the other hand, the
relative abundance of Ralstoniaand Symbiobacterium was significantly lower in the hydrogen-rich water
group compared to the control group.

Conclusion: In summary, the results of this study highlight the beneficial effects of hydrogen-rich water
on antioxidant parameters in the serum and liver of broilers. It also suggests its potential improving the
quality and composition of amino acids and fatty acids in broiler breast meat. Additionally, hydrogen-rich
water appears to have a significant impact on the cecum microbiota of broilers.

Introduction
Hydrogen, as the most abundant chemical element in nature, primarily exists as a colorless, odorless, and
tasteless gas at standard temperature and pressure. Historically, hydrogen has been predominantly

Page 2/26
studied and utilized for its applications in energy-related fields, as it was considered physiologically
inert[1]. In 1975, Dole et al. conducted a study that discovered the therapeutic effects of hydrogen on
squamous cell carcinoma in mice[2]. Subsequently, Ohsawa et al. reported in 2007 that hydrogen can
function as a selective antioxidant by specifically reducing cytotoxic oxygen radicals in a mouse model
of ischemia-reperfusion[3]. These seminal studies have paved the way for further investigations into the
biological effects of hydrogen. Subsequently, a growing body of literature has revealed the antioxidant,
anti-inflammatory, anti-apoptotic, gene expression modulating, and signaling pathway regulating
properties of hydrogen[4]. Numerous studies have delved into these diverse facets of hydrogen and its
potential therapeutic applications. To administer hydrogen to animals, various methods have been
employed, including inhalation of hydrogen gas[5], injection of hydrogen solution[6], and ingestion of
hydrogen-rich water[7]. Among these methods, the consumption of hydrogen-rich water has gained
significant attention due to its simplicity, cost-effectiveness, and safety. The process of obtaining
hydrogen-rich water through the waster electrolysis is straightforward, making it a viable option for
implementation in livestock production.

In a previous study conducted by our research team, we investigated the effects of hydrogen-rich water
on piglets fed Fusarium toxin-contaminated diets. Our results demonstrated the beneficial effects of
hydrogen-rich water on growth performance with reduced oxidative damage observed[8]. Furthermore,
hydrogen-rich water was found to protest against intestinal morphological damage, preserve intestinal
barrier function, and inhibit apoptosis of small intestinal epithelial cells[9]. Additionally, hydrogen-rich
water played a role in maintaining imbalances within the intestinal microbiota[10]. These findings
highlight the potential of hydrogen-rich water as a protective intervention against the detrimental effects
of Fusarium toxin exposure in piglets. Another study conducted by Azad et al.[11] reported the positive
impact of hydrogen-rich water on broilers experiencing heat stress, alleviating oxidative damage and
improving growth performance. Furthermore, other studies have shown that hydrogen-rich water can
enhance the antioxidant capacity of broilers[12]. Chicken breast, known for its high nutritional value,
specifically its protein content and low-fat composition, holds great significance in broiler production.
Moreover, chicken breast is versatile and widely used in various culinary applications, making it popular
in the catering industry. Considering the importance of breast meat quality, as it directly influences
consumer preferences, it is essential to explore the effects of hydrogen-rich water on broiler meat quality.
However, no previous studies have investigated the impact of hydrogen-rich water on broiler meat quality.
Therefore, the objective of this study is to examine the effects of drinking hydrogen-rich water on broiler
growth performance, antioxidant capacity in blood and liver, meat quality, and cecum microbiota. The
findings of this study aim to provide a theoretical foundation for the application and promotion of
hydrogen-rich water in broiler production.

Materials and methods

Experimental materials

Page 3/26
The hydrogen production machine (NB-X71F) and hydrogen pressurization machine (NB-HS71A) were
acquired from Shanghai Nanobubble Technology Co., Ltd. The hydrogen production machine utilizes the
process of electrolysis on pure water to generate hydrogen. Subsequently, the hydrogen pressurization
machine is employed to increase the pressure, resulting in the production of hydrogen-rich water. This
hydrogen-rich water is then connected to the drinking water pipes of the broilers, enabling them to
consume it freely as their drinking water source.

Animal and experimental design

A total of 240 healthy male AA broilers, aged 1 day, were randomly assigned to two groups with 6
replicates per group. Each replicate consisted of 10 chickens, and the allocation was based on similar
body weights to ensure uniformity. The control group was provided with normal water, while the
experimental group received hydrogen-rich water. Throughout the experiment, the broilers had ad libitum
access to feed and water. The commercial feed utilized in this trial was purchased from Beijing
Dabeinong Technology Group Co., Ltd. The composition and nutrient levels of the diet are outlined in
Table 1. The trial was conducted over a duration of 42 days.

Page 4/26
 Table 1
Composition and nutrient levels of the experimental diets
Feeding period 1-21d 22-42d

Ingredients (%)

Corn 60.175 50.795

Soybean meal 31.3 25.5

Cottonseed meal 2 1.5

Soybean oil 1.5 6.6

Calcium hydrogen phosphate 1.3 0.7

Limestone 1 0.8

Corn gluten meal 0.6

Lysine sulfate 0.56 0.56

Pre-period premix 1

Methionine 0.29 0.25

Salt 0.26 0.28

Antioxidant 0.015 0.015

corn germ cake 12

Mid-term premix 1

Total 100 100

Nutrients levels

Moisture content (%) 12.53 11.85

Crude protein (%) 21.51 19.94

Ether extract (%) 4.37 9.89

Crude Ash (%) 5.44 4.72

Note: The Pre-period premix premix provided the following per kg of diets: vitamin A, 13500 IU;
vitamin D3, 3300 IU; vitamin E, 30 IU; vitamin K, 3.0 mg; vitamin B1, 3.0 mg; vitamin B2 9.0 mg;
vitamin B6, 6.0 mg; vitamin B12, 0.03 mg; biotin, 0.15 mg; pantothenic acid, 18 mg; niacin, 65 mg;
folic acid, 1.5mg; choline chloride, 450 mg; Fe, 60 mg; Mn, 98 mg; Zn, 82 mg; Cu, 60 mg; I, 1.5 mg; and
Se, 0.3 mg.

