BISC Lab Manual

BIOLOGICAL SCIENCES 101
GENERAL BIOLOGY
LAB MANUAL
Fall 2023 Edition
© Thong and Lam, with additions & modifications

by Hollmann, Sharp, Barley, Barker, Mladenovic & Becalska
Simon Fraser University, 2023
STUDENT INFORMATION
Student Name: ____________________________________
Student Number: ____________________________________
Student email: ______________________________________
Lab section: Day ________________________

Time ________________________
Room ________________________
Tutorial Section: Day ________________________

Time ________________________
Room ________________________
Lab Instructor: Name ____________________________________

Office ____________________________________
Office Hours _______________________________
Phone Number _____________________________
E-Mail ____________________________________
TA: Name ____________________________________

Office ____________________________________
Office Hours _______________________________
Phone Number _____________________________
E-Mail ____________________________________
Fall 2023. All SFU BISC101 lab materials are © SFU course instructors; not for distribution outside the course. Pg. 2
BISC 101 LAB CHECK-OUT
WEEK: CHECK-OUT:
TWO
THREE
FOUR
FIVE
SEVEN
EIGHT
NINE
TEN
ELEVEN
TWELVE
BISC 101 LAB SCHEDULE FALL 2023
WEEK ONE. Sept 4-6. NO LABS

WEEK TWO. Sept 10-15. Introduction & Exploring the unknown
WEEK THREE. Sept 17-22. Experimental design & research project planning
WEEK FOUR. Sept 24-29. Cell membrane function & structure
WEEK FIVE. Oct 1-6. DNA structure, micropipetting, & agarose gel electrophoresis
WEEK SIX. Oct 8-13. NO IN-PERSON LABS
WEEK SEVEN. Oct 15-20. Enzymes
WEEK EIGHT. Oct 22-27. Research project— project consultation & data analysis
WEEK NINE. Oct 29-Nov 3. Plant biology
WEEK TEN. Nov 5-10. Photosynthetic pigments
WEEK ELEVEN. Nov 12-17. Animal biology— excretory & digestive systems
WEEK TWELVE. Nov 19-24. Animal biology— respiratory & circulatory system
WEEK THIRTEEN. Nov 26-Dec 1. LAB EXAM
BISC 101 LAB + TUTORIAL MARK BREAKDOWN FALL 2023
7% LAB & TUTORIAL PREPARATION & PARTICIPATION (INCLUDING TUTORIAL

PARTICIPATION, PRE-LAB QUIZ, & LAB CHECK-OUT)
10% TEAM PROJECT
23% LAB EXAM
40% LAB TOTAL OF BISC 101 MARK
To be able to pass BISC101, you must pass the overall lab+tutorial component of the
course (with a grade of >50%).
BISC 101 WELCOME
Welcome to the Lab portion of BISC 101, one of our foundational General Biology
courses. This course provides a foundation in three broad topics: cell and molecular
biology, animal form and function, and plant form and function. Each week in labs, you’ll
have the opportunity to apply terms and concepts that relate to material from lectures.
Even more importantly, you’ll have the opportunity to do science. This includes
everything from making predictions, to designing experiments, to using equipment and
following protocols (i.e., scientific instructions), to interpreting and communicating
results.
Labs are fast paced. It is important that you come prepared, attend every week, and
make time to review what you’ve learned regularly. This will reinforce your learning and
ensure that you’re ready for the end of semester lab exam.
As illustrated in the figure below, the goals for the lab are that you are able to:
• Apply the scientific method to explore a research question
• Connect structure to function at the level of molecules, cells and organisms
• Perform basic lab skills common in a biology laboratory
• Demonstrate safe, professional, and collaborative laboratory conduct
• Communicate effectively in written and oral formats, employing a scientific

vocabulary
Weekly Student Guide
The Lab portion of the course has 4 parts:
1. Weekly Lab Preparation Exercises, to complete before your lab

2. Weekly In-lab Activities, to do each week during your scheduled lab time
3. A Team Project
4. A Lab Exam
Here are the details for each:
1. Lab Preparation Exercises

It is expected that you come to each lab ready to begin the day’s experiments. This
includes thoroughly reading through the lab manual before class, such that you
understand the purpose, as well as the process of the tasks you will be completing.
Each week, material will be posted to the course Canvas site to guide your
preparation. This might elaborate on the lab itself, guide you through work to be done
prior to your weekly scheduled lab, or direct you to an outside resource. Each
module will include a link to a pre-lab quiz, based on your preparation, that you must
complete BEFORE attending lab each week (due by midnight the night before your
scheduled lab section). Late pre-lab quizzes will not be accepted and are
automatically given a zero on Canvas.
2. In-Lab Activities. This is what you will do IN lab each week.

In lab, you will work through the activities in the lab manual, typically with a group of
students.
• Activities. These may include conducting experiments, observing prepared
materials (slides, models, specimens), or discussing biological concepts in
small groups.
• Note-taking. Be sure to answer all questions, take notes, and/or make
drawings in your lab manual as you go. It is OK to take photos of lab materials
in addition to viewing the material but note that photos are not a good
substitute for interacting with the material.
• Check-in. Be sure to check experimental results, and/or discuss your answers
with the lab instructor and/or TAs in lab or in tutorial.
• Check-out. Before you leave the lab, show your lab manual to your lab
instructor or TA. If you have satisfactorily completed the day’s activities, your
lab manual will be stamped. Failure to check-out of lab will result in a grade
reduction on the lab preparation component of the course.
• Review. Discuss the answers to the questions in the lab manual with your
peers, your lab instructor and your TA.
3. Team Project
With your team, you will design, execute, analyze and present a research project
based on course material. There are two labs devoted to the project, but you will
carry out the experiments themselves on your own time.
4. Lab Exam
You will write the lab exam during the last week of labs, during your scheduled lab
time slot. The exam will test you on material from both lab preparation and in lab
activities and could include identifying and interpreting specimens you’ve seen in lab
(e.g., microscope slides), applying concepts, drawing conclusions from experimental
results, or using equipment. Your lab instructor will provide additional information
closer to your lab exam date.
Attendance and Punctuality

Laboratory attendance is mandatory. Your absence affects your team as a whole.
Exceptions will be made for students who:
• cannot come to campus due to symptoms of COVID-19 or exposure to a

confirmed case of COVID-19
• have a medical reason other than COVID-19 that prevents participation in the
laboratory
• have another excusable absence
Students must notify the lab instructor (Megan Barker, via Canvas Inbox) as soon as
possible in the event of a missed lab, or before the lab if possible. You will still be
responsible for the material covered. Makeup labs are unlikely due to limited space.
At the start of each week’s lab, there will be a pre-lab talk given by your laboratory
instructor which will outline the day’s activities, provide additional background
information, go over safety procedures, and demonstrate techniques and use of
equipment. Because of the importance of the pre-lab talk, it is imperative that you are in
the lab at the start of each week’s class. If you are late for the lab by more than 5
minutes, you may receive a grade reduction on the lab preparation component of the
course. Depending on how late you arrive, your instructor might not allow you to enter
the lab at their discretion. In this case, your attendance will be recorded as an
unexcused absence.
Student Responsibilities
Food and Drink. Open food and drink (including water bottles) are NOT permitted in the
lab. Please leave all food and drink outside the lab, or out of sight in your bag.
Safety. Follow all safety guidelines and information provided. Report any injury, no
matter how slight, to the lab instructor.
Jackets, bags, and personal items. To keep the benches and stools clear for
movement around the lab, please put your bags/jackets/etc. on the side tables or in the
space provided at the back of the lab.
Equipment care. Please follow instructions carefully for all equipment, and ASK if you
are unsure or need assistance. If any of the equipment becomes damaged or is not
working properly, let your lab instructor or TA know.
Distractions. It is important that you remain focused and on task in the lab. Please step
out into the hallway if you have urgent business that is not related to the lab.
If you are unsure about something, ask your TA or Lab Instructor.
Academic Honesty
Academic Honesty is a condition of continued membership in the academic community.
Academic Dishonesty is misrepresentation with the intent to deceive or without regard to
the source or accuracy of statements. In the context of BISC 101, Academic Dishonesty
may include (but is not limited to):
• Copying from another student, or allowing another student to copy from you on
exams (e.g. including the lab exam)
• Passing off someone else’s work as your own (e.g. copying a classmate’s Lab
Prep answers)
• Sharing of confidential material without permission (e.g. distributing answers to
Lab Manual questions)
• Submitting falsified documents (e.g. illegitimate doctors’ notes)
Students are responsible for informing themselves about SFU’s Academic Honesty and
Student Conduct Policies http://www.sfu.ca/policies/gazette/student.html.
Penalties imposed by the University for Academic Dishonesty may include (but are not
limited to) one or more of the following: a warning, a requirement to redo the work with a
grade penalty, a grade of ‘F’ for the work, submission of an Academic Dishonesty form
to the Registrar, or a grade of ‘FD’ (failed – Academic Dishonesty) for the course on
your transcript, and/or more severe penalties as recommended by the Chair of the
Department.
Acknowledgements
Robert Arnold contributed to the early development of the laboratory handouts, which
were written and maintained by Cyril Thong until 2012. In 2013 the lab handouts
underwent a major revision by Kevin Lam, to accommodate scheduled labs and to
emphasize a discovery-based learning approach. The manual was further modified in
2014 by Peter Hollmann, Joan Sharp, and Erin Barley who also developed a new roots
and stems lab. In 2019 Ivona Mladenovic developed a new molecular biology lab
activity. In 2022 Megan Barker and Agata Becalska further modified the manual and
added a new research project component. Alex Fraser has also been helpful in
contributing ideas to the revised lab handouts. The lab manual is currently maintained
by Agata Becalska, Megan Barker, Erin Barley, Yvonne Dzal, Peter Hollmann, Kevin
Lam, and Ivona Mladenovic.
© Cyril Thong, Ph.D., Kevin Lam, Ph.D., Joan Sharp, M.Sc., Peter Hollmann, M.Sc., Erin Barley, M.Sc., Megan Barker,
Ph.D., Agata Becalska, Ph.D., and Ivona Mladenovic, Ph.D., Simon Fraser University. Fall 2023
WEEK TWO. EXPLORING THE UNKNOWN— USING LAB
EQUIPMENT AND TEAMWORK
LAB PREPARATION EXERCISES
As part of your laboratory preparation, work through these exercises, answering all
questions (indicated by à), then complete the quiz on the course Canvas site before
attending your lab each week.
Instructions
These Lab Preparation Exercises are to be completed at home BEFORE attending lab
each week. Please work by yourself and discuss your answers with your lab instructor, a
TA or a class-mate only after you’ve answered every question. By working alone, you
will have a chance to process the information and practice solving problems
independently (a useful skill for your quizzes and exam), and you will not run the risk of
plagiarizing someone else’s work when you submit your answers for marking. By
discussing your ideas with classmates or your lab instructor and TAs afterwards, you
can make sure your answers are on the right track before you attend your lab and
submit your work.
For Lab Preparation Exercises each week, you should:

1. Read the lab preparation and in lab activities.
2. Acquire the Important Background by reviewing your textbook and lectures.
3. Complete the Lab Preparation Exercises and answer all of the questions (all
questions are marked with an arrow à).
4. Complete the weekly quiz on the course Canvas site before attending your lab
each week.
PART A— WHEN AND HOW TO USE LAB EQUIPMENT
Introduction
Many areas of biology require laboratory experimentation. Such experiments require the
use of laboratory equipment. To prepare for your first lab and future labs, you will need
to learn how to use some common lab equipment.
Important Background
Read the following information to learn about each piece of equipment that you will be
using in lab this week.
SEROLOGICAL PIPETTE INSTRUCTIONS
What are they used for?

To accurately dispense volumes of liquids.
Procedure:
1. Choose the smallest pipette suitable for the volume you intend to deliver
à Pipettes are more accurate near the maximum measurement.
2. Attach the pipette to a pump or bulb

à Make sure a proper seal is formed; the pipette should not drip.
3. Draw the liquid into the pipette slowly

à Watch the level of liquid as you are using the pipette! Liquid should never enter
the pumps or bulbs. If it does, give it to a TA/lab instructor for cleaning.
à Sometimes substances can block the tip. If you notice the liquid not rising
within the pipette, do NOT keep increasing the suction in the pump. Instead,
slowly release the liquid out of the pipette until the blockage clears, and then
slowly draw liquid into the pipette again.
4. Dispense the liquid into the receiving container slowly

à Be careful not to break the tip of the pipette or contaminate it with other
substances. If this happens, change to a new pipette.
5. Notice that (for the 10 mL pipette, for example), the numbers might start with
9 on the bottom, and count to 0 on the top
à This means that if you fill the pipette to 0 and dispense down to the 2 mL mark,
you have dispensed 2 mL. This also means that if you fill the pipette to 8 and
dispense the pipette till it is empty, you have dispensed 2 mL again.
à If you filled the pipette to 0 and want to dispense 2.5 mL, notice that the 2.5 mark
is BELOW the 2, between the 2 and the 3.
6. Look out for decimal places

à The 1 mL pipettes have numbers for every 0.1 mL, and a mark for each 0.01 mL.
7. CLEAN UP
à Return the pipette with bulb to where you got it.
PASTEUR PIPETTE INSTRUCTIONS

To dispense liquids when accuracy is less important, and to gently mix liquid
mixtures by pipetting liquid in and out.
(When adding small volumes drop-wise, ~35 drops = 1 mL)
Procedure:
1. Attach the pipette to a rubber bulb

à Make sure a proper seal is formed… the pipette should not drip.
2. Draw the liquid into the pipette slowly

à Do not overfill the pipettes! Liquid should never enter the bulb. If it does, give it
to a TA/ lab instructor for cleaning.
à Sometimes substances can block the tip. If you notice the liquid not rising
within the pipette, do NOT keep increasing the suction in the bulb. Instead, slowly
release the liquid out of the pipette until the blockage clears, and then slowly
draw liquid into the pipette again.
3. Dispense the liquid into the receiving container slowly

à Be careful not to break the tip of the pipette, or contaminate it with other
substances. If this happens, change to a new pipette.
4. CLEAN UP
à If you used a new pipette, make sure the bulb is dry and return it to where you
got it from. Dispose of the Pasteur pipette in the glass disposal container (usually
on the bench).
àSome weeks you’ll find Pasteur pipettes pre-labelled and attached to a specific
bottle. If so, return them to the bottle they came from so they can be re-used.
Note for all pipettes: Double-check that you are using the correctly-labeled pipette
for the liquid you are dispensing, to avoid cross-contamination.
à Make your own label with tape and a felt pen when appropriate.
PREPARING WET MOUNTS ON GLASS SLIDES
Why is this done?

To spread a sample thin enough (between a glass slide and a glass cover slip) to
view clearly under a microscope.
Procedure:
1. Place a small drop of your sample in the middle of a glass slide.
2. Gently place one edge of a glass cover slip on the slide, so that the cover slip
touches your sample.
3. Gently lower the opposite edge of the cover slip using a pencil or Pasteur pipette to
avoid forming bubbles under the cover slip.
4. Use a tissue to soak up any excess liquid until the cover slip does not move when
the slide is tilted.
5. Dispose of the slide and cover slip in a glass disposal container, usually found on
the bench.
A SIMPLE CHEMICAL TEST:
USING IODINE TO TEST FOR STARCH
What is this used for?

To determine whether a sample contains starch.
Procedure:
1. Obtain some Iodine and a clean, dry spot-plate with many depressions on it.
2. Add 2-3 drops of your sample to one of the depressions of the spot-plate. Note the
colour. Add 2 drops of Iodine solution to the same depression.
3. Observe any changes in colour. Iodine binds to starch to produce a deep purplish-
blue colour (indicating a positive test for starch).
4. To clean-up, rinse the spot plates, turn the water on to a slow stream, then hold the
plate at an angle to wash it. Iodine stains! Be careful not to splash it on yourself or
your classmates.
CHEESECLOTH AND FUNNEL FILTER INSTRUCTIONS

To filter out larger solids while allowing liquids and smaller particles (e.g. cells,
organelles, etc.) to pass through.
Procedure:
1. Label a clean test tube and place it in a test tube rack.
2. Place the funnel on top of the test tube, and place a square of cheesecloth on top of
the funnel.
3. Pour the sample slowly into the middle of the cheesecloth then wait for the sample
to pass through, into the test tube.
4. To clean-up, dispose of the cheesecloth and contents in the garbage. Wash the
funnel and return it to the bench where you found it.
COMPOUND MICROSCOPE INSTRUCTIONS
What is it used for?
To view objects at 40x, 100x, or 400x magnification (e.g. to see cells!)
Procedure (Tip: ask a TA/ lab instructor if you are unsure about any part/step)
1. Rotate the objective lenses until the red 4x objective is pointing straight down, then
place a slide on the stage of the microscope.
Note: the eyepieces magnify by 10x, so you will actually be viewing at a total
magnification of 40x, with this objective lens.
2. Hold the metal spring clip on the stage aside and set the slide all the way back and
to the right so that the corner of the slide sits snugly in the metal slide holder. Gently
release the spring clip so that it pushes gently against the opposite corner of the
slide, holding it in place.
Note: do NOT try to tuck the slide under any part of the clip.
3. Move the slide using the stage movement controls until the object is centered under
the 4x objective lens.
Tip: the upper dial adjusts up/down, the lower dial adjusts left/right.
4. Turn the light intensity adjustment dial down to ~5 and turn on the microscope lamp.
Move the substage condenser (located just under the stage) all the way up using the
small adjustment knob on the left. Close the diaphragm of the substage condenser
using the small black diaphragm lever.
5. Using the coarse focus knob (the larger wheel of the focus knob), focus until you can
see the object clearly
Tip: start with the stage at the top then lower it slowly.
6. To put the object in focus with both eyepieces, close your left eye and focus the
image in the right eyepiece with the fine focus knob (the smaller wheel of the focus
knob) until it is sharply in focus. Then close your right eye and focus the left eyepiece
with the eyepiece focusing ring without altering the focus knob settings you made
before.
7. Adjust for your eye distance by pushing together or pulling apart the two eyepieces
until you see one image instead of two.
Tip: pull and push on the grips found on the outer edges of the eyepiece base, and
not the eyepieces themselves)
8. Without changing the focus, rotate to the 10x objective lens**. Using only the fine
focus knob, refocus on the object and center what you wish to see with the stage
movement controls.
Note: Once an object is in focus with the 4x objective, it will be approximately in

focus for all other objectives, and will only need minor adjustments with the fine
focus knob. Do not use the coarse focus knob at the higher magnifications.
You could smash the objective lens through your glass slide!
9. Rotate to the 40x objective**. Refocus with the fine focus knob.
**Warning: When you rotate the objective lenses, watch from the side and rotate
slowly to make sure the lens never touches the slide/sample, as this can ruin the
lens.
Tip: Because more powerful lenses capture less light, you may need to increase light
intensity by either opening the diaphragm lever on the substage condenser or
adjusting the light intensity
10. The light intensity adjustment dial should always be reset to ~5 before you turn the
microscope off. You should also rotate the objective lenses back to the 4x objective
before you remove a slide from the stage, to ensure you do not scratch the higher
objectives with the slide.
SPECTROPHOTOMETER INSTRUCTIONS

To measure how much light (of each specific wavelength/colour) is absorbed by a
sample. A prism is used to split the light, so that you can test one wavelength at a
time across a wide range of possible wavelengths.
General Procedure:
1. Transfer your sample into a new cuvette.

2. Put the “blank” cuvette into the spectrophotometer.
a. Always hold cuvettes near the top, and wipe the sides with a kimwipe to
remove fingerprints, before putting into the machine.
b. Cuvette orientation in this machine— The light moves left-to-right, so the
clear windows of the cuvette need to be at the left and right.
c. Double-check— the triangle at the top of the cuvette should be on the right or
left side
3. Reset the machine— On the top left of the screen, click “untitled” and make a
new file, discarding the previous data.
4. Calibrate (or “blank”) the machine:
a. On the top right, click the gear icon.
b. Select “Absorbance” and then “Wavelength”
c. Click “Calibrate” (which is the same as ‘Blank’).
5. Remove the blank cuvette; insert the sample cuvette (in the correct orientation).
6. At the top of the screen, click “Collect” and then click “Stop”
7. On the graph, click the curve at the wavelengths of interest (or look at the table
on the top right of the screen). Write down the absorbance at each wavelength.
8. Leave the blank cuvette at the spectrophotometer. Discard your sample in the
appropriate location (as instructed by your lab instructor/ TAs), and throw out the
cuvette.
EPPENDORF CENTRIFUGE INSTRUCTIONS

To separate the particles within a mixture into layers according to their relative
densities, by spinning the mixture at extremely high speeds. The densest
particles are found at the bottom of the tube.
Procedure:
1. Label 2 clean falcon tubes (with tapered, cone-shaped bottoms).
2. Add a volume of your sample to one tube, and an equal volume of liquid to the
second tube. (If there is only one sample being spun, add water to the second
falcon tube)
3. Turn the main POWER switch on, if it is not already on.
4. Press the OPEN button to open the centrifuge lid. Load your centrifuge tubes and
ensure they are balanced diagonally opposite each other (ask the lab
instructor/TA if you are unsure).
5. Close the centrifuge lid firmly and wait for it to lock.
6. Press the SPEED button repeatedly until it reads an rcf value (this has a * sign
before the number). With the SPEED display flashing, use the arrow buttons to
set your centrifugation speed at 1,300 (= 1,300 x gravitational force).
7. Next, press the TIME button; the time display will flash. Using the arrow buttons
again, set the centrifugation time to 10 minutes.
8. Press the START/STOP button to start the centrifuge.
9. After 10 minutes the centrifuge will beep. Press the OPEN button to open the lid
of the centrifuge.
10. Leave the centrifuge main POWER switch on for the next user.
11. To clean-up, rinse your falcon tubes and leave them in the container beside the
sink.
**End of Lab Preparation Exercises**
IN-LAB ACTIVITIES
First, meet the people sitting around you!

Put your names onto your nametags.
Then we’ll get started.
SAFETY SCAVENGER HUNT
On the floor plan below, write in the locations of the following & check off when done:
Safety Equipment:
☐ Eyewash stations (2) ☐ Glass waste bins ☐ Regular garbage/recycling
☐ First aid kit ☐ Broom/dust pan ☐ MSDS (chemical safety info)
☐ Where to leave food/drink/water (or keep in your bag) ☐ Fire extinguishers (2)
☐ Sinks (4) for handwashing when you enter/leave
☐ Sinks (2) for chemicals/experiments only
☐ Poster on wall: Lab emergency procedures and hazardous waste guide
☐ Ethanol bottles for spraying & wiping your bench, each day before you leave.
Other important things to write on the floor plan:

☐ Prep room doors (for techs/instructors only; no student access)
☐ AED (emergency equipment for heart failure) – in the hall
☐ Cubbies for your belongings; 1 per person (please leave bags/coats there, not at bench)
☐ Bench where your team sits
☐ Door to the BISC101 help room (note that there is another door to get into it, via the hall)
☐ In case of fire alarm, where do you exit? Draw an arrow
PART A— WHEN AND HOW TO USE LAB EQUIPMENT
Introduction
As a practical and challenging way to learn how each piece of lab equipment can be
used, your team will be working together to identify an “unknown homogenate”. You will
decide as a group how and when to use every tool, and gather as much useful
information as you can about the “unknown homogenate”. At the end of lab, your team
will submit a single summary sheet, stating all of the tools you used, and why. If you did
not use certain tools, provide your rationale for not using those tools. Please state your
hypothesis, what you think the “unknown homogenate” is, and list all of the logical
reasons for your answer. It is ok to write your summary sheet in point-form.
At the end of the lab, the top three teams (one team per TA) will be chosen, based on
the quality of their scientific work and reasoning (and NOT on whether their answers are
actually correct) and given one bonus mark on their lab final. The winners will be
announced next week. One obvious goal of this lab is to help you learn when and how to
use each piece of lab equipment. An equally important goal is to give you and your team
an opportunity to explore something unknown. Exploring the unknown is what makes
science so fascinating and exciting. We hope that this exercise will not only help you get
to know your teammates better (as you compete against other teams for valuable bonus
marks); we hope that you will also get an appetizing taste of what it is like to be a
scientist as well.
ACTIVITY A— EXAMINING AND IDENTIFYING AN UNKNOWN HOMOGENATE

Preliminary Observations
First, examine the tube of “unknown homogenate” given to your team. Discuss what
you notice about it, record your preliminary observations below, and make your best
guess at what it is. (Warning: Please do not take any of the homogenate out of the tube
yet!)
Preliminary observations:
What do you think was blended to make this homogenate, based on your observations?
Hypothesis:
Rules for this exercise
To avoid disqualification of your team from the competition for bonus marks, make sure
you follow ALL of these rules:
1. Carefully follow the instructions beside each piece of equipment while using it.
-Misuse of any lab equipment will result in immediate disqualification.
2. Note down exactly how you used every drop of your 12 mL of “unknown
homogenate”.
-Measure each sample precisely using serological pipettes and record everything
you did/saw.
3. Have a good reason for every step you take.
-Plan ahead, but adjust your plans if you come across some unexpected results.
4. Work at each station as a group and give each person a chance to use the
equipment.
-In later labs, you will assign different tasks to each teammate to finish each
activity more quickly, but this is a team-building exercise, and you will need to
adjust your plan with each step, so, today, you will work together and teach each
other!
-Don’t just sit there… if additional equipment is available, practice using it!
5. No cheating!
-Include only what you observed and tested as a team on your summary sheet.
Do not obtain information from the Web or what you heard other groups
discussing.
Important note: the Lab Exam evaluates your achievement of the Student Learning
Objectives (SLOs) from each lab… including this one! Make sure you can demonstrate
proper equipment use for the lab exam!
What your team should do

1. Work together to outline a rough plan. As a team, take a few minutes to
discuss what you will do and to outline a brief plan. Every team should plan to
use all the equipment. Think about the order in which you’ll use the different
pieces of equipment and estimate how much “unknown homogenate” you’ll need
for each step. Record your rough plan in the table below.
Step # Equipment Purpose Unknown
Homogenate
(mL)
2. Perform your planned procedures, one at a time.

