International Journal of Biological Macromolecules 160 (2020) 871–879

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

journal homepage: http://www.elsevier.com/locate/ijbiomac

Immunomodulatory effects of the polysaccharide from Craterellus

cornucopioides via activating the TLR4-NFκB signaling pathway in
peritoneal macrophages of BALB/c mice
Mingzhu Guo, Meng Meng, Jiahao Zhao, Xu Wang, Chunling Wang ⁎
Key Laboratory of Food Nutrition and Safety, Ministry of Education, College of Food Engineering and Biotechnology, Tianjin University of Science and Technology, Tianjin 300457, China

a r t i c l e i n f o a b s t r a c t

Article history: The immunoregulatory effect and immunologic response mechanism of Craterellus cornucopioides (L.) Pers. poly-
Received 2 February 2020 saccharide (CCP) with a triple-helix structure on peritoneal macrophages was investigated in vitro for the first
Received in revised form 8 May 2020 time. These studies demonstrated that treatment of peritoneal macrophages with 80 μg/mL CCP for 48 h signif-
Accepted 30 May 2020
icantly strengthened their phagocytic function as well as increases the activities of lysozyme (LZM), acid phos-
Available online 03 June 2020
phatase (ACP) and succinodehydrogenase (SDH) when compared with the untreated group. Furthermore,
Keywords:
Western Blot and quantitative real-time polymerase chain reaction (qRT-PCR) assays demonstrated that
Craterellus cornucopioides (L.) Pers. polysaccha- 80 μg/mL CCP activated macrophages, significantly increased mRNA expression of cytokines (IL-8, IL-1β, IFN-α
rides and TNF-α) and upregulated the protein expression of cell membrane receptor TLR4, as well as its downstream
Immunoregulation protein kinase products (MyD88, TAK1, P-IKKα/β and P-MEK) through activation of the TLR4-NFκB pathway in
Mechanism peritoneal macrophages. In conclusion, these results showed that the immunomodulatory mechanism of CCP in
peritoneal macrophages was associated with the release of NO, related enzymes and cytokines by stimulating the
NF-κB p50 pathway via TLR4-MyD88-TAK1 signaling.
© 2020 Published by Elsevier B.V.

1. Introduction proliferation. NF-κB has long been considered as prototypical represen-

The innate immune system is the primary defense of the host against
invading pathogens [1,2]. It mainly comprised of innate (macrophages,
mucosal associated invariant T (MAIT) cells, B lymphocytes, T lympho-
cytes and natural killer (NK) cells) [3,4]. Phagocytosis is one of the
most important non-specific immune activities in situ. It is performed
by macrophage and activated by the pathogen associated molecules
via pattern-recognition receptors (PRRs) [5–8]. PRRs discriminate spe-
cies specific monosaccharide variations [9,10], and pathogen-derived
glycoconjugate structures, both of which activate the innate immune re-
sponse. TLRs are highly conserved PRRs [11] and identified in Drosophila
melanogaster for the first time in 1988 [12]. Essential for the activation of
macrophages by many natural polysaccharides, TLR4 is a PRR that plays
an important role in the pathogen recognition, activation of antigen pre-
senting cells (e.g. dendritic cells and macrophages) and initiation of
adaptive immunity [2,13,14]. The activation of TLR4 directly results in
the up-regulation of key signal transmission factors, including NF-κBs,
AKT and MAPKs [15]. The MAPK pathway regulates cell functions in-
cluding apoptosis, mitosis, differentiation, gene expression and
⁎ Corresponding author.
E-mail address: wangchunling@tust.edu.cn (C. Wang).
tative of immunoregulatory signaling pathway.
Investigators have focused on discovering compound that modulate
the biologic response of immune cells to enhance the ability of the host
to resist microbial infection [16]. Several classes of these compounds, for
instance lipid derivatives, glycoproteins, lipopolysaccharides peptides
and proteins, have all been characterized as molecules with potent ef-
fects on the host immune system. Polysaccharides present in almost
all organisms, which are composed of aldose and/or ketose linked by
glycosidic bonds in branched or unbranched chains. It has drawn signif-
icant attention for few adverse effects and low toxicity [17,18]. In partic-
ular, the study of polysaccharides from fungi has been fast growing in
the academic community as natural therapeutic compounds. The fungal
polysaccharides have long been believed to possess benign immuno-
regulatory effects with low toxicity. Furthermore, they are considered
as potent immunomodulatory agents since they activate both innate
and adaptive immune responses [19,20]. In addition, polysaccharides
can stimulate the secretion of corresponding immune factors while ac-
tivating innate immunity [21,22].
Craterellus cornucopioides (L.) Pers. is a kind of precious, wild and ed-
ible fungus which widely distributed in Europe, North America, Korea,
Japan and deep mountains of Sichuan and Yunnan provinces [23]. De-
spite accessibility, the research on Craterellus cornucopioides (L.) Pers.
was limited in recent years. Liu et al. [24] isolated three new keto esters