The Mid-term premix premix provided the following per kg of diets: vitamin A, 11250 IU; vitamin D3,
3300 IU; vitamin E, 25 IU; vitamin K, 2.5 mg; vitamin B1, 2.5 mg; vitamin B2 7.5 mg; vitamin B6, 5.0
mg; vitamin B12, 0.025 mg; biotin, 0.12 mg; pantothenic acid, 15 mg; niacin, 55 mg; folic acid, 1.3mg;
choline chloride, 350 mg; Fe, 60 mg; Mn, 98 mg; Zn, 82 mg; Cu, 100 mg; I, 1.5 mg; and Se, 0.3 mg.
Page 5/26
 Feeding period 1-21d 22-42d

Crude fiber (%) 3.33 3.47

Neutral detergent fiber (%) 10.42 12.11

Calcium (%) 0.87 0.65

Total phosphorus (%) 0.69 0.63

Available phosphorus (%) 0.39 0.28

Salt (%) 0.25 0.27

Potassium (g/kg) 8.82 7.37

Sodium (g/kg) 0.6 0.38

Chlorine (mg/kg) 0.46 0.53

Lysine 1.27 1.15

Methionine 0.58 0.52

Methionine + Cysteine 0.91 0.82

Note: The Pre-period premix premix provided the following per kg of diets: vitamin A, 13500 IU;
vitamin D3, 3300 IU; vitamin E, 30 IU; vitamin K, 3.0 mg; vitamin B1, 3.0 mg; vitamin B2 9.0 mg;
vitamin B6, 6.0 mg; vitamin B12, 0.03 mg; biotin, 0.15 mg; pantothenic acid, 18 mg; niacin, 65 mg;
folic acid, 1.5mg; choline chloride, 450 mg; Fe, 60 mg; Mn, 98 mg; Zn, 82 mg; Cu, 60 mg; I, 1.5 mg; and
Se, 0.3 mg.

The Mid-term premix premix provided the following per kg of diets: vitamin A, 11250 IU; vitamin D3,
3300 IU; vitamin E, 25 IU; vitamin K, 2.5 mg; vitamin B1, 2.5 mg; vitamin B2 7.5 mg; vitamin B6, 5.0
mg; vitamin B12, 0.025 mg; biotin, 0.12 mg; pantothenic acid, 15 mg; niacin, 55 mg; folic acid, 1.3mg;
choline chloride, 350 mg; Fe, 60 mg; Mn, 98 mg; Zn, 82 mg; Cu, 100 mg; I, 1.5 mg; and Se, 0.3 mg.

Feeding management and sample collection

In this trial, the broilers were housed in a stepped system, and proper disinfection procedures were
implemented. The broilers were also immunized following standard protocols. Daily feed intake was
recorded throughout the duration of the trial. At both day 21 and day 42, the body weight of each bird was
measured and documented. On day 42, one broiler from each replicate was selected based on their
weight, aiming to choose the bird closest to the mean weight of the respective replicate. Blood samples
were collected from the subwing vein, and subsequently, the selected broilers were slaughtered. The
collected blood and liver samples were used for subsequent antioxidant measurements. Breast muscle
samples were obtained for assessments related to meat quality, as well as the measurement of amino
acid and fatty acid composition. Furthermore, cecum chyme samples were collected for microbiological
analysis.

Growth performance

Page 6/26
The average body weight (BW), average daily gain (ADG), average daily feed intake (ADFI), and feed-to-
weight ratio (F/G) were calculated based on initial BW, BW at day 21, BW at day 42, and food intake.

Antioxidant capacity
The levels of reactive oxygen species (ROS) and malondialdehyde (MDA), as well as the enzyme
activities of total superoxide dismutase (T-SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and
total antioxidant capacity (T-AOC) in both serum and liver samples were measured using specific test
kits.The ROS kit was purchased from Jiangsu Meimian Industrial Co., Ltd, while the remaining kits for
measuring T-SOD, GSH-Px, CAT, MDA, and T-AOC were obtained from Nanjing Jiancheng Bioengineering
Institute.

Determination of meat quality, amino acids, and fatty acids

The pH measurements were conducted using the PH-star instrument (Matthaus, Germany), while the
color of the breast was assessed using the precision colorimeter CR18 (Kemei Runda, China). Shear force
was determined using the C-LM3B digital display muscle tenderness meter (Northeast Agricultural
University, China). Drip loss and cooking loss were measured by hanging and cooking the breast,
following the method described by Carvalho[13], For amino acid determination, pre-treatment procedures
were performed according to the method outlined by Adeola et al.[14]. The analysis of amino acids was
carried out using the LA-8080 Hitachi fully automatic amino acid analyzer (Hitachi, Japan). Regarding the
determination of fatty acids, pre-treatment was conducted following the procedure described by
Figueiredo et al.[15]The analysis of fatty acids was performed using the TRACE 1310 gas chromatograph
(Thermo, Germany) equipped with the TG-FAME column (Thermo, Germany).

Determination of short-chain fatty acid concentration in

cecum chyme
Approximately 0.2 g of cecum chyme sample was weighed and then mixed with 1 ml of sterile ultrapure
water. The mixture was vortexed to ensure thorough mixing. Subsequently, the supernatant was obtained
by centrifuging the mixture at 12,000 rpm for 15 minutes.From the supernatant, 700 µL was extracted
and combined with 140 µL of a metaphosphoric acid/crotonic acid mixture. The resulting mixture was
vortexed to ensure proper mixing and then centrifuged once again at 12,000 rpm for 10 minutes.The
supernatant obtained after centrifugation was filtered through a 0.22 µm aqueous needle filter. The
filtered supernatant was then injected into a column (No. 34292-07B, Supelco, USA) using a 1 µL
microsampler.The concentration of short-chain fatty acids was determined using a GC-14B
meteorological chromatograph (Shimadzu, Japan). This analytical technique allows for the accurate
measurement and quantification of short-chain fatty acids present in the cecum chyme sample.

DNA extraction and 16S rRNA sequencing of cecum chyme

microbiota

Page 7/26
DNA was extracted from six samples of each of the two groups of cecum chyme strictly according to the
instructions by using QIAamp® PowerFecal® Pro DNA Kit(Qiagen, Germany), DNA concentration and
purity were determined using an ultra-micro spectrophotometer (Nano-drop Technologies, USA).