• Read the instructions beside the equipment.
• Make sure every member of your team has a turn with every piece of equipment.
• Document your work in the summary sheet and blank page below. List each piece of
equipment you used, in the order you used it in. Include notes on how much
homogenate you used, and what you observed and/or learned for each step. Include
drawings where relevant (e.g., microscope observation).
• Clean up as you go. If you’re not sure where things go, consult the lab preparation
notes or ask a TA/ lab instructor.
3. Work as a team to fill out ONE Summary Sheet per team. Your summary should
state your best guess, and document the evidence and scientific thinking that led you to
your conclusion. Be sure to include every teammate’s name (first and last) and submit
your Summary Sheet to a TA/ lab instructor before the end of today’s lab.
BISC 101 UNKNOWN HOMOGENATE SUMMARY SHEET
Lab Section: D1_ _

(Note: BISC101 is the course,
D101 is the lecture;
D1_ _ is your lab/tutorial section).
TA Name: _____________
Team member names: _______________________________
_______________________________
_______________________________
_______________________________
Homogenate identity: _______________________________
Rationale:
STUDENT LEARNING OBJECTIVES (SLOs)
Once you’ve completed and reviewed this lab (and if you want to do well on your tutorial
quizzes and lab exam), you should be able to:
1. Appropriately apply the terminology, ideas, and tools from this week’s lab towards
analyzing new problems and discussing potential solutions.
2. Properly use serological pipettes, Pasteur pipettes, glass slides and cover slips,
compound microscopes, simple filters, centrifuges, spectrophotometers, and simple
chemical tests to analyze samples.
3. Choose the appropriate lab equipment for a given task or scientific study.
4. Plan and outline clear and logical steps for a scientific study, and adjust those steps,
as necessary, in response to preliminary results.
5. Record detailed observations and notes while performing scientific studies.
6. Summarize and discuss the results of a scientific study, draw conclusions from
these results, and defend your conclusions using your results and observations.
WEEK THREE. RESEARCH PROJECT— EXPERIMENTAL
DESIGN

PART A— EXPERIMENTAL DESIGN BACKGROUND

Introduction
The scientific method involves making observations and asking questions. Scientists
form hypotheses to test these questions, and then develop controlled experiments to
collect and analyze data. Using these data, they are able to draw conclusions and form
questions for new scientific research. In this week’s lab you will use the scientific
method and explore experimental design to help you design your own experiment for
your lab team project.
Research Question and Hypothesis
Research questions generally ask about the impact of something onto something else.
For example, what is the impact on Y, if I do X? These questions can be based on prior
experience, or new observations, or other research that you have read. Research
questions are ideally focused on something you are genuinely interested in, because
you’re going to spend time trying to answer them.
In science, research questions need to be answered using experimentation (or

observations) of phenomena. To focus your research questions, and make them
testable, you develop a hypothesis. The hypothesis includes a prediction, and a
rationale (a proposed explanation). For example, when I do X, Y will
increase/decrease/change… because of reasons A & B.
Here’s a specific example: let's say you have the following research question about
chickens: What is the impact of a chocolate-based diet on the relative number of
female (vs. male) chicken offspring?
Feel free to read that sentence a few times to make sense of it. Science writing is often
quite dense, and takes time to interpret.
The relative number of female vs male offspring can be shortened to the “sex ratio” of
the offspring.
One possible hypothesis (there can be more than one) is that when chocolate is
consumed by chickens it has an effect on the sex ratio of offspring, because the
molecules in chocolate are known to interact with gamete production. One of the
variables tested in this experiment affects another. We can also say that the observed
results are not due to a random chance occurrence.
Your experiment could be to feed chocolate to a bunch of chickens, then look at the sex
ratio in their offspring.
Independent, Dependent, and Confounding Variables
An experiment is a type of research method in which you manipulate one or more

independent variables and measure their effect on one or more dependent variables.
Good experimental design means creating a set of procedures to test a hypothesis.
When preparing an experiment, it’s important to keep things simple. Most often, in an
experiment, one variable is tested at a time, and we are looking to observe its effect, or
changes it can make, on another variable.
Independent variables— things that you, the experimenter, sets in the experiment. In
our chicken example, we want to see the effects of chocolate consumption on the sex
ratio of chicken offspring. It is a variable that you think may cause a change in a
particular dependent variable.
Dependent variables— variables that “depend” on the independent variable. In the

chicken example we specified that the dependent variable is the sex ratio of offspring,
which could be altered by the addition of chocolate in the diet of chickens. Dependent
variables are measurable, so that you can determine if an effect has occurred. We can
simply count the number of male and female chicks to determine the outcome.
On a graph, typically the X axis is the independent variable, and the Y axis is the
dependent.
Confounding variables— In a perfect experiment, the only thing that will affect your
dependent variable (Y) is your independent variable (X). However, in reality, there may
be confounding variables. These confounding variables can affect your dependent
variable in ways that are difficult to predict or explain. For example, in our chicken
example, it may be that the chickens just happen to love the taste of chocolate. What if
the outcome you see resulted from the total number of calories rather than the food
source? Quite often, you’ll do an experiment, analyze the data, realize that there may
have been a confound, and then do a follow up experiment to rule it out.
à Thought question – in theory, is it possible to have a ‘perfect’ experiment, with

no confounds? Why or why not?
Experimental/Treatment and Control Groups
In order to determine if chocolate truly does affect the normal sex ratio of chicken
offspring, we need to know what the normal ratio of males to females would be, in the
absence of the independent variable. We can think of this as a baseline for our
experiment. We use control groups (also called controls) to establish this baseline.
One control group would be chickens that are given food, but no chocolate (they are not
given the independent variable). We would then observe the ratio of male to female
offspring to determine what “normal” is for chickens under these conditions. It would be
incorrect to assume that normal should be a 1:1 ratio of males to females without any
prior experimentation or knowledge.
Conversely, the experimental group would receive chocolate in their diet. We would
then observe the ratios of the offspring and compare these results with the results from
the control group. By comparing these two groups, we can determine if the independent
variable affects the dependent variable.
A control can act as a comparison to your experimental or treatment group, to

determine if some sort of change or event has occurred. There are lots of good ways to
think about controls; one way is to consider them as either positive controls or
negative controls:
• A negative control is handled the same way as your treatment group, except that it
does not receive the experimental treatment. There is no expected effect that occurs
here, due to the absence of the variable or treatment in question.
• A positive control receives a treatment/variable different than the one you are
curious about, that causes a change. A positive control produces an expected result
which you can compare to your treatment group.
• Sometimes the story is not clear-cut: not all controls can be (or need to be) classified
as positive or negative. They may be included to check specific components of the
reaction, and can give useful information, without fitting neatly into these two
(somewhat arbitrary) boxes.
• Also, you might have more than one positive (or negative) control, which can be
useful for quantitative comparisons and checks of different things.
Why bother with controls? In general, including experimental controls is critically

important. They can be a challenging part of designing an experiment, but they are
critical. They help you to troubleshoot problems & identify confounds; they allow you to
know if you can trust your results; and they allow other scientists to decide whether they
can trust your results; and they help other scientists when they are trying to replicate
your work, which is a central value of science (replicability as an indicator of your
experiment being objective).
à In your own words, what is the definition of a “Control” in an experimental
setup?
Replicates
It is important to design an experiment that leads to the most accurate results possible.
If we perform our chicken experiment with only a single chicken we can’t know if the
result is representative of chickens as a whole. We can repeat the same experimental
condition to see if the results we saw can be reproduced – this is called a replicate. In
our experiment, each chicken could be considered a replicate. Variation may result from
slight differences in test subjects (an old versus a young chicken may affect offspring
ratios), mistakes in our methods (perhaps you forgot to feed one chicken one day), or
data collection (not counting the chicks correctly). Experimental replicates help to
reduce those effects.
Standardized variables
Often the difference between our experimental and control groups is the presence or
absence of the independent variable. This allows the experimenter to determine if the
independent variable affects the dependent variable chosen for the experiment.
However, there are other variables present that can affect the outcome of your
experiment and act as confounding variables. If we can anticipate these variables, we
can mitigate their effects by standardizing them, or always keeping them the same
within the experiment, so we can be sure our independent variable is causing any
observed phenomena.
In our chicken example, if some of the chickens have more time to eat than others, or
some chickens are fed at a different time of day, this could influence our results. We can
standardize these variables by feeding all chickens at the same time, for the same
amount of time each day. Other examples of variables that should be standardized in
our chicken experiment are the brand food the chickens get, the breed of chickens, age,
and number of chickens per cage.
Experimental Setup/Procedure
Finally, you have all the components identified for a well-thought-out experiment. When
asked to describe an experimental setup, you should walk the reader through what you
intend to do. Some aspects of an experiment may require a particular order, or
sequence, which can be conveyed here. For example, if we want our chickens to be fed
their normal chicken feed at noon, then at 1 PM they receive their dose of chocolate, we
can describe that here.
We could also run an experiment that perhaps doesn’t have an obvious ending (like the
laying and hatching of eggs) so a timeline may be required to be mentioned. Perhaps
we are interested in how much radioactive nitrogen has been taken up by grasses over
a period of time. The grasses will continue to grow throughout the experiment; it is up to
us to make an informed decision as to when to end the experiment (and sometimes that
can be an educated guess).
Flowchart
Experimental plans can sometimes be intricate, with several pieces— which can make
them difficult to understand as an outsider. One way to communicate these plans is to
use a flowchart. This is a rough sketch of the overall steps that your experiment will
include. They often have the side-benefit of helping you keep in mind the “big picture” of
your experiment. You will be uploading a flowchart most weeks as part of your pre-lab
quiz on Canvas.
Flowcharts can go through a few rounds of edits, and should be legible, but in a lab
notebook they are NOT intended to be perfect and polished. They also shouldn’t be a
wall of text; by necessity, they won’t include every tiny detail. You can draw them on a
computer using shapes in PowerPoint or Word, but it is generally faster to hand-draw
them (on a tablet, or on paper and take a picture, to embed them in your notebook).
This is not an art class— it is a sketch, so do not worry about perfect formatting.
For example, here is a flowchart of the chicken-chocolate experiment:
à As a real, everyday scientist, what could be one benefit of having your
flowchart be slightly informal/unpolished, such as the one above? What could be
one drawback?
PART B: INTRODUCTION TO LAB TEAM PROJECTS
This semester, your team will undertake a shared, hands-on research project, from
start to finish. This week in lab, you’ll be deciding on your team’s project, and setting
your research plan. The project will require you to articulate your research question,
define your variables, design your controlled experiment, plan and communicate with
your team, collect & interpret real data, & share findings. Every team member is
involved throughout, including everyone collecting data at home and being part of the
dissemination (sharing of findings)
Timeline: You have the following major checkpoints during upcoming weekly labs. The
general plan:
• Week 3 Lab (Sept 17 to 22): Define your shared project, build your shared
project timeline and data collection plan.
o Between weeks 3 & 7, at your own pace: get supplies, & collect data.
Each student does some of the experiment at their own home, so that as a
team you have a larger data set (replicates).
• Week 8 Lab (Oct 22 - 27): Use this lab to learn how to analyze, graph, and
interpret your precious data.
o Between weeks 8 & 10, at your own pace: analyze data & write up your
findings in the form of a brief abstract & graphical poster (details to follow).
• Week 10 Lab (Nov 5): Hand in a draft of your abstract on Canvas. Your TAs will
provide you with feedback that you will incorporate into your final abstract, due
on Canvas Week 14 (Dec 4).
• Week 11 Lab (Nov 12): Hand in a draft of your poster on Canvas. Your TAs will
provide you with feedback that you will incorporate into your final poster, due on
Canvas Week 14 (Dec 4).
• Week 14 (Dec 4): Hand in final abstract & poster, incorporating your feedback
from your TA. This will also include self- and team-evaluation.
Grading (10% of final BISC 101 mark): Your grade for your team project will come
from a combination of:
• Abstract & Poster draft— receive a completion mark as part of your Lab
Preparation Exercises mark. Note: A big chunk of your final abstract and poster
mark comes from how you incorporate feedback from your TAs.
• Final Abstract— 4%
• Final Poster— 6%
Overall constraints & goals: Your project design needs to be—

- Achievable
o Can collect all data between your lab days on weeks 3 and 10 (from start to
finish, including acquiring materials).
- Shared
o Every team member will collect data at their own location
- An experiment
o Needs to have a research question, an independent variable (that you
manipulate), and a dependent variable (that you measure). There are lots of
neat biological studies that are *not* experiments (e.g. observation of natural
phenomena), but this is your chance to design an *experiment* where you
test out an idea, and see what happens.
- Reasonable
o Have your priorities straight: a tight experiment (well-designed, small
experiment that clearly tests for one independent variable, including good
controls) is better than a broad experiment (that tries to test for too many
things at once, and gives data that is messy or uninterpretable… or has too
many ways to fail).
o We want this to be a reasonable workload, not overwhelming (and not
boringly small).
o But, don’t be afraid to try something that is a little ambitious and interesting!
- Inexpensive
o No more than approximately $5 per person.
o Why? We want this to be inclusive, and equitable across teams – and we
want to see good scientific thinking, not expensive tools/kits that do the work
for you.
o If money becomes an issue for you personally, please privately let your lab
instructor know. We have lots of good ideas about how to do science on a $0
budget; we will not judge you, and will protect your confidentiality if you don’t
want your team to know your situation.
- Ethically straightforward
o Collect data on cells/biomolecules/plants/microbes, rather than humans (to
avoid issues of ethical testing on humans & protecting individual privacy)
o Can’t believe we have to say this, but: it can’t involve questionable/illegal
behaviours
- Connected to our course material!
o When you interpret your findings, you’ll be putting them in the context of what
is known about biology/biochemistry/physiology. There are lots of neat
experiments out there that focus on *other sciences* but this is your chance
to do a *life sciences* experiment.
- Assessed for reasonable safety
o You are responsible for knowing the safety of your reagents/ experiment
/setup. We can help with this if you reach out. Because you are doing diverse
projects of your own choosing at your own homes, it is infeasible for us to fully
assess the overall safety and risk of each project. So, you’ll need to assess
risk, minimize it, & be comfortable with it.
o We have compiled project themes that are low-risk, but: you need to know
that there is no such thing as zero-risk. For example, many food and cleaning
supplies in regular kitchens/homes are hazardous; and, “natural” is not the
same as “safe.”
o You’ll talk with your group about this, but here are some general safety
considerations:
§ Reagents (alone or in combination) – can be hazardous to touch/
breathe/ splash/ ingest. You need to know the hazards of your own
reagents, and the necessary precautions to work with them. This
includes preparing any materials— e.g. cutting, heating, wearing
appropriate eye/clothing/hand protection, getting materials outside in
nature, etc.
§ Individual allergies/sensitivities/constraints of team members & their
housemates.
§ Your own mental health & stress are important. Set a reasonable non-
overwhelming amount of time you can all work on this, and stick to it!
Build in wiggle room to work around midterms, schedule changes,
setbacks.
- And, critically important: Interesting to you

o Don’t pick a project that you don’t care about!
Overview of Project Themes

Your team has a choice of several possible project themes. For each, we’ll provide an
overview and a set of constraints, described further below. Within the theme you will
decide your team’s specific research question.
We are aiming for all projects to be similar workload/difficulty, with possibly different
schedules or focus points. For example, one project might have a couple intense days
of data collection, while another might have small amounts of data collection over a
longer period of time. Or, one project might have more data collection but simple
analysis, while another has less data collection time but more challenging
analysis/interpretation. You are welcome to consider these aspects, along with your
scheduling/life/preferences, when you consider which project ideas you are interested
in. Read through the project theme choices in this week’s lab, then answer the
questions below.
à From a first look, which of the project themes is MOST appealing to you? What
about this project theme appeals to you?
à From a first look, which of the project themes is LEAST appealing to you?
What about this project theme does not appeal to you?
IN-LAB ACTIVITIES
PART A— CHOOSING A RESEARCH TOPIC

Instructions
Look over the project theme choices below. Examine each project as a team and
answer the questions below to help you choose your shared project.
Project Theme Choices

1. Seed germination and plant growth
In this experiment, you will investigate the impact of environmental variables on seed
germination and/or seedling growth— whether in soil, or in a Ziploc bag. From growing
these seeds, you will investigate rates of germination and/or growth in your treatment
conditions. These conditions could be intended to support seed germination (sun,
temperature, etc.), or deter it (irradiation of the seed, heating, treatment with chemicals
such as peroxide). What affects the direction/speed of growth?
You might instead be interested in the further growth of already-sprouted plants, and
how they can be affected by hormones. For example, mint plants are fast-growing, and
can be treated with plant hormone. Could you design an experiment to make them
branch out rather than grow taller?
2. Fruit enzymes and jello jigglers

Gelatin, an animal protein, is the component of jello that gives it firmness/structure.
Some fruits, such as pineapple, have enzymes that may break down the gelatin and
prevent it from “setting.” This project theme encourages you to characterize something
about either the enzyme, or the gelatin itself. For example, what can you learn about the
enzyme? Is it heat-sensitive? Is it pH-sensitive? Does the amount of enzyme make a
difference? Is it found in the fruit juice, or only in intact fruit? Does the enzyme also
work on gelatin substitutes such as fruit pectin?
3. Preventing microbial growth

Maybe you’re interested in preventing microbial growth. Microbes grow on our food (for
example, growing on berries) or can be cultivated (on home-made agar plates). In this
theme, you’ll design an experiment to test the impact of environmental conditions or
applied treatments on the growth of microbes. For example, some websites say that
aloe vera will prevent mould growing on blueberries. Does it make a difference if the
berries are in the fridge? Or, maybe you’re interested in testing out the effect of cleaning
supplies or kitchen materials on the growth of bacteria in a dish?
4. Osmosis/diffusion in plant (potato tubers) or animal (eggs) models:

In this experiment, you will use root vegetables (e.g. potatoes) to investigate osmosis.
The cell membranes of these sticks are selectively permeable and allow water but not
all other molecules to cross. Your team will design an experiment using common
kitchen reagents (root vegetables, sugar, salt) to investigate rates of osmosis, and
membrane permeability, in potatoes or other root vegetables.
Instead, you could use eggs to investigate osmosis and diffusion. You can remove
the shell through ‘decalcification’ and then soak the eggs in varying solutes (such as
table sugar) to understand egg physiology. Or, you can use food colouring to and other
conditions to measure the rate of diffusion through the egg.
5. Capillary action in plant stems

In flowers, liquids move from the base of plants up to the flowers through the plant’s
vasculature system. Using white flowers such as carnations or vegetables like celery
together with food colouring, you can test hypotheses about what factors affect the rate
of fluid movement. Does the size of stem matter? What about temperature, tonicity,
size of the food colouring molecule, other chemical characteristics? Does the liquid
always move the same direction, or can it go in either direction?
6. Another project idea that you have!

You’ll need to think this through, and it has to meet the overall project constraints/goals.
à From a first look, which project is each teammate most interested in, and
why?
à What project will you move forward with as a team?
PART B— DESIGNING AN EXPERIMENT
Instructions
Often one of the hardest parts of experimental design is narrowing your research idea
into a single, testable, tight question.
As you are working today, if you have questions, ideas, concerns— please do reach out
to your TA or lab instructor. Experimental design can be fun but challenging, and we are
happy to talk over ideas with you. It’s often easier/faster to talk over ideas rather than
writing out formal plans. We love talking about science, and that’s what you’re doing
here!
à What is your Research Question?
à Why is your Research Question interesting to you?
à What is your Hypothesis?
à What is your Independent Variable?
à What are your Dependent Variable(s)? (at least one of these needs to be
quantitative/numerical - i.e., you can measure it as some kind of number.)
à How will you measure your Dependent Variable(s)? Be as specific as you can
here!
à What materials and space will you need?
Lots to consider here including things you may have at home, or can get at a dollar
store/grocery store, your phone, software…and individual team members’ space
limitations
à What are some potential confounding variables?

(You may want to collect data on these, as you perform your experiment)
à What control groups might be important to include? What are these controls
being used to check/show/test?
à What standardized variables will you keep the same, between all groups?
à How many replicates will you have for each treatment/control group? Note that
each team member will be collecting data at their home but you can decide how
to split replicates up amongst the group. Will you each perform each condition?
Or will one person perform all replicates for a given condition?
à Read over the project goals/guidelines in the Lab Prep this week, particularly
the safety notes. Remember: there is no such thing as “no-risk” - so you should
recognize and minimize risks to do a safe experiment. What are the safety risks of
your experiment? How will you manage /minimize these?
à Roughly sketch a flow chart to illustrate the steps of your experimental setup /
procedure, in chronological order.
At this point, you should have your TA or lab instructor take a look at your flow
chart to assess the overall viability of your experimental design.
A last few quick checks on your project idea, based on the overall guidelines— talk
about these, and just make sure you can answer “yes” to all of these questions. If not,
it’s totally fine - please adjust your experiment now, to address these before you start.
• Is it achievable and reasonable? Can you collect all of the data, without getting
overwhelmed? Is it overly easy, and too trivial? Are the data reasonable (not
crazy-complicated) to analyze?
• Will all of your teammates be able to get the materials, space, and time to do the
project? Timing and space constraints: All of your data needs to be collected by
your lab in week 10. Will all teammates have enough time and undisturbed space
to complete their part of the project, between now and week 10? Will you be able
to get materials?
• Is it inexpensive (less than ~$5/person)?
• Are there any ethical issues with your experiment?
• Is it connected to our course material?
à And finally: why are you excited about doing this project?
PART C— TEAMWORK
Modern science is done in teams, who work collaboratively on projects. Team skills are
not always easy, but they are super important: when we surveyed recent SFU science
graduates, the number one skill that they wished they’d had more of in their degree was
collaborative work skills. So, we’re going to continue working on it here.
Note that this group project requires reasonably equal contribution from every team
member, as you are all getting graded together. For most teams, this is fine.
However, if in your team there are substantial problems or differences in contribution/
attendance, you need to first try and work them out— i.e., the absent team member
needs to be reached out to, and given a chance to explain and correct the problem. If
you have been more of a slacker, you need to step up and communicate to your group.
This is a team project, which involves building team skills as a core part of being a
scientist. So, leaving your team to work individually on your own project is not meeting
the learning goals of the course.
Big picture: As a group, you have the responsibility for managing your project
and your team relationships. If you’re feeling frustrated, you need to try and resolve
your group problems early on, not just at the end. If, during the project, after having tried
several ways to address any issues, please check in with your instructor for ideas.
Today, you’ll have conversations about your shared contributions. These can be difficult
conversations to have, but they are also valuable— and it’s more useful to have these
open conversations now, rather than after-the-fact when nothing can be changed. Just
like with our science experiments, we are all here to learn, and everyone needs to take
ownership of how the teamwork is going. Celebrate the effective teamwork you have,
and own the problems to solve them!
à What is something you each think your group does really well, and you want to
keep doing?
àWhat is something you each think your group needs to improve on?
àThis project involves a lot of being accountable to yourself and each other.
Have there been any issues with people not attending, or leaving early, or not
equally contributing? If so, how have you (or how will you) resolve this problem,
early on? Have this conversation in an honest but not judgey way.
à What expectations do you have of each other, for the next few weeks on this
project? These can be big (“come up with amazing ideas and share them with the
group”) or detailed/small (“show up on time, stay throughout the lab; reply to
messages within a day; if you’re going to miss a deadline, let us know rather than
just not showing up”)
àAs a team, where will you collect your data? How will you share it?
àKnow the reasonable things you’re getting into: everyone has a life outside of
this course and project, and we need to respect that. So, what constraints do
each of you have, related to the project? (e.g. dates of midterms/schoolwork to
work around; job or family care schedules; allergies/sensitivities to different
reagents; access to materials or a place to work on your project.)
Before you leave lab today, plan out a timeline of your project. This should include
each major step of your experiment, and even distribution of work among teammates.
Setting deadlines up front makes you accountable to your group and ensures you have
a reasonably workable plan to get everything done in time.
1. Appropriately apply the terminology, ideas, and tools from this week’s lab
towards analyzing new problems and discussing potential solutions.
2. Given an experiment or scenario, identify and describe the following: research

question, hypothesis, independent variable, dependent variable, confounding
variables.
3. Identify and describe experimental/treatment and control groups in a possible

experiment or scenario.
4. Explain why replicates are necessary and important for producing valid and
reliable experimental results.
5. Identify various variables that should be standardized when preparing an

experiment.
6. Describe or draw an experimental setup or procedure, to clearly illustrate your

understanding of an experiment.
7. Design a controlled experiment to isolate and test an independent variable,

including the use of appropriate controls.
8. Plan the practical steps of an experiment and creatively solve the practical
problems that arise along the way.
9. Continue building collaborative skills, to meet the following larger learning

objectives that cover the whole semester
• Elicit, listen to, and incorporate ideas from teammates with different/diverse
perspectives and backgrounds.
• Work effectively with teammates to complete experiments.
• Critique others’ work and ideas constructively and respectfully.
• Proactively manage your team, including ongoing constructive communication
about group expectations, processes, and problem-solving.
WEEK FOUR. CELL MEMBRANE FUNCTION & STRUCTURE

questions (indicated by à), then complete the quiz on the course Canvas site.
PART A: UNDERSTANDING PERMEABILITY,