https://doi.org/10.1016/j.ijbiomac.2020.05.270
0141-8130/© 2020 Published by Elsevier B.V.
872 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879
and Hua et al. [25] obtained three illudin sesquiterpenoids from cultures
of C. cornucopioides, and identified their structures. Teodora et al. [26]
evaluated chemical composition, antioxidant activity and cytotoxic ef-
fects of several dry extracts obtained from Craterellus cornucopioides
(L.) Pers. Marijana et al. [27] determined the phenolic compounds and
antioxidant, antimicrobial, genotoxic, and anticancer potential of
Craterellus cornucopioides. In addition to the above, the research of poly-
saccharides extracted from Craterellus cornucopioides (L.) Pers. even
fewer. Only Yang et al. [28] studied on the structural characterization
and antioxidant activities of a novel polysaccharide fraction from the
fruiting bodies of Craterellus cornucopioides with the molecular weight
of 9.2 × 105 Da. Overall, based on the advantages of fungal polysaccha-
rides and the studies that have been reported, we have done a series
of studies on the structure and activity of Craterellus cornucopioides
(L.) Pers. polysaccharides to expand its application. In our previous
study, we found a novel water-soluble polysaccharide with average mo-
lecular weight of 1.97 × 106 Da from Craterellus cornucopioides. Subse-
quently, we investigated its structural characteristics, physicochemical
properties and solution behaviors [29]. In addition, the immunomodu-
latory activity of Craterellus cornucopioides polysaccharide (CCP) in im-
munosuppressive murine models was investigated [30]. From our
preliminary experiments, we found that CCP significantly activated
peritoneal macrophages in vitro. However, it was unknown whether
TLR4 was the receptor of CCP. Therefore, the role of TLR2, TLR4 and
Dectin as candidate receptors of CCP as well as their related signaling
pathway in peritoneal macrophages was investigated.
In this study, phagocytic activity, phagocytic-related enzyme activity
and the mRNA production of cytokines (IL-1β, IL-8, TNF-α and IFN-γ) in
peritoneal macrophages were measured to evaluate the effects of CCP in
different experimental models in vitro. Moreover, the amount of NO re-
leased was measured to explore the surface receptor of CCP in perito-
neal macrophages. Finally, the subcellular expression of P-NF-κB p50
and protein expressions of TLR4, MyD88, TAK1, IKKα/β, MEK and P-
NF-κB p50 were investigated to determine the pathway stimulated by
CCP. The objective of this study was to observe whether CCP could en-
hance the immune activity of peritoneal macrophages in vitro, investi-
gate the molecular mechanism of CCP and provide theoretical
evidence for developing a new-type of immunomodulator.
2. Materials and methods
2.1. Material and chemical
Fetal bovine serum and DMEM medium were purchased from Gibco
BRL (Grand Island, NY, USA). dimethyl sulfoxide (DMSO), phosphate
buffer saline (PBS), trypsin, Penicillin–streptomycin solution, 3-(4,5-
Dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) and
neutral red were purchased from Thermo (Beijing, China). The LZM,
ACP, SDH and nuclear and cytoplasmic protein extraction kit were pur-
chased from Beyotime Institute of Biotechnology (Shanghai, China).
Horseradish peroxidase-conjugated secondary antibodies, MyD88,
TLR4, TAK1, IKK1/2, P-IKK1/2, β-actin, NF-κBp50, P-MEK, MEK and fluo-
rescein FITC-labeled polyclonal goat antimouse IgG antibody (diluted
1000 times with PBS) were purchased from Cell Signaling Technology
(Danvers, MA, USA). The 4′,6-diamidino-2-phenylindole (DAPI) was
provided by Sigma company (Darmstadt, Germany). The Trizol reagent,
Triton X-100 and bovine serum albumin were purchased from Solarbio
Institute of Biotechnology (Beijing, China). The PrimeScript RT and SYBR
qRT-PCR kit were purchased from Takara Biological Engineering com-
pany (Dalian, China). Specific primers were designed by Sangon Bio-
technology company (Shanghai, China). All other chemicals were of
the analytically purest grade available Pharmacia Biotech (Piscataway,
NJ, USA).
2.2. Extraction and purification of CCP
The extraction and purification of CCP were performed according to
our previous method [29]. Briefly, fruiting body was soaked 4 times ac-
etone to degrease and then was extracted using distilled water at 85 °C
for 2.5 h (3 times). The supernatant was concentrated in small volumes
by using rotary evaporator under vacuum at 60 °C. Then sevag reagent
was used to remove protein by shaking for 30 min (10 times), and
then three volumes of ethanol were added to precipitate the
C. cornucopioides crude polysaccharide (CCCP) which were collected
after centrifugation at 3000 rpm at 25 °C for 10 min. The precipitate
was rewashed by ethanol, then dissolved in water and freeze-dried
under −80 °C. The CCCP (80 mg) was dissolved in distilled water
(2 mL), purified by DEAE-Sepharose CL-4B column (1.6 × 100 cm) and
eluted at the flow rate of 0.6 mL/min. The eluant contained macromo-
lecular judged by HPLC was collected and named as CCP. Its yield was
calculated by formula (1)
WCCP  100
CCP yieldð%Þ ¼ ð1Þ
Wsample
where WCCP and W sample are the weights of CCP and Craterellus
cornucopioides (L.) Pers. powder, respectively.
2.3. The viability of peritoneal macrophages
The female BALB/c mice (18.3 ± 2.2 g) were provided by the Exper-
imental Animal Center of China Academy of Chinese Medical Sciences,
Beijing, China. All animal procedures were performed in accordance
with the Guidelines for Care and Use of Laboratory Animals of “Tianjin
University of Science and Technology” University and approved by the
Animal Ethics Committee of “Animal Ethical and Welfare Committee
(AEWC)”.
Macrophages, which were extracted from mice abdominal cavity,
were examined by Trypan Blue to measure a 95% survival rate for
assay. The viability of peritoneal macrophages was determined by the
MTT assay. The experiments were conducted by the reported methods
[31].
Briefly, the viability of macrophages was determined by the MTT
assay. CCP solution was prepared by cell culture and diluted to various
working concentrations before use. After incubation for 4 h, the non-
adherent cells were removed by PBS washing, and the adherent macro-
phages were stimulated with various concentrations of samples for an-
other 72 h. Then, the cells were incubated with 20 μL MTT solution
(5 mg mL−1) in the medium for 4 h at 37 °C. Viable cells convert the
MTT to formazan, which generates a blue-purple color after dissolving
in 150 μL DMSO. The absorbance at 570 nm was measured with a micro-
plate reader (Thermo, USA). All tests were carried out in six indepen-
dent experiments.
2.4. The phagocytosis activity of peritoneal macrophages
The phagocytic ability of macrophages was measured by 0.1% neu-
tral red uptake. Briefly, CCP solution was prepared by cell culture and di-
luted to various working concentrations before use. After the cells were
cultured with CCP solution for 24, 48 and 72 h, respectively. 100 μL of
neutral red solutions dissolved in 10 mmol L−1 phosphate buffer solu-
tion (PBS) was added and incubated for 2 h. The supernatant was
discarded and the cells in the 96-well plates were washed with PBS.
Then, cell lysis buffer (ethanol and 0.01% acetic acid at the ratio of 1:1
(100 μL per well)) was added to lyse the cells. After the cells were incu-
bated at room temperature for 2 h, the absorbance at 540 nm was mea-
sured with a microplate reader (Thermo, USA).
 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879
Table 1
Primers sequence of polymerase chain reaction (qRT-PCR).
Target gene Forward primer
IL-1β GATGAAGGGCTGCTTCCAAC
IL-8 ATGGCTGCTGAACCAGTAGA
TNF-α CTGAACTTCGGGGTGATCGG
IFN-γ TGAGCAGAGCTCTTGTGGTC
β-Actin TATAAAACCCGGCGGCGCA
2.5. The nitric oxide production and related enzyme activities of peritoneal
macrophages
Nitrite accumulated in the culture medium was measured as an indi-
cator of NO production based on the Griess reaction [32]. In addition, the
LZM, ACP and SDH activities of peritoneal macrophages were evaluated
according to the kit manufacturer's instructions.
2.6. The expression of cytokine gene
The mRNA expression of cytokines IL-1β, IL-8, IFN-γ and TNF-α
were determined by Quantitative real-time PCR (qRT-PCR). Total
RNAs were extracted from peritoneal macrophage with Trizol reagent
(Solarbio, Beijing, China) of different concentrations of CCP (40,
80,160 and 320 μg/mL) groups. The cDNA was synthesized with 5 μg
of total RNA by PrimeScript RT kit (Takara Biological Engineering Com-
pany, Dalian, China) based on the manufacturer's protocol. Specific
primers (Table 1) were designed with Primer5.0 plus and synthesized
by Sangon Biotech (Sangon Biotechnology company, Shanghai, China).
qRT-PCR was conducted using the Mx3000P™ qRT-PCR system (Strata-
gene, USA) and SYBR qRT-PCR kit (Takara Biological Engineering Com-
pany, Dalian, China). The RT-PCR reaction under the following
conditions: 40 cycles of 95 °C for 10 s, 61 °C for 30 s, 72 °C for 30 s,
95 °C for 1 min, 55 °C for 30 s, and 95 °C for 30 s. Data were analyzed
and expressed as relative gene expression to β-actin using the 2−ΔΔCt
method as described previously [29]. The primers used for qRT-PCR ex-
periments were listed in Table 1.
2.7. Western blot analysis
In brief, peritoneal macrophages were inoculated onto six-well cul-
ture plates at 1 × 105 cells/mL with or without CCP (40, 80 and
160 μg/mL). The medium was aspirated after incubation for 48 h.
Then, peritoneal macrophages were washed in cold PBS three times
and lysed with the Nuclear and Cytoplasmic Protein Extraction Kit
(Beyotime, Shanghai, China). Protein concentrations were quantified
Fig. 1. (a) Effects of CCP on the cell viability of peritoneal macrophages. Cells were treated with CCP at various concentrations (0, 20, 40, 80, 160, 320 and 640 μg/mL) for 72 h. (b) Effects of
CCP on the phagocytic activity of peritoneal macrophages. Cells were treated with CCP at various concentrations (0, 20, 40, 80, 160, and 320 μg/mL) for 48 h. The control group cells were
incubated with DMEM medium. **p b 0.01, *p b 0.05 vs. control group. Data were expressed as means ± SE.
873
Reverse primer Product size (bp)
GCTTCTCCACAGCCACAATG 128
CTAGTCTTCGTTTTGAACAG 135
TGCTCCTCCACTTGGTGGTT 113
CGTTCCTCCTTGTGGCCTAA 157
TCATCCATGGCGAACTGGTG 117
with the BCA Protein Assay Kit using bovine serum albumin as a stan-
dard. Lysates were subjected to 10% SDS-PAGE and transferred to nitro-
cellulose NC membranes. After 1 h of blocking with 5% (w/v) nonfat
milk in tris-buffered saline containing Tween 20 (TBST), the NC mem-
branes were incubated overnight at 4 °C with monoclonal antibodies.
Then, the membranes were subsequently washed with TBST and incu-
bated for 1 h at room temperature with the appropriate secondary
anti-bodies conjugated with horseradish. All the primary antibodies
were diluted with PBS by 1000 times (Cell Signaling Technology, Dan-
vers, MA, USA) [33]. Each test was performed in six independent exper-
iments and β-actin was used as the internal control [34].
2.8. The immunofluorescence assay for P-NF-κB p50
The peritoneal macrophages (1 × 105 cells/well) were inoculated on
coverslips which were previous partitioned into a six-well plate and
then treated with CCP solution (0 or 80 μg/mL, 2 mL) for 48 h. After-
wards, peritoneal macrophages were fixed with paraformaldehyde for
20 min and washed with PBS for three times. 2% bovine serum albumin
was used to block cells after permeabilization by 0.2% Triton X-100.
Thereafter, the antibody NF-κB p50 (dilution 1:100) were added at
4 °C overnight after cells were washed three times with PBS. The cells
were incubated with fluorescein FITC-labeled polyclonal goat
antimouse IgG antibody (dilution 1:1000) at 37 °C for 1 h and stained
with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma, St. Louis, MO) on
the following day. Finally, coverslips were scanned by laser scanning
confocal microscopy (LSCM, Nikon, D-Eclipse C1, Tokyo, Japan) after
being washed with PBS three times [35].
2.9. Data analysis
In this study, all the statistical analyses were performed using SPSS
20.0 software (SPSS, Inc., IL, USA). The data were expressed as the
mean ± standard error (SE). One-way ANOVA and t-tests were used
for significance analysis. The values of P b 0.05 were considered statisti-
cally significant.
874 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879

