CHAPTER 06

MOLECULAR BASIS OF
INHERITANCE
1. List the salient features of double helix structure of DNA. Support
your answer with a diagram.

Ans. Salient features of DNA double helix are as follows:

i. It is made up of two polynucleotide chains containing the backbone

of sugar-phosphate from which the bases project inside.
ii. The two chains have anti-parallel polarity, i.e. one of them is 5′ → 3′,
the other has 3′ → 5’polarity.
iii. The bases in two strands are paired through hydrogen bond (H-
bonds) forming base pairs (bp). Adenine pairs through two hydrogen
bonds with thymine on opposite strand and vice-versa. In the same
way, guanine is bonded with cytosine through three H-bonds. Due to
which, purine always comes opposite to a pyrimidine.
iv. The two chains are coiled in a right-handed fashion. The pitch of the
helix is 3.4 nm and there are roughly 10 bp in each turn.
Consequently, the distance between base pair in a helix is about 0.34
nm.
v. The plane of one base pair stacks over the other in double helix.
vi. This confers stability to the helical structure.
 DNA Double helix

2. Draw the schematic diagram of:

(i) Single stranded polynucleotide
(ii) Double stranded polynucleotide

Ans. (i)

Single stranded polynucleotide

(ii)

Double stranded polynucleotide

3. The length of DNA in a eukaryotic cell is 2.2 m How can such a

huge DNA be packaged in a nucleus of micrometer in diameter?
 Ans. In eukaryotic cells, DNA (2.2 meters) is condensed, coiled and
supercoiled to be packaged efficiently in the nucleus. DNA is
associated with histone and non-histone proteins. Histones are a set
of positively charged, basic proteins, rich in basic amino acid residues
lysine and arginine. Nucleosome consists of nucleosome core (two
molecules of each of histone proteins viz. H2 A, H2 B, H3 and H4
forming histone octamer) and negatively charged DNA that wraps
around the histone octamer. H1 protein binds the DNA thread where
it enters and leaves the nucleosome. Each nucleosome contains 200
bp of DNA. Packaging involves formation of – Beads on string (10 nm
diameter), Solenoid fibre (looks like coiled telephone wire), Chromatin
fibre and Chromosome. Non-Histone Chromosomal Proteins (NHC)
contribute to the packaging of chromatin at a higher level.

4. What is transformation? Describe Griffith’s experiment to show

transformation? What did he prove from his experiment?

Ans. Transformation means change in genetic makeup of an individual.

Fredrick Griffith conducted a series of experiments on streptococcus
pneumoniae. He observed two strains of this bacterium – one forming
smooth colonies with capsule (S-type) & other forming rough colonies
without capsule (R-type)
(i) when live S-type cells were infected into mice, they produced
pneumonia & mice dies.

(ii) When live R-type cells were infected into mice, disease was not
produced ie it did not appear & mouse survived.

(iii) When heat – killed S-type cells were infected into mice, the disease
did not appear & mouse survived.

(iv) When heat killed S-type cells were mixed with live R-cells & infected
into mice, the mice died.

He concluded that R-strain bacteria had somehow been transformed by

heat –killed S-strain bacteria which must be due to transfer of genetic
material (transforming principle).

5. Explain, how the biochemical characterization (nature) of

‘Transforming Principle’ was determined, which was not defined
from Griffith’s experiments.

Ans. Various experiments were conducted to prove that DNA is the

genetic material. Griffith did his experiment and concluded that some
substance causes transformation. However, he did not tell the substance
that had caused the transformation.