TONICITY, AND OSMOSIS
Introduction
Life on Earth would not exist without cell membranes to separate the inside of each
living cell from its outside environment. A cell membrane is a semi-permeable barrier
that allows some substances to pass through easily, while restricting the passage of
other substances. Let’s start by examining how solutions of different concentrations
affect movement of specific substances across a semi-permeable membrane.
Before beginning this week’s Lab Preparation Exercises, review your lectures or
textbook on membrane permeability. Specifically, make sure you are familiar with how
different types of molecules move across membranes, how different structural
components of the cell membrane affect those movements, and the concept of tonicity.
In addition, review the basics of experimental design in your lectures or textbook.
Tonicity
Picture a cell surrounded by an extracellular solution that may have one or several
solutes in it, each with their own concentration. The cell also has many solutes in its
cytoplasm, each with their own concentration. So, the extracellular solution will have a
total solute concentration, and the cytoplasm will also have its own total solute
concentration. The relative total solute concentrations (inside compared to outside) are
used to understand tonicity. Tonicity describes the ability of the extracellular solution to
make water passively move into or out of the cell. This passive movement is diffusion;
when water moves by diffusion, it’s called osmosis.
Three terms — hypotonic, isotonic, hypertonic — are used to compare the total
solute concentration of a cell cytoplasm (“inside”) to the total solute concentration of the
extracellular liquid around it (“outside”).
If you place a cell into a solution with a total solute concentration that is lower outside
than inside, the solution (or environment) is said to be hypotonic relative to the
cytoplasm (hypo meaning lower or less than). In this situation, the net diffusion of water
will be into the cell.
In the reverse case, if the cell is placed in an extracellular fluid with a higher total solute
concentration, the solution is hypertonic relative to the cytoplasm (hyper meaning
higher or greater than). Water will diffuse out of the cell.
In an isotonic solution (iso meaning same), the extracellular fluid has the same total
solute concentration as the cell, and there will be no net movement of water into or out
of the cell.
In general, you can think of this as “water follows solute.”
It is important to note that these conditions can change over time if the solutes present
are capable of crossing a membrane. We will explore this in the next exercise.
à What is the difference between diffusion and osmosis?
à You place a cell in a solution that is hypertonic. The membrane is impermeable

to all solutes present. You wait a few minutes. After this time, how might you
describe the tonicity? Explain your reasoning.
Exploring the Red Blood Cell Membrane’s Permeability

to Increasingly Non-polar Solutes
This lab illustrates the process of diffusion, tonicity, and osmosis by observing red
blood cells (RBC) in different conditions.
Useful to know, for this whole lab:

● The RBC cytoplasm has a total solute concentration of 0.3M. M represents
molarity, measured in moles per litre.
● The RBC membrane has very few membrane proteins, and none of them
are transporters for the solutes we’re testing here. So, you can think of it as
a reasonably good model for a pure phospholipid bilayer.
We will examine how RBCs respond when placed in different solutions. In this scenario
the cell membrane may be permeable to some of these solutes, which means that the
solutes could also be diffusing across the membrane and affecting tonicity.
Remember: Solutes diffuse according to their own concentration. Water diffuses

according to the tonicity of the solution as a whole. (ie. the concentration of all solutes
present.)
When you’re thinking about this, it makes sense to go step-by-step:

● What is the tonicity of the solute of interest?
● Will this cause the solute to diffuse across the membrane, and if so, in
which direction?
● What are the (relative) resulting total solute concentrations?
● Which way (if any) will water diffuse due to this total solute concentration
(tonicity)?
● What effect will this movement of water have on RBC shape?
Here are two examples to see how this plays out.
Consider a fictional solute, Barkamide. The RBC is permeable to Barkamide, and the
RBC cytoplasm doesn’t normally contain any Barkamide. If you place a cell in a 0.3M
solution of Barkmide, what happens?
● There is a relatively higher concentration of Barkamide outside than

Barkamide inside the cell, but the total solution is isotonic (same
concentration of total solute inside and outside the cell).
● So, Barkamide will move into the cell, if it can. (Can it? Yes! The
membrane is permeable to it.)
● This increases the total solute concentration inside the cell to some
number higher than 0.3M. (The cell is now in a hypotonic solution.)
● Now, water will follow total solute, and so it will move in.
● The influx of water causes the cell to swell, then burst (or “lyse”).
(Note: you might have answered the “what happens” question simply with “The RBC
lyses.” This is true, but it’s not nearly as good of an answer as giving the step-by-step
mechanism of what is going on.)
Consider another fictional solute, Wrinklamide. The cell is VERY permeable to this
solute, much more so than Barkamide. The normal RBC cytoplasm doesn’t contain any
Wrinklamide.
à If you place a cell in a 0.3M solution of Wrinklamide, what happens?
à Make a prediction, and give your reasoning. Which would make the cell lyse
faster: 0.3M Barkamide or 0.3M Wrinklamide?
Working With Experimental Data
Now, let’s work with an actual experiment, with non-fictional solutes and real data.
We will measure the time it takes for the RBCs to lyse in the presence of different
solutes, and with known permeability. Given that we will be working with known solutes,
we can make a connection between the chemical characteristics of the solute and the
membrane permeability.
The research question that we will be investigating is: How do the chemical
characteristics of a solute affect its membrane permeability?
It is possible to approach this question in many ways, so we will narrow and refine our
question, choosing to test the following hypothesis.
Hypothesis: Solutes that are more nonpolar will cause a faster lysis time, because
the membrane is more permeable to them.
Here is a longer justification for our hypothesis. In biological environments (i.e. in water),
polar molecules are repelled/excluded from the hydrophobic lipid bilayer. In contrast,
non-polar molecules are not excluded. If they are small enough, they are free to pass
through the fluid membrane. The more non-polar a molecule is, the easier and faster it
will move (net movement) across the membrane. The faster it moves across, the faster it
will impact total solute concentration, and thus the faster it will impact water movement
which causes cell lysis.
For this exercise, you will explore the methods and results of an experiment that tests
this hypothesis. You can use what you learn in this exercise to help you design &
interpret a similar experiment in lab.
Experimental design:
We will place RBCs in various solutes (always at 0.3M), and measure the lysis time.
This will allow us to determine whether red blood cells (RBCs) are permeable to the
solute, and if so, to what extent.
à What is the independent variable in this experiment?
à What is the dependent variable?
à Why is it important that the concentration of each solute be standardized to

0.3M?
Methods and Materials
In these experiments, 2 mL of a particular test solution was pipetted into a test tube. A
single drop of blood is added to this test solution. Initially, the test-solution-plus-blood
mixture is opaque (i.e. if you placed this page of your lab manual against the back of the
test tube, you would not be able to see the text clearly through the mixture). However,
as more and more RBCs lyse, the mixture will become more and more transparent
(while still remaining red in colour) until you are able to see the text clearly.
Lysis time was measured from the moment the blood hits the solution till the moment the
text could be read through the mixture in the test tube.
Four different solutes were tested, with their chemical characteristics given in Table 1.
For each, ten replicate test tubes were prepared. The lysis times were measured for
each, and the measurements from all ten replicates were averaged. The results are
given in Table 2.
Table 1: Chemical characteristics of four solutes, from outside data sources.
Solute Relative nonpolarity of this solute *

Formamide 0.00076
Acetamide 0.00083
Propionamide 0.0036
Butyramide 0.01
* The larger the value, the more nonpolar the solute. The scale goes from 0 to 1.
(Optional info, if you are interested, the nonpolarity of a molecule can be experimentally
measured using a “partition coefficient.” This is a measure of the solubility of a solute
molecule in oil relative to its solubility in water. A value close to 1 means that the solute
has high solubility in oil and low solubility in water. In other words, it is not very polar. A
value close to 0 means that the solute has low solubility in oil and high solubility in
water. In other words, it does have many strong polar groups or is even charged.)
à Assuming our Hypothesis is correct, predict which experimental group should

have the fastest lysis time, and which experimental group should have the
slowest lysis time. Explain.
Experimental Results:
Table 2: Lysis time for RBC placed in 0.3M solute; n=10 replicates per condition.
Experimental condition Average lysis time +/- Standard Deviation
Formamide 10 minutes +/- 0.2
Acetamide 5 minutes +/- 0.1
Propionamide 1.25 minutes +/- 0.12
Butyramide 0.25 minutes +/- 0.03
à Is our Hypothesis supported or rejected by these experimental results? Explain

your reasoning, with reference to the given solute properties and the results.
All of the solutes in this experiment are molecules which do not dissociate when
dissolved in water, meaning that they stay as one single species in solution. Some
compounds, such as NaCl, fully dissociate into ions when dissolved in water, meaning
there may be more than one species in solution.
à If we used NaCl as a solute in this experiment, which dissociates into Na+ and
Cl- ions when dissolved in water, what concentration of NaCl would we need to
use so that the experiment starts with cells in an isotonic solution?
PART B: MEMBRANE PERMEABILITY AND TEMPERATURE
Introduction
For Part B, you will combine your knowledge of experimental design and RBC
membrane permeability to design and carry out an experiment.
Lab Prep Exercise B: Understanding Experimental Design
As before, we begin with a research question: What effect does temperature have on
membrane permeability? We can focus our question by stating a specific and testable
hypothesis.
Hypothesis: As temperature increases, RBC membrane permeability will increase.
à State the independent variable (i.e., the variable you will manipulate).
à State the dependent variable (i.e., the variable you will measure).
à Explain why a change in temperature might increase membrane permeability.
à How will you measure RBC membrane permeability? (Hint: Review Lab Prep
Exercise A and In-Lab Activity A.)
IN-LAB ACTIVITIES
PART A: UNDERSTANDING PERMEABILITY,
TONICITY, AND OSMOSIS
Introduction:
To begin this week’s lab, you will add a drop of blood to 4 different solutions to see how
each solution affects the RBCs. You will then use what you’ve learned about
permeability, tonicity, and osmosis to explain what’s happening to these cells.
Useful to know, for this whole lab:

• The RBC membrane has very few membrane proteins, and none of them
are transporters for the solutes/reagents we’re testing here. So, you can
think of it as a reasonably good model for a pure phospholipid bilayer.
• The RBC cytoplasm has a total solute concentration of 0.3M.
o M represents molarity, measured in moles per litre.
o Of this total solute concentration, only a very tiny amount (assume ~0M) is
NaCl, and none of it is ethylene glycol.
Activity 1: Observing Red Blood Cells in 4 different solutions
Method Questions – Read through the methods and answer these before you perform
your experiment
à Understanding your reagents - Fill out the blanks in the following table, to
understand the reagents you are working with. (Some of the table is filled out for
you)
Reagent: When the reagent is dissolved in Based on the chemical properties of

water, what chemical species each species, do you expect these
is/are present in solution? species to be able to cross the RBC
membrane? (yes/no?)
NaCl
Ethylene
glycol
Distilled
water
à Understanding the tonicity - Fill out the blanks in the following table, to
understand the reagents you are working with. (Some of the table is filled out for
you)
Test Solution: What is the What is the total Consider the tonicity
concentration solute concentration to fill in the blank for
of each of the of this solution? each tube:
species in this
solution? Initially, this solution
(List each is ___________ to
species and the RBC.
give its
concentration)
A:
0.15 M NaCl
B:
0.8 M NaCl
C: N/A N/A
Distilled Water (no solutes)
D:
0.3M Ethylene glycol
Now, time to setup your experiment!
Materials
Gather and prepare the following materials
• Metal test tube rack x 1
• Test tubes x 4 – label the tubes A, B, C, D
As a team, figure out how to hold all 4 test tubes upright with a page of your lab manual
pressed against the back of all 4 tubes. You should be able to see the text through all 4
test tubes (see Figure 1 below).
Figure 1 - Schematic of test tubes held up in front of a background (page with text),
used to show RBC lysis. Lysis is observed by how transparent (or how opaque) the
solution is.
Methods
1. Using serological pipettes, transfer 2 mL of the appropriate test solution into
each tube (see Table 1 below).
2. Have one team-mate add one drop of blood to each tube, and then start a
stopwatch.
Important: Make sure the blood drops directly into the solution at the bottom of
each test tube. If the blood is slowly running down the inside of the test tube into the
solution, your results will not be accurate.
3. As soon as the blood has been added to all 4 tubes, give the tubes a gentle
shake to mix their contents, and then observe the tubes carefully for 8 minutes.
Tip: Assign one teammate to observe each tube.
• Note down any changes you observe in each tube, during this time (in Table
1 below)
• When any blood-solution mixture becomes transparent enough for you to see
the text clearly, view the stopwatch to note down the lysis time on Table 1.
• After 8 minutes, note down “> 8 minutes” as the lysis time for any tube that is
still opaque
If time is short, leave step 4 until after you have collected the rest of the data.
4. For each mixture that did not lyse within 8 minutes (i.e. that still have intact cells),
use a pasteur pipette to transfer a drop of this mixture to a clean glass slide,
cover it with a cover slip, and examine the RBCs under the microscope at 100x
and 400x magnification.
Note: You do not need to view the mixtures that have become transparent,
because you will not be able to find any intact cells anyways.
Tip: If you are unfamiliar with the compound microscopes, read the instructions
found in Lab One, or ask your TA/LI for help.
Results
Table 1: Lysis times and observations of the mixtures within each test tube.
Tube Test Solution Lysis Time Observations

(min)
A 0.15 M NaCl
B 0.8 M NaCl
C Distilled Water
D 0.3M Ethylene glycol
Microscopic observations of mixtures that had not lysed:
For each tube that did not lyse: draw 1-2 RBCs (NOT the whole field of view) from each
tube as observed through the microscope. Note the total magnification.
Total Magnification = eyepiece magnification (10) x objective mag. (4, 10 or 40)
Hint: You should only have to view and sketch samples from two tubes
à RBCs from Tube ____ viewed under microscope at _____ magnification.
à RBCs from Tube ____ viewed under a microscope at _____ magnification.
Discussion
à What differences did you notice between the RBCs in Tube A and Tube B,
when viewed under the microscope? Clearly explain why these differences exist,
in terms of permeability and tonicity.
à Why did lysis occur in Tube C? Explain what caused this in terms of
permeability and tonicity.
à Is test solution A hypertonic, hypotonic, or isotonic to the inside of the RBCs?
Justify your answer using the results (i.e. lysis times and your microscope
observations).
NaCl splits into two separate solute particles (Na+ and Cl- ions) when placed in water.
This means that Tube A with 0.15M NaCl and Tube D with 0.3M Ethylene glycol have
the same total solute concentration.
à If total solute concentration was the same for Tube A and Tube D, why were
the results different? Clearly compare what happened to the RBCs in these two
tubes, in terms of permeability and osmosis.
à Explain why the lysis times were different between Tubes C and D.
PART 2: MEMBRANE PERMEABILITY AND TEMPERATURE
Introduction
In Lab Prep Exercise B, you were introduced to an experiment on RBC membrane
permeability. In lab, you will finish planning the experiment with your team and carry it
out. To refresh your memory, you are testing the following hypothesis.
Hypothesis: As temperature increases, RBC membrane permeability will increase.
Experimental Design Questions
à What is your independent variable here?
à What is your dependent variable here?
Materials
For this experiment, you will use the following materials, and any other materials you
wish from Part A:
• Test tubes, and a test tube rack
• Your choice of solution from Part A: 0.15 M NaCl, 0.8 M NaCl, distilled water, or 0.3
M ethylene glycol
• blood
• Water baths at any of the following temperatures: 0, 10, 20, 37, 60, and 100°C.
Method
You will measure membrane permeability using the same general method you used in
Part A. However, in this case you will be isolating and manipulating temperature. This
means that you need to use the same solution in all your treatment groups, so that the
only difference between the test tubes is the temperature.
Method Questions – Answer these before you perform your experiment
à You need to pick one solution to use throughout the experiment. Do you think
this solution should be one that causes lysis by osmosis, or not? Explain your
reasoning.
à Based on your previous answer, which solution will you choose for this
experiment?
à Select 3-4 temperatures from the options listed under materials. Justify your
choice of temperatures.
To gather robust data from this experiment, we need to add one more component to our
experimental design: a negative control. For this experiment, our endpoint is the lysis
of RBCs. But there is a complication – there is more than one reason that RBCs may
lyse.
à In Part A, what caused RBCs in some of the solutions to lyse?
Here, we consider a confounding variable (i.e., a complicating factor that may interfere
with our results). At high temperatures, RBCs will denature (i.e., lose their structure) and
lyse. So, when RBCs in our experiment lyse, we need to know if it is because of
membrane permeability (as you observed in Part A) or because the cells denatured.
To separate these two effects, we will use a negative control. For every treatment test
tube, we will have a negative control test tube at the same temperature. The negative
control will be a set of test tubes where we do not expect the cell to lyse due to
membrane permeability. That way if we do observe lysis, we know the cells have
denatured because of high temperature.
à Now you need to choose a solution for the control tubes now – and it’s going
to be different than the solution in your treatment tubes. Which solutions didn’t
cause RBC lysis?
à If we can, we should try to use solutions in this experiment that have the same
molarities (Note: this could be an example of a standardized variable!). Based on
this, which solution should you pick for your negative controls?
Now, time to setup your experiment!
Results
Fill in the row and column headings with your choice of solutions and temperatures in
Table 2. Then, record time to lysis and notes (i.e., observations on any changes you
note in colour etc.) for each test tube.
Table 2: Time to lysis for treatment and control groups at different temperatures.
Temp 1: Temp 2: Temp 3: Temp 4:
Treatment Time
solution:
Notes
Control Time
solution:
Notes
à Did any of your control groups lyse? If so, at which temperature(s)?
We now use our negative control results to determine which treatment results are valid.
If any of the controls lysed, then we consider the paired treatment results to be invalid.
In other words, we cannot draw conclusions about membrane permeability for treatment
groups at these temperatures.
à In Table 2, circle the treatment groups that were valid, and mark a small ‘x’
beside the treatment groups that were not valid.
à Explain why we cannot draw conclusions about treatment groups whose

paired negative controls lysed.
Discussion
à Did your results support or reject your hypothesis (or were they inconclusive)?
Explain. (Remember, consider only the valid results.)
à Describe any sources of error in carrying out your experiment that may have
affected your results. (In other words, did you make any mistakes?)
à Describe exactly how you would change the design of your experiment to
increase your confidence in your results and conclusions.
è CHALLENGE. Write two new hypotheses that you might test, to dig deeper into
what you’ve already discovered with this experiment. (Notice that even if your
results are not what you expected, you still gain new information that can help
you focus your new hypotheses or raise new research questions.)
1. Appropriately apply the terminology and ideas from this week’s lab towards
2. Determine what a cell membrane is permeable and impermeable to, when given
descriptions of what happened to the cell in specific solution(s).
3. Given the results from an experiment involving solutions separated by a semi-
permeable membrane, identify the relatively hypertonic, hypotonic, or isotonic
solutions.
4. Explain why RBCs will lyse in 0.3M solutions when the RBC membrane is
permeable to the solute in that 0.3M solution.
5. Predict how permeable the RBC membrane would be to specific solutes, when
given information on the solutes’ polarity or partition coefficient.
6. Predict whether a particular solute will cross a cell membrane through the
phospholipid bilayer or through a transport protein, based on its polarity, or
partition coefficient.
7. Given descriptions of mixtures of solutions and RBCs, predict which mixture will
have a shorter lysis time, and justify your prediction.
8. Given the results of an experiment with RBCs mixed with different 0.3M
solutions, draw reasonable conclusions from these results.
9. Point out mistakes made in the methods of an experiment, and explain how
those mistakes might lead to misleading results.
10. Predict the direction in which solutes and/or water will move, when given a
description of the permeability of a membrane, and the solutions found on either
side of that membrane. Defend these predictions in terms of diffusion and
osmosis.
11. Prepare a wet-mounted slide, view with the 40X objective of a compound
microscope, and calculate the total magnification.
12. Draw what a RBC would look like when placed in a specific solution.
13. Perform each step of the scientific method, including: asking a research
question; choosing independent and dependent variables; composing a
hypothesis; designing experiments to test the hypotheses; gathering results and
objective observations; discussing those results and revising the hypotheses
based on your conclusions.
14. Design proper negative controls for an experiment, and explain why they are
necessary.
15. Discuss experimental results by drawing conclusions from the data, discussing
possible improvements to the experimental design, and composing new
hypotheses to test, with follow-up experiments.
WEEK FIVE: DNA STRUCTURE, MICROPIPETTING AND
AGAROSE GEL ELECTROPHORESIS

This week, we’re using Agarose Gel Electrophoresis to perform DNA
fingerprinting. This lab prep has 4 parts, in which you will build up your skills to be
ready to run the gel in lab.
PART A: INTRODUCTION TO PIPETTING
Pipettes are common tools in biology, used to transfer liquids from one place to
another. Learning to use pipettes is one of the most fundamental and important skills in
lab research, because appropriate and accurate transfer of reagents affects all lab
experimental data.
Many different types of pipettes exist, including these three: serological pipettes,
Pasteur pipettes and micropipettes. We have already used Pasteur and serological
pipettes. This week in lab we’ll be using micropipettes. Each type of pipette is useful for
its own reasons; read through the basics of each type below. In your lab quiz, you’ll be
asked about what pipette is the best choice for a given situation.
Serological Pipettes Pasteur Pipettes Micropipettes
Serological pipettes are Pasteur pipettes are used to Micropipettes are used to
used to accurately dispense liquids from accurately dispense very small
dispense volumes of volumes of drops to a few volumes (<1mL) of liquid. The
liquids. mL. They’re useful when most common sizes are the
accuracy is less important. P1000 (100-1000uL), P200 (20-
Commonly encountered
They’re also called “transfer 200uL), P100 (10-100uL) and
sizes are 1 mL, 2 mL, 5
pipettes” because they’re P10 (1-10uL).
mL, 10 mL and 25 mL.
useful for transfer, but not
Micropipettes use a disposable
The gradations on the side measurement.
plastic pipette tip, fresh with each
of a serological pipette are
These are glass (with a time you draw up liquid. The tips
used to measure liquid
removable re-usable bulb) or come in boxes.
aspirated and dispensed.
plastic.
à Question 1: If you are pipetting 0.05 mL of solution, how many microlitres is this?
(Note that microlitres is written as µL, or often typed as uL for convenience)
à Question 2: If you are pipetting 980uL of solution, how many mL is this?
PART B: MICROPIPETTING SIMULATION
Work through the following simulation about micropipetting that introduces the various
aspects of micropipette use.
Note: when doing the simulation, don’t worry too much about overshooting the “first
stop.” In real life you have control over the speed at which you press the plunger, and
how long you pause at each stop.
1. Open the simulator at
https://www.labxchange.org/library/items/lb:LabXchange:4eecf5fe:lx_simulation:1
2. Work through the simulation on Level 1 from start to finish, doing all the exercises
from Context to Summary.
3. Click on the “Results” tab on the right of the simulation, take a screenshot of your
results (including predicted, actual, and ideal), and paste it below.
A few notes:
- Depending on your screen size, you may need to hide the lab notebook by clicking on the blue
hexagon.
- If you encounter glitches, first try moving back and forth to different steps in the
sim or in the notebook. I suggest turning off adblockers; I had good luck with the
Chrome browser.
- If the browser window/tab gets closed, you’ll need to start again.
à Question 4: Screenshot of your Results in the micropipetting simulation (including

predicted, actual, and ideal results):
(Note that you will not be graded for accuracy of your own results in today’s simulations.
Just practice with the simulation until you are comfortable with the process, to be ready
for lab. Again, note that it will be much easier to feel the pipette’s “first stop” in lab than
it is in the simulation.)
PART C: GEL ELECTROPHORESIS SIMULATION
This simulation is gel electrophoresis using dyes (small molecules). In our lab, we’ll be doing
electrophoresis using nucleic acids, but the principles are the same.
1. Open the simulator at

https://www.labxchange.org/library/items/lb:LabXchange:9548bee3:lx_simulation:1
2. Work through the simulation from start to finish, doing all the exercises from
Context to Summary.
3. Click on the “Results” tab on the right of the simulation, take a screenshot of your
results (the three gels – predicted, actual, and ideal), and paste it below.
à Question 5: Screenshot of your Results in the gel electrophoresis simulation:
à Question 6: I ran the simulation myself, and here are my results (at right). There
weren’t any bands! But I definitely loaded the gel, and ran it!
Wow, I need your help. From these results, what mistake did I likely make? Why did it
give me a blank gel with no bands?
PART D: DNA FINGERPRINTING USING GEL ELECTROPHORESIS
Watch the first 3:00 minutes of the following video. (You don’t need to watch anything beyond that
time). https://www.youtube.com/watch?v=7onjVBsQwQ8
Note: the video briefly mentions STRs, PCR, and Restriction Endonucleases. You are not
responsible for knowing about these, though they are interesting and we are happy to chat about
them.
Also, unlike in the video, note that “Loci” is typically pronounced “low-sigh” not “lo-kee” – it is the
plural of the word ‘locus’ which just means ‘location’ or ‘place.’
à Question 7: In lab, we’ll be doing electrophoresis of DNA fragments in a

fingerprinting experiment. When the DNA is loaded into the wells, and the electrical
current is turned on, the DNA will migrate toward one electrode.
Which electrode will it move toward? Explain your reasoning.
IN-LAB ACTIVITIES
PART A: MICROPIPETTING
Micropipettes are used to accurately dispense very small volumes (<1mL) of liquid. As
part of your lab prep, you worked through an online simulation of micropipetting. Let’s
try it for real!
They are expensive and delicate, so be mindful of how you use and handle them.
Pipette dials and volumes: We are working with three micropipettes today, as below.
** The volume shown is in microlitres; fill out the blanks.
P20 P200 P1000
Volume Volume Volume range:

range: range: 100 uL to
2 uL to 20 uL to 1000 uL
20 uL 200 uL
Volume Volume Volume shown

shown in shown in in picture:
picture: picture: uL
7.5 uL uL
ACTIVITY A1: GET FAMILIAR WITH A PIPETTE