3. Results and discussions 3.4. Effects of CCP on mRNA expression of cytokines in peritoneal
macrophages
3.1. The extraction, purification and purity of CCP
Synthesized and secreted by immune cells and non-immune cells,
The structural information has been reported in our previous study cytokines have broad biological activities regulating both innate and
[29]. The purity of CCP was 91.3%. adaptive immunity [43]. Numerous reports have confirmed that macro-
phages produce cytokines and other bioactive compounds once acti-
vated (such as reactive oxygen/nitrogen species and NO) [44–47].
Importantly, inflammatory cytokines play an essential role in the resis-
3.2. CCP promotes phagocytosis activation of peritoneal macrophages tance of the human body to infections and abnormal cells through either
direct or indirect confrontation via the activation of T-helper cells [48].
The cell vitality of peritoneal macrophages in various polysaccharide In this study, the mRNA expressions of IL-1β, IL-8, IFN-γ and TNF-α
treatment groups were not significantly lower than that of the control were all increased to various degrees with CCP exposure and reached
group indicating no cytotoxicity of CCP (Fig. 1a), the corresponding con- the highest at the concentration of 80 μg/mL compared with the control
centrations were considered as their maximal safe concentration for
macrophages. The phagocytosis on peritoneal macrophages was inves-
tigated to evaluate the immunomodulatory effects of CCP in vitro by
neutral red uptake assay. Compared with the control group, CCP in-
creased the cell phagocytosis at the concentrations of 40–320 μg/mL
and reached maximum at the concentration of 80 μg/mL (**p b 0.01).
Meanwhile, CCP also significantly enhanced the phagocytosis of perito-
neal macrophages with the extension of culture time (24, 48, 72 h) at
80 μg/mL (Fig. 1b). In general, the phagocytosis of peritoneal macro-
phages of BALB/c mice were significantly increased by CCP and reached
the maximum at 48 h, 80 μg/mL of CCP treatment (**p b 0.01). Yang et al.
[36] showed that a sulfated polysaccharide from sea cucumber viscera
process immune-enhancing activity in SCVP-1-induced macrophage acti-
vation via NF-κB pathway. However, it not same as the induction of LPS.
Luo et al. [37] demonstrated that selenium polysaccharides-based nano-
particles could enhance the activation of macrophages to improve im-
mune distinguish the inflammatory effects. In the present study,
results indicated that CCP could improve the peritoneal macrophages
phagocytosis much lower than that in the LPS group in vitro, which con-
firmed the improvement of phagocytosis not related to inflammatory
stimulation, but to the improvement of immune function contrasted
to the results in the literature.