The extracted DNA samples were sent to Shanghai Biozeronbiotechnology Co., Ltd. for 16S rRNA
sequencing. The 16S V3-V4 region was amplified using the primer set 338F
(ACTCCTACGGGAGGCAGCAG) as the upstream primer and 806R (GGACTACHVGGGTWTCTAAT) as the
downstream primer. Three independent PCR amplifications were performed for each sample, and the
resulting amplicons were then mixed together. The PCR products were purified using the AxyPrep DNA Gel
Extraction Kit, and their concentrations were quantified using a Quantus™ Fluorometer. The purified PCR
products were normalized to the appropriate sequencing volume for each sample. Libraries were
constructed using the NEXTFLEX Rapid DNA-Seq Kit, and sequencing was carried out on Illumina's
NovaSeq PE250 platform. Upon completion of sequencing, the raw sequence data underwent quality
control using the fastp software (https://github.com/OpenGene/fastp, version 0.20.0). The sequences
were then merged using the FLASH software (http://www.cbcb.umd.edu/software/flash, version 1.2.7) to
obtain full-length sequences. The ASV (amplicon sequence variant) sequences were generated using the
DADA2 ASV method based on Qiime2. Each sequence was assigned a species classification using the
RDP classifier (http://rdp.cme.msu.edu/, version 2.2) and compared against the Silva 16S rRNA database
(v138) with a comparison threshold set at 70%. Taxonomic analysis of the ASV representative sequences
was performed using the uclust algorithm. The community composition of each sample was determined
at each taxonomic level, allowing for subsequent analysis of the microbial community structure..

Statistical analysis
The data were initially compiled using Microsoft Office Excel 2019. Growth performance, serum and liver
antioxidant capacity, meat quality indicators, and concentrations of short-chain fatty acids were
subjected to independent samples t-test using IBM SPSS Statistics 25. A significance level of P < 0.05
was used to determine statistical significance, while P > 0.05 indicated a lack of statistical significance,
and 0.05 < P < 0.1 suggested a trend of change. Furthermore, a significance level of P < 0.01 was used to
denote a highly significant difference.The data are presented as "Mean ± Standard Deviation (SD)". The
relative abundance of cecum microbiota at the phylum and genus levels between the two groups was
analyzed for differences and identified as differential microbiota using non-parametric tests. Further
analysis of microbial data was conducted using the OmicStudio tool available on the LianChuan
BioCloud platform (https://www.omicstudio.cn/tool/). Alpha and beta diversity, as well as species
composition, were analyzed. Microorganisms from phylum to genus levels between the two groups were
subjected to LEfSe (Linear discriminant analysis Effect Size) analysis to identify differential bacteria with
an LDA (Linear Discriminant Analysis) score greater than 3 as the criterion. Functional prediction was
performed based on the PICRUSt2 results. Species composition and differential microbial histograms at
the alpha diversity, phylum level, and genus level were generated using GraphPad Prism 8. Additionally,
Spearman correlation analysis was conducted to examine the relationship between differential microbial
genera and relevant indicators, and heat maps were created.

Page 8/26
Results
Growth performance
Table 2 presents the results of the effects of hydrogen-rich water on the body weight (BW), average daily
gain (ADG), average daily feed intake (ADFI), and feed-to-weight ratio (F/G) of broilers at different stages.
The statistical analysis revealed that the consumption of hydrogen-rich water did not have a significant
effect (P > 0.05) on these growth performance parameters.

Table 2
Effects of hydrogen-rich water on growth performance of broilers
Items CTR HRW P-value

Body Weight (g)

Day1 (g) 49 ± 1 49 ± 1 0.555

Day21 (g) 892 ± 25 900 ± 45 0.722

Day42 (g) 2873 ± 166 2938 ± 108 0.445

ADFI (g/d)

Day1-Day21 57.23 ± 3.19 57.62 ± 3.96 0.855

Day22-Day42 150.54 ± 5.35 150.26 ± 10.16 0.955

Day1-Day42 105.04 ± 8.36 105.07 ± 6.18 0.994

ADG (g/d)

Day1-Day21 40.47 ± 1.50 40.82 ± 1.00 0.644

Day22-Day42 90.66 ± 5.48 92.49 ± 8.40 0.665

Day1-Day42 73.98 ± 2.49 76.25 ± 2.09 0.117

F/G

Day1-Day21 1.41 ± 0.07 1.41 ± 0.10 0.974

Day22-Day42 1.67 ± 0.14 1.64 ± 0.19 0.774

Day1-Day42 1.42 ± 0.11 1.38 ± 0.07 0.451

Effect of hydrogen-rich water on antioxidant capacity of

broilers
Table 3 displays the activity of total superoxide dismutase (T-SOD) in serum and total antioxidant
capacity (T-AOC) of serum in broilers from the HRW group and the CTR group. The statistical analysis
revealed that the HRW group exhibited significantly higher T-SOD activity in serum and T-AOC compared

Page 9/26
to the CTR group (P < 0.05). These findings suggest that hydrogen-rich water supplementation positively
influenced the antioxidant capacity in the serum of broilers.

Table 3
Effects of hydrogen-rich water on serum antioxidant capacity of broilers
Items CTR HRW P-value

ROS (pg/ml) 149.74 ± 13.9 141.28 ± 14.73 0.330

MDA (nmol/ml) 2.59 ± 1.09 2.17 ± 0.93 0.495

T-SOD (U/ml) 79.7 ± 27.44b 124.81 ± 26.41a 0.016

T-AOC (mmol Trolox/L) 0.35 ± 0.07b 0.48 ± 0.08a 0.013

GSH-Px (U/ml) 225.09 ± 42.81 245.6 ± 35.84 0.389

CAT (U/ml) 3.92 ± 2.25 3.63 ± 2.29 0.831

Table 4 presents the data on the levels of ROS and MDA in the liver of broilers in the HRW group and the
CTR group. The statistical analysis reveals that the HRW group exhibited significantly lower levels of ROS
and MDA in the liver compared to the CTR group (P < 0.05). This indicates that the consumption of
hydrogen-rich water had a beneficial effect on reducing oxidative stress and lipid peroxidation in the liver
of broilers, as evidenced by the decreased levels of ROS and MDA.