Repeat these steps to get comfortable.
1. Hold the pipette as in the figure shown, hooked over
your index finger of your dominant hand.
2. Get a feel for the plunger (top) and tip ejector (closer
to your palm).
3. Push the plunger down until you feel resistance. This is the first
stop. This is the “accurate” location for the volume you’d set on the
dial. You’ll start at this stop to draw up liquid.
4. Push the plunger down further. This is the second stop. This is
used to fully dispense the entire contents (but is not used to draw
liquid up, because it’s not accurate to the dial).
5. Release the plunger slowly, from both the 1st and 2nd stop, to feel
the difference.
6. Attach a pipette tip by firmly (but not roughly) pressing down on the
tip in the box.
7. Press the ejector button to eject the tip.
ACTIVITY A2: PRACTICE PIPETTING
Pipetting accurately takes practice. Follow the instructions given at the station, & help
each other out while you’re learning.
1. Practice pipetting water onto a surface to see if you can get consistent
volumes/sizes.
Choose the right pipette, and follow the appropriate steps to pipette water into a
provided weighboat or card:
a. Pipette three separate spots, each of 1000uL.
b. Pipette three separate spots, each of 100uL.
c. Pipette three separate spots, each of 9uL.
Try and see if you can make the spots within each volume consistent in size!
Practice as much as you need.
2. Make some solutions!

a. Using a Sharpie label three cuvettes (near the top of the cuvette): A, B, C.
b. Using the appropriate pipettes, measure the dye solutions into each cuvette
according to the table below. (Each person should pipette at least twice!)
General tip: pipette the largest volume first, then add the rest; mix each
time by gently pipetting up and down a few times (to the first stop only, not
2nd stop).
Solutions to make up – volumes to pipette (all volumes in uL)
Volume of Red Volume of Yellow
Cuvette Volume of Blue Dye Total Volume =
Dye Dye
A 91 4 805 ____
B 8 27 865 ____
C 9 101 790 ____
c. Check your accuracy by eye: Are all of the cuvettes at the same height?
d. Check your accuracy by pipetting:
i. With a fresh tip, using the appropriate pipette, set the dial to match
the (expected) total volume of the solution.
ii. Aspirate the liquid, and notice if your volume is what you expected
(i.e., no liquid left in tube, and no big bubbles in the pipette tip).
iii. If you notice any issues, check with your team and LI/TA for
troubleshooting your practice.
e. Check your accuracy by eye, comparing colours: Compare the colours of
your solutions to the instructor-provided solutions.
f. Set your cuvettes aside. Later, while your gel is running, you’ll use them
for Part D.
PART B: AGAROSE GEL ELECTROPHORESIS
In your lab prep, you did a simulation of agarose gel electrophoresis, with chemical
dyes being separated by size. Today in lab, we’ll instead we’ll be separating out DNA
samples in a forensic analysis. We’ll use a technique called DNA Fingerprinting: this
compares the electrophoresis band pattern of DNA samples taken from a crime scene
versus DNA samples taken from suspects. This allows the investigator to identify (or
rule out) who left their DNA at the crime scene.
First, you’ll practice loading a gel, to get a feel for it. Then, you’ll load a gel sample, run
the gel, and interpret the results.
ACTIVITY B1: PRACTICE LOADING A GEL

Practice gels are set up on the side benches of
the lab room. You’ll practice using food colouring
to get a feel for loading.
An excellent reference video (1.5 minutes long):
https://www.youtube.com/watch?v=Gzz07kz-zE8
1. What do a gel and its well feel like?
Holding a pipette tip directly in your hands,
put it into a well and move it around to feel
where the sides & bottom of the well are.
2. Using a pipette (with a tip on), load 20uL

of sample into a well.
• Plant yourself (elbows on bench,
stabilize pipette with other hand)
• See the wells from above
• Gently put the tip into the well, without stabbing the bottom. Pipette
slooowly.
• Dispense your sample. Do not go to the second stop (to avoid bubbles).
Don’t relax your thumb until the tip is out (or you’ll re-draw up the sample)
• After loading, look at the side of the well to see how it loaded.
It takes practice! Try a few times until you’re comfortable (you can re-use wells if
needed).
ACTIVITY B2: LOADING A DNA SAMPLE

You’ll be sharing a gel with your table. Each student will load one lane with 20uL of a a
DNA sample either from the crime scene or from a suspect.
Your LI/TA will load the ladder as a demonstration.
1. What sample are you loading? _____
2. What gel did you load into? ____ What row? (top or bottom) What lane #?
____
3. What are two purposes of the DNA ladder?
4. On the “top view” diagram above, draw an arrow showing the direction of DNA
movement. Why does the DNA move in this direction, in the gel? Which DNA
fragments (large or small) will move fastest, and why?
Once all of the samples are loaded, the instructor will start the gel. Notice that bubbles
should start rising from the wire (as a sign that the electrical current is on), and the dye
in the samples should start to migrate. The gel will run at 110V for 25 minutes.
5. What are the coloured bands that you can visually see in the gel? How are these
helpful to you for your gel experiment? (Note: they are NOT the DNA; DNA is
not visible, and needs a UV-fluorescent stain to be visualized on camera.)
During the gel run time, take a spectrum of your earlier food colouring sample (from Part
A), and work on the DNA structure activity (Part C, below).
ACTIVITY B3: IMAGING THE GEL AND INTERPRETING THE RESULTS

1. When the gel is ready, we’ll place it onto the visualizer and turn on the UV lights
to see the DNA bands. One member of the gel will take two photos: the signup
sheet, and the gel itself. You can then share amongst yourselves.
2. On the figure below (next page), use the gel image result to sketch the results
for your team’s samples plus the ladder in your row(s).
3. Consider the three different suspect samples. Which had the smallest DNA
fragment size? Which had the largest? Explain your reasoning, using the
results.
4. From your team’s DNA fingerprinting analysis, explain which suspect may have
left their DNA at the crime scene. Explain your reasoning.
Challenge (to discuss but don’t need to write down): Is DNA fingerprinting, as we’ve
done here, enough evidence to fully convict a criminal? Why or why not?
Your gel results: (Leave blank the lanes from other teams’ wells; if your team is small
today, you can use lanes from other teams to make sure that you have a complete set of
results.)
NEXT: Parts C and D, while your gel is running. They can be done in either order.
PART C: SPECTROPHOTOMETRY
1. Choose one of your colour mixtures (in the cuvettes). Load one of these cuvettes
into a spectrophotometer cuvette, and collect a spectrum.
Don’t forget to blank first. You can take a photo of your spectrum for analysis.
a. Which sample did you choose to load: Circle one: A B C
b. Look at the spectrum: What wavelengths had the highest absorbance?
c. Interpret the data: What colours are being absorbed by this sample?
Does this make sense, with the colours that you see? (Hint: if a colour
was absorbed by the sample, it’s not reflecting back out to your eyes.
White light contains all colours; if a colour wasn’t absorbed, it was
reflected…)
PART D: UNDERSTANDING DNA STRUCTURE
For this exercise, you team should observe the 3D model of DNA, along with the figure
below. Work as a team to answer the following questions. Note that if time is short for
this part, we will leave the DNA model out in the lab for you to revisit in office hours.
Please DO NOT TOUCH the model or move the stand it is sitting on. (please walk
around the table instead). It is very delicate and you don’t want to denature it.
DNA structure:
1. From Atoms to Nucleotides: Use the figure below & the 3D model in lab to
complete the table on the next page.
• (Hints, for figuring this out. What is covalently bonded to what? How big
are the atoms? Where are they situated within the DNA molecule?)
• Also, a chemistry reminder: phosphorous is not the same as phosphate!
• In the sugar ring here, the unlabeled corners of the pentagon are carbon
atoms.
• If you’re looking at this online (in colour), note that the colours here are
unfortunately not the same as in the 3D model in lab.
In the 3D model of DNA Explain your reasoning for how you
in the lab, what colour identified these atoms.
are these atoms?
Phosphorous
Nitrogen
Carbon
Oxygen
Hydrogen
In the model in the lab, visually locate a single DNA nucleotide within the 3D model,
and then find the following three components of this nucleotide:
• The phosphate group
• The deoxyribose sugar
• The nitrogenous base
2. Which of these three components is the most important for causing DNA
movement in gel electrophoresis?
3. Bond types: Find an example of each bond type in the model, & complete the table.
Give an example of this bond type, within the DNA model.
Covalent
Hydrogen
Bond
Stacking
interaction
What is the specific name of the bond between one nucleotide & the next, within one
strand?
___________________
What is the specific name of the interaction/bond between the nitrogenous bases
across strands? _______________
Nucleotides:
4. Find examples of all 4 bases (A, T, G, and C) in the 3D model. Briefly explain
how you were able to tell them apart.
5. Cytosine doesn’t normally bind with adenine, even though this would be a
purine-pyrimidine pair. Imagine if there was a mutation in one strand causing a
C in place of a T. What would happen to the overall DNA structure in this part of
the molecule?
Directionality and the double helix:

6. Look closely at the bottom end of the 3D model of DNA. Do the ends of the two
DNA strands look exactly the same? Discuss with your group which end is
which label. Explain your reasoning:
7. On the model, locate the major groove and the minor groove. Why do proteins
(such as transcription initiation factors) tend to bind the major groove, but not the
minor groove? (Hint: these proteins are physical objects; the answer here is
pretty simple.)
8. Major groove: Look along the major groove. The surface of the major groove is
NOT uniform all the way along – take a moment to try and see this subtle
structural element. What parts of the nucleotide causes these differences? How
is this non-uniformity a useful feature for the function of DNA?
End of in-lab activities.

Acknowledgements:
Parts of today’s lab were adapted from the SFU BPK408W lab manual, and from the MiniPCR
BIO Electrophoresis Forensics Lab Protocol.
Once you’ve completed and reviewed this lab you should be able to:
1. Appropriately apply the terminology and ideas from this week’s lab towards analyzing
new problems and discussing potential solutions.
2. Work effectively & respectfully with diverse teammates to collaboratively carry out the
process of science.
3. Use micropipettes to accurately pipette small volumes, including making a sample and
loading agarose gel electrophoresis.
4. Explain the reasoning why DNA migrates in electrophoresis, and why the size of the
molecule affects the speed of its movement in the gel.
5. Explain the purpose(s) of a DNA ladder in gel electrophoresis.
6. Interpret DNA fingerprinting results based on agarose gel electrophoresis data.
7. Describe all of the parts of a DNA double-helix, identify them in 3D model or figure, and
relate structure to function.
8. Use a spectrophotometer readout to identify & interpret peak absorbance wavelengths.
WEEK SIX. NO IN-PERSON LABS THIS WEEK.
GENE EXPRESSION: OPTIONAL LAB PREPARATION EXERCISES

FOR YOUR OWN STUDY
PART A: INFORMATION FLOW FROM DNA TO RNA TO PROTEIN
Introduction
Although DNA holds all of the genetic information of a cell, the DNA itself does not
directly perform most cellular activities. Instead, the information from each DNA-coded
gene is usually transcribed into mRNA. This mRNA is sent out of the nucleus to be
processed, and then translated into a protein within the cytoplasm. These proteins
can then catalyze chemical reactions as enzymes, control what enters/exits the cell as
membrane transport proteins, or synthesize the other biological molecules that the cell
needs. Overall, the process of transcription (+ mRNA processing, in eukaryotes) +
translation is called gene expression.
Transcription and translation can be challenging to picture in action. This is why, in this
week’s lab, your team will work together to perform a detailed demonstration of both
transcription and translation (with your TA/LI as your audience), using models`.
To prepare for this demonstration, complete Lab Prep Exercise 1 to make sure you
understand what happens to the genetic code during transcription and translation.
Before moving on to the remaining parts of this week’s Lab Preparations Exercises,
review your lecture notes or textbook to make sure that you are familiar with all of the
actions that take place during transcription and translation.
Lab Prep Exercise 1: Follow a Genetic Code as it is Transcribed and Translated

Introduction:
Here, you will take a DNA code (shown on the next page), and figure out what will
happen to this code during transcription and translation.
Transcription
Here (on the next page) is the genetic code from a strand of DNA. In this example, the
top strand is the template strand of this gene, and the bottom strand is the coding
strand. (This does NOT always have to be the case!)
3’ GGTATATTTTGGGCGGGCTGACTAGTACGATCGTTCGACTCTTCGGATT 5’
5’ CCATATAAAACCCGCCCGACTGATCATGCTAGCAAGCTGAGAAGCCTAA 3’
Some notes and tips:

• The bold underlined letter “G” marks the transcription start point (also called
the +1 site) for the gene we are transcribing.
• The bold underlined letters “ATT” mark the beginning of the termination
sequence of this gene.
• Eukaryotes process their mRNA after transcription. To keep your lab prep simple
today, we are skipping the RNA processing steps here.
• Real chromosomes are much longer, and contain many more genes.
• In test questions, we will always give you enough information to determine which
strand is which – but it might be indirect information.
• Consider to yourself: Do you expect your RNA strand to be the same length as
your DNA sequence? Why or why not?
à Using the DNA and notes above, write the sequence for the transcribed RNA
strand, from 5’ to 3’.
Translation
à Using the table on the next page, translate the mRNA from 5’ to 3’, and write
down the amino acids of the resulting polypeptide (in the order that they are
added during translation).
(Hint: there are only 3 amino acids (not including the start and stop codons), if you use
the start and stop codons properly)
à CHALLENGE: As a thought exercise, try repeating the exercise above using
the bottom strand of DNA as your template strand, and transcribing that entire
strand. Will a polypeptide be made? What problem occurs during translation?
(i.e. what is missing?)
Hint: Don’t forget directionality: the gene expression machinery only move in one
direction. That direction is determined by the 5’ and 3’ directionality, not by where the
DNA is written on the page.
à CHALLENGE: How do you think the transcription machinery “knows” which

strand is the template?
OPTIONAL IN-LAB DROP-IN REVIEW ACTIVITIES

GENE EXPRESSION FROM DNA TO PROTEIN
The activities here are designed to help you solidify your understanding of
lecture and lab material. We encourage you to join with your team, and work
through exercises together. Using the models set out in lab, you can review the
details of transcription and translation in eukaryotes.
These review activities are self-guided (i.e. there may not be an instructor or TA to
help, but we are happy to help in tutorial or office hours!)
Gene expression describes how the DNA-coded information from one gene is
transcribed into RNA and then translated into a polypeptide that the cell needs.
Note: we will focus on eukaryote transcription and translation in lab.
Your job today: understand the machines & processes of gene expression using model
kits. First, look over the parts list included with the models, and figure out the pieces.
à Get familiar with the pieces in this kit: what is the shape difference between an
RNA nucleotide and a DNA nucleotide?
à Get familiar with the nucleotide pieces: what shape is the 5’ end & what is the
3’ end?
TRANSCRIPTION
1) Watch this to see how you get started: https://bit.ly/bisc101transcription

2) Get organized: have the DNA sequence ready to go into the RNA polymerase,
and have a pile of RNA nucleotides ready to go.
3) Use the RNA polymerase, the DNA sequence, and the nucleotides to do
transcription (a.k.a. to synthesize/make the complete mRNA strand).
a. During this, write notes in your lab manual questions below,
describing what is happening.
b. Note that the first base in the mRNA corresponds to the transcription start
site (the +1 site); the last bases in the mRNA are the transcription
termination sequence.
mRNA processing:
There are no pieces on the kit to show this, but make sure to talk over the importance
of mRNA processing with your group.
à What are the three steps of mRNA processing?
TRANSCRIPTION & MRNA PROCESSING SUMMARY
Working with the model, use the terminology listed below for each step to explain what
is going on. Make sure you can define the roles of all of the terms listed for each step,
even if not presented by the model.
Initiation. Template strand, coding strand, promoter region of the DNA, TATA box,
transcription factors, RNA polymerase, transcription start point, complementary base.
Elongation. DNA, template strand, RNA polymerase, mRNA, 5’, 3’, complementary
base-pairing.
Termination. DNA, RNA polymerase, termination sequence, pre-mRNA.
mRNA processing. (you don’t have pieces in the model for this, so just talk it over and
write the steps.). Terms: RNA splicing, intron, exon, 5’ cap, poly-A tail, nuclear
membrane, cytoplasm, pre-mRNA, mature RNA.
TRANSLATION
1) Watch this to see how you get started: https://bit.ly/bisc101translation

2) Get organized: have the mRNA sequence ready to go into the ribosome. Make
sure all the tRNA molecules are loaded up with (attached to) their amino acids.
3) Use the ribosome, the mRNA sequence, and the nucleotides to do translation
(a.k.a. to synthesize/make the complete polypeptide).
a. During this, write notes in your lab manual questions below,
describing what is happening.
b. Note that the start codon in the mRNA corresponds to the tRNA carrying
the first amino acid of the polypeptide. The stop codon corresponds to the
release factor, which is not carrying any amino acid.
TRANSLATION QUESTIONS
Working with the model, use the terminology listed below for each step to explain what
is going on. The DNA is already assembled.
Make sure you can define the roles of all of the terms listed for each step, even if not
presented by the model.
Initiation. mRNA, small ribosomal subunit, start codon, tRNA, methionine, anticodon,
large ribosomal subunit, P site.
Elongation. Codon, anticodon, tRNA, A site, P site, E site, peptide bond, polypeptide,
translocation.
Termination. Stop codon, A site, P site, E site, release factor, polypeptide, tRNA, small
ribosomal subunit, large ribosomal subunit.
After expressing a gene, tidy up and keep everything organized.
Tidy up:
1) LEAVE the DNA sequence intact (do not dismantle it).
2) Dismantle the mRNA sequence into a pile of nucleotides. Make sure you do
not break the “arrows” or “tails” on the foam pieces.
3) Dismantle the protein sequence.
4) Load the amino acids back onto the tRNA molecules.
5) Put the pieces back in an organized way, for the next team.
9. Appropriately apply the terminology and ideas from this week’s lab towards analyzing
new problems and discussing potential solutions.
10. Describe all of the parts of a DNA double-helix, and identify them in 3D model or figure.
11. When given a DNA sequence, write the mRNA sequence that will be transcribed, and
name the amino acid sequence that will be translated.
12. Describe the steps of transcription and mRNA processing, using the appropriate
terminology.
13. Describe the steps of translation, using the appropriate terminology.
WEEK SEVEN. ENZYMES

PART A— EXPERIMENTING WITH TEMPERATURE,

ENZYME CONCENTRATIONS, AND pH
Introduction
Enzymes are proteins (and sometimes nucleic acids) that can greatly increase the rates
of specific chemical reactions by acting as catalysts that lower the activation energies of
chemical reactions. Enzymes are essential to life because most metabolic reactions
would not take place at all, unless the enzymes that catalyze them are synthesized.
In Part A of this week’s lab, you will experiment with different variables that could affect
the rate of a specific chemical reaction— the digestion of starch by the enzyme
amylase.
Amylose is one of the two main components of starch (along with amylopectin). Amylose
is very common in your diet; it is a carbohydrate. For the purposes of today, we’ll use
the terms “starch” and “amylose” interchangeably.
Amylose is a linear polysaccharide, consisting of a long chain of glucose monomers

linked together by glycoside bonds. Amylose is the substrate for the enzyme amylase.
Amylase is an enzyme found in the digestive system of many animals; today, we’re
working with salivary amylase, which can be isolated from human saliva.
Amylase digests amylose by breaking the glycoside bond at one end of the
polysaccharide, releasing a glucose molecule. Essentially, amylase is chewing off the
glucose molecules, one at a time, from the end of the amylose.
We can represent this reaction in words:
Amylosen + Water → Amylosen-1 + Glucose
‘n’ is the number of monomers in the polysaccharide. Typically amylose is anywhere

from ~300-600 monomers long.
We can also show the reaction in a chemical reaction diagram:
à If amylose and amylase are left together in solution in a test tube for a long
period of time, what will be left in the test tube at the end?
Enzyme-catalyzed reactions can be affected by many different variables and we may

want to measure the activity of an enzyme, or its rate of reaction, under specific
conditions.
How can we see the rate of reaction in a test tube? For

the amylase enzyme, we will use an iodine test. Iodine is
normally yellow, but is used as a chemical indicator
which turns purple in the presence of starch. In this
figure you see that in the presence of starch, the sample
is purple (left). In the absence of starch, the sample is
yellow (right).
The research question and the three hypotheses you will be testing are given below. By
interpreting the results of these experiments, you will learn how to gather and
summarize quantitative results, and you will improve your understanding of how
enzymes work.
Research Question: What factors affect the rate of an enzyme-catalyzed reaction?
Hypothesis 1: Increasing the temperature will increase the rate of enzyme-catalyzed

reactions. (Tested in Lab Prep Exercise A)
Hypothesis 2: Increasing the enzyme concentration will increase the rate of enzyme-
catalyzed reactions. (Tested in In-Lab Activity A1)
Hypothesis 3: Enzyme-catalyzed reaction rates peak at an optimal pH and rates
decrease at pHs above or below that optimum. (Tested in In-Lab Activity A2)
Before moving on to the remaining parts of this week’s Lab Preparation Exercises,
review your lectures or textbook to make sure you are familiar with the ways in which an
enzyme affects a chemical reaction, and the factors that can affect an enzyme’s activity.
EXERCISE A— TESTING THE EFFECTS OF

TEMPERATURE ON REACTION RATES
Introduction
In lab, you will be testing Hypothesis 2 (in Activity A1) and Hypothesis 3 (in Activity A2).
Read through the introductions and methods of these exercises to understand how you
will be setting up these experiments.
In this Lab Preparation Exercise, you will prepare for your in-lab activities by designing
an experiment to test Hypothesis 1. You will then graph, interpret, and discuss the given
results to determine whether the hypothesis is supported or rejected in order to gain a
better understanding of how temperature affects enzyme-catalyzed reactions.
Hypothesis 1: Increasing the temperature will increase the rate of enzyme-catalyzed

reactions.
à State the independent variable:
à State the dependent variable:
Materials & Methods
à Design an experiment to test Hypothesis 1. You may use any of the materials
outlined in Activity A1. In addition, you have 6 water baths at the following
temperatures: 0, 10, 20, 37, 60, and 100°C. Your experimental design should
include all the steps needed to complete the experiment.
Results
Table A shows the raw observations from an experiment that tests Hypothesis 1.
Table A: Raw results from Lab Preparation Exercise A. At each temperature, 10

replicate reactions were performed. These reached completion at the same time, and so
only one representative set of results is given for each temperature, for graphing
purposes.
Temperature tested (°C)

Time (min) 0 10 20 37 60 100
1 Purple Purple Purple Yellow Purple Purple
2 Purple Purple Yellow Purple Purple
3 Purple Purple Purple Purple
7 Purple Yellow Purple Purple
8 Purple Purple Purple
Note: For this experiment, we also tested 10 control tubes (which contained everything
except the amylase enzyme) at each of these temperatures to make sure that these
temperatures do not directly cause starch breakdown. For all 6 temperatures, the tests
were purple for all 8 minutes.
à Summarize these results in a more easily-interpretable way by plotting a graph of

Reaction rate vs. Temperature on the graph paper provided below (Figure A). Clearly
label the axes!
Reaction rate = 1 ÷ (the time taken for the reaction to reach completion)
Hint 1: If the reaction didn’t finish in eight minutes, assume that the reaction rate was
close to zero.
Hint 2: The independent variable is usually plotted on the x-axis (the horizontal one).
Figure A: A graph of the relationship between reaction rate and reaction temperature,
for the enzymatic digestion of starch by alpha amylase.
Discussion
à Why do you think the reaction rate was so low at 0°C?
à The reaction rate seemed to increase exponentially as the temperature

increased from 0 to 37°C. Propose some possible explanations for this result.
à The reaction rate dropped suddenly between 37 and 60°C. Propose some
possible explanations for this result.
à CHALLENGE: How might the graph be different if we had collected amylase

from a bacterium that thrives in warm waters around 70°C? Explain your answer
in terms of enzyme structure and function.
EXERCISE B— TESTING THE EFFECTS OF CONCENTRATION ON REACTION

RATES: EXPERIMENTING WITH COMPETITIVE AND NON – COMPETITIVE
INHIBITORS
Introduction
Another important factor that can affect enzyme activity is the presence (and
concentration) of molecules that can inhibit or promote enzyme activity. We will consider
two types of chemical inhibitors: competitive inhibitors and non-competitive
inhibitors.
Check out the video summary of inhibitor types— https://bit.ly/bisc101inhibitors
Competitive inhibition occurs when a specific inhibitor molecule binds reversibly to the
active site of an enzyme. The inhibitor slows down the reaction rate by competing with
the substrate for the enzyme’s active site— just like a race. Whichever molecule first
gets to the active site is the “winner,” and this determines whether the reaction will
happen or not. The reaction rate depends primarily on the concentration of substrate
relative to competitive inhibitor. Because these inhibitor molecules recognize/bind the
active site (which is where the substrate normally binds), they often have a very similar
structure as the substrate (or at least a part of the substrate).
Non-competitive inhibitors (a type of allosteric inhibitor) bind to the enzyme at an

“allosteric” site— this is any site other than the active site. When non-competitive
inhibitors bind the enzyme, they can change the shape of the active site or otherwise
prevent the substrate from binding to the active site. The enzyme is changed, such that
it no longer functions. Some poisons work this way by inhibiting a variety of different
types of enzymes. These inhibitors don’t bind the active site, so they don’t generally
have similar structures as the substrate.
Note: there are lots of molecules/compounds/chemicals in the cell that do not affect a
given enzyme, at all. Not every molecule that an enzyme bumps into, or even binds to,
is an inhibitor.
In Part B of this week’s lab, you will experiment with three potential inhibitor molecules
to determine which one(s) inhibit the activity of the enzyme succinic dehydrogenase.
If they do inhibit the reaction, you will also determine whether they are competitive or
non-competitive inhibitors.
Before moving on to the remaining parts of this week’s Lab Preparations Exercises,
review your lectures or textbook to make sure you understand how enzymes work.
INTERPRETING THE METHODS OF OUR CHEMICAL INHIBITION EXPERIMENT
For this exercise, read through the Introduction and Methods for In-Lab Activity B to
learn about the chemical inhibition experiment that you will be performing this week.
The following questions prompt you to make predictions about the experiment that will
help you interpret your results in lab.
à Predict your data in the table below.