3.3. Effects of CCP on related enzyme activities of peritoneal macrophages

LZM is iconic lytic enzyme on the surface of macrophages, which

could promote phagocytosis [38]. ACP is important hydrolytic enzymes
that participate in signal transduction and energy transformation, and
also regulated nonspecific immunity and nutrient metabolism. SDH, a
respiratory chain enzyme in the tricarboxylic acid (TCA) cycle pathway,
couple with the reduction of ubiquinone (Q)1 to the oxidation of succi-
nate and involved in energy metabolism that regulating ATP synthesis
[39,40].
In current study, the CCP increased the activities of LZM, ACP and
SDH during the experiment (Fig. 2). The activity of LZM and ACP were
increased remarkably in 80 and 160 μg/mL CCP treatment groups com-
pared with the control group (**p b 0.01) (Fig. 2a,b). In addition, the ac-
tivities of LZM activity was higher than the control group (**p b 0.01;
**p b 0.01; **p b 0.01; *p b 0.05) (Fig. 2c). Xue et al. [41] reported that
the Sarcodon imbricatus polysaccharides could enhance catalase, acid
phosphatase (ACP) and lysozyme (LZM) levels of thymus in CTX-
induced immunosuppressive mice. Gao et al. [42] proved that okra poly-
saccharide was correlated with enhancing succinate dehydrogenase
(SDH), adenosine triphosphate (ATP) and adenosine triphosphatase
(ATPase) levels to regulate immune activity. The change of enzyme ac-
tivity was effective indicator of the enhancement of immunomodula-
tory activity, and the similar conclusion was found to above literature
Fig. 2. Effects of CCP on activities of LZM (a), ACP (b) and SDH (c) of peritoneal
reports. The results of enzyme activity further confirmed that CCP pos- macrophages. Cells were treated with CCP at the various concentrations (0, 40, 80, 160,
sessed main principles responsible for the elevation of immunologic and 320 μg/mL) for 48 h. The control group cells were incubated with DMEM medium.
function. **p b 0.01, *p b 0.05 vs. control group. Data were expressed as means ± SE.
 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879 875

3.5. TLR4 was the critical receptor for peritoneal macrophages activation by
CCP

The polysaccharide can't penetrate into cells directly because of its

Fig. 3. Effects of CCP on mRNA expressions of cytokines (IL-1β, IL-8, TNF-α and IFN-γ) in
peritoneal macrophage. qRT-PCR analysis was relative to that of the reference gene (β-
actin). **p b 0.01, *p b 0.05 vs. the control group. Data were expressed as means ± SE.
group (Fig. 3). The IL-8 mRNA production in CCP treatment groups (40,
80, 160 and 320 μg/mL) were significantly higher than the control group
(**p b 0.01). The relative mRNA expression of IL-1β and IFN-γ were
markedly elevated with the addition of CCP, compared with the control
group (**p b 0.01; **p b 0.01; **p b 0.01; *p b 0.05). Furthermore, the CCP
dramatically promoted TNF-α mRNA expression compared with the
control group (*p b 0.05; **p b 0.01; **p b 0.01; **p b 0.01). Gu et al.
[49] found that Angelica sinensis polysaccharide nanoparticles signifi-
cantly activated macrophages as an immunopotentiator by promoting
the production of IL-1β and IL-12 cytokines. In addition, Tabarsa et al.
[50] reported that Tornabea scutellifera polysaccharides effectively in-
duced RAW264.7 cells to release IL-6, IL-1β and TNF-α. In this study,
the mRNA upregulation of cytokines as a result of CCP exposure was
consistent with previous studies, which strongly suggesting CCP upreg-
ulated mRNA expression of cytokines to activate peritoneal macro-
phages. Additionally, the presence of phosphorylated IKKα/β, MEK,
and NFκB p50 in CCP-treated peritoneal macrophages was explored to
provide insights into the mechanism.
large molecular mass. Therefore, the polysaccharide need to combine
with cell membrane receptors to mediate intracellular events and
thereby trigger the immune response. Several PRRs (including TLR2,
TLR4 and Dectin-1) have been reported to participate in signal trans-
mission of macrophages [51]. TLRs play a key role in innate immune re-
sponses to enhance the body's defense system against bacterial and
viral infections. It was reported that several natural polysaccharides in-
duced cytokine production and activated the transcription factor NF-κB
via TLR4 in macrophages [52,53].
To investigate which PRRs sensed CCP in macrophages, several PRRs
neutralizing antibodies were used to block receptor-mediated signaling
in peritoneal macrophages. It was found that TLR4 regulates the CCP-
induced increase of NO levels in peritoneal macrophages by using
function-blocking antibodies of TLR2, TLR4 or Dectin-1 (C29, TAK242,
Laminarin) (Fig. 4a).
The activation of TLR4 directly induces the expression of cyto-
kines as well as activates the cascade of immunoregulatory path-
way and key downstream transcription factors (e.g. MyD88, and
NF-κBs) [54]. Wang et al. [55] reported that the polysaccharide
from Phellinus igniarius could significantly increase the expression
of MyD88 and TRIF dependent cytokines via stimulating TLR4 path-
ways. Yang et al. [56] found that the polysaccharide isolated from
the fruits of Physalis alkekengi L. induced RAW264.7 macrophages
activation via TLR2 and TLR4-mediated MAPK and NF-κB signaling
pathways, and the activation was decreased once TLR2 and TLR4
were blocked. Therefore, the protein expressions of TLR4-
mediated signaling pathway, including TLR4, MyD88, P-IKKα/β,
P-NF-κB p50, TAK1 and P-MEK was determined to elucidate the
immunomodulatory mode of CCP, It showed that the TLR4-NF-κB
signaling pathway was activated after administration CCP to peri-
toneal macrophages. The protein expressions of TLR4, MyD88 and
TAK1 were increased in CCP treatment groups compared to the
control group (Fig. 4b), suggesting that the modulation of TLR4,