Table 4
Effects of hydrogen-rich water on liver antioxidant capacity of broilers
Items CTR HRW P-value

ROS (pg/mgprot) 11.79 ± 0.93a 10.32 ± 1.18b 0.038

MDA (nmol/mgprot) 0.54 ± 0.10a 0.38 ± 0.08b 0.014

T-SOD (U/mgprot) 121.42 ± 10.80 115.88 ± 15.01 0.481

T-AOC (mmol Trolox/gprot) 19.90 ± 8.06 18.70 ± 11.33 0.840

GSH-Px/ (U/mgprot) 18.75 ± 3.65 19.69 ± 3.94 0.677

CAT (U/mgprot) 14.65 ± 5.16 23.89 ± 5.61 0.014

Effect of hydrogen-rich water on meat quality, composition of amino acid and fatty acid in breast of
broilers

Table 5 illustrates the results of the shear force measurement on chicken breast meat, indicating that the
HRW group exhibited significantly lower shear force compared to the CTR group (P < 0.05). This implies
that the consumption of hydrogen-rich water contributed to improved tenderness of the chicken breast
meat.In Fig. 1, the proportions of leucine and lysine in chicken breast meat were significantly higher in the

Page 10/26
HRW group compared to the CTR group (P < 0.05). Moreover, the proportions of non-essential amino
acids were significantly lower, while the proportions of essential amino acids were significantly higher in
the HRW group (P < 0.01). These findings suggest that hydrogen-rich water intake influenced the amino
acid composition of chicken breast meat, enhancing the levels of specific essential amino acids. Figure 2
presents the fatty acid composition of chicken breast meat. The proportion of undecanoic acid (C11:0) in
the HRW group was significantly lower than that in the CTR group (P < 0.01). Additionally, the proportion
of erucic acid (C22:1n9) was significantly higher in the HRW group (P < 0.05). Furthermore, the
proportions of palmitoleic acid (C16:1), oleic acid (C18:1n9c), γ-linoleic acid (C18:3n6), α-linoleic acid
(C18:3n3), and monounsaturated fatty acids (MUFA) were significantly higher in the HRW group
compared to the CTR group (P < 0.01). These results indicate that hydrogen-rich water consumption
influenced the fatty acid composition of chicken breast meat, promoting the presence of certain
beneficial fatty acids while reducing the levels of specific fatty acids. Overall, the findings highlight the
positive impact of hydrogen-rich water on the tenderness, amino acid composition, and fatty acid profile
of chicken breast meat.

Table 5
Effects of hydrogen-rich water on meat quality of broilers
Items CTR HRW P-value

Lightness, L* 45min 42.95 ± 1.75 42.18 ± 1.24 0.399

Lightness, L* 24h 44.73 ± 0.14 45.49 ± 0.53 0.363

Redness, a* 45min 1.01 ± 1.45 1.01 ± 1.06 0.983

Redness, a* 24h 0.51 ± 0.83 0.31 ± 1.78 0.137

Yellowness, b* 45min 4.68 ± 0.28 4.43 ± 0.12 0.743

Yellowness, b* 24h 2.04 ± 0.83 2.46 ± 0.41 0.294

pH 45min 6.48 ± 0.12 6.40 ± 0.12 0.280

pH 24h 6.23 ± 0.15 6.14 ± 0.09 0.250

Drip loss 24h (%) 1.38 ± 0.63 1.53 ± 0.50 0.658

Drip loss 48h (%) 1.95 ± 0.69 2.24 ± 0.64 0.477

Cooking loss (%) 9.66 ± 2.00 9.29 ± 1.76 0.744

Shear force (N) 19.60 ± 1.15a 14.20 ± 1.60b < 0.001

Effect of hydrogen-rich water on concentration of short-

chain fatty acids in cecum chyme of broilers
Table 6 presents the concentrations of various short-chain fatty acids in broiler cecum chyme. The results
indicate that hydrogen-rich water did not have a significant effect (P > 0.05) on the concentrations of
Page 11/26
these short-chain fatty acids. However, there was a trend towards an increase in the concentration of total
short-chain fatty acids in broiler cecum chyme(0.05 < P < 0.1). Although this trend did not reach statistical
significance, it suggests a potential influence of hydrogen-rich water on the overall concentration of short-
chain fatty acids in the cecum chyme of broilers. Further investigation with a larger sample size may be
necessary to confirm this observation.

Table 6
Effects of hydrogen-rich water on concentration of short-chain fatty
acids in cecum chyme of broilers
Items CTR HRW P-value

Concentration (µg/ml)

Acetic acid 33.26 ± 6.14 34.62 ± 5.04 0.111

Propionic acid 6.47 ± 2.33 7.84 ± 1.66 0.151

Isobutyric acid 0.98 ± 0.02 1.14 ± 0.38 0.694

Butyric acid 6.20 ± 0.72 6.43 ± 1.94 0.160

Isovaleric acid 0.98 ± 0.13 1.21 ± 0.23 0.753

Valeric acid 1.22 ± 0.19 1.50 ± 0.58 0.598

Total SCFA 49.10 ± 7.08 52.74 ± 3.86 0.063

Effect of hydrogen-rich water on the microbial diversity of

broiler cecum
Figure 3 illustrates the impact of hydrogen-rich water on the α-diversity and β-diversity of broiler cecum
microbiota. In Fig. 3A, it is evident that hydrogen-rich water did not exert a significant effect on the four α-
diversity indices, namely Chao1, ACE, Shannon, and Simpson, of broiler cecum microbiota (P > 0.05).
Similarly, Fig. 3B demonstrates that hydrogen-rich water had no significant effect on the β-diversity of
broiler cecum microbiota (P > 0.05). These findings suggest that the introduction of hydrogen-rich water
did not result in substantial alterations in the diversity of the cecum microbiota in broilers.