If the tube... ...contains a molecule that ...contains a molecule that
DOES inhibit the reaction does NOT inhibit the
reaction
Do you expect an
enzymatic reaction to
occur?
(yes or no)
What colour would the

tube be at the end of the
experiment?
(more or less blue or
purple)
à Predict how substrate concentration will affect your results by entering the
colour you predict to see in the table below.
If the tube... ...contains a ...contains a non- …contains a molecule

competitive inhibitor competitive inhibitor that is not an inhibitor
Low substrate
High substrate
à Tubes A, B, and C have no inhibitor. They are your control tubes. Writing in the
table below: what will the results from each tube tell you? What is this tube being
used to check? Predict the colour of the tube.
Tube Purpose Colour
Tube A:
Tube B:
Tube C:
Note: during analysis, you always want to analyze control tubes first, before interpreting
the findings for other tubes
IN-LAB ACTIVITIES
Important Instructions for this week:

Each team will complete Activity B first, and either Activity A1 or A2, as assigned by a
lab instructor or TA. Teams will swap results for Activities A1 and A2 and answer
discussion questions for both activities.
PART A— EXPERIMENTING WITH TEMPERATURE, ENZYME CONCENTRATIONS,

AND pH
In Part A of this week’s lab, you will investigate how different variables affect the rates of
enzyme-catalyzed reactions by testing just one of these two hypotheses:
Hypothesis 2: Increasing the enzyme concentration will increase the rate of

enzyme-catalyzed reactions. (Tested in Activity A1)
Hypothesis 3: Enzyme-catalyzed reaction rates peak at an optimal pH (and rates

decrease at pHs above or below that optimum pH). (Tested in Activity A2)
ACTIVITY A1: TESTING THE EFFECT OF ENZYME CONCENTRATION ON

REACTION RATE
Introduction
The purpose of Activity A1 is to test the effect of enzyme concentration on reaction rate.
The independent variable (i.e., what we will manipulate) is enzyme concentration and
the dependent variable (i.e., what we will measure) is reaction rate. We will use starch
as our substrate and our enzyme is amylase, which digests starch. We will then use an
iodine test to determine whether the starch has been digested by the amylase. Using the
iodine test we can figure out how quickly the starch broke down. This gives us our
reaction rate.
Materials
Gather and prepare the following materials:
Equipment:
• Test tubes x 7 – Label the tubes “amylase”, “iodine”, and #1-5
• Drop-plates x 2 – Make sure the plates are clean and dry
• Pasteur pipettes with bulbs x 3 – Place one in the test tubes for amylase,
iodine, and test tube #1.
Chemical Reagents:
CAUTION: Please make sure you use the correct labeled pipettes for these solutions,
as cross-contamination will ruin the entire bottle of solution!!!
• Amylase solution— Shake the bottle well before pipetting 1 mL into the
“amylase” test tube
• Iodine solution— Pipette 4 mL into the “iodine” test tube
• 0.5% starch solution— Shake the bottle well before pipetting 1 mL in to each of
tubes #1-5.
• Distilled water— You can get this from the glass bottles at the Activity A1 lab
bench.
Methods
It is very important that you understand the protocol and that your team is organized
before you begin the experiment, making an experimental flow chart will help. Make sure
that you have prepared all tubes as indicated in the Materials section.
Organize your team

• Timer. This person will start the timer as soon as the amylase is added, and call
out 30 second intervals to the team.
• Experimenter. This person will add the amylase and water to the starch tube,
and shake the test tube to keep it stirred. This person will also add 2 drops of the
starch-enzyme mixture to the plate every 30 seconds. Make sure not to mix up
the pipettes from the amylase and test tube #1!
• Observer. This person will add 2 drops of iodine to the spot plate every 30
seconds, and will determine whether the mix in the spot plate is clear or opaque.
• Recorder. This person will record the data in Table A1-2. The reaction time is the
time it takes until the starch-amylase mixture turns clear/when you can see the ‘X’
on the spot plate when tested. Make sure every teammate copies down the
results in Table A1-2.
Protocol
Working one tube at a time:

o Add the indicated number of drops of enzyme and water (see Table A1-1)
to the starch solution, then start the timer. Shake or stir the mix frequently.
Make sure the amylase and water drop directly into the starch and does
not run slowly down the test tube sides.
o After 30 seconds, take out a small sample of the mixture. Add 2 drops of
the mixture and 2 drops of iodine to a well on the spot plate. Note the
colour immediately after the starch-amylase mixture has been added to the
iodine. Record this data in Table A1-2.
• If the result is purple and opaque (i.e., you cannot clearly see the ‘X’ in the spot
plate), wait another 30 seconds then re-test the mixture from the test tube.
• If the result is clear (you can see the ‘X’, the starch has been digested and you
can stop the timer.
• If the result is still purple and opaque at 8 minutes, record >8min.
Note: There are reference photos in the lab to help you judge when the sample is
sufficiently clear.
Flowchart A-1. Flow chart for iodine starch test shown for one tube of starch. Testing
should continue until a clear liquid result is observed, or wait up to 8 minutes, whichever
happens first.
Table A1-1: Number of drops of water and amylase solution added to each tube to
begin each reaction.
Tube # # of drops of distilled water # of drops of amylase solution
1 4 1
2 3 2
3 2 3
4 1 4
5 0 5
Important tips
• When you are ready, begin with test tube 1. When you are finished test tube 1,
record your data. Empty any liquid from the pipette in test tube 1, then transfer
the pipette to test tube 2. Repeat for each test tube.
• The amylase will settle over time. Shake or stir the amylase bottle or test tube
before you take some out.
• Be very careful not to mix the pipettes! This can spoil a bottle or affect results.
• The chemical reaction takes place in the test tube, not in the spot plates! This is
why every 30 seconds you need to take another sample from the test tube, and
test it in the spot plate. DO NOT watch the spot plates waiting for the mixture to
change colour over time.
Clean up
• Dispose of all solutions down the drain.
• Dispose of test tubes in the glass disposal container.
• Return pipette bulbs to their original container and dispose of pipettes to the glass
disposal container (on the bench or beside the sink).
Results
Use Table A1-2 to record your observations from this experiment. Record “P” for purple
if the “X” was not visible at that time, and “Y” for if the “X” was visible.
Table A1-2: Raw data for reaction time at different enzyme concentrations (Activity A1).
Tube #
Time 1 2 3 4 5
(min)
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
4.5
5.0
5.5
6.0
6.5
7.0
7.5
8.0
Graph Reaction Rate vs. Enzyme Concentration on the graph below (Figure A1-1). The
reaction rate is 1 ÷ the time taken for the reaction to reach completion. The unit for
Enzyme Concentration = “Drops of amylase solution per mL of starch solution”. Be sure
to label the axes.
Figure A1-1. A graph of the relationship between reaction rate and enzyme
concentration, for the enzymatic digestion of starch by alpha amylase.
Discussion:
You need to complete this section even if you did not carry out this experiment!
à Did reaction rate increase with increased concentration of amylase enzyme?
Explain your answer (i.e. why would increasing concentration of amylase have
this effect on reaction rate?).
The following graph shows what happens to reaction rates when you keep enzyme
concentration constant, and increase substrate concentration instead.
à Explain why reaction rate increases as substrate concentrations increase, at

low substrate concentrations (i.e. on the left side of the graph).
à Explain why reaction rates plateau at a maximum reaction rate, at high

substrate concentrations (i.e. on the right side of the graph).
à CHALLENGE: Your body produces amylase whenever you eat starch, to help
digest that starch into simple sugars that you can absorb into your bloodstream.
If your blood sugar is too low due to a lack of sugar-uptake from your digestive
system, is this more likely because of a lack of substrate (i.e. starch) or a lack of
enzyme (amylase)? Explain your answer using your own words and logic.
ACTIVITY A2: TESTING THE EFFECT OF pH ON REACTION RATE
Introduction
The purpose of Activity A2 is to test the effect of pH on reaction rate. The independent
variable (i.e., what we will manipulate) is pH and the dependent variable (i.e., what we
will measure) is reaction rate. We will use starch as our substrate and our enzyme is
amylase, which digests starch. We will then use an iodine test to determine whether the
starch has been digested by the amylase. Using the iodine test we can figure out how
quickly the starch broke down. This gives us our reaction rate.
Materials
Gather and prepare the following materials:
Equipment:
• Test tubes x 7 – Label the tubes “amylase”, “iodine”, and #1-5
• Drop-plates x 2 – Make sure the plates are clean and dry
• Pasteur pipettes with bulbs x 3 – Place one in the test tubes for amylase,
iodine, and test tube #1.
Chemical Reagents:
CAUTION: Please make sure you use the correct labeled pipettes for these solutions,
as cross-contamination will ruin the entire bottle of solution!
• Amylase solution – Shake the bottle well before pipetting 1 mL into the
“amylase” test tube
• Iodine solution – Pipette 4 mL into the “iodine” test tube
• 0.5% starch solution – Shake the bottle well before pipetting 1 mL in to each of
tubes #1-5.
• pH buffers x 5 – These are on the Activity A2 lab bench.
Methods
It is very important that you understand the protocol and that your team is organized
before you begin the experiment. Make sure that you have prepared all tubes as
indicated in the Materials section.
Organize your team

• Timer. This person will start the timer as soon as the amylase is added, and call
out 30 second intervals to the team.
• Experimenter. This person will add the amylase to the starch tube, and shake
the test tube to keep it stirred. This person will also add 2 drops of the starch-
enzyme mixture to the plate every 30 seconds. Make sure not to mix up the
pipettes from the amylase and test tube #1!
• Observer. This person will add 2 drops of iodine to the spot plate every 30
seconds, and will determine whether the mix in the spot plate is clear or opaque.
• Recorder. This person will record the data in Table A2-2. The reaction time is the
time it takes until the starch-amylase mixture turns clear/’X’ is visible when tested.
Make sure every teammate copies down the results in Table A2-2.
Protocol
• Add pH buffer to each test tube, as outlined in Table A2-1.
• Working one tube at a time:
o Add 1 drop of enzyme to the starch solution, then start the timer. Shake or
stir the mix frequently. Make sure the amylase drops directly into the
starch and does not run slowly down the test tube sides.
o After 30 seconds, take out a small sample of the mixture. Add 2 drops of
the mixture and 2 drops of iodine to a well on the spot plate. Note the
colour immediately after the starch-amylase mixture has been added to the
iodine. Record this data in Table A2-2.
• If the result is purple and opaque (i.e., you cannot clearly see the ‘X’ in the spot
plate), wait another 30 seconds and retest the mixture from the test tube.
• If the result is clear (i.e. you can clearly see the ‘X’ in the spot plate), the starch
has been digested and you can stop the timer.
• If the result is still purple and opaque at 8 minutes, record > 8min.
Note: There are reference photos in the lab to help you judge when the sample is
sufficiently clear.
Table A2-1: The pH of the buffer added to each test tube.
Tube # pH of the buffer added to each Volume of buffer added

tube (mL)
1 pH 2 0.7
2 pH 4 0.7
3 pH 6 0.7
4 pH 8 0.7
5 pH 10 0.7
Flowchart A-2. Protocol for iodine starch test shown for one tube of starch. Testing
should continue until a clear liquid result is observed or for 8 minutes, whichever
happens first.
Important tips
• When you are ready, begin with test tube 1. When you are finished test tube 1,
record your data. Empty any liquid from the pipette in test tube 1, then transfer
the pipette to test tube 2. Repeat for each test tube.
• The amylase will settle over time. Shake or stir the amylase bottle or test tube
before you take some out.
• Be very careful not to mix the pipettes! This can spoil a bottle or affect results.
• For the serological pipettes, read the scale carefully. If the zero is at the top you
might need to do some simple math to measure out the volumes. Ask if you need
clarification!
• The chemical reaction takes place in the test tube, not in the spot plates! This is
why every 30 seconds you need to take another sample from the test tube, and
test it in the spot plate. DO NOT watch the spot plates waiting for the mixture to
change colour over time.
Clean up
• Dispose of all solutions down the drain.
• Dispose of test tubes in the glass disposal container.
• Return pipette bulbs to their original container and dispose of pipettes to the glass
disposal container (on the bench or beside the sink).
Results
à Use Table A2-2 to record your observations from this experiment.
Record “P” for purple if the “X” was not visible at that time, and “Y” if the “X” was
visible.
Table A2-2: Raw data for reaction time at different pHs (Activity A2).
pH of the buffer added to the starch

Time 2 4 6 8 10
(min)
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
5.5
6
6.5
7
7.5
8
à Graph Reaction Rate vs. pH on the graph below (Figure A2-1). Be sure to label
the axes.
Reaction rate = 1 ÷ (the time taken for the reaction to reach completion)
Figure A2-1: A graph of the relationship between reaction rate and pH, for the
enzymatic digestion of starch by amylase.
Discussion:
You need to complete this section even if you did not carry out this experiment!
Many enzymes have a sharp peak in reaction rates at an optimum pH. For these
enzymes, reaction rates drop quickly as the pH becomes greater or less than the
optimum pH.
à Explain why reaction rates are so low at extremely high and low pHs.
(Hint: what happens to protein enzymes at these extreme pHs?)
à Explain why even moderate changes in pH can result in lower reaction rates,
when the pH is not optimal. (Hint: how might pH affect an enzyme’s active site?)
à CHALLENGE The fungal amylase used in this experiment has a broader optimal
pH than many other enzymes. Explain why an amylase with a broader optimum pH
might have evolved in fungi, and not in our human digestive systems. In other
words, why might a broad pH tolerance benefit fungi, but not humans?
PART B— TESTING THE EFFECTS OF CONCENTRATION ON REACTION RATES:
EXPERIMENTING WITH COMPETITIVE AND NON – COMPETITIVE INHIBITORS
ACTIVITY B: TESTING THE EFFECT OF POTENTIAL INHIBITORS
Introduction
This experiment will determine if (and how) three chemicals might inhibit the activity of
succinic dehydrogenase. In the mitochondria of living cells, this enzyme is responsible
for the removal of two hydrogen atoms from succinic acid during the citric acid cycle (an
important biochemical pathway). The reaction changes succinic acid into fumaric acid,
and the hydrogen atoms are transferred to FAD, which becomes FADH2.
This means that the substrate for succinic dehydrogenase is succinic acid, and its
products are fumaric acid and hydrogen atoms.
In this experiment, we will be extracting succinic dehydrogenase from living beef heart
cells and experimenting with it outside of the living cells. Therefore, there is no FAD to
accept the hydrogen ions being produced by the enzyme. Instead, we will add
methylene blue as a useful chemical indicator, because it changes from blue to
colourless when it reacts with hydrogen atoms.
Therefore, by adding methylene blue to a mixture of succinic dehydrogenase (the
enzyme) and succinic acid (the substrate), we can detect when hydrogen atoms (the
product) are produced because the methylene blue (the indicator) will gradually
change colour, from blue to colourless, as the enzyme-catalyzed reaction proceeds.
The three potential inhibitor molecules are in this exercise are:
COOH COOH
| |
CH2 CH3
|
COOH acetic acid methylparaben
malonic acid
Methods
Procedure B1: Extracting succinic dehydrogenase from beef heart cells
Work carefully to keep everything cold throughout the procedure.
1. Prepare the beef heart sample for enzyme extraction.
• Weigh 5-6 g of beef heart. Remember to tare (zero) the balance with the empty
weigh boat.
• Coarsely dice the beef heart with a razor blade, cutting it into approximately 2-
mm-wide cubes.
Please hold the meat with forceps to avoid cutting your fingers.
• To wash the beef, place the diced tissue in a beaker, add 10 mL of ice-cold
distilled water, and swirl the mixture for 1 min. Pour off the water through a
cheesecloth, keeping the diced beef in the beaker. Dispose of the rinse water in
the sink.
• Repeat the washing with another 10 mL of ice-cold distilled water, and dispose of
the rinse water in the sink.
2. Releasing the enzyme from the live beef-heart cells.

• Add 25 ml of ice-cold, 0.25M sucrose solution to the meat. Swirl the mixture and
pour it into a tissue homogenizer (blender).
• Cover the homogenizer and, keeping the palm of your hand on the cover,
homogenize the tissue for 1 minute.
3. Filtering the homogenate to remove larger solids:

• Place an unused piece of cheesecloth in a funnel, and place the funnel in a
beaker.
• Pour the homogenized beef heart mixture through the cheesecloth and funnel, to
remove any solid chunks.
• Pour the filtered enzyme extract into a test tube and discard any excess mixture
in the sink.
• IMMEDIATELY place your test tube in ice to keep it cold.
• This is the enzyme extract you will use for procedure B2
4. CLEAN UP
• Rinse out the homogenizer and cover for the next group.
• Discard the cheesecloth and any remaining beef chunks in the garbage.
• Rinse the funnel and beaker and return it to the bench.
Procedure B2 – The Enzyme Assay
1. Label nine test tubes A to I, and keep them in an ice bucket.
2. Add the correct volumes of substrate, indicator, water, and “inhibitor” using the
chart below. Add the enzyme extract last to tubes B-I.
*Make sure to read the volumes on the pipettes carefully (i.e., if the zero line is at the top
and you want 0.1 mL, draw the liquid to the 0.9 mL line).
*Use the correct pipettes to avoid cross-contamination.
Tube # Treatment Ingredients _________________________ _
A Control, no enzyme. 0.1 mL of 0.5M sodium succinate (substrate)

0.2 mL of 0.01% MB (indicator)
0.9 mL of distilled water
B Control, no substrate. 0.2 mL of 0.01% MB (indicator)

0.6 mL of enzyme extract
C Enzyme + substrate, 0.1 mL of 0.5M sodium succinate (substrate)

no test inhibitors. 0.2 mL of 0.01% MB (indicator)
D Enzyme + substrate, 0.1 mL of 0.5M sodium succinate (substrate)

malonic acid as test 0.1 mL of 0.5M malonic acid (“inhibitor” #1)
inhibitor. 0.2 mL of 0.01% MB (indicator)
E Enzyme + substrate, 0.3 mL of 0.5M sodium succinate (substrate)

malonic acid as test 0.1 mL of 0.5M malonic acid (“inhibitor” #1)
inhibitor, substrate 0.2 mL of 0.01% MB (indicator)
concentration tripled. 0.6 mL of enzyme extract
F Enzyme + substrate, 0.1 mL of 0.5M sodium succinate (substrate)

acetic acid (sodium 0.1 mL of 0.5M sodium acetate (“inhibitor” #2)
acetate) as test 0.2 mL of 0.01% MB (indicator)
inhibitor. 0.2 mL of distilled water
G Enzyme + substrate, 0.3 mL of 0.5M sodium succinate (substrate)

acetic acid (sodium 0.1 mL of 0.5M sodium acetate (“inhibitor” #2)
acetate) as test 0.2 mL of 0.01% MB (indicator)
inhibitor, substrate 0.6 mL of enzyme extract
concentration tripled.
H Enzyme + substrate, 0.1 mL of 0.5M sodium succinate (substrate)

methylparaben 0.1 mL of 0.5M methylparaben (“inhibitor” #3)
as test inhibitor. 0.2 mL of 0.01% MB (indicator)
I Enzyme + substrate, 0.3 mL of 0.5M sodium succinate (substrate)

methylparaben as 0.1 mL of 0.5M methylparaben (“inhibitor” #3)
test inhibitor, substrate 0.2 mL of 0.01% MB (indicator)
concentration tripled 0.6 mL of enzyme extract
3. Mix the contents of each test tube well by holding the tube firmly near the top of
the tube with one hand, and tapping the bottom of the tube with your other hand.
4. Holding the test tube on an angle, pour mineral oil down the inside of each tube
to form a surface layer about 0.5 cm thick.
*The oil keeps oxygen from diffusing in, so that any reduced methylene blue will
not be re-oxidized.
*Once the oil has been added, be very careful not to shake or stir the test tubes.
5. Carefully transfer the all nine test tubes to a 37°C water bath for 20 minutes.
6. After 20 minutes, remove the test tubes to a rack, being careful not to stir or
shake the test tubes. Record your results below.
Results
Record your observations in the table below. Rank the color intensity of the contents of
each tube using the following notations:
0 no blue color ( or reddish color of enzyme extract)
+ faint blue color
++ fair blue color
+++ good blue color (e.g. tube #2)
++++ deep blue color (e.g. tube #1)
Make additional observations in the Observations column, as you see fit.
Tube # Colour Ranking Observations

A
Discussion
Use your lab prep predictions to help answer these questions.
àDid your control tubes behave as expected? Yes or no (and for which
tubes). By answering this question, you are essentially answering the question:
Did my experiment work? Can I trust my results?
àOf the 3 potential inhibitors, which one was NOT an inhibitor? How did you
arrive at this conclusion?
à Which chemical was the competitive inhibitor? How does a competitive

inhibitor work?
à Which chemical was the non-competitive inhibitor? How does a non-

competitive inhibitor work?
àWhich of the 3 potential inhibitors most closely resembles succinic acid?