Fig. 4. The protein expressions of TLR4, MyD88, TAK1, P-MEK, P-IKKα/β and P-NF-κB p50 by western blotting. (a) TLR4 was critical for macrophage activation. Peritoneal macrophages
were pretreated with TLR2, TLR4 and Dectin-1 function-blocking antibodies (20 μg/mL) for 2 h, followed by incubation with 80 μg/mL of CCP for 48 h. *p b 0.05, **p b 0.01 vs. CCP
group. #p b 0.05, ##p b 0.01 vs. control group. Data were expressed as means ± SE. (b) Effect of CCP on the expression of TLR4, MyD88 and TAK1 of peritoneal macrophages. Cells
were treated with CCP (40, 80 and 160 μg/mL) for 48 h. The control group cells were incubated with DMEM medium. The expression of protein was analyzed by Western blot.
(c) Effect of CCP on the expression of phospho-IKKα/β, phospho-MEK and phospho-NF-κB p50 of peritoneal macrophages. β-actin was used as an equal loading control. *p b 0.05,
**p b 0.01 vs. the control group. Data were expressed as means ± SE.
876 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879

MyD88 and TAK1 were linked to immune adjuvant activity of CCP.
The result was highly consistent to those reported in the literature
which linked to its immunoregulatory activities.
Additionally, the effect of CCP on stress-activated protein ki-
nase pathway was examined by measuring the phosphorylation
of IKKα/β, MEK and NF-κB p50. It showed the phosphorylation of
these proteins were affected compared with the control group
(Fig. 4c).
Based on the above results and combined with literature analysis,
this study concluded the TLR4-NFκB signaling pathway was involved
in immune regulation. The clarification of upstream and downstream
relationships between proteins was necessary.
3.6. Effects of PRR neutralizing antibodies and signaling pathway inhibitors
on CCP-induced protein production in peritoneal macrophages
The results above demonstrated TLR4, MyD88, TAK1, P-IKKα/β and
P-MEK were involved in CCP-induced peritoneal macrophage activa-
tion. Nevertheless, the intracellular pathway for the cascade between
upstream and downstream proteins was undefined. Therefore, to assess
the location of TLR4 and phosphorylated cell-signaling proteins in the
activation pathway, peritoneal macrophages were treated with 5 μM
TLR4 inhibitor (TAK242) or P-IKKα/β inhibitor (Ser176) before exposed
to CCP. Based on the results, TLR4 was located upstream of IKKα/β (in-
hibitor of NFκB kinase), which in turn phosphorylated and induced NF-

Fig. 5. (a) Effect of TLR4 inhibitor TAK242 on CCP-induced proteins production in peritoneal macrophages. (b) Effect of P-IKKα/β inhibitor Ser176 on CCP-induced proteins production in
peritoneal macrophages. The protein expressions were analyzed by Western blot. Cells were treated with 80 μg/mL CCP for 48 h in the presence or absence of 5 μM TAK242 or Ser176. The
β-actin was used as an equal loading control. *p b 0.05, **p b 0.01 vs. the control group. Data were expressed as means ± SE.
 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879 877

Fig. 6. Effect of CCP on the expression of P-NF-κB p50 in peritoneal macrophages. Immunofluorescence staining demonstrating the effects of CCP (80 μg/mL) on subcellular expression of P-
NF-κB p50 in peritoneal macrophages. Visualization of the P-NF-κB p50 fluorescence was recorded by using a LSCM, bar = 50 μm (×400).

κB activation in peritoneal macrophages. In this study, CCP induced the
expression of TLR4, MyD88, TAK1, P-IKKα/β and P-MEK, as well as pro-
moted NF-κB p50 translocation into the nucleus in macrophages. How-
ever, pre-incubation with TAK242 (inhibitor of TLR4) clearly inhibited
the upregulation of MyD88, TAK1, P-IKKα/β, P-MEK and P-NF-κB p50.
The phosphorylation of molecules involved in NF-κB pathway was sig-
nificantly up-regulated after CCP treatment. In addition, the effects of
CCP on the macrophages almost completely disappeared after treating
the cells with the TLR4 antagonist TAK-242. Therefore, the production
of MyD88, TAK1, P-IKKα/β, P-MEK and P-NF-κB p50 was dependent
on TLR4.
Additionally, the expression of P-IKKα/β regulated the NFκB signal-
ing pathway as demonstrated by treatment with Ser176 reducing P-
IKKα/β and P-MEK in the endochylema (Fig. 5b). Therefore, we as-
sumed phosphorylated IKKα/β may act as an upstream regulator of
CCP induction of the phosphorylation of MEK in peritoneal macro-
phages. In contrast to P-IKKα/β and P-MEK, the production of TAK1
was not decreased with the addition of the IKKα/β inhibitor, indicating
TLR4, MyD88, and TAK1 located upstream of IKKα/β. Taken together,
the results suggested the immunological activity of CCP mediated by
activation of TLR4, MyD88, and TAK1 as well as phosphorylation of
IKKα/β and MEK to translocate P-NFκB p50 into nucleus.
3.7. CCP activated NFκB p50 nuclear translocation factor in peritoneal
macrophages
When cells were unstimulated, NFκBs existed in cytosol with its in-
hibitory protein subunit (IκBα) [57]. After stimulation, IκBα was phos-
phorylated by IKKs and was subsequently degraded in the proteasome,
leading to phosphorylation and translocation of NFκBs into the nucleus
[58]. The nuclear translocation of p50 was studied in CCP-treated perito-
neal macrophages by confocal laser microscopy (Fig. 6). The confocal
microscopy data revealed intensity of P-NF-κB p50 fluorescence accu-
mulated in the nucleus of cells treated with CCP significantly stronger
than that of control group. The results above indicated CCP could induce
NF-κB activation by increasing the expression of phosphorylation in
peritoneal macrophages, which was the precondition of nuclear tran-
scription and consistent with above results.
Moreover, as shown in Fig. 7, the mechanism study suggested the
immunological activity of CCP was mediated by TLR4 and mitogen