Effect of hydrogen-rich water on the composition and relative abundance of microbiota in the cecum of
broilers

As depicted in the Venn plot (Fig. 4A), a total of 393 ASVs were found to be shared between the CTR and
HRW groups, with 1205 ASVs specific to the CTR group and 1085 ASVs specific to the HRW group.
Figure 4B displays the relative abundance of microbiota at the phylum level in the cecum of the two
broiler groups. The dominant phyla, defined as those with a relative abundance > 1%, included Firmicutes,
Proteobacteria, Bacteroidetes, and Verrucomicrobia. The relative abundance of each dominant phylum
did not show significant differences between the two groups (P > 0.05). At the genus level, dominant
genera were defined as those with a relative abundance > 1%, while the remaining genera were combined
Page 12/26
as Others. As presented in Fig. 4C, the shared dominant genera between both groups comprised Blautia,
Cronobacter, Bacteroides, Vibrio, Akkermansia, Barnesiella, Sporobacter, Salmonella, Escherichia,
Alistipes, Mediterraneibacter, Ligilactobacillus, Enterocloster, Phocaeicola, Eisenbergiella, Sellimonas,
Murimonas, Anaerobutyricum, Tidjanibacter, Acutalibacter, Faecalimonas, Anaeromassilibacillus,
Fusibacter, and Kineothrix, totaling 24 genera.

Among the dominant genera, the relative abundance of Kineothrix and Mediterraneibacter was found to
be significantly higher in the HRW group compared to the CTR group (P < 0.05). Upon adjusting the
screening range to a lower threshold of 0.1%, it was observed that the relative abundance of Roseburia,
Stenotrophomonas, and Proteobacteria_Unclassified in the HRW group was significantly higher than that
in the CTR group (P < 0.05). Conversely, the relative abundance of Ralstonia (P < 0.05) and
Symbiobacterium (P < 0.01) was significantly lower in the HRW group compared to the CTR group.

LEfSe(Linear discriminant analysis Effect Size) analysis was conducted to identify statistically different
biomarkers between the groups. The Cladogram evolutionary branching diagram (Fig. 5A) illustrates
bacteria at five taxonomic levels, phylum, class, order, family, and genus. Bacteria enriched in the CTR
group are indicated in red, while those enriched in the HRW group are indicated in blue. Figure 5B displays
the histogram of LDA (Linear Discriminant Analysis) values, where higher values indicate greater
abundance of bacteria in the respective group. The LEfSe analysis results revealed 14 groups with
significant differences between the two groups at the phylum, order, family, and genus levels. Specifically,
at the genus level, the abundance of Kineothrix, Mediterraneibacter, Roseburia, and Stenotrophomonas
was significantly higher in the HRW group compared to the CTR group (P < 0.05), while the abundance of
Massilimaliae and Symbiobacterium was significantly lower in the HRW group compared to the CTR
group(P < 0.05).

Effect of hydrogen-rich water on microbial metabolic

pathways in the cecum of broilers
The PICRUSt2 analysis revealed a significant impact of feeding hydrogen-rich water on the metabolic
pathways of broiler cecum microbiota at the KEGG Level 3 (Fig. 6). Among the top 20 metabolic
pathways in terms of relative abundance, several pathways exhibited notable differences between the
HRW group and the CTR group. Specifically, the following pathways showed significantly lower relative
abundance in the HRW group compared to the CTR group (P < 0.05): Citrate cycle, Carbon fixation
pathways in prokaryotes, Biosynthesis of siderophore group nonribosomal peptides, Base excision repair,
Valine, leucine and isoleucine degradation, Nitrogen metabolism, Huntington disease, Folate biosynthesis,
C5-Branched dibasic acid metabolism, beta-Alanine metabolism, Taurine and hypotaurine metabolism,
Nicotinate and nicotinamide metabolism, Limonene and pinene degradation, Inositol phosphate
metabolism, Glutathione metabolism, Biotin metabolism, Arachidonic acid metabolism, and Alzheimer's
disease. Additionally, the relative abundance of the PPAR signaling pathway and Peroxisome functional
gene expression was significantly lower in the HRW group compared to the CTR group (P < 0.01).

Page 13/26
Correlation analysis of different microbial genera of broiler cecum with antioxidant capacity and meat
quality index

In Fig. 7, the correlation analysis between different genera of microbiota in the cecum of broilers and
various indicators of serum antioxidant capacity and meat quality is presented. The following
correlations were observed: Mediterraneibacter in the cecum of broilers was significantly and positively
correlated with T-SOD and T-AOC in serum, the proportion of leucine, C16:1, C18:1n9c, C18:3n6, C18:3n3
in breast (P < 0.05), was highly significantly and positive correlated with MUFA (P < 0.01), and was
significantly and negatively correlated with shear force in breast (P < 0.05). Kineothrix in the cecum of
broilers was significantly and positively correlated with T-AOC in serum, the proportion of leucine, lysine,
essential amino acids, C16:1, C18:1n9c, C18:3n6, MUFA in breast (P < 0.05), and was significantly and
negatively correlated with nonessential amino acids in breast (P < 0.05). Roseburia in the cecum of
broilers was significantly and positively correlated with the proportion of leucine and lysine in breast (P <
0.05). Stenotrophomonas in the cecum of broilers was significantly and positively correlated with the
proportion of leucine in breast (P < 0.05). Ralstonia was highly significantly and negative correlated with
T-AOC in serum, was highly significantly and negative correlated with the proportion of leucine, lysine,
essential amino acids, C16:1, C18:3n6 in breast (P < 0.01). Proteobacteria_Unclassified was significantly
and positively correlated with the proportion of leucine in breast (P < 0.05). Symbiobacterium was
significantly and negatively correlated with T-AOC in serum, the proportion of leucine, lysine, C16:1,
C18:3n6 in breast (P < 0.05), was highly significantly and negative correlated with essential amino acids
in breast (P < 0.01), was highly significantly and positively correlated with nonessential amino acids in
breast (P < 0.01). In Fig. 7, the correlation analysis between different genera of microbiota in the cecum of
broilers and various indicators of serum antioxidant capacity and meat quality is presented. The
following correlations were observed: Mediterraneibacter in the cecum of broilers showed a significant
positive correlation with T-SOD and T-AOC in serum, as well as the proportions of leucine, C16:1,
C18:1n9c, C18:3n6, and C18:3n3 in breast (P < 0.05). It also exhibited a highly significant positive
correlation with MUFA (P < 0.01) and a significant negative correlation with shear force in breast (P <
0.05). Kineothrix in the cecum of broilers demonstrated a significant positive correlation with T-AOC in
serum, as well as the proportions of leucine, lysine, essential amino acids, C16:1, C18:1n9c, and C18:3n6
in breast (P < 0.05). It also showed a significant negative correlation with nonessential amino acids in
breast (P < 0.05).Roseburia in the cecum of broilers exhibited a significant positive correlation with the
proportions of leucine and lysine in breast (P < 0.05).Stenotrophomonas in the cecum of broilers
displayed a significant positive correlation with the proportion of leucine in breast (P < 0.05).Ralstonia
showed a highly significant negative correlation with T-AOC in serum and a highly significant negative
correlation with the proportions of leucine, lysine, essential amino acids, and C18:3n6 in breast (P <
0.01).Proteobacteria_Unclassified demonstrated a significant positive correlation with the proportion of
leucine in breast (P < 0.05). Symbiobacterium showed a significant negative correlation with T-AOC in
serum, as well as the proportions of leucine, lysine, C16:1, and C18:3n6 in breast (P < 0.05). It also
displayed a highly significant negative correlation with essential amino acids in breast (P < 0.01) and a
highly significant positive correlation with nonessential amino acids in breast (P < 0.01).