Explain.
àCHALLENGE: What information can you infer by comparing the structure of this
inhibitor to the structures of sodium succinate and sodium acetate? Which
structures seem to be necessary for the molecule to bind to the active site?
Hint: Remember that carboxylic acid groups (-COOH) dissociate into carboxyl (-COO-)
and hydrogen (H+) ions in solution, and that opposites attract.
2. Explain what enzymes are and why they are important.
3. Name several variables that affect enzyme activity, and explain how each variable
affects the rates of enzyme-catalyzed reactions.
4. Design a complex experiment when given a list of materials and a hypothesis to
test.
5. Summarize raw data in a properly-labeled graph, and interpret that graph using
background understanding and common sense.
6. Describe how temperature affects enzyme-catalyzed reaction rate, and explain why
this pattern exists.
7. Compare and contrast competitive and non-competitive inhibitors.
8. Predict the results of an experiment when given information about the reactions and
conditions involved.
9. Examine a set of experimental groups and determine what hypotheses are being
tested, and why specific control groups were included.
10. Draw a graph showing how reaction rates change with increasing enzyme
concentration, and interpret each part of that graph.
11. Draw a graph showing how reaction rates change with increasing substrate
concentration, and interpret each part of that graph.
12. Conduct a complex experimental procedure with precision, and gather and analyze
quantitative results from the experiment.
13. Draw a graph showing how reaction rates change with pH, and interpret each part of
that graph.
14. Use pipettes of the appropriate size with accuracy and efficiency.
15. Describe an experiment that tests whether a chemical is a competitive inhibitor, a
non-competitive inhibitor, or not an inhibitor.
16. Hypothesize the properties of an enzyme’s active site using information about
compounds that are (and are not) competitive inhibitors of that enzyme.
WEEK EIGHT. RESEARCH PROJECT— PROJECT
CONSULTATION & DATA ANALYSIS
Please start by reviewing the project guidelines and grading document posted to
Canvas. This document goes over how today’s lab fits into the overall project.
PART A— FINALIZING YOUR EXPERIMENTAL METHODS
No matter how carefully you plan your experimental methods in advance, these
plans almost inevitably change as you put them into action. This happens as you
discover new practical problems, notice new sources of variability, and find creative
solutions to these new challenges. Now that you are finishing your data collection,
this is the perfect time to update your planned experimental methods with all the
changes that you made over the last 4 weeks, so that the methods in your team’s
final presentation of the data will be up-to-date and accurate.
As a helpful first step, answer the following questions to brainstorm possible

updates (based on your own personal experiences with data collection at home),
so that you’re better prepared to share these ideas with your team during lab this
week:
à Re-read your team’s most up-to-date experimental plan, that you had
aimed to achieve. As you read, brainstorm a point-form list of all of the
updates and clarifications that should be added to your experimental plan, to
make it a more detailed and accurate description of what you actually did
during this experiment.
PART B— FINALIZING THE DATA THAT YOU PERSONALLY COLLECTED
One of your tasks during this week’s lab is to analyze your team’s raw data. In
preparation for this task, you’ll organize the data you collected so far in a table and
share this with your team.
Some notes:
• If you recorded your data into a shared group file or notebook, you can copy
all the data, and highlight the data that you personally collected if this is
easier.
• Do record and share anything interesting that you noticed! This will include
the variables you expected, but also might include other notes. These kinds
of casual observations often become inspiration for even better follow-up
experiments.
• If any of your samples had to be stopped at a certain point (e.g. plants died),
then you make observations about this and make a note of why/when you
stopped your experiment.
You can build your table in a Google sheet, or in Excel. No matter which you
choose, you should download the desktop application of Excel now. You will be
using this software with your team during the lab and it will save you time to get it
installed ahead of time.
To get the desktop application of Excel (full version, free for SFU students):
• https://www.sfu.ca/itservices/technical/software/office365.html
• If you already have a trial or unpaid version of Excel, it may not allow you to
export as xlsx/xls. You should get the full version, at the link above.
• Unfortunately, Excel on Google Chromebooks does not support error bars,
so if you have a Chromebook you’ll have to find a solution within your group.
Now that you each have a copy of Excel, back to your data table! Don’t forget to
give your table a proper heading (e.g. Table 1: A descriptive title here).
à Looking at just your own data from the table you prepared, which
dependent variable seems to vary the most between your sample groups?
à Do you think this result will become more or less conclusive once you
combine it with the rest of your team’s data? Why?
à Aside from the variables/data you had planned on collecting, was there
anything else you noticed about the samples in your experiment?
This can be anything that went differently than expected, or anything that you
happened to observe that might be worth talking about with your group, and/or
including in your presentation.
With your team:

- Share your personal data table with your team before lab
- (At least) one person needs to bring a laptop to lab this week. Decide before lab
who this will be.
PART C— DATA TYPES AND DATA GRAPHING/VISUALIZATION
For your experiment, you’ll be collecting data, which you’ll use to test your hypothesis.
There are two general types of data: qualitative (or categorical), and quantitative (or
numerical). Both are useful. To communicate some of your data, you’ll be making at
least one graph.
For any given dataset, there might be multiple ways to graph it. You (the researcher) will
need to choose how to graph your data, based on 2 reasons:
1) to best tell its story

2) represent the data in a clear and transparent way to the reader
Let’s start by reviewing some of the types of graphs you might see used in biology.
Within each graph description below, note the type of data that is displayed on each
axis.
Bar (or Column) Designed to make comparisons of data, often averages.
Graph
Useful when you have a categorical independent variable (each bar) and a
quantitative dependent variable (height/length of bar). The bars do not touch.
These are extremely common, and quite useful. They have one drawback which is
that they only show the average value— in other words, they hide all of the raw data
points that went into them.
Side note: Bar and column graphs are both often called bar graphs. Technically, “bar”
graphs have the bars going left to right; the picture here shows a column graph (up
and down). We won’t worry about this distinction.
Example: Comparison of the reaction rate for 4 different enzymes.
Histogram Histograms appear similar to bar graphs but are interpreted quite differently. The data
represented in a histogram are usually in groups of continuous numerical (quantitative)
data (i.e. 0-5 years, 6-10 years). In this case, the bars do touch— no space between
them. The y-axis of histograms are often used to show frequency data.
Example: The prevalence of asthma in different age groups.
Pie Graph Designed to show a percent of a whole, where the whole equals 100%. Pie charts are
used to compare data but cannot be used to see how a manipulated variable affects a
responding variable. Pie charts do not show change with respect to another variable.
Though these are commonly used in infographics, media, etc., for many types of data,
pie charts are not as appropriate/”good” as bar (or column) graphs. Feel free to chat
about why with your lab instructor or TA.
Example: Percent of time that a cell is in each phase of the cell cycle.
Line Graph A line graph consists of a series of plotted points connected together point to point by
a line. Line graphs depict the effects of a continuous variable and are only used when
both variables are quantitative. Line graphs show trends, particularly localized or small
trends, such as how things change over time.
Example: Enzymatic activity across a range of temperatures
Scatter Plot The points are plotted on the graph, but they are not joined point to point. A best fit line
may be added to a scatter plot to show a trend. Scatter plots are also only used when
both variables are quantitative. These graphs are useful for showing if a correlation
exists between two variables, especially when it is not possible to alter either of the
variables (i.e. in descriptive studies).
Example: Plant height at different altitudes
Lots more: We are just scratching the surface here. Appropriate data visualization is a really
Violin plots, interesting field, and incredibly important to advancing science, but unfortunately it’s
Box-and- largely outside the scope of our course! Also, lots of valuable data are shown
whisker plots, qualitatively (e.g. microscopy images, photographs of samples). If interested check it
heatmaps, etc. out.
à On a typical graph that has an x and y axis, which axis is (generally) used for
the dependent variable?
à Fill in the table, stating which graph type would be useful for each
circumstance:
Example What type of graph could be used?

(To help you do this, it may be useful to
sketch an example graph)
Comparing quadricep muscle length of 5-year-old

children who either consume a normal diet supplemented
with B vitamins, or a normal diet with no supplements
The relative amount of sleep that Canadian teenagers

sleep each night.
The minimum decibel level heard by young children,

teenagers, adults, and retirees
The time it takes for different animals to urinate compared

to their body mass
PART D: GRAPHING DATA, AND INTERPRETING GRAPHS
To communicate your quantitative data, you’ll be making at least one graph.

Review some of the types of graphs you might see used in biology above.
When collecting quantitative data, we generally take several measurements (replicates)

of the same quality. These measurements may give different numbers, due to normal
biological variation (e.g. not all trout fish have the same body length). They also give
different results due to observational error— the difference between a measured value
of a quantity and its true value. Though statistics is not a focus of this course, it is
important for you to know that in statistics, an error is not a "mistake". Variability is an
inherent part of the results of measurements and of the measurement process.
Regardless of the reasons why the underlying measurements may be different,
scientists strive to be open and transparent about these numbers, and so we need to
show this variation on our graphs. For this, we use error bars, displayed around the
average of the measurements, as shown in the figure below.
Error bars display the variability of the data on a graph— or, how similar all of the raw
datapoints are to each other. Error bars can be included on any graph that uses
quantitative measurements. Typically error bars are shown on scatterplots, histograms,
bar charts or line graphs. Error bars can be used to display a few different statistics, all
of which tell you something slightly different about the variability of the data. For the
purposes of this course, we are mostly working with averages (“means”) and our error
bars will display a measurement called the standard deviation of the mean.
Standard deviation (often abbreviated as "Std Dev" or "SD") provides an indication of

how far the individual measurements vary or "deviate" from the mean (a.k.a. the
average of the data). Standard deviation tells the researcher how spread out the datas
are— were the data points all near the mean, or scattered far & wide? If a researcher
was measuring leaf sizes: were the leaves all pretty much the same medium size, or
were there some small ones and some big ones?
à On the Bar Chart in the figure above, which of the datasets (left, middle or
right) has the highest mean value? In the Bar Chart, which of the three datasets
(left, middle, right) has a higher standard deviation?
à In your own words, what does it mean if error bars on different datapoints
are not overlapping?
Important note: visually using error bars to decide whether differences are
considered significant is a quick-but-imperfect approach. In higher-level courses,
you would perform numeric statistical analyses/calculations to give you a more
rigorous decision— but this is outside the scope of our course. Regardless,
knowing how to interpret and use error bars to interpret a graph is a central
scientific skill that scientists use regularly when they are deciding whether or not to
trust results and draw meaningful conclusions from them (whether their own and
others).
Now, use Excel to make a graph using the following data—
Independent variable— Chicken diet (chocolate or regular)

Dependent variable— Mass of the eggs they laid (in grams)
These data were collected at three different farms, each growing one chicken and
each experimenter wrote down the data collected, so the data are recorded a little
messy.
Your farm— Chocolate-diet chicken laid an egg that weighs 75.2 grams, and a
chicken on the regular diet laid an egg that weighed 48.0 grams.
Your neighbour’s farm— Regular diet– egg: 52.0 grams. Chocolate diet – egg:
87.1 grams.
A farm in another province— Egg #1 from chocolate-fed chicken was 92.5

grams, egg from regular-fed chicken was 46.8 grams.
First, put the data into excel in an organized way, and make a bar (or column)
graph that is appropriately formatted and includes error bars of standard deviation.
àBased on your graph, what can you conclude about the effect of the diet
on egg size?
PART E— PROJECT PEER CONSULTATION
During today’s lab, you’ll talk over your project plan and any updates so far, in a
research team meeting. As part of your prep, briefly review your team’s experimental
design (hypothesis, variables) and your project plan over the next few weeks.
à Consider your data: the independent and dependent variables. (You may have
a few of these; for now, just focus on one.) Consider how you might graph your
data. Sketch what the graph might look like if your hypothesis were supported by
the data. Include axes, and predicted data for your treatment and controls.
Note: be specific about these variables, knowing what measurements you’ll take
and when.
à Based on your plan so far, what are your own next steps?
à What, if anything, would you like for your team to get advice on, for your
project?
PART F— SHARING YOUR WORK WITH OTHER SCIENTISTS:
WRITING AN ABSTRACT & PRESENTING A POSTER
This week, you’ll begin working with your team on your analysis. In Week 14 you’ll
share your final abstract and poster with us. Make sure to check out the Project
Guidelines & Rubric posted on Canvas.
à Given what the purpose of an abstract is, what key information do you
think needs to be included in the abstract text?
à For your own project, what figure do you think would be most useful in
your abstract? If a graph, please describe the axes and graph type; if a
diagram or flowchart, describe what it shows. Why would you make this
choice?
à What are some elements of a good poster presentation?
IN-LAB ACTIVITIES
PART A— FINALIZING YOUR EXPERIMENTAL METHODS
As a team, go through your most up-to-date description of your experimental methods

from your Lab Preparation Exercises, and update your experimental methods together
as each teammate shares their own experiences and modifications. Along the way, you
might find that there were some differences in what each teammate did at home. Here
are some tips for how to deal with these differences:
1. Is the difference consistent for all students?

• Change your methods to accurately reflect the modification or the full
range of values/methods used (e.g. If one teammate added an extra 5 g of
salt, you might write “15-20 g of salt was added to 250 mL of water…”).
Note: Don’t worry, these things often happen when conducting research, and if you
report them honestly, other researchers who are reviewing / repeating / expanding upon
your study will know what to do / expect.
2. Did the change produce different results?

• If yes, why? What can you learn from this? How might you explore this
trend further, with a follow-up experiment?
• If not, why not?
Tip: If this discussion raises some interesting questions, try examining
them further as you compile, present, and analyse your data.
à Question A1: Make notes based on your team discussion.

What parts of your methods changed from your initial plan? What parts stayed the
same? How did any changes affect your research process?
e.g. level of detail of your research question, type(s) of data you collected, consistency
between how different people did the experiment or made measurements, number of
experimental trials or modifications, etc.
PART B— FINALIZING YOUR DATA
As part of your lab prep, you shared your individual data with your team. Now, you
will work together to compile your data into one shared table in a single Excel file
(.xls or .xlsx) on one student’s laptop.
Organize your data in a way that will help make your data processing and analysis
easier. Once all your data are collated, calculate averages and standard deviations.
• At first, just put all of your data into a spreadsheet, in whatever form you have.
• Then, organize your quantitative data by experimental condition (putting all
replicates in the same area on the spreadsheet), not by the person who collected
the data.
• Quantitative data should be included as raw data AND as processed data
(typically, processed data includes averages and standard deviations - but not
graphs yet).
• Your qualitative data should be organized within the same worksheet.
• This worksheet should be tidy/organized, and it should be comprehensive—
including all of the data that you collected, any other observations that you made,
and any other comments you might have. As you compile your data together, you
might discuss with your teammates how to best organize it, and anything that you
happen to notice or find interesting.
• Then: save your file as an .xls or .xlsx (before making any graphs). You will show
this file to your TA/ lab instructor for your checkout this week. Make sure to share
it with all team members!
Excel & Data Tips:

• Excel files may each consist of several different worksheets, which are tabs with
different names at the bottom of one file.
• Any datapoints you exclude need to have a good reason identified in the
observations/notes column. For example, “black mould overgrew in this sample,
so the measurement is not an indication of yeast growth” or “sample jar was
broken, so the volume was estimated before discarding the sample”. You can’t
just omit a datapoint because you don’t like it.
• If there are any datapoints that you are excluding from the data processing, you
can mark these numbers with a * or other symbol in the same cell. For example,
instead of writing “15” you would write “*15” in the cell. This will exclude the value
from any excel formula calculations, but doesn’t erase it from your raw data
entirely. If it causes you problems in your calculations, you can instead just
include it in the “other” column, reserving your quantitative columns for numbers
that will be used in formulas.
Help! Our experiment didn’t work as expected!
If this happened to you, welcome to research! There are lots of reasons why
experimental results don’t turn out as predicted, and it’s not generally because you
failed or messed up.
A few tips to consider, if you find yourself in this situation:

• Your data are the real world, and your hypothesis is your best guess— and it is
completely fine if your best guess was wrong. More important is— what are you
going to do/say about it, with whatever data you have? The data you have are
the data you have. It’s all about how you interpret and communicate your data, in
a way that is thoughtful, specific, and useful to others who are reading/hearing
your work.
• If you need to work out kinks in your methods, then focus on interpreting how you
would modify your methods. What specific changes would you make to your
methods, and why would those changes improve your chances of getting data
that can answer your research question? Scientists often call these self-critiques
& suggestions “limitations of the study” and “future directions” of the method,
respectively.
• If you got results that weren’t what you expected, including missing data you
thought you’d get, or didn’t realize you’d need—think critically to interpret or
brainstorm why a result happened. What can you say about the biology of what
was going on, even if it wasn’t the biology you expected to be talking about? You
might need to do some research to explain your results - and that is totally fine.
PART C & D: GRAPHING AND INTERPRETING YOUR DATA
Work with your team to make at least one preliminary graph that clearly presents your
most interesting finding(s).
à For your quantitative data, what type(s) of graph(s) is/are most suitable for
presenting this data? For each, explain why this graph type is appropriate?
Here are some suggested steps for how to proceed in graphing and interpreting your
data:
1. For each experimental group, calculate means and standard deviations for each
of your dependent variables.
2. Compare your means and standard deviations between experimental groups,
and make a list of the most interesting comparisons. For example:
• Do you see the differences between experimental groups that you
predicted, based on your hypotheses?
• Did you see any unexpected differences?
• Do you see a lack of difference, even though you expected to see a
difference?
Note: All of the above situations are interesting and useful results, so don’t feel like you
“messed up” just because you didn’t see the result you originally predicted. We can
learn as much, if not more, when unexpected things happen, than when things happen
as planned).
3. Interpret the graph(s) as a team, and decide which one(s) are most interesting.
à Which graph(s) do you find most interesting? Why?
à Look over any qualitative data you collected. Talk these over with your team,
and summarize your findings from these data here (in words). What conclusions
can you draw from these data? How will you tell the “story” of these data? How
can you use them to further describe your quantitative data?
à Look at your “other” observations, including any parts of the experiment that
you had to discontinue. Talk them over with your team. Do they provide any
suggestions for improving your methods next time, or do you have any ideas for
future experiments?
à Looking at your data, are there any surprises? If so, what biology might you
need to research, to understand the context or reason why these results
occurred?
PART E— PROJECT PEER CONSULTATION
Today you’ll be checking in on your project, in whatever stage it is at. Some teams may
have started getting materials together, or collecting data, or running pilot experiments;
others may be in the planning phases, or have come across issues that they need to
troubleshoot. All of these are fine. You’ll be meeting with another team to briefly explain
your project, get advice, and hear their questions/ideas.
a. Share your pre-lab graphs with your team

Get out your lab prep exercises, and share with each other your graphs (showing
imaginary results, if your hypothesis were supported by the data).
à Why are the graphs you chose appropriate for the data type you are
collecting? (Note that working through this question might make you
reevaluate/refocus your dependent variable, which is fine.)
à Check-in and talk things over: where is your team at, with your project? Have
you learned anything new since Lab Two? What are your next steps? Do you
need to revise your plan at all? Write down a few useful notes here.
à What is something you’re unsure about, or something you could you use
advice on, for your project so far?
à Get ready to briefly summarize your experiment, to informally share with

another team (~2-3 minutes to summarize, ~5 minutes for questions and
discussion). Be ready to be brief, and to focus on your overall plan, your specific
variables, where you’d like some advice/ideas.
Choose one main “presenter”____________________
Choose one person to take notes on the feedback you receive ___________________.
b. Consult with another team (5 minutes per team).
You’ll take turns with another team to informally present your experimental overview.
Listening team: Your goal is to be constructive, and help the team work through their
experimental plan. Ask questions for understanding/clarity (not for criticizing). Don’t be
afraid to ask questions that are specific and questions that are big-picture. Focus your
ideas on the places where they are asking for advice, or where things aren’t clear.
à Space for the note-taker, for project notes on the feedback you receive:
c. After consulting: Check back in with your team

à Note-taker: report to your team a summary of the notes you wrote & ideas you
heard.
à Based on the consultation, write you team’s next steps. For example, are there
any changes you need to make to your experimental plan, or how you define
your variables? Is there any outside research you need to look into, to help
improve your project?
PART F— SHARING YOUR WORK WITH OTHER SCIENTISTS:
WRITING AN ABSTRACT & PRESENTING A POSTER
Planning ahead—
With whatever time remains for this week’s lab, work with your team to:
1. decide what information and figures you want to present in your abstract & poster
2. divide up the work evenly among your teammates; and
3. set up a schedule for when each item needs to be completed, so that you still
have time to combine your efforts and polish the final products.
Some general tips for what your next few weeks will include on the project: Read
these together, then get started on your plan.
• Work as a team to write a rough outline of your abstract and poster, to decide
what topics you want to cover, and what figures you want to include. You can
organize these ideas in point form or, alternatively, as a rough map/storyboard.
• Focus on the figures that you’ll use to present your methods and results first,
then decide on the text that will help your audience understand the figures.
• Edit this outline to find the right balance between keeping things concise and
giving enough detail for your audience to picture what happened in your study.
• List all of the tasks that need to be done (both individually and as a team), in
order to complete your abstract.
• Divide the tasks between your teammates, keeping in mind each teammates’
strengths, schedules, and preferences as much as possible (but realizing that not
everyone will get the tasks and schedule that they most prefer).
• Set careful deadlines for when each task must be complete, and make a
commitment to each other to meet those deadlines. Set up “update meetings” at
the half-way point between deadlines, to check in and support each other’s
progress.
• Start on this work today, and remember to talk to your lab instructor and TA
whenever you’re unsure of what to do. This is a new and challenging experience
for all of you, and the more you talk things over, the more you’ll learn and grow
as a scientist!
• Build into your plan a draft version of your abstract and poster, with time
to make edits to your story afterwards. You’ll find all sorts of things you’ll
want to change, so give yourself time to make those changes.
WEEK NINE. PLANT BIOLOGY: PLANT OVERVIEW, ROOTS,
STEMS AND LEAVES
Introduction
A significant part of this introductory biology course is dedicated to plants. Plants are an
abundant and important group of organisms and we only have TWO labs to talk about
them! They have successfully adapted to exist in diverse forms around the globe. They
are important contributors to the oxygen in our atmosphere, which is essential to aerobic
organisms. As the primary producers in most terrestrial ecosystems, plants also form the
base of terrestrial food webs. Without plants, many non-photosynthetic organisms
ranging from fungi to animals could not exist.
Plants are also essential from a nutritional and health perspective to humans and are
also important for medicinal and pharmaceutical purposes. Examples of the industrial,
agricultural and economic roles of plants are just too numerous to list here.
This lab will focus on the structure and function of the different tissues and organs of
flowering plants, and the structural features these organs have for performing those
functions. With this week’s lab, you will learn to identify some of the basic organs,
tissues, and cell types in plants. You will also learn some distinctive differences that will
be useful in distinguishing between the two major taxa of flowering plants— monocots
and eudicots.
Before beginning the Lab Preparation Exercises, review your lectures and/or textbook to
make sure you are familiar with the major organs, tissues, and cells found in plants, and
their functions. You should also read about the structural differences between monocot
and eudicot plants and the arrangement of tissues in their roots, stems, and leaves.
PART A— MONOCOT OR EUDICOT?