Fig. 7. The schematic of the immunoregulatory response of peritoneal macrophages induced by CCP.
878 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879
activated protein kinases to NF-κB pathways. CCP had an effective and
beneficial stimulatory effect either on the production of NO, related en-
zymes, cytokines and protein expressions of TLR4-NFκB p50 pathway in
peritoneal macrophages. The finding was expected to expand the
knowledge on the immunomodulatory mechanism of CCP acted as po-
tent adjuvant and agent.
4. Conclusion
In the last decade, polysaccharides isolated and purified from fungi
have attracted much attention due to their biological activity. Herein,
the immunoregulatory mechanism induced by CCP in vitro was investi-
gated for the first time. It was found CCP was a functional component of
Craterellus cornucopioides (L.) Pers. The phagocytosis assay showed the
phagocytosis of peritoneal macrophages was increased (40–320 μg/mL
CCP on peritoneal macrophages) and reached maximum at 48 h by
80 μg/mL of CCP. Therefore, 80 μg/mL of CCP was chosen to incubate
peritoneal macrophages. The following results showed peritoneal mac-
rophages incubated with CCP exhibited considerable stimulation
through NF-κB signaling pathway leading to the release of related en-
zymes, NO and cytokines. In addition, we identified the macrophage ac-
tivation pathway by using neutralizing antibodies and chemical
inhibitors. The results indicated CCP-induced immunoregulatory signal-
ing depended on TLR4-NF-κB pathway. The immunofluorescence and
Western blot assay indicated CCP activated phosphorylated NFκB p50
and provided the possibility for translocation into the nucleus of perito-
neal macrophages. Overall, the current findings demonstrated polysac-
charides from Craterellus cornucopioides (L.) Pers. were potential
biological response modifiers. The administration of CCP could be devel-
oped as a promising biological additive candidate and an effective way
to improve the immunocompetence of immunosuppressive patients
in food nutrition industry.
Declaration of competing interest
The authors declare no competing financial interest.
Acknowledgment
Chunling Wang and Mingzhu Guo designed and conceived the ex-
periments; Mingzhu Guo performed the experiments and wrote the pa-
per; Meng Meng, Jiahao Zhao and Xu Wang contributed reagents/
materials/analysis tools; All authors read and approved the final
manuscript.
Funding
This study was supported by the National “13th Five-Year” Plan for
Science & Technology Support (grant number 2016YFNC010104); State
Key Laboratory of Food Nutrition and Safety, Tianjin University of Sci-
ence & Technology (grant number 18ZYPTJC00020; 17YDLJNC00130;
17PTSYJC00080). This research was also funded by the Open Fund from
the State Key Lab of Food Nutrition and Safety, Tianjin University of Sci-
ence and Technology (grant number SKLFNS-KF-201820).
References
[1] S.S. Ferreira, C.P. Passos, P. Madureira, M. Vilanova, M.A. Coimbra, Structure-function
relationships of immunostimulatory polysaccharides: a review, Carbohydr. Polym.
132 (2015) 378–396.
[2] T. Ohta, K. Kusano, A. Ido, C. Miura, T. Miura, Silkrose: a novel acidic polysaccharide
from the silkmoth that can stimulate the innate immune response, Carbohydr.
Polym. 136 (2016) 995–1001.
[3] R.A. van Dijk, K. Rijs, A. Wezel, J.F. Hamming, F.D. Kolodgie, R. Virmani, A.F.
Schaapherder, J.H. Lindeman, Systematic evaluation of the cellular innate immune
response during the process of human atherosclerosis, J. Am. Heart Assoc. 5 (2016).
[4] Y. Ma, K. Zhang, F. Ren, J. Wang, Developmental fluoride exposure influenced rat's
splenic development and cell cycle via disruption of the ERK signal pathway,
Chemosphere 187 (2017) 173–180.
[5] Y. Chen, F. Yao, K. Ming, D.Y. Wang, Y.L. Hu, J.G. Liu, Polysaccharides from Traditional
Chinese Medicines: Extraction, urification, Modification, and Biological Activity,
MOLECULES 21 (2016) 1705.
[6] J.A. Willment, G.D. Brown, C-type lectin receptors in antifungal immunity, Trends
Microbiol. 16 (2008) 27–32.
[7] K. Vijay, Toll-like receptors in immunity and inflammatory diseases: past, present,
and future, Int. Immunopharmacol. 59 (2018) 391–412.
[8] W. Wei, H.T. Xiao, W.R. Bao, D.L. Ma, C.H. Leung, X.Q. Han, C.H. Ko, C.B. Lau, C.K.
Wong, K.P. Fung, P.C. Leung, Z.X. Bian, Q.B. Han, TLR-4 may mediate signaling path-
ways of Astragalus polysaccharide RAP induced cytokine expression of RAW264.7
cells, J. Ethnopharmacol. 179 (2016) 243–252.
[9] D. Bernarreggi, S. Pouyanfard, D.S. Kaufman, Development of innate immune cells
from human pluripotent stem cells, Exp. Hematol. 71 (2019) 13–23.
[10] L. Gao, Y. Han, H. Deng, W. Hu, H. Zhen, N. Li, N. Qin, M. Yan, W. Wu, B. Liu, B. Zhao,
Q. Pang, The role of a novel C-type lectin-like protein from planarian in innate im-
munity and regeneration, Dev. Comp. Immunol. 67 (2017) 413–426.
[11] S. Xu, R. Tian, Y. Lin, Z. Yu, Z. Zhang, X. Niu, X. Wang, G. Yang, Widespread positive
selection on cetacean TLR extracellular domain, Mol. Immunol. 106 (2019)
135–142.
[12] A. Vizzini, F. Di Falco, D. Parrinello, M.A. Sanfratello, M. Cammarata, Transforming
growth factor β (CiTGF-β) gene expression is induced in the inflammatory reaction
of Ciona intestinalis, Dev. Comp. Immunol. 55 (2016) 102–110.
[13] E. Araldi, M. Fernández-Fuertes, A. Canfrán-Duque, W. Tang, G.W. Cline, J. Madrigal-
Matute, J.S. Pober, M.A. Lasunción, D. Wu, C. Fernández-Hernando, Y. Suárez,