Biochemical Characterisation of Transforming Principle:

Three scientists Avery, MacLeod and McCarty revealed that the chemical
nature of the transforming substance was DNA. They showed that DNA
isolated from S-strain could itself confer the pathogenic properties to R-
strain. They purified biochemicals (proteins, DNA, RNA, etc.) from the
heat-killed S cells to see which ones could transform live R cells into
S cells.
They also discovered that protein-digesting enzymes (proteases) and
RNA-digesting enzymes (RNases) did not affect transformation, so the
transforming substance was not a protein or RNA. Digestion with DNase
did inhibit transformation, suggesting that the DNA caused the
transformation. They discovered that DNA alone from S bacteria caused
R bacteria to become transformed. They concluded that DNA is the
hereditary material.
This fact suggested that DNA possesses the genetic properties.
The outline of the experiment is given below:
6. Who performed the blender experiment? What does this
experiment prove? Describe the steps followed in this
experiment?

Ans. The proof for DNA as the genetic material came from the
experiments of Hershey & Chase who worked with bacteriophage.

The bacteriophage on infection injects only the DNA into the bacterial
cell & not the protein coat. Bacterial cell treats the viral DNA as its own
& subsequently manufactures more virus particles.

They grew some viruses on a medium that contained radioactive

Phosphorus & some other on a medium that contained radioactive
Sulphur. Virus grown in the presence of radioactive phosphorus
contained radioactive DNA but not proteins because DNA contains
phosphorus. Similarly, virus grown on radioactive sulfur contained
radioactive protein because DNA does not contain sulfur.
Radioactive phages are allowed to infect E. coli bacteria & soon after
infection the cultures were gently agitated in a blender to separate the
adhering protein coat of virus from bacterial cell. It was found that when
phage containing radioactive DNA was used to infect the bacteria its
radioactivity was found in bacterial cells indicating that DNA has been
injected into bacterial cell so, the DNA is the genetic material & not
proteins.

7. List the criteria of a molecule that can act as genetic material

must fulfil. Which one of the criteria is best fulfilled by DNA or by
RNA thus making one of them a better genetic material than the
other? Explain.

Ans. From the Hershey and Chase experiment, the fact was established
that DNA acts as genetic material. But later studies revealed that in some
viruses (e.g. Tobacco Mosaic Viruses, QB bacteriophage, etc.) RNA is the
genetic material. Following are the criteria that a molecule must fulfil to
act as a genetic material.

 It- should be able to replicate.

 It should be chemically and structurally stable.
 It should provide the scope for slow changes (mutation), which are
required for evolution.
 It should be able to express itself in the form of ‘Mendelian
characters’.

According to these criteria, both DNA and RNA have the ability to direct
their duplications (because of the rule of base pairing and
complementarity).

So, both the nucleic acids (DNA and RNA) have the ability to direct their
duplications, whereas the other molecules in the living system, fail to
fulfil first criteria itself, e.g. protein. The most important criteria of genetic
material is the stability as the genetic material should not change with
the different stages of life cycle, age or with change in the physiology of
an organism. Both DNA and RNA have the ability to mutate. Since, RNA
is unstable, it mutates at a faster rate. That is why, those viruses, which
have RNA genome and a shorter lifespan, undergo mutation and thus,
evolve rapidly.

DNA is dependent on RNA for protein synthesis, whereas RNA directly

codes for protein synthesis. This proves that both RNA and DNA act as
genetic material, but DNA being more stable is preferred for the storage
of genetic information.

8. What do you mean by semi conservative nature of DNA

replication? Who proved it & how?
Ans. Semiconservative nature of DNA replication suggested that during
replication two strands would separate & each acts as a template for the
synthesis of new complementary strand so, that after complete
replication, each DNA molecule would have one parental & one newly
synthesized strand thus, half the information is conserved over
generation. Mathew Meselson & Franklin Stahl have performed an
experiment using Escherichia coli to prove that DNA replication is
Semiconservative. They grew E.coli in a medium containing 15N, until
15N was incorporated in the two strands of newly synthesized DNA this
heavy DNA can be separated from normal DNA lay centrifugation in
density gradient. Then they transferred the cells into a medium with
normal & took samples at various time intervals & extracted DNA &
centrifuged then to measure their densities. The DNA extracted from the
cells after one generation to transfer from medium to medium had an
intermediate / hybrid density. The DNA extracted after two generations
(i.e. after 40 min) consisted of equal amount of “light” DNA &
“Hybrid”DNA.
9. Explain the process of DNA replication with the help of a
schematic diagram.
Ans. DNA replication is the process of producing two identical strands of
DNA from the original strand. DNA replication is semiconservative in
nature. The original strand is known as the parent strand and the new
strands are known as the daughter strands. This process is achieved by a
number of enzymes such as DNA polymerase, helicase, primase,
topoisomerase, and ligase.