Introduction
Two taxonomic groups within the flowering plants are monocots and eudicots. For
your lab exam, you may be asked to identify whether a plant sample comes from a
monocot or a eudicot. Furthermore, you will get a better understanding of how different
kinds of plants meet the same challenges using somewhat different evolutionary
solutions.
Distinguishing monocots and eudicots
For your lab prep, you’re going to go out during the day (when the light is best) to see
some plants and their features.
à Before you head out, download the incredible app, called Seek (by iNaturalist)
on your phone. A link to the Seek app is provided on Canvas alongside this
week’s lab prep quiz. You can also find it on the app store.
à Now go outside for a walk until you see some plants (in a yard, or roadside, or
park, or anywhere) or take photos of plants in your house. Choose two or three
plants and use the app to identify them. Weeds such as dandelions, or trees, or
grasses, or anything you see is great. Take a moment to appreciate these plants
that we often ignore!
Depending on the plant, the app may only know whether it’s a monocot or eudicot/dicot,
and that is fine. Identifying plants is really challenging, and even though this app is
incredible— designed by many, many wildlife biologists and botanists— it’s not perfect.
à What plants did you find? Google these plants (or these plant categories), and
write something about each that you find interesting.
Note: if for some reason you are unable to use the Seek app, you can take pictures of
plants you see and do your best to identify them yourself.
à What features on the plant do you think the app used to identify them?
PART B: ORGANIZATION OF PRIMARY TISSUES IN ROOTS, STEMS AND LEAVES
Introduction
There are some simple patterns in the arrangement of vascular plant tissues that are
useful in determining whether you are looking at a cross-section of a root or a stem. In
addition, these patterns make it possible to tell whether the section is from a monocot or
a eudicot.
In lab this week, you will learn to section, stain, and interpret your own cross-sections of
plant specimens. This Lab Prepartion Exercise B will prepare you for that hands-on
activity.
Distinguishing stems and roots of monocots and eudicots
In lab this week you will learn how to prepare your own section of a plant for microscopic
observation. You will use this section to prepare a scientific figure. The figure will need
to be appropriately labeled, using your knowledge of plant organs, tissues, and cell
types.
à To prepare for this, you will need to view the “Plant Sectioning and Staining
Video”, posted to Canvas alongside this week’s lab prep quiz, before attending
lab. You should also review the use of the microscope (see Lab One).
Figures B1-B4 below describe and demonstrate the structural differences between
monocot and eudicot leaves and stems. Use this information to answer this week’s lab
preparation exercise questions.
Roots
Vascular cylinder
Figure B1: A labeled example of a monocot root cross-section.
Figure B2: A labeled example of a eudicot root cross-section.
Figure B3: A labeled example of a monocot stem cross-section.
Figure B4: A labeled example of a eudicot stem cross-section.
à Using the information provided in Figures B1-B4, answer a-c for photos B1-B4
below.
a) Shade the xylem tissue one colour, and the phloem tissue a different colour, on
the photograph, using different-coloured pens.
Tip: Use the same colour scheme for all 4 photos, for easier comparisons between the
photos
b) Is the photograph of a plant root or a plant stem? Justify your answer.

c) Is the specimen from a monocot or a eudicot? Justify your answer.
Photo B1. Colour the photograph as described.
à Root or stem? Explain.
à Monocot or eudicot? Explain.
Photo B4. The photo on the right is a close-up of the photo on the left. Colour the
photographs as described.
IN-LAB ACTIVITIES
PART A: ORGANIZATION OF PRIMARY TISSUES IN ROOTS AND STEMS

Introduction
Working in your teams, you will prepare, stain, and identify plant sections. Each team
should complete a full set of 4 plant sections. You will then work together to figure out
which section is which: monocot stem, monocot root, eudicot stem, and eudicot root.
Slide Preparation
1. Obtain a sample from the bench. Make a note of which section (A, B, C, D) you
are working with.
2. Using a razor blade, cut 2-3 thin sections of your sample.
Tip: For best results, hold the razor vertical and perpendicular to your sample. Make
sure the blade slices cleanly and doesn’t squash your sample.
3. In a petri dish, place a drop of water and add 2 drops of toluidine blue to it.
Transfer your sections to the stain, and leave it for ~40 seconds.
4. Use the plastic squeeze-bottle of water to gently dilute the stain and wash excess
stain from the sections, until the pool of water is clear enough for you to see your
sections.
5. Place a drop of water on a clean glass slide.
6. Using the paint brush, transfer the stained sections to the water on the slide. You
can blot excess water with tissue or add more water to remove excess stain if
necessary.
7. Add a cover slip and observe your wet mount of the stained section under the
microscope.
Note: if your sample is getting tipped over or squished by the cover slip, you can
leave the cover slip off. If you do, make sure you keep your section moist, and don’t
let the objective lenses touch any part of your sample (or they can be dirtied or
damaged.
8. CLEAN UP:
• To clean-up the diluted stain, soak up the fluids with paper towels and place the
damp paper into the larger plastic buckets provided in the lab.
• Dispose of the slides in the white containers on the benches.
• Make sure your workstation is tidy.
Plant Identification
Working as a team, identify the 4 samples as stem vs. root, and monocot vs. eudicot.
There are several resources available to help you with this: your lab prep, posters in the
lab, and textbooks in the lab. Keep in mind the tissue colours depend on the stain, and
so will likely be different in different pictures. Check your IDs with a TA or lab instructor
before you complete your Observation Worksheet.
Observation Worksheet
Once a TA or lab instructor has confirmed your identifications, each student will select
one section to draw. Before you start, view the Example Worksheet in your lab manual
below. Your worksheet should include the following:
• A drawing of your section. You may draw the full section, or a radial portion (i.e., pie-
shaped wedge) of the section.
• Drawing labels (e.g., xylem, phloem etc.). If you use abbreviations, you need to
include a legend.
• A figure number and caption.
• The drawing magnification (see below for details), including your calculations.
• Identification of your section as stem or root, and monocot or eudicot.
• A summary that explains how you identified your section.
To calculate your drawing magnification, follow the calculations in the Example

Worksheet in your lab manual below. You will need to know the actual diameter of the
field of view, shown below in Table B.
Table B: Diameter of the field of view when using each objective lens:
Eyepiece (10 x) & Objective Diameter of field of view
Lens Magnification
(and colour)
40x (red) ~5 mm
100x (yellow) ~2 mm
400x (blue) ~0.5 mm
EXAMPLE WORKSHEET
Note: We purposefully chose a different specimen and a different stain for this example,
so that you CAN use this example to understand the formatting and what to include in
your work, but CANNOT use of the content to interpret your own samples. Please refer
to your lab manual and your own stained sections when identifying your sample and
writing a summary.
Tip: when calculating drawing magnification, pick a specific structure (one that is easy to
recognize and to estimate the actual size of) to base your measurements and
calculations upon.
Drawing: Sample Letter: __Z__
Figure 1. A stained cross-section of mystery plant sample Z.

The drawing magnification = 32x.
Calculations for Drawing Magnification:
• Drawing Size— From measuring the size of your drawing of the plant structure=
1.6 cm. Convert 1.6 cm to mm (to match the units for the actual size) = 16 mm
• Actual Size— around ¼ of the diameter of the field of view when using the 100x
magnification (which has an actual diameter of 2 mm, according to Table B)
= ¼ x 2 mm = 0.5 mm
•
Drawing Magnification— Drawing Size ÷ Actual Size
= 16 mm ÷ 0.5 mm
= 32
Summary
I believe that mystery plant sample Z is a leaf because, as shown in Figure 1, the
palisade mesophyll cells have…[include your own reasons here]
I also noted, when observing the mystery plant specimen before wax embedding, that…
[make use of your own additional observations here, if appropriate]
Observation Worksheet
PART B: THE STRUCTURES AND FUNCTIONS OF MONOCOT AND EUDICOT
LEAVES
Introduction
For this section, your team will work together to compare the structures of monocot and
eudicot leaves and examine the structure and adaptations of specific plant types.
ACTIVITY B1: THE STRUCTURES AND FUNCTIONS OF MONOCOT AND EUDICOT

LEAVES
Observations:
View the stained cross-sections of a monocot and eudicot leaf. Both sections are on a
single slide. You will need to move the slide up and down to see each section. Use the
photos in the lab to help you identify which section is which.
à Draw a rough sketch of a cross-section of a monocot leaf. Identify and label the
following: epidermis, stomata, spongy mesophyll, xylem, phloem, and
sclerenchyma.
à Draw a rough sketch of a cross-section of a eudicot leaf. Identify and label the
following: epidermis, stomata, palisade mesophyll, spongy mesophyll, xylem,
phloem, and sclerenchyma.
à Compare the location of stomata (top, bottom, or both surfaces) in the monocot
and eudicot leaf. Where are they found in monocots? In eudicots?
à Compare the type and arrangement of mesophyll in the monocot and eudicot.
Discussion Questions
à Explain how the structural features of eudicot leaves are optimal for
photosynthesis while minimizing water loss. Consider the orientation of the
leaves, the presence and arrangement of veins, the density and location of
stomata, the types of mesophyll and how they are arranged, etc.
Having answering the previous question, you might be tempted to think that eudicots
have evolved perfect leaf structure and orientation. However, monocots are very
successful plants despite having features that are different from those of eudicots. Can it
be that there is more than one combination of structural features that allows leaves to
function efficiently? To consider this possibility, answer the following question:
à List at least four structural differences between monocot and eudicot leaves,
and explain why each monocot feature still makes functional sense, when all of
these differences are considered together.
ACTIVITY B2: THE LEAF ADAPTATIONS OF HYDROPHYTES AND XEROPHYTES
Hydrophytes
Water lilies are an example of a hydrophyte, a plant adapted for aquatic environments.
Water lilies are a eudicot whose leaves float on the surface of freshwater ponds and
lakes. Examine the cross-section of a water lily with your team, and compare it to a
typical eudicot (Activity B1) by answering the questions below.
à Where are the stomata located, and how does this compare with a typical
eudicot leaf? Explain why the location of stomata is different in water lilies.
à What structural adaptation can you observe that helps the leaves float on the
surface of water?
à Water lilies have less xylem tissue than some other eudicot leaves. Explain
why. Hint: think about the 2 main functions of xylem.
Xerophytes
Xerophytes are plants adapted to dry environments and include agave (also called
century plant), sand-dune grass, and cacti. Xerophytes have diverse adaptations that
help them obtain, store, and conserve water. Examine the cross-sections of these three
plants with your team, and compare them to a typical eudicot (Activity A1) by
answering the questions below. You may need to ask a TA or lab instructor for help
interpreting these slides.
Examine the agave leaf.
à Compare the waxy cuticle and the stomata of the agave with the typical eudicot
leaf. How are agave leaves adapted to reduce water loss?
Examine the cactus stem.

à Cacti have many thin-walled parenchyma cells. What is the function of these
cells?
à How is the cactus stem adapted to minimize water loss?
Examine the sand-dune grass leaf.

à Where is the waxy cuticle thickest? Where are the stomata located? Explain,
with reference to conserving water. Tip: it might help to include a sketch in your
explanation.
à These leaves unroll when moisture is available, and roll up when the
environment is dry. Explain how they do this, and why this is advantageous to the
plant.
2. Describe the structure and function of plant tissues (xylem, phloem etc.).
3. Explain how structure is related to function for different plant tissues (xylem,
phloem etc.).
4. Identify a plant as a monocot or eudicot, using the morphology of general

structures.
5. Section and stain a root or stem sample for observation with a compound
microscope.
6. Identify a slide (or photo) of a plant section as a stem or root, and monocot or
eudicot.
7. Recognize specific plant tissues (xylem, phloem, sclerenchyma, epidermis,

endodermis (root only)) in a cross section of a root or stem.
8. Calculate drawing magnification.
9. Create a scientific figure, including a caption and legend.
10. Given a plant leaf specimen at any scale or orientation (surface or cross section),
determine whether the leaf comes from a monocot or a eudicot, and justify our
answer.
11. Describe differences in the structure and orientation of monocot and eudicot
leaves
12. Given a structural difference between monocot and eudicot leaves, explain how
each structural feature is adaptive in relation to each plant’s other structural
features.
13. Given a leaf specimen or cactus stem, determine whether it comes from a
hydrophyte or a xerophyte, and justify your answer.
14. Identify and describe specific adaptations in the leaves or cactus stem of
hydrophytes and xerophytes that help them live in their respective environments.
WEEK TEN. PHOTOSYNTHETIC PIGMENTS

Besides your Pre-Lab quiz on Canvas, there are no written lab preparation exercises for
this week’s lab, because each part of this week’s lab will act as lab preparation for the
following part.
Before attending lab this week, review your lectures and/or textbook to make sure you
are familiar with all of the reactions, enzymes, and molecules of photosynthesis.
In addition, read through all of this week’s In-lab Activities to make sure you are ready
to complete each activity efficiently and accurately during lab, since this week’s lab is a
fairly challenging one that requires much care, organization, and mindfulness. Your
flowchart will help with this!
Two websites that you should visit to refresh your understanding of the material—
1) Leaf anatomy and light-dependent reactions of photosynthesis—

https://biomanbio.com/HTML5GamesandLabs/PhotoRespgames/photointeractive
html5page.html
2) Short video about light absorption in photosynthesis. Focus on being able to

interpret what an absorption spectrum tells you about a sample (such as a
photosynthetic pigment)— https://www.youtube.com/watch?v=dwz3qozDiyI
IN-LAB ACTIVITIES
PART A— EXTRACTING AND STUDYING PHOTOSYNTHETIC PIGMENTS
Introduction
In this week’s lab, you will study photosynthesis— the process by which the energy of
sunlight is harnessed and transformed into storable chemical energy (e.g. glucose
sugars). Photosynthesis is performed by primary producers such as photosynthetic
bacteria, algae, and plants. For consumers (like us) who cannot perform
photosynthesis, all of the food energy we consume comes ultimately from these primary
producers. For example, even the beef we eat comes from cattle that eat grass and
other green plants. This is why it is so important that you understand how
photosynthesis works, and how different factors affect net photosynthetic rates.
To begin our exploration of Photosynthesis, Part A of this lab focuses on the pigments
that leaf cells use to capture light energy from the sun. Photosynthetic Pigments are
compounds that absorb light, with several different kinds of pigments that are important
for photosynthesis.
In today’s lab you will complete Activity A1 to extract these pigments from live plant
leaves, then complete Activities A2 and A3 to examine the extracted pigments more
closely while learning some essential lab skills.
ACTIVITY A1: EXTRACTING PHOTOSYNTHETIC PIGMENTS
Introduction
For this activity, your team will use plant leaves to make a concentrated, ethanol-based
extract containing several different kinds of photosynthetic pigments. You will then
analyze these pigments during Activities A2 and A3.
Extraction Procedure
1. Select 2-3 large whole leaves. Place them in a petri dish. Using a razor blade,
carefully cut the leaves into small pieces (about 0.5 cm wide). Place the cut leaf
pieces into a mortar.
2. Add 2 mL of ethanol. Use the pestle to grind the leaf up, extracting the pigments
from the leaf.
3. Pour off your extract into a single-layer cheesecloth filter on top of a clean flask
and wring the filter into the clean flask.
4. CLEAN UP:
• Rinse off petri dish, flask, and mortar/pestle and return to the side bench.
• Razor goes into the yellow sharps waste
• Cheesecloth goes into garbage.
ACTIVITY A2: IDENTIFYING PHOTOSYNTHETIC PIGMENTS
Introduction
The extract you made during Activity A1 contains a mixture of all the pigments found in
the leaf. In Activity A2, you will separate these pigments using paper chromatography
so that you can observe them individually and learn more about each one. Perform the
procedures, and answer the questions that follow, as a team.
Procedure for Separating the Pigments using Paper Chromatography

1. Obtain a strip of filter paper (1.5cm x 12cm) from the workbench. Taper one end of
it to a point using a pair of scissors (see Figure 1 following procedure).
Warning: Be careful not to make the strip shorter during these cuts. You need the paper
strip to remain ~12 cm in length after cutting.
2. Using a ruler and a pencil, draw a small dot 1.0 cm from the tip of the tapered end
of the paper strip. Then, measure 6 cm further up the strip from the dot, and draw a
line across the paper strip (see Figure 1 following procedure).
3. Punch a hole at the top of the paper strip using a hole punch.
4. Apply the extracted pigments to the dot at a very high concentration by repeating
the following steps at least 8-10 times (try to get your origin dot as dark as
possible).
a. Obtain a micro-capillary tube and holder, then read the instructions posted at
the workbench to learn how to use these tubes and holders properly.
b. Using the capillary tube, carefully apply one drop of your pigment extract
directly on the dot that you marked near the tapered end of your paper. Small,
concentrated dots will work best.
c. Let your pigmented spot dry completely before repeating these steps.
You can read ahead and start planning other exercises as a team, during these
repeated steps.
Looking ahead: As the chromatography solvent moves up the paper strip (from the
tapered tip all the way up to the line that you drew in step 2), the different kinds of
pigments will be separated as they are carried up the paper at different rates.
5. When the pigment spot has dried completely, obtain a chromatography tube from
the side-bench and place it in a test tube rack. Make sure it is dry.
6. Using an appropriate dispenser (pipette or graduated cylinder), pour 4 mL of
chromatography solvent into the chromatography tube. This solvent is more less
polar (more non-polar) than the paper.
7. Read the following steps carefully, and then perform them as quickly and carefully
as possible as a team to minimize how long the tube remains open.
a. Take the stopper off of the tube.
b. Push the glass hook away from the stopper a little, so that you can hang your
filter paper on this hook by its punched hole.
c. Pull the hook back up, so that the filter paper is pulled as close to the rubber
stopper as possible.
d. Put the stopper back on the tube tightly, making sure that the paper strip does
not touch the solvent yet (see Figure 2 following procedure)
e. Stand the chromatography tube in the test tube rack and make sure that no
part of the paper strip is touching the inside of the test tube.
8. Gently push the glass hook down so that the tip of the paper strip dips into the
solvent by 2-3 mm.
Caution: Hold the test tube firmly and press the glass hook down slowly. Do NOT push
while the test tube is in the rack, or the tube may shatter.
Warning: Do NOT let the pigment spot become immersed in the solvent, and make sure
that the paper strip doesn’t touch the inside of the test tube.
9. Watch carefully as the solvent rises up the filter paper, wetting it gradually as the
solvent is drawn up (Note: the border between the wet and unwet paper is called
the solvent front). As soon as the solvent front reaches the 6 cm line on the paper
strip, remove the paper strip (and then close the tube quickly)!
Warning: Do NOT shake or move the tube while it is “developing”.
Warning: Do NOT let the solvent rise all the way to the top of the paper.
Note: If the solvent front overshoots the 6 cm line a bit, that’s ok, use a pencil to quickly
draw a line to mark where the solvent actually reached.
10. Let the paper strip air-dry for 30 seconds, take a picture of your strip. Observe your
pigments under UV light. Follow the instructions posted on the UV chamber and
record your observations in Table 1. Take a photo and then quickly circle all
pigment spots on the paper, and record their colours on Table 1, before they fade.
Note: One often-missed pigment spot will be right on the solvent front.
Note: If you do not see 4 spots, it is usually because your extract was not concentrated
enough, and/or not enough extract was deposited on the filter paper strip.
11. CLEAN UP:
• Place your used chromatography tube into the appropriate rack. Do not pour out
the solvent or clean the tube.
• Dispose of the used capillary tube in the appropriate container.
• Make sure your workstation is clean.
• You will need the vial with your pigment extract for A3, with the spectrophotometer.
If you have already done A3 and are finished with your vial, pour any extra extract
in the sink and leave your vial in the container of ethanol provided.
Hole 1.5cm Rubber

stopper with
glass hook
Mark 6cm
stop line
with
a pencil 12 cm
long
paper Chromato-
6 cm graphy tube
Draw a small run strip
dot with a
pencil, to mark
where you will
apply the plant
extract (i.e. the
origin)
Solvent
1cm
Figure 1: Setting up the paper strip Figure 2: proper positioning in the

tube
Examination and Identification of Pigments

What is an Rf value?
An Rf value is a number that reflects how far the pigment moved from its origin (the
penciled dot), relative to how far the solvent front moved. This is why Rf is stands for
“relative to front”.
Therefore, an Rf value of 1.0 means the center of the pigment spot moved all of the way
to the top of the paper with the solvent, and an Rf value of 0 means that the pigment
spot did not move away from the origin.
How do you calculate an Rf value?
Measure the distance (in cm) that the pigment spot travelled. Measure from the origin to
the center of the final location of the pigment spot, and divide this by the distance (in cm)
from the origin to where your solvent front stopped at the line.
Rf = distance travelled by pigment ÷ distance travelled by solvent
à Calculate an Rf value for each pigment spot and record the values on Table 1.
Table 1: Your team’s observations and Rf values.
Spot # Colour Rf Value Colour Identification
(numbered under UV
from origin to
solvent front)
Paper is somewhat polar because it is made largely of cellulose molecules, which are, in
turn, made out of glucose sugars. Our chromatography solvent is LESS polar than the
paper.
à Imagine that pigment X has an Rf value of 0.35, and pigment Y has an Rf value
of 0.75. Which of these two pigments is more polar? Clearly justify your answer.
In the UV chamber, the pigments are kept in the dark, and the only light that they are
exposed to is UV light (which is not visible to the human eye). However, not only can
you still see the pigment spots light up, they appear to be a different colour than they are
under normal lighting!
à CHALLENGE: Discuss with your team what might be happening here. Hint: it
involves fluorescence and electron energy shells.
à Once your team has completed Table 1, compare it to the observations

summarized in Table 2 (posted in the lab) to identify your 4 pigments. Record the
identity of each pigment on your Table 1.
à Why do you think a plant leaf has 4 different kinds of pigment, instead of just
one?
ACTIVITY A3: MEASURING THE ABSORPTION SPECTRUM OF YOUR PIGMENT

EXTRACT
Introduction
The extract you made during Activity A1 contains a mixture of all the pigments found in
the leaves. In activity A3, your team will measure the absorbance of this extract and
plot your data to draw the absorption spectrum for this mixture of extracted leaf
pigments.
Since 400-700 nanometers represents the wavelengths of light (or the colours) that we
can see with our eyes, an absorption spectrum is really a graph of the amount of each
colour that is absorbed by this extract.
Perform the procedures carefully, and answer the questions that follow, as a team.
Preparation
1. Pipette 2 drops of your concentrated leaf extract (from Activity A1) into a cuvette
and add 2 mL of ethanol to make a more diluted solution of the extracted leaf
pigments. Mix your diluted solution by inversion.
2. Locate the stoppered cuvette with pure ethanol in it. Holding the tubes near the top
only, wipe the bottom halves of both colourimeter tubes with tissue to remove
fingerprints.
Reminder from Lab 1: This tube of pure ethanol is the blank that you will use to
calibrate the spectrophotometer BEFORE you measure the absorbance of your solution.
This way, any light absorbed by the glass tube or the ethanol are omitted, and only what
is absorbed by the pigments in the solution is measured.
3. Using the directions from Lab One, use these data to record the spectrum of your
sample.
Collecting and graphing your data
1. Using the data on the screen), write down the absorbance at the wavelengths below
or take a photo of your results or save them and airdrop them to yourself.
2. CLEAN UP:
• Leave the spectrophotometer turned on.
• Pour your dilute solution in the sink, and pour out your extract. Rinse out the
cuvette and let it dry.
Table 3: Absorbance readings for a pigment extract at wavelengths 400-700 nm.
Wavelength (nm) Absorbance reading
400 _
420 _
440 _
460 _
480 _
500 _
520 _
540 _
560 _
580 _
600 _
620 _
640 _
660 _
680 _
700 _
Figure 3: Your absorption spectrum. This graph plots absorbance against wavelength of
your leave pigment extract, and connects the points with smooth curves. Don’t forget to
label your axes clearly. Note: Absorbance has no units.
à The pigment solution you analyzed appears green when you look at it. Does
this mean that the green wavelengths of light are being absorbed or transmitted
(i.e. passed through without being absorbed)?
à If you wanted a plant to grow as slowly as possible, what colour(s) of light

would you shine on it? Explain your answer(s) using your absorption spectrum
and your sense of logic.
à If you wanted a plant to grow as efficiently as possible, what colour(s) of light

would you shine on it? Explain your answer(s) using your absorption spectrum
and your sense of logic.
à CHALLENGE: The graph below shows the action spectrum of photosynthesis,

which shows the relative effectiveness of different wavelengths of light to drive
photosynthetic activity (often measured by the rate of oxygen gas production as a
by-product). Does this graph match your absorption spectrum? Brainstorm some
possible reasons for your answer
2. Extract pigments from a plant sample using heat and ethanol.