Lanosterol modulates TLR4-mediated innate immune responses in macrophages,
Cell Rep. 19 (2017) 2743–2755.
[14] J. Baardman, S.G.S. Verberk, K.H.M. Prange, M. van Weeghel, S. van der Velden, D.G.
Ryan, R.C.I. Wüst, A.E. Neele, D. Speijer, S.W. Denis, M.E. Witte, R.H. Houtkooper, L.A.
O’neill, E.V. Knatko, A.T. Dinkova-Kostova, E. Lutgens, M.P.J. de Winther, J. Van den
Bossche, A defective pentose phosphate pathway reduces inflammatory macro-
phage responses during hypercholesterolemia, Cell Rep. 25 (2018) 2044–2052.e5.
[15] S. Goulopoulou, C.G. Mccarthy, R.C. Webb, Toll-like receptors in the vascular system:
sensing the dangers within, Pharmacol. Rev. 68 (2016) 142.
[16] Y.J. Zeng, H.R. Yang, H.F. Wang, M.H. Zong, W.Y. Lou, Immune enhancement activity
of a novel polysaccharide produced by Dendrobium officinale endophytic fungus
Fusarium solani DO7, J. Funct. Foods 53 (2019) 266–275.
[17] M. Jin, K. Zhao, Q. Huang, P. Shang, Structural features and biological activities of the
polysaccharides from Astragalus membranaceus, Int. J. Biol. Macromol. 64 (2014)
257–266.
[18] C.Y. Shen, J.G. Jiang, L. Yang, D.W. Wang, W. Zhu, Anti-ageing active ingredients from
herbs and nutraceuticals used in traditional Chinese medicine: pharmacological
mechanisms and implications for drug discovery, Brit. J. Pharmacol. 174 (2016)
1395.
[19] A.O. Tzianabos, Polysaccharide immunomodulators as therapeutic agents: structural
aspects and biologic function, Clin. Microbiol. Rev. 13 (2000) 523–533.
[20] W.C. Zeng, Z. Zhang, L.R. Jia, Antioxidant activity and characterization of antioxidant
polysaccharides from pine needle (Cedrus deodara), Carbohydr. Polym. 108 (2014)
58–64.
[21] J. Cao, D. Tang, Y. Wang, X. Li, L. Hong, C. Sun, Characteristics and immune-
enhancing activity of pectic polysaccharides from sweet cherry (Prunus avium),
Food Chem. 254 (2018) 47–54.
[22] L. Wang, L. Chen, J. Li, L. Di, H. Wu, Structural elucidation and immune-enhancing ac-
tivity of peculiar polysaccharides fractioned from marine clam Meretrix meretrix
(Linnaeus), Carbohydr. Polym. 201 (2018) 500–513.
[23] F. Costa-Silva, G. Marques, C.C. Matos, A.I.R.N.A. Barros, F.M. Nunes, Selenium con-
tents of Portuguese commercial and wild edible mushrooms, Food Chem. 126
(2011) 91–96.
[24] R. Liu, Z.Y. Zhou, J.K. Liu, Three new keto esters from cultures of the basidiomycete
Craterellus cornucopioides, Chin. J. Nat. Med. 8 (2) (2010) 88–90.
[25] H. Guo, Q.P. Diao, D.Y. Hou, Z.H. Li, Z.Y. Zhou, T. Feng, J.K. Liu, Sesquiterpenoids from
cultures of the edible mushroom Craterellus cornucopioides, Phytochem. Lett. 21
(2017) 114–117.
[26] T. Costea, Chemical composition, antioxidant activity and cytotoxic effects of
Romanian Craterellus Cornucopioides (L.) Pers. mushroom, Farmacia 68 (2)
(2020) 340–347.
[27] M. Kosanić, B. Ranković, T. Stanojković, M. Radović-Jakovljević, A. Ćirić, D. Grujičić, O.
Milošević-Djordjević, Craterellus cornucopioides edible mushroom as source of bio-
logically active compounds, Nat. Prod. Commun. 14 (5) (2019) 1934578X1984361.
[28] W.W. Yang, L.M. Wang, L.L. Gong, Y.M. Lu, W.J. Pan, Y. Wang, W.N. Zhang, Y. Chen,
Structural characterization and antioxidant activities of a novel polysaccharide frac-
tion from the fruiting bodies of Craterellus cornucopioides, Int. J. Biol. Macromol.
117 (2018) 473–482.
[29] M.Z. Guo, M. Meng, S.Q. Duan, C.C. Feng, C.L. Wang, Structure characterization, phys-
icochemical property and immunomodulatory activity on RAW264.7 cells of a novel
triple-helix polysaccharide from Craterellus cornucopioides, Int. J. Biol. Macromol.
126 (2019) 796–804.
[30] M.Z. Guo, M. Meng, C.C. Feng, X. Wang, C.L. Wang, A novel polysaccharide obtained
from Craterellus cornucopioides enhances immunomodulatory activity in immuno-
suppressive mice models via regulation of the TLR4-NF-kappaB pathway, Food
Funct. 10 (2019) 4792–4801.
[31] L.X. He, J.W. Ren, R. Liu, Q.H. Chen, J. Zhao, X. Wu, Z.F. Zhang, J.B. Wang, G. Pettinato,
Y. Li, Ginseng (Panax ginseng Meyer) oligopeptides regulate innate and adaptive
 M. Guo et al. / International Journal of Biological Macromolecules 160 (2020) 871–879
immune responses in mice via increased macrophage phagocytosis capacity, NK cell
activity and Th cells secretion, Food Funct. 8 (2017) 3523–3532.
[32] L. Han, J. Yu, Y. Chen, D. Cheng, X. Wang, C. Wang, Immunomodulatory activity of
docosahexenoic acid on RAW264.7 cells activation through GPR120-mediated sig-
naling pathway, J. Agric. Food Chem. 66 (4) (2018) 926–934.
[33] D. Ren, D. Lin, A. Alim, Q. Zheng, X. Yang, Chemical characterization of a novel poly-
saccharide ASKP-1 from Artemisia sphaerocephala Krasch seed and its macrophage
activation via MAPK, PI3k/Akt and NF-kappaB signaling pathways in RAW264.7
cells, Food Funct. 8 (2017) 1299–1312.
[34] S.J. Price, P. Pangloli, V.P. Dia, Pepsin-pancreatin hydrolysis reduced the ability of
lunasin-enriched material to inhibit activation of the inflammasomes in THP-1
human macrophages, Food Funct. 8 (2017) 4449–4458.
[35] X. Cao, M. Zhou, C. Wang, L. Hou, B. Zeng, Lectin purified from Musca domestica
pupa up-regulates NO and iNOS production via TLR4/NF-κB signaling pathway in
macrophages, Int. Immunopharmacol. 11 (2011) 399–405.
[36] D. Yang, F. Lin, Y. Huang, J. Ye, M. Xiao, Separation, purification, structural analysis
and immune-enhancing activity of sulfated polysaccharide isolated from sea cu-
cumber viscera, Int. J. Biol. Macromol. 155 (2020) 1003–1018.