Page 14/26
Discussion
Previous studies conducted in both mammals and poultry have demonstrated the potential of hydrogen-
enriched water to mitigate the negative impact on growth performance induced by adverse external
factors[8, 11]. However, it is important to note that these studies primarily focused on animals
experiencing challenging physiological conditions. In the present experiment, broilers were subjected to
normal physiological conditions, and the findings align with existing research, suggesting that hydrogen-
rich water does not exert a significant effect on the growth performance of broiler chickens under such
conditions. It is worth mentioning that the potential of hydrogen-enriched water to alleviate the decline in
broiler growth performance resulting from health impairments remains an area that requires further
investigation and exploration. While the current study did not observe substantial effects on growth
performance under normal physiological conditions, it does not discount the possibility of hydrogen-rich
water exerting positive effects in situations where broilers are subjected to health-related challenges.
Therefore, future research should delve into the mechanisms underlying the potential beneficial effects of
hydrogen-enriched water in mitigating growth performance declines caused by health damage in broiler
chickens. Such investigations would provide valuable insights into the application of hydrogen-rich water
as a potential therapeutic approach in poultry farming practices.

Oxidative stress in broiler production can have detrimental effects on health, including reduced immunity,
intestinal damage, decreased nutrient absorption, and ultimately, impaired production performance. The
body's antioxidant capacity plays a crucial role in maintaining broiler health. Excessive accumulation of
ROS can lead to damage to cell membranes, proteins, and DNA, disrupting cellular functions[16], MDA, a
byproduct of lipid peroxidation, is a marker of oxidative stress and a toxic compound that can cause lipid
peroxidation in cell membranes[17]. T-SOD and CAT are two antioxidant enzymes that scavenge oxygen
free radicals and protect the body from oxidative damage. T-AOC is an index used to evaluate the overall
antioxidant capacity of the organism. In this study, feeding hydrogen-rich water significantly increased
serum T-AOC and enhanced T-SOD and CAT activity in the liver of broiler chickens. Moreover, it reduced
the levels of ROS and MDA in the liver, indicating an improvement in the antioxidant properties of broilers
and a reduction in the likelihood of oxidative stress. Previous studies have reported the antioxidant
effects of hydrogen-rich water, such as alleviating chronic graft-versus-host disease in mice[18], and
reducing oxidative stress in mice with DSS-induced chronic ulcerative colitis[19]. Shin et al.[12]
demonstrated that hydrogen-rich water increased T-AOC in broilers and elevated T-SOD activity in serum
and breast tissue. Azad et al.[11] also showed that hydrogen-rich water alleviated oxidative damage in
skeletal muscle of broilers. These findings highlight the promising application of hydrogen-rich water as
an antioxidant to prevent and mitigate oxidative stress in livestock and poultry production.

Chicken breast meat is highly valued by consumers due to its low fat content, low calorie count, and high
protein content, which can account for over 86% of the total mass[20]. Therefore, selecting and breeding
broiler chickens with desirable breast meat characteristics is a crucial focus in poultry production. Shear
force, a measure of tenderness, is an important indicator of chicken breast quality. The results of this
experiment revealed that consuming hydrogen-rich water significantly reduced the shear force of chicken
Page 15/26
breasts, indicating an improvement in tenderness and taste. The amino acid composition is another
essential criterion for evaluating meat products. In this study, the consumption of hydrogen-rich water
increased the ratio of leucine to lysine and the total essential amino acid content in chicken breast meat.
Essential amino acids are necessary for the body, as they cannot be synthesized internally and must be
obtained from external sources. Leucine, in particular, aids in blood sugar control, protein synthesis, and
muscle function maintenance[21];Lysine plays a vital role in various life cycle processes, promoting
energy metabolism, mineral absorption, bone growth, protein synthesis, immune function, and anxiety
reduction. When evaluating the fatty acid composition of chicken breast meat, it is important to consider
saturated fatty acids (SFA), monounsaturated fatty acids (MUFA), and polyunsaturated fatty acids
(PUFA). Long-term intake of SFA, which contains saturated bonds in their carbon chains, may increase
the risk of cardiovascular disease. On the other hand, unsaturated fatty acids, including
monounsaturated fatty acids (MFUA) and polyunsaturated fatty acids (PUFA), are considered essential
nutrients for the human body. PUFA exhibit anti-inflammatory properties, promote brain development, and
help prevent cardiovascular disease[22], MUFA also offer beneficial effects such as blood sugar
regulation, blood lipid control, heart protection, and cholesterol reduction[23]. In this experiment, drinking
hydrogen-rich water significantly reduced the proportion of C11:0 (SFA) in chicken breast meat and
decreased the proportion of C22:1n9 (MUFA), while highly increasing the proportion of C16:1 (MUFA),
C18:1n9c (MUFA), and total MUFA. Additionally, there was a significant increase in the proportion of
C18:3n6 (PUFA) and C18:3n3 (PUFA). Overall, feeding hydrogen-rich water improved the quality and
tenderness of chicken breast meat, as well as enhanced the amino acid and fatty acid composition of the
meat.