For the replication to begin there is a particular region called the origin
of replication. This is the point where the replication originates. This is
followed by the unwinding of the two DNA strands.
Unzipping of DNA strands in their entire length is not feasible due to
high energy input. Hence, first, a replication fork is created catalyzed by
the helicase enzyme, which unzips the DNA strand. The primase enzyme
helps in the synthesis of RNA primer complementary to the DNA
template strand.
As the strands are separated, the DNA polymerase enzymes start
synthesizing the complementary sequence in each of the strands. The
parental strands will act as a template for newly synthesizing daughter
strands.
Deoxyribonucleoside triphosphates are the substrate as well as the
energy provider for the replication process.
It is to be noted that elongation is unidirectional i.e. DNA is always
polymerized only in the 5′ to 3′ direction. Therefore, in one strand (the
template 3‘→5‘) it is continuous (leading strand), hence called continuous
replication while on the other strand (the template 5‘→3‘) it is
discontinuous (lagging strand) hence called discontinuous replication.
They occur as fragments called Okazaki fragments. The enzyme called
DNA ligase joins them later.

10. With the help of a schematic diagram, explain the location and
role of the following in a transcription unit. Promoter, structural
gene, terminator.

Ans.

The promoter and terminator flank the structural gene in a transcription

unit. The promoter is located towards 5’end (upstream) of the structural
gene and it helps to initiate transcription by binding with RNA
polymerase. The terminator is located toward 3’end (downstream) of the
coding strand and it usually defines the end of the process of
transcription. The structural gene is present in between promoter and
terminator. It codes for enzyme or protein for structural functions.

11. A template strand is given below. Write down the

corresponding coding strand and the mRNA strand that can be
 formed, along with their polarity.
3′- ATGCATGCATGCATGCA TGCATGC-5′

Ans.
For the given template strand 3- ATGCATGCAT GCATGCATGCATGC- 5′
Coding strand is 5′- TACGTACGTACGTACGTACG TACG – 3′
and mRNA strand is 5′- UACGUACGUACGUACGU ACGUACG – 3′

12. Illustrate schematically the process of initiation, elongation

and termination during transcription of a gene in a bacterium.

Ans. In bacteria, there are three major types of RNAs: mRNA (messenger
RNA), tRNA (transfer RNA), and rRNA (ribosomal RNA). There is single
DNA-dependent RNA polymerase that catalyzes transcription of all types
of RNA in bacteria.
RNA polymerase binds to promoter and initiates transcription (Initiation).
It uses nucleoside triphosphates as substrate and polymerizes in a
template depended fashion following the rule of complementarity. It
somehow also facilitates opening of the helix and continues elongation.
Only a short stretch of RNA remains bound to the enzyme. Once the
polymerases reaches the terminator region, the nascent RNA falls off, so
also the RNA polymerase. This results in termination of transcription.
The RNA polymerase is only capable of catalyzing the process of
elongation. It associates transiently with initiation-factor () and
termination-factor () to initiate and terminate the transcription,
respectively. Association with these factors alter the specificity of the
RNA polymerase to either initiate or terminate.
13. Transcription in eukaryotes is more complex process than in
prokaryotes. Justify. Support your answer with suitable diagram.
Ans. In eukaryotes, there are two complexities as follows:
(i) There are at least three RNA polymerases in the nucleus (in
addition to the RNA polymerase found in the organelles). There
is a clear cut division of labour.
The RNA polymerase I transcribes rRNAs (28S, 18S, and 5.8S).
The RNA polymerase II transcribes precursor of mRNA, the
heterogeneous nuclear RNA (hnRNA).
The RNA polymerase III transcribes tRNA, 5srRNA, and snRNAs
(small nuclear RNAs).
(ii) The second complexity is that the primary transcripts contain
both the exons and the introns and are non-functional. Hence, it
is subjected to a process called splicing where the introns are
removed and exons are joined in a defined order. hnRNA
undergo two additional processing called as capping and
tailing.
In capping an unusual nucleotide (methyl guanosine
triphosphate) is added to the 5'-end of hnRNA.
In tailing, adenylate residues (200-300) are added at 3'-end in a
template independent manner.
It is the fully processed hnRNA, now called mRNA, that is
transported out of the nucleus for translation.
14. (a) Following are the features of genetic codes. What does each
one indicate? Stop codon, Unambiguous codon, Degenerate codon,
Universal codon.