[37] Y. Luo, Z. Ren, R. Bo, X. Liu, J. Zhang, R. Yu, S. Chen, Z. Meng, Y. Xu, Y. Ma, Y. Huang, T.
Qin, Designing selenium polysaccharides-based nanoparticles to improve immune
activity of Hericium erinaceus, Int. J. Biol. Macromol. 143 (2020) 393–400.
[38] K. Chen, W.D. Jiang, P. Wu, Y. Liu, S.Y. Kuang, L. Tang, W.N. Tang, Y.A. Zhang, X.Q.
Zhou, L. Feng, Effect of dietary phosphorus deficiency on the growth, immune func-
tion and structural integrity of head kidney, spleen and skin in young grass carp
(Ctenopharyngodon idella), Fish Shellfish Immun 63 (2017) 103–126.
[39] P. Jin, H. Zhu, J. Wang, J. Chen, X. Wang, Y. Zheng, Effect of methyl jasmonate on en-
ergy metabolism in peach fruit during chilling stress, J. Agric. Food Chem. 93 (2013)
1827–1832.
[40] Q. Zhou, C. Zhang, S. Cheng, B. Wei, X. Liu, S. Ji, Changes in energy metabolism ac-
companying pitting in blueberries stored at low temperature, Food Chem. 164
(2014) 493–501.
[41] W. Xue, W. Zhuqian, W. Honghong, J. Wei, T. Lesheng, S. Jia, Y. Xige, W. Di, Sarcodon
imbricatus polysaccharides protect against cyclophosphamide-induced immuno-
suppression via regulating Nrf2-mediated oxidative stress, Int. J. Biol. Macromol.
120 ( (2018) 736–744.
[42] H. Gao, W. Zhang, B. Wang, A. Hui, B. Du, T. Wang, L. Meng, H. Bian, Z. Wu, Purifica-
tion, characterization and anti-fatigue activity of polysaccharide fractions from okra
(Abelmoschus esculentus (L.) Moench), Food Funct. 9 (2018) 1088–1101.
[43] P. Dehghan, S. Tolouie, B. Baradaran, S. Nami, H. Morovati, TLR-2, IL-10 and IL-17-
mediated immunity in experimental chemotherapy murine model of systemic can-
didiasis; cyclophosphamides' impact and roles, Microb. Pathog. 119 (2018)
183–192.
[44] J. Habijanic, M. Berovic, B. Boh, M. Plankl, B. Wraber, Submerged cultivation of
Ganoderma lucidum and the effects of its polysaccharides on the production of
human cytokines TNF-α, IL-12, IFN-γ, IL-2, IL-4, IL-10 and IL-17, New Biotechnol.
32 (2015) 85–95.
[45] E. Goillot, J. Raingeaud, A. Ranger, R.I. Tepper, R.J. Davis, E. Harlow, I. Sanchez,
Mitogen-activated protein kinase-mediated Fas apoptotic signaling pathway, Proc.
Natl. Acad. Sci. U. S. A. 94 (1997) 3302–3307.
879
[46] S. Fuu, C. Po-Jung, H. Kuang-Yang, C. Kah-Lock, H. Wan-Ting, T. Chiao-Yin, C. Yin-
Fang, C. Hui-Chung, C. Hui-Hsin, Purification, cloning, and functional characteriza-
tion of a novel immunomodulatory protein from Antrodia camphorata (bitter
mushroom) that exhibits TLR2-dependent NF-κB activation and M1 polarization
within murine macrophages, J. Agric. Food Chem. 57 (2009) 4130–4141.
[47] C. Liu, J. Chen, L. Chen, X. Huang, P.C. Cheung, Immunomodulatory activity of
polysaccharide-protein complex from the mushroom sclerotia of Polyporus
rhinocerus in murine macrophages, J. Agric. Food Chem. 64 (2016) 3206–3214.
[48] Z. Liu, J. Xing, Y. Huang, R. Bo, S. Zheng, L. Luo, Y. Niu, Y. Zhang, Y. Hu, J. Liu, Y. Wu, D.
Wang, Activation effect of Ganoderma lucidum polysaccharides liposomes on mu-
rine peritoneal macrophages, Int. J. Biol. Macromol. 82 (2016) 973–978.
[49] P. Gu, A. Wusiman, S. Wang, Y. Zhang, Z. Liu, Y. Hu, J. Liu, D. Wang,
Polyethylenimine-coated PLGA nanoparticles-encapsulated Angelica sinensis poly-
saccharide as an adjuvant to enhance immune responses, Carbohydr. Polym. 223
(2019), 115128. .
[50] M. Tabarsa, S. You, M. Abedi, N. Ahmadian, C. Li, N. Talapphet, The activation of
RAW264.7 murine macrophage and natural killer cells by glucomannogalactan
polysaccharides from Tornabea scutellifera, Carbohydr. Polym. 219 (2019) 368–377.
[51] Y. Meng, J. Yan, G. Yang, Z. Han, G. Tai, H. Cheng, Y. Zhou, Structural characterization
and macrophage activation of a hetero-galactan isolated from Flammulina velutipes,
Carbohydr. Polym. 183 (2018) 207–218.
[52] Y. Yao, J. Yao, Z. Du, P. Wang, K. Ding, Structural elucidation and immune-enhancing
activity of an arabinogalactan from flowers of Carthamus tinctorius L, Carbohydr.
Polym. 202 (2018) 134–142.
[53] J.B. Lee, T. Tanikawa, K. Hayashi, M. Asagi, Y. Kasahara, T. Hayashi, Characterization
and biological effects of two polysaccharides isolated from Acanthopanax
sciadophylloides, Carbohydr. Polym. 116 (2015) 159–166.
[54] M. Campolo, I. Paterniti, R. Siracusa, A. Filippone, E. Esposito, S. Cuzzocrea, TLR4 ab-
sence reduces neuroinflammation and inflammasome activation in Parkinson's dis-
eases in vivo model, Brain Behav. Immun. 76 (2019) 236–247.
[55] Y.Q. Wang, J.B. Mao, M.Q. Zhou, Y.W. Jin, C.H. Lou, Y. Dong, D. Shou, Y. Hu, B. Yang,
C.Y. Jin, H.C. Shi, H.J. Zhao, C.P. Wen, Polysaccharide from Phellinus igniarius acti-
vates TLR4-mediated signaling pathways in macrophages and shows immune adju-
vant activity in mice, Int. J. Biol. Macromol. 123 (2019) 157–166.
[56] F. Yang, X. Li, Y. Yang, S.M. Ayivi-Tosuh, F. Wang, H. Li, G. Wang, A polysaccharide
isolated from the fruits of Physalis alkekengi L. induces RAW264.7 macrophages ac-
tivation via TLR2 and TLR4-mediated MAPK and NF-kappaB signaling pathways, Int.
J. Biol. Macromol. 140 (2019) 895–906.
[57] M.H. Pan, S.Y. Lin-Shiau, J.K. Lin, Comparative studies on the suppression of nitric
oxide synthase by curcumin and its hydrogenated metabolites through down-
regulation of IκB kinase and NFκB activation in macrophages, Biochem. Pharmacol.
60 (2000) 1665–1676.
[58] Q. Li, Q. Lu, V. Bottero, G. Estepa, L. Morrison, F. Mercurio, I.M. Verma, Enhanced NF-
κB activation and cellular function in macrophages lacking IκB kinase 1 (IKK1), P.
Natl. Acad. Sci. USA 102 (2005) 12425–12430.