The intestinal microbiota plays a vital role in maintaining animal health by performing various functions
such as vitamin production, nutrient absorption, and development of the host immune system[24]. In this
experiment, it was observed that consuming hydrogen-rich water led to an increase in the relative
abundance of Kineothrix, Mediterraneibacter, Roseburia, and Stenotrophomonas at the genus level, while
the relative abundance of Ralstonia and Symbiobacterium significantly decreased. Both
Mediterraneibacter[25] and Kineothrix[26] are butyrate-producing bacteria in the intestine. Butyrate, as a
metabolite of the intestinal microbiota, plays a crucial role in the interaction between the gut flora and the
host. Numerous studies have demonstrated the therapeutic effects of butyrate on intestinal tumors,
inflammation, and malabsorption. Therefore, the increased relative abundance of Mediterraneibacter and
Kineothrix can enhance butyrate production in the intestine, thereby improving the health status of
broilers. Furthermore, the LEfse analysis revealed that the relative abundance of Roseburia was
significantly higher in the HRW group compared to the CTR group. Roseburia is another beneficial
bacterium known for its ability to produce butyrate, contributing to the overall health of the host. The
increased relative abundance of Roseburia is beneficial for the host's well-being. Although the relative
abundance of several butyric acid-producing bacteria mentioned above increased, the results of cecum
chyme short-chain fatty acid concentration measurements showed that there was no significant
difference in butyric acid concentration between the two groups. The speculation is that the butyric acid
produced is absorbed and used by the host to improve the host's health. The predicted functional

Page 16/26
analysis of the gut microbiota showed that the HRW group exhibited decreased relative abundance of
pathways related to amino acid and fatty acid metabolism (Valine, leucine, and isoleucine degradation,
Nitrogen metabolism, Arachidonic acid metabolism, and PPAR signaling pathway), as well as
antioxidant-related pathways (Glutathione metabolism and Peroxisome). These findings suggest that
hydrogen-rich water may modulate the composition of the intestinal microbiota, leading to changes in the
metabolic pathways associated with amino acid, fatty acid, and antioxidant metabolism. Correlation
analysis further revealed significant and positive associations between the relative abundance of
Mediterraneibacter and Kineothrix in the HRW group with serum antioxidant performance, as well as
certain amino acid and fatty acid proportions. These findings suggest that hydrogen-rich water may
improve broiler antioxidant performance by modulating the composition of the intestinal microbiota,
ultimately influencing the quality of chicken breast meat, as well as its amino acid and fatty acid
composition.

Conclusions
In conclusion, the findings of this study suggest that the consumption of hydrogen-rich water in broilers
has several advantageous effects. It enhances antioxidant activity in both serum and liver, resulting in a
decrease in oxidative stress. Additionally, it positively impacts the quality of chicken breast meat by
improving its amino acid and fatty acid composition, which contributes to better improving taste and
tenderness. Moreover, hydrogen-rich water influences the structure of the cecum microbiota, promoting
the growth of beneficial bacteria involved in butyrate production. Importantly, these benefits effects are
achieved without compromising the growth performance of broilers. Therefore, the application of
hydrogen-rich water can be considered a safe and feasible approach in broiler production.

Abbreviations

Page 17/26
 HRW Hydrogen-rich water

CTR Control

T-AOC Total antioxidant capacity

T-SOD Superoxide dismutase activity

ROS Reactive oxygen species

MDA Malondialdehyde

CAT Catalase

BW Body weight

ADG Average daily gain

ADFI Average daily food intake

F/G Feed-to-weight ratio

Lefse Linear discriminant analysis Effect Size

LDA Linear Discriminant Analysis

Declarations
Ethics approval and consent to participate

The experiment was approved by the Animal Care and Use Committee of Nanjing Agricultural University.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on
reasonable request.

Competing interests

The authors declare that there are no conflicts of interest.

Funding

Not applicable.

Authors’ contributions

Page 18/26
WJZ and WY designed the study. HZ conducted the experiment. HYY provided hydrogen-related
instruments HZ performed and collected the data. HZ analyzed the data. HZ wrote the manuscript. All
authors read and approved the final manuscript.

Acknowledgements

Not applicable.

References
1. Zeng J, Ye Z, Sun X. Progress in the study of biological effects of hydrogen on higher plants and its
promising application in agriculture [J]. Med Gas Res. 2014;4:15.
2. Dole M, Wilson FR, Fife WP. Hyperbaric hydrogen therapy: a possible treatment for cancer [J].
Science. 1975;190(4210):152–4.
3. Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K, et al. Hydrogen acts as
a therapeutic antioxidant by selectively reducing cytotoxic oxygen radicals [J]. Nat Med.
2007;13(6):688–94.
4. Li HM, Shen L, Ge JW, Zhang RF. The transfer of hydrogen from inert gas to therapeutic gas [J]. Med
Gas Res. 2017;7(4):265–72.
5. Kurioka T, Matsunobu T, Satoh Y, Niwa K, Shiotani A. Inhaled hydrogen gas therapy for prevention of
noise-induced hearing loss through reducing reactive oxygen species [J]. Neurosci Res. 2014;89:69–
74.
6. Shen L, Wang J, Liu K, Wang C, Wang C, Wu H, et al. Hydrogen-rich saline is cerebroprotective in a rat
model of deep hypothermic circulatory arrest [J]. Neurochem Res. 2011;36(8):1501–11.
7. Xin HG, Zhang BB, Wu ZQ, Hang XF, Xu WS, Ni W, et al. Consumption of hydrogen-rich water
alleviates renal injury in spontaneous hypertensive rats [J]. Mol Cell Biochem. 2014;392(1–2):117–
24.
8. Zheng W, Ji X, Zhang Q, Du W, Wei Q, Yao W. Hydrogen-Rich Water and Lactulose Protect Against
Growth Suppression and Oxidative Stress in Female Piglets Fed Fusarium Toxins Contaminated
Diets [J]. Toxins (Basel). 2018;10(6):288.
9. Ji X, Zhang Q, Zheng W, Yao W. Morphological and molecular response of small intestine to lactulose
and hydrogen-rich water in female piglets fed Fusarium mycotoxins contaminated diet [J]. J Anim
Sci Biotechnol. 2019;10:9.
10. Zheng W, Ji X, Zhang Q, Yao W. Intestinal Microbiota Ecological Response to Oral Administrations of
Hydrogen-Rich Water and Lactulose in Female Piglets Fed a Fusarium Toxin-Contaminated Diet [J].
Toxins (Basel). 2018;10(6):246.
11. Azad MA, Kikusato M, Zulkifli I, Toyomizu M. Electrolysed reduced water decreases reactive oxygen
species-induced oxidative damage to skeletal muscle and improves performance in broiler chickens
exposed to medium-term chronic heat stress [J]. Br Poult Sci. 2013;54(4):503–9.