(b) Give an example of a codon having dual function.

Ans. (a)

Stop codon: It does not code for any amino acids, e.g. UGA, UAG, UAA.

Unambiguous codon: One codon codes for only one amino acid, e.g.
UUU codes for phenylalanine.

Degenerate codon: A single amino acid is coded by more than one

codon, e.g. serine is coded by 6 codons.

Universal codons: The codons codes for the same amino acid in all
organisms (except in mitochondria and few protozoan).

(b) AUG is a codon with dual functions. It codes for the amino acid
methionine (met) and also acts as an initiator codon of polypeptide
synthesis during protein synthesis.

15. (i) Name the scientist who postulated the presence of an adapter
molecule that can assist in protein synthesis, (ii) Describe its
structure with the help of a diagram. Mention its role in protein
synthesis.
Ans.
(i) Francis Crick proposed the presence of an adapter molecule, i.e. /RNA
which could read the code and bind to the specific amino acids, thus
assisting in protein synthesis.
(ii) A clover leaf structure of tRNA.

A tRNA- functions as carrier of amino acids and participates in protein

synthesis.

16. Describe the steps involved in translation?

Ans.
(i) Activation of amino acids:- amino acids are activated in the
presence of ATP lay enzyme aminoacyltRNA synthetase.
(ii) Binding of activated aminoacid with tRNA :- Activated amino
acids binds with specific tRNA to form charged tRNA .
(iii) Initiation of polypeptide chain :- Initiation codon is AUG which
codes for methionine. Initiation codon of mRNA binds to p-site
of ribosome with the help of initiation factors.
(iv) Elongation of polypeptide chain :-

(a) Second activated amino acid along its tRNA reaches the ‘A’ site &
binds to mRNA codon next to AUG. (b) A peptide bond is formed
between two amino acid by peptidyl transferase. (c) Ribosomes
translocation mRNA in -direction due to which free tRNA slips away &
peptidyltRNA reaches at P – site. Now third amino acid reaches at A –
site & process continues.
(v) Termination of polypeptide chain :- When a terminator codon (UAA,
UAG, UGA) reaches at A- site translation terminates since there is no
specific tRNA for these codons.

17. What do you understand by an operon? Draw a schematic

labelled illustration of lac operon in “switched on” and “switched
off” state. Describe the role of lactose in lac operon.
Ans. The lac operon consists of one regulatory gene (the i gene – here
the term i does not refer to inducer, rather it is derived from the word
inhibitor) and three structural genes (z, y, and a). The i gene codes for
the repressor of the lac operon. The z gene codes for beta-galactosidase
(-gal), which is primarily responsible for the hydrolysis of the
disaccharide, lactose into its monomeric units, galactose and glucose.
The y gene codes for permease, which increases permeability of the cell
to -galactosides. The a gene encodes a transacetylase. Hence, all the
three gene products in lac operon are required for metabolism of
lactose. Lactose is the substrate for the enzyme beta-galactosidase and it
regulates switching on and off of the operon. Hence, it is termed as
inducer. In the absence of a preferred carbon source such as glucose, if
lactose is provided in the growth medium of the bacteria, the lactose is
transported into the cells through the action of permease. The lactose
then induces the operon in the following manner.
The repressor of the operon is synthesised (all-the-time – constitutively)
from the i gene. The repressor protein binds to the operator region of
the operon and prevents RNA polymerase from transcribing the operon.
In the presence of an inducer, such as lactose or allolactose, the
repressor is inactivated by interaction with the inducer. This allows RNA
polymerase access to the promoter and transcription proceeds.
Regulation of lac operon by repressor is referred to as negative
regulation.

18. (i) List the two methodologies which were involved in human
genome project. Mention how they were used.

(ii) Expand ‘BAC’ and ‘YAC’ what are they and what is the purpose
for which they are used?
Ans.

(i) Two major methodologies involved in HGP are as follows

 Expressed Sequence Tags (ESTs) This method focuses on identifying

all the genes that are expressed as RNA.
 Sequence annotation This method involves the sequencing of whole
set of genome (that contained all coding and non-coding sequence)
and then assigning functions to the different regions in the
sequence.
(ii) BAC — Bacterial Artificial Chromosome
YAC — Yeast Artificial Chromosome.
‘BAC’ and ‘YAC’ are used as vectors in cloning of DNA.

19. (i) Explain the significance of satellite DNA in DNA

fingerprinting technique.
(ii)Expand VNTR and describe its role in DNA fingerprinting.
(iii) List any two applications of DNA fingerprinting technique.
Ans. (i)

 Significance of satellite DNA in DNA fingerprinting A DNA satellite

is a region that consists of short DNA sequences repeated many
times. The variation between individuals in the lengths of their DNA
satellites forms the basis of DNA fingerprinting.
 DNA satellites are of two types, i.e. microsatellites and
minisatellites. Their characteristic that makes them useful for
identification is that they are highly polymorphic. The length of
each satellite in DNA is inherited.
 The length of satellite regions is highly variable between people.
These form small peaks during density gradient centrifugation and
thus, are invaluable for identification purposes.

(ii)VNTR The expanded form of VNTR is Variable Number of Tandem

Repeats. These are short nucleotide repeats in the DNA. These are
highly specific for individuals. No two individuals have the same
VNTR.

Role of VNTR in Fingerprinting VNTRs are used as probe markers in

the identification of DNA of different individuals because no two
individuals can have the same VNTRs (except in case of monozygotic
twins).

(iii) Applications of DNA Fingerprinting:

 DNA fingerprinting can identify the real genetic mother, father and
offspring.
 DNA fingerprinting is very useful in the detection of crime and legal
pursuits.

20. Two claimant fathers filed a case against a lady claiming to be

the father of her only daughter. How could this case be settled
identifying the real biological father? Explain in brief.
Ans. This case to identify the real biological father could lee settled lay
DNA – finger printing technique. In this technique:-

1. First of all, DNA of the two claimants who has to be tested is

isolated.
2. Isolated DNA is then digested with suitable restriction enzyme &
digest is subjected to gel electrophoresis.
3. The fragments of ds DNA are denatured to produce ss DNA by
alkali treatment.
4. The electrophoresed DNA is then transferred from get into a
nitrocellulose filter paper where it is fixed.
5. A known sequence of DNA is prepared called probe – DNA & is
labelled with radioactive isotope32p & then probe is added to
nitrocellulose paper.
6. The nitrocellulose paper is photographed on X –ray film through
auto radiography. The film is analysed to determine the presence of
hybrid nucleic acid.

Then, the DNA fingerprints of the two claimants is compared with the
DNA fingerprint of the lady &her daughter, whosoever matches with
each other would be declared as biological father of her daughter.

**********************************************************************