Page 19/26
12. Shin D, Cho ES, Bang HT, Shim KS. Effects of oxygenated or hydrogenated water on growth
performance, blood parameters, and antioxidant enzyme activity of broiler chickens [J]. Poult Sci.
2016;95(11):2679–84.
13. Carvalho LT, Owens CM, Giampietro-Ganeco A, Malagoli De Mello JL, Ferrari FB, De Carvalho F et al.
a L,. Quality of turkeys breast meat affected by white striping myopathy [J]. Poult Sci, 2021, 100(4):
101022.
14. Adeola O, Shafer DJ, Nyachoti CM. Nutrient and energy utilization in enzyme-supplemented starter
and grower diets for White Pekin ducks [J]. Poult Sci. 2008;87(2):255–63.
15. Figueiredo IL, Claus T, Oliveira Santos Junior O, Almeida VC, Magon T, Visentainer JV. Fast
derivatization of fatty acids in different meat samples for gas chromatography analysis [J]. J
Chromatogr A. 2016;1456:235–41.
16. Ezraty B, Gennaris A, Barras F, Collet JF. Oxidative stress, protein damage and repair in bacteria [J].
Nat Rev Microbiol. 2017;15(7):385–96.
17. Del Rio D, Stewart AJ, Pellegrini N. A review of recent studies on malondialdehyde as toxic molecule
and biological marker of oxidative stress [J]. Nutr Metab Cardiovasc Dis. 2005;15(4):316–28.
18. Qian L, Liu J, Ma W, Liu Y, Wang X, Liu D. Hydrogen-Rich Water Ameliorates Murine Chronic Graft-
versus-Host Disease through Antioxidation [J]. Oxid Med Cell Longev, 2021, 2021: 1165928.
19. Song L, Zhang Y, Zhu C, Ding X, Yang L, Yan H. Hydrogen-rich water partially alleviate inflammation,
oxidative stress and intestinal flora dysbiosis in DSS-induced chronic ulcerative colitis mice [J]. Adv
Med Sci. 2022;67(1):29–38.
20. Dalle Zotte A, Ricci R, Cullere M, Serva L, Tenti S, Marchesini G. Research Note: Effect of chicken
genotype and white striping-wooden breast condition on breast meat proximate composition and
amino acid profile [J]. Poult Sci. 2020;99(3):1797–803.
21. Duan Y, Li F, Li Y, Tang Y, Kong X, Feng Z, et al. The role of leucine and its metabolites in protein and
energy metabolism [J]. Amino Acids. 2016;48(1):41–51.
22. Liu Y, Ren X, Fan C, Wu W, Zhang W, Wang Y. Health Benefits, Food Applications, and Sustainability
of Microalgae-Derived N-3 PUFA [J]. Foods, 2022, 11(13).
23. Ravaut G, Legiot A, Bergeron KF, Mounier C. Monounsaturated Fatty Acids in Obesity-Related
Inflammation [J]. Int J Mol Sci, 2020, 22(1).
24. Adak A, Khan MR. An insight into gut microbiota and its functionalities [J]. Cell Mol Life Sci.
2019;76(3):473–93.
25. Kim JS, Lee KC, Suh MK, Han KI, Eom MK, Lee JH, et al. Mediterraneibacter butyricigenes sp. nov., a
butyrate-producing bacterium isolated from human faeces [J]. J Microbiol. 2019;57(1):38–44.
26. Haas KN, Blanchard JL. Kineothrix alysoides, gen. nov., sp. nov., a saccharolytic butyrate-producer
within the family Lachnospiraceae [J]. Int J Syst Evol Microbiol. 2017;67(2):402–10.

Figures
Page 20/26
Figure 1

Effects of hydrogen-rich water on the amino acid composition on breast meat of broilers. Red and blue
represent the CTR and HRW groups, respectively. * represents significant difference (P<0.05),** represents
highly significant difference(P<0.01)

Page 21/26
Figure 2

Effects of hydrogen-rich water on the amino acid composition on breast meat of broilers. Red and blue
represent the CTR and HRW groups respectively. * represents significant difference (P<0.05),** represents
highly significant difference(P<0.01)

Figure 3

Effects of hydrogen-rich water on the alpha diversity (A) and beta diversity (B) of cecum microorganisms
of broilers. Red and blue represent the CTR and HRW groups respectively.

Page 22/26
Figure 4

Effects of hydrogen-rich water on the composition and relative abundance of the microbial of cecum
chyme in broilers

Notes: (A) Venn Graph based on ASVs. Red and blue represent the CTR and HRW groups respectively. (B)
Microbial composition bar chart of the phylum level (relative abundance >1%), (C) Microbial composition
bar chart of the genus level (relative abundance >1%), (D) The relative abundance bar chart of genus level
microorganisms with significant difference between the two groups (relative abundance>0.1%). Red and
blue represent the CTR and HRW groups respectively. * means significant difference (P<0.05), * * means
extremely significant difference (P<0.01).

Page 23/26
Figure 5

The LEfSe analysis of cecum chyme in broilers. Red and blue represent the CTR and HRW groups
respectively.

Page 24/26
Figure 6

Effects of hydrogen-rich water on microbial functional metabolic pathways of cecum in broilers. Red and
blue represent the CTR and HRW groups respectively.

Page 25/26
Figure 7

Spearman correlation analysis of differential microbial in the genera of cecum with antioxidant capacity
on serum and liver and intestinal morphology of broilers. The red, blue and white colors represent
significant positive correlation (P<0.05), significant negative correlation (P<0.05) and no correlation
(P>0.05) respectively

Page 26/26