3. Separate a mixture of pigments using paper chromatography, and explain the
importance of each step of the procedure.
4. Explain what an Rf value is, calculate Rf values when given a completed paper
chromatograph, and use these values (and other observations) to identify unknown
pigments.
5. Use a spectrophotometer to measure the absorbance of a solution at specific
wavelengths, with proper use of a solvent blank.
6. Adjust the concentration of a solution for use in a spectrophotometer.
7. Draw an absorption spectrum, and discuss its shape in relation to the colours of light
that would best support plant growth.
WEEK ELEVEN. ANIMAL BIOLOGY— DIGESTIVE AND
EXCRETORY SYSTEMS
review your lecture notes or textbook to make sure that you are familiar with the organs
of the digestive and excretory systems and their functions, how nephrons process blood
filtrate and conserve water, as well as the digestive enzymes found in the mammalian
digestive system.
PART A— RAT DISSECTIONS

Introduction
In this Lab Preparation Exercise, you will familiarize yourself with the parts of the
mammalian digestive and excretory systems. In lab, you will then identify these parts on
pre-dissected rats.
Digestive System
Following is a list of organs involved in the digestive system: small intestine, anus,
pancreas, mouth, large intestine, liver, salivary glands, esophagus, rectum, stomach,
cecum and gallbladder.
à On the list of organs above, underline all the organs that food passes through.
List these below in order, starting with the mouth. Briefly summarize the function
of each organ.
à On the list of organs above, circle all the accessory organs. These organs
secrete enzymes or other molecules that help with digestion. List the accessory
organs below, and briefly summarize what molecules each organ releases or
secretes.
Excretory System
à Using Figure C1 on page 128 as your guide, name the three main tubes that are
connected to each kidney in Table A1 below.
à For each of these three tubes, describe in Table A1:
i) What the tube contains,
ii) Which organ these contents came from, and
iii) Which organ those contents are going to next
Table A-1.
Tube # Name Contents Where from Where next?
PART B— MAMMALIAN DIGESTIVE SYSTEMS
Introduction
For this week’s lab, you will examine some of the structures and functions of the
mammalian digestive system. In this Lab Preparation Exercise, you will review the
organs and enzymes involved with digesting each biological molecule as it passes
through your digestive tract. Then, in lab, you will use experiments to determine the
function of bile salts in digesting fat.
Chemical and Enzymatic Digestion of Food in the Human System

Most of the foods that we eat consist of large, complex macromolecules (carbohydrates,
proteins, nucleic acids, and fats). Depending on the food, the macromolecules may be
still contained within cells & tissues (e.g. food directly from organisms such as fruits,
vegetables, meats, eggs, grains), and/or they may be more extracted/prepared (e.g.
juice, milk, cake, coffee, etc.). Either way, the macromolecules in these foods must be
chemically digested by our digestive system, into simpler monomers that are small
enough to be absorbed through the cell membranes of the cells that line the digestive
tract. From there, these dietary sources of energy, building blocks, and essential
nutrients can move into our circulatory systems to be transported to all of the other cells
in our body.
à CHALLENGE: Give at least two reasons why more than one enzyme is
necessary for digesting most types of biological molecule.
à Organize your understanding of the enzymatic digestion of food
macromolecules, by filling out the following table.
Enzyme Produced by Where does What is its

name which organ? this enzyme substrate
get released? and
product?
Digestion of Salivary
carbohydrates glands
Pancreas
Digestion of Stomach
proteins
Small intestine
Digestion of Salivary
fats glands
Stomach
Small intestine
Digestion of Several Pancreas

nucleic acids nucleases
Read through the experiments in Part B for your in-lab activities this week and answer
the following questions:
For Bile Salt Experiment 1:
à If the reaction occurs (and proceeds to completion), what colour do you expect
the tube to be? If the reaction does not occur, what colour do you expect the tube
to be? Explain your answers.
à Identify and explain which tube(s) are the controls in this experiment. What are
they controlling/checking for?
à Why do we add NaOH to each tube before the reaction starts? Hint: it is NOT for
any direct chemical reaction with triglycerides.
PART C— MAMMALIAN EXCRETORY SYSTEMS
Introduction
We have so far only talked about macromolecules that are part of our food— but, don’t
forget about other nutrients such as vitamins, minerals, electrolytes, and of course
water. To maintain a balance (or homeostasis) of all of the solutes in your digestive
tract, you have an excretory system. Here we will summarize and review some of the
key aspects of the excretory system that you have seen in lecture.
The mammalian excretory system has two functions for maintaining homeostasis.
These functions are excretion and osmoregulation.
Excretion is the process by which the body removes nitrogenous waste products,
deactivated drugs, toxins, and excess solutes from the body.
Osmoregulation is the process by which the body balances the intake and loss of water
and solutes.
Figure C1. Components of the mammalian excretory system
Osmoregulation takes place in the kidneys, where water and nutrient reabsorption and
secretion are finely controlled at different points throughout the nephron (think of it as
the functional unit of the kidney). Wastes carried in the blood are excreted in the kidneys
as well, where they are channeled out of the kidney, through the ureters to the bladder,
and out the urethra.
à How does your excretory system help you maintain homeostasis when you are
dehydrated? Hint: Why is your urine darker-coloured when you are thirsty?
Osmoregulation largely takes place, at the molecular level, along the membranes of the
nephron. Your kidneys contain many microscopic excretory tubes called nephrons.
Figure C2 is a simplified drawing of a single nephron. There are four important
functional steps that you can work through, and try to recognize in this figure:
1. Filtration: The blood vessels form a ball of capillaries (called a glomerulus) within the
cup-shaped end (the Bowman’s capsule) of the nephron. The high blood pressure in
this capsule causes some fluid to be pushed out of the blood vessel to be captured by
the nephron. Since the glomerular capillary walls acted like a filter to keep blood cells
and other large particles within the blood vessel, the fluid that escaped into the nephron
is called the glomerular filtrate.
2. Reabsorption: The glomerular

filtrate contains water and valuable
solutes (e.g. glucose) that we do not
want to lose. Therefore, an important
function of the nephron is to reabsorb
valuable solutes and water. Note that
the blood vessel that takes blood away
from the glomerulus remains adjacent
to the nephron, so that these
reabsorbed solutes and water can
efficiently move back into the blood by
diffusion and osmosis.
3. Secretion: One way to conserve

water is to concentrate as much
metabolic waste into as small a volume
of urine as possible. To do this, your
kidney actively transports wastes into
the filtrate as it is processed into urine.
4. Excretion: Once the filtrate has

been processed through reabsorption
and secretion, it becomes concentrated
urine that is ready to be excreted from
your body when you urinate.
Figure C2. Simplified drawing of a single nephron.
à Structures within a nephron are
labelled in Figure C3. In which of
these parts of the nephron is water
reabsorbed back into the body?
Figure C3. Labelled nephron
à Using Figure C3, in which of these parts of the nephron is NaCl reabsorbed
back into the body?
The rates of water reabsorption in the kidney can be regulated by your body. When your
hypothalamus (in your brain) detects that you’re a little dehydrated, or it detects that
your blood solutes are more concentrated than normal, it triggers the release of a
hormone called ADH (antidiuretic hormone or vasopressin) into your bloodstream.
ADH acts on the kidney, stimulating the production of membrane proteins called
aquaporins, which will insert into the cell membranes lining the collecting duct.
Figure C4. Aquaporin proteins inserted into the plasma membrane of cells lining the
collecting duct.
à Aquaporins allow the transport of what molecule?
IN-LAB ACTIVITIES
PART A: MAMMALIAN DIGESTIVE AND EXCRETORY SYSTEMS
Instructions
These rats have been dissected to show the digestive and excretory systems. A list of
organs and other components that are part of these systems is given below. For each
component listed:
1. Identify the organ/component on a dissected rat.
2. List the other organs/components to which it attaches.
3. Define the organs/components function.
Tip: You may find figures A1-A4 below helpful as you proceed.
Digestive System
Salivary glands (major salivary glands include the sublingual and submandibular gland)
Esophagus
Stomach
Small intestine
Cecum
Large intestine / Colon
Pancreas (This is sometimes damaged during dissection, or hard to identify. You might
need to look at more than one rat to see clearly see a pancreas.)
Liver
Note: Rats do NOT have gall bladders.
Excretory System
Kidneys
Renal artery & vein
Ureter
Urinary bladder
Seminal vesicle
Figure A1. The urogenital system of a male rat.
Figure A2. The urogenital system of a female rat.
Figure A3. Anterior region of the rat digestive system.
Figure A4. Digestive system of a male rat. The small intestine includes the duodenum,
jejunum, and ilium. The cecum is found at the junction of the small and large intestines,
and holds bacteria that digest cellulose for rats. In humans, this organ is non-functional,
and evolved into a much smaller structure called the appendix.
PART B— MAMMALIAN DIGESTIVE SYSTEM
Activity B: Discovering the Function of Bile Salts
Introduction
Bile salts are produced by the liver, stored in the gall bladder, and released via the bile
duct into the duodenum of the small intestine when you eat foods that contain fats. But
what exactly do bile salts do? Let’s find out!
The Nature of Lipids and Triglycerides
Triglycerides, like other lipids, are non-polar. Unlike phospholipids, triglycerides do not
have a charged head group - instead they are fully non-polar.
Figure B1. General structure of triglycerides and phospholipids. Dashed lines indicate
that the fatty acid tails can be quite long, and can vary in length.
When we observe lipids in the small intestine (which is an aqueous environment), we

won’t find one triglyceride molecule floating around, but rather many triglyceride
molecules packed together in a droplet— like how oil forms droplets when you put it in
water and shake it up. Note: this is not the same as a micelle or bilayer; triglycerides
don’t form those structures, but phospholipids do.
Compared to individual triglycerides floating around by themselves, or in smaller

groups, these larger droplets have a low surface-area-to-volume ratio. This means that
digesting the droplets may take a long time, because any digestive enzymes can only
access the droplet’s surface.
In today’s lab, you will investigate bile salts— can they speed up digestion? You’ll also
use pancreatin, which contains lipases that break down triglycerides and release H+ as
a by-product (Figure B2).
Figure B2. Reaction catalyzed by the lipase enzymes in pancreatin.

Your first bile salt experiment mixes fat (triglycerides) from whipping cream with bile
salts (extracted from bile), pancreatin (extracted from pancreatic juices), and both bile
salts and pancreatin, to see what effect these secreted bile salts have on fat digestion.
In your second bile salt experiment you will go a bit further, to propose ideas as to how
bile salts might have an effect.
Bile Salt Experiment 1
Research Question: Do bile salts contribute to the digestive capacity of pancreatin?

Independent Variable: Presence or absence of bile salts.
Dependent Variable: pH of the solution after 8 minutes. (Measured using phenol red as
a pH indicator.)
Methods
1. Label four test tubes 1-4, and add to each one:
• 5 mL of whipping cream (using a graduated cylinder)
• 5 drops of phenol red
• 12 drops of 0.1 M NaOH
2. Mix the contents by covering each tube tightly with parafilm and gently inverting
the tubes several times.
Note: Phenol-red is a pH indicator dye. It is pink-red under basic conditions and yellow
under acidic conditions.
3. Add the following amounts of bile salts, pancreatin, and/or water to each tube:
Tube # 1 2 3 4
Water 5mL 5 mL* - -
Bile salts - Small scoop - Small scoop
Pancreatin - - 5 mL 5 mL
* Water is added to tube 2 to dissolve the bile salts, which are provided as a solid powder. Pancreatin is
provided already in solution, so no additional water is needed in tubes 3/4.
4. Mix all tubes thoroughly but gently and ensure they are all the same pink colour
and place in a 37°C water bath. Start a timer.
5. Watch the tubes and record the time taken for the contents of each tube to turn
yellow in Table B1 below.
Note: If a tube does not turn yellow within 8 minutes, record the reaction time as > 8
min and end the experiment. Do NOT wait longer than 8 minutes.
6. CLEAN UP.
• Wash the graduated cylinder and funnel with warm water to remove the cream
and return them to the bench where you found them.
• Pour the contents of the test tubes down the drain, rinse the test tubes in the sink,
and dispose of them in the glass recycling box.
• Make sure all reagent bottles are capped and the cream is on ice.
• Make sure your workstation is tidy
Results
Record your observed reaction times in the table below:
Table B1
Tube Reaction time (minutes)
1
2
3
4
à When a tube turns yellow, what does this indicate? Hint: What does this change
in colour indicate about the pH of the mixture, and what caused this change in pH?
à What conclusions can you draw about the impact of bile salts alone on lipid
digestion? Explain which data (which tubes) you used to draw this conclusion.
à What conclusions can you draw about the impact of pancreatin alone on lipid
digestion? Explain which data (which tubes) you used to draw this conclusion.
à What conclusions can you draw about the impact of bile salts AND pancreatin
on the reaction? Explain which data (which tubes) you used to draw this
conclusion.
Bile Salt Experiment 2
Research Question: How do bile salts affect the structure of fats in aqueous solution?
Independent Variable: Presence or absence of bile salts.
Dependent Variable: Size of fat droplets
Methods
1. Label two clean test tubes # 1 and 2.
2. Place 2 mL of water and 20 drops of mineral oil into each tube.
Note: Mineral oil is a triglyceride.
3. Add a small scoop of bile salts into tube #2 only.
4. Shake both tube vigorously
5. Observe the sizes of the oil droplets within the shaken mixtures, and the length of
time that the oil remains mixed with the water. Record this in Table B2 below.
6. CLEAN UP.
• Rinse ALL equipment in the sink that came in contact with the cream.
• Dispose of the test tubes in the bins provided and return all other equipment to
the workbenches.
• Make sure all caps are on reagent bottles.
• Make sure work station is tidy.
Results
Record your observations in the table below:
Table B2
Mixture Relative oil-droplet Length of time that the
size oil remained mixed with
water
Water + oil
Water + oil + bile

salts
Use data from BOTH experiments to answer the overarching questions below.
à How do bile salts increase the rate of fat digestion, when the bile salts
themselves do not digest fat? Note: This is a summary question in which you should
draw logical connections between your observations and conclusions.
à CHALLENGE: People suffering from gallstones will sometimes have their gall
bladders removed. Should these people stop eating fats completely? Why or why
not?
PART C— MAMMALIAN EXCRETORY SYSTEMS
Introduction
For Part C of this week’s lab, your team will explore the structure and function of the
mammalian excretory system in detail, to understand how this system maintains
homeostasis through osmoregulation and excretion of these wastes.
ACTIVITY C: THE STRUCTURE AND FUNCTION OF THE MAMMALIAN

EXCRETORY SYSTEM
Instructions
Your Lab Preparation Exercise contained an introduction to kidneys and the excretory
system. Let’s look at some data to help further understand the kidney!
Nephrons in Action: Blood Filtration

The kidneys filter a substantial amount of blood every day. Table C1 below shows the
relative fluid volumes at various stages of filtration.
Table C1: Approximate total renal fluid volumes over a 24-hour period.
Blood flow in renal artery (entering kidney) 800 litres
Glomerular filtrate 160 litres
Urine produced 1.5 litres
Blood flow in renal vein (leaving kidney) 798.5 litres
Note: any time you are talking about molecule transport into/out of the nephron in this
section, you should consider whether the transport is up or down a concentration
gradient, and whether it will occur by passive or active transport.
à As you can see in Table C1, 160 litres entered the nephron as glomerular
filtrate, but only 1.5 litres of urine was produced. Explain what happened to the
other 158.5 liters of fluid that entered the nephron as glomerular filtrate.
à Glucose concentrations are 120 mg per 100 mL in the blood entering and
exiting the glomerulus AND the same concentration in the glomerular filtrate, but
glucose is absent in the urine. Can you explain why/how this is?
à Urea concentrations are 30 mg per 100 mL in the blood entering and exiting the
glomerulus; they are the same concentration in the glomerular filtrate. However,
in the urine, urea is 2000 mg per 100 mL. Can you explain why/how this is
possible?
Remember from your lab prep that the hormone ADH acts on the kidney, stimulating the
production of aquaporins. Desmopressin is a drug that simulates ADH in the body.
à If a patient were administered desmopressin, predict what effect this would

have on each of the values in Table C1. (Would they increase, stay the same, or
decrease?) Explain your answer with reference to the mechanism and site of
action of aquaporins.
2. List the organs of the digestive system, and describe the function of each.
3. On a dissected rat, identify the organs/components of the digestive and excretory
system and list other organs/components to which they attach.
4. Describe how your excretory system’s osmoregulatory function helps to maintain
homeostasis, and what can happen when your body deviates from homeostasis.
5. Describe the 4 general functions of a nephron in a kidney.
6. Interpret new renal fluid volume data to learn more about how a kidney’s actions
affect blood and urine volumes.
7. Given any biological molecule, list the enzymes that digest it, the organs the
produce these enzymes, and the locations where these enzymes are active in
digesting food.
8. Describe the functioning of the nephron, including the movement of solutes and
water in and out, by passive or active transport.
9. Interpret the methods and results of simple experiments with digestive enzymes
and substrates.
10. Describe the roles that the liver plays in human digestion.
WEEK TWELVE. ANIMAL BIOLOGY— RESPIRATORY AND
CIRCULATORY SYSTEMS
review your lecture notes or textbook to make sure that you are familiar with the partial
pressures and the diffusion of gases, the structure, function, and regulation of the
mammalian respiratory system.
PART A: OVERVIEW and RAT DISSECTIONS

Introduction
This is the second of two labs that examine the structure and function of animals, and it
focuses on animal respiratory systems and circulatory systems.
Respiratory and circulatory systems co-evolved to solve some major challenges faced
by most animals. Firstly, because animals are active, aerobic organisms, animal cells
must be efficiently supplied with oxygen so that they can use the energy from food
molecules to produce large numbers of ATP via cellular respiration. When an animal cell
lacks oxygen, it must resort to fermentation to produce a much smaller number of ATP
per food molecule, and will produce lactic acid as a by-product. While fermentation is a
valuable “back up plan” during brief periods of low oxygen availability, it cannot sustain
active animal cells for much longer than you can hold your breath.
Secondly, because animals are multicellular, and diffusion is a very slow process even
over short distances, animals cannot rely on diffusion alone to deliver the necessary
oxygen to all cells. For example, if your body relied only on diffusion to supply oxygen to
your cells, only the outermost layers of your skin would receive enough oxygen to
survive, as diffusion would be too slow to supply any of the deeper layers of your body.
While some animals (like the parasitic tapeworm) overcame these problems by
remaining small or flat enough to obtain oxygen by diffusion alone, most other animals
evolved specialized respiratory and circulatory systems to supply oxygen to much larger
and more active bodies.
Respiratory systems, in general, increase absorption of oxygen into the body by

greatly increasing the surface area for gas exchange (e.g. in gills and lungs), and
constantly bringing a fresh supply of water or air in contact with these surfaces (e.g. by
breathing in and out).
Circulatory systems, in general, use a muscular heart to circulate blood within the
body, so that every cell is efficiently supplied with needed nutrients, and wastes are
efficiently removed. In both systems, the exchange surfaces are kept as thin as possible
(just 1-2 cells thick) so that diffusion distances are minimized.
In Lab Prep Exercise A, you will study the functional relationships between the
respiratory and circulatory systems in your own bodies. Then, in Part A of your in-lab
activities, you will familiarize yourself with the structures and functions of your circulatory
and respiratory systems.
LAB PREP EXERCISE A1: UNDERSTANDING GAS EXCHANGE WITHIN

MAMMALIAN RESPIRATORY AND CIRCULATORY SYSTEMS.
Instructions
Figure A depicts the generalized relationship between the respiratory and circulatory
systems of mammals. This simplified figure shows the partial pressures of oxygen (O2)
and carbon dioxide (CO2) in the atmosphere, in the alveoli of the lungs, in the systemic
arteries that transport blood to the body’s other tissues, and the systemic veins that
leave those tissues to bring blood back towards the lungs. Examine Figure A and
answer the questions below to better understand the relationships between these two
organ systems.
Figure A: O2 and CO2 partial pressures in the atmosphere and in the respiratory and
circulatory systems of a human being (measured in mm of Hg).
à How do the partial pressures of O2 and CO2 in blood change from when it
enters the tissue capillaries to when it exits those tissue capillaries? Explain why
these changes occurred. Hint: Consider the partial pressure gradients that exist
across the capillary walls, and how they might affect diffusion across those capillary
walls.
à Why do the cells in these tissues have such low partial pressures of O2 and
high partial pressures of CO2? What makes the partial pressure of O2 so variable
among different tissues (0- 40 mm Hg)?
à The blood leaving the tissue capillaries is low in O2 and high in CO2. What
happens to this blood as it passes through the lung capillaries?
à How do we manage to maintain such a high concentration of O2 in our alveoli

when O2 is constantly diffusing out of the alveoli and into the blood?
à CHALLENGE: When you exercise strenuously, your muscles consume more

O2. List 3 physiological responses of your body to exercise, and explain how each
one increases O2 delivery to your muscles.
PART B— MAMMALIAN CIRCULATORY SYSTEMS
Introduction
In Part B of this week’s lab, you will study the structure and function of animal circulatory
systems. In this Lab Preparation Exercise , you will review the flow of blood through the
mammalian circulatory system, and take a closer look at mechanisms that keep blood
moving. During your in-lab activities, you will study the different blood vessels of your
circulatory system, and measure your heart rate and blood pressure, and explore the
different factors that can affect them.
In all vertebrate circulatory systems, blood flows through two sets of capillaries: one set
is located in the lungs or gills, where O2 diffuses into the blood and CO2 diffuses out; the
second set includes all of the systemic capillaries, which deliver oxygen to (and take
CO2 from) all of the other tissues in the animal’s body. In this exercise, you will examine
how blood is moved between these lung capillaries and systemic capillaries in a
mammalian circulatory system.
LAB PREP EXERCISE B: MAMMALIAN CIRCULATORY SYSTEMS
Now, lets take a closer look at mammalian arteries and veins, by examining the ones
found in your own body. First, place your left hand in a relaxed position on your lap with
your palm facing up, and find your arterial pulse by pressing very gently with the first two
fingers of your right hand as shown below. If you watch your wrist closely, you can
sometimes even see your skin rise and fall with each pulse.
à What is causing your artery to expand like this? Be very specific.
Now try feeling for a “pulse” from a vein on the back of your forearm, the side opposite
where you took your arterial pulse, so that you do not confuse the two. To find a vein, let
your left arm hang by your side and relax all of the muscles in that arm. After about 20-
30 seconds, your veins should be more pronounced. Place the first two fingers of your
right hand on one of the larger veins to mark that spot, then place your left arm in your
lap (palm down) as you take the “pulse” of this vein with the same pressure and posture
as you did with the artery.
à What did you feel? Explain any differences between the artery and the vein, in
terms of what you know about the circulatory system and how blood pressure
changes after it passes through the capillary beds.
So why is this difference in blood pressure between arteries and veins important? Well,
you noticed earlier that when you hang your left arm down, the veins become swollen
with blood. This happens because there is not enough blood pressure to push this blood
all the way back up your arm to your heart, and so the veins become swollen as oxygen-
poor blood collects inside them.
à Hold your arm straight up and take your arterial pulse. Can you still find your
pulse? Why or why not?
Because the heart pumps blood directly into your arteries with high blood pressure, this
pressure is sufficient for pushing blood (against gravity when necessary) to all other
parts of your body. But what about the veins? After passing through the systemic
capillaries, there is no longer enough pressure to push the blood back to the heart
against gravity. Let’s look at two ways that we can return the blood from our arms to our
hearts:
1. Try letting your arm hang limply by your side again until the veins become very
visible, then slowly raise that arm in front of you while keeping it relaxed.
à What happens to your veins as your arm reaches the height of your heart?
Why do you think this happens?
2. Let your arm hang limply by your side again until the veins become very visible. Flex
your arm muscles four times in quick succession and relax again.
à What did you notice about your veins right after you contracted these
muscles?
The veins in your arms and legs have one way valves.
à Explain why these valves are necessary for returning venous blood to the
heart.
à CHALLENGE: people taking long flights on airplanes sometimes develop blood

clots in their leg veins that can dislodge and cause major problems (e.g. a heart
attack if the clot blocks the coronary artery that nourishes the heart). Airlines
suggest that passengers stretch and wiggle their toes often during long flights.
Explain what circulatory problem these suggested exercises were designed to
prevent.
IN-LAB ACTIVITIES
PART A: MAMMALIAN CIRCULATORY AND RESIPRATORY SYSTEMS

Activity A1: Identifying Organs in the Rat Dissections
Instructions
These rats have been dissected to show the respiratory and circulatory systems. Below
is a list of organs and other components that are part of these systems. For each
component listed:
1. Identify the organ/component on a dissected rat.
2. List the other organs/components to which it attaches.
3. Define the organs/components function.
Respiratory System
Trachea
Lungs
Diaphragm
à Explain how the diaphragm helps us breathe.
Circulatory System
Heart (Make sure you can distinguish between the right atrium, left atrium, and
ventricles.)
Aortic arch
Superior/Anterior Vena Cava
Inferior/Posterior Vena Cava
Pulmonary Artery (The pulmonary vein is likely too difficult to find.)
Renal Artery & Vein
Spleen
Figure A1. Blood vessels and organs of the thorax and head of a rat.
Figure A2. Blood vessels and organs of the abdomen of a rat.
Activity A2: Examining the Structure of Mammalian Respiratory Systems
Instructions
To explore the anatomy of mammalian respiratory systems, examine Figure A3 and the
preserved sheep and rat lungs as you answer the questions below.
Figure A3. The human respiratory system.
Examine the very delicate sheep and rat lung specimens with extreme care. These are
real lungs that were fully inflated and then preserved. A smooth layer of connective
tissue protects the outside of the lungs so that they are not damaged when they rub
against the inside of the rib cage during breathing.
When lungs first evolved in ancestral vertebrates, they were little more than a balloon-
like air bladder that was surrounded by blood vessels and connected to the outside
environment by a simple tube. However, when you look through the damaged areas of
the connective tissue on the preserved lung specimens, you’ll notice that the inside of a
modern mammal’s lung is not an empty, air-filled cavity. Instead, you’ll find a sponge-like
tissue that’s made up of many microscopic alveoli, each surrounded by tiny capillaries.
In our lungs, finely branching bronchioles deliver air to around 300 million alveoli that,
when added up, cover an area of about 70 square meters (~1/4 of a tennis court)!
à Why are modern lungs more efficient at gas exchange than an ancestral
balloon-like air bladder? Explain your answer in terms of the variables that affect
diffusion.
à CHALLENGE: Birds have a different and more efficient respiratory system than
mammals. Compare these two systems. Why is the avian (i.e., bird) system more
efficient?
Activity A3: Examining the Structure of Mammalian Circulatory Systems
Instructions
For this activity, you will be studying the structure and function of the mammalian heart
using stethoscopes, models, preserved samples, and some very useful figures. Follow
the procedures as you tackle each question as a team.
Heart Structure
Begin by examining Figure A4, and the plastic 3D heart model in the lab.
To better understand the structure of each part of the heart and how they are connected,
identify each of the heart chambers, valves, and major blood vessels that blood will
travel through as it completes one full circuit through the body.
Figure A4. An adult mammalian heart showing its chambers, valves, and major
connecting vessels. The course of blood through the heart is indicated by the arrows.
à Examine the preserved sheep heart. Which side of the heart has more muscular
ventricle walls? Explain why this difference in ventricle strength is adaptive.
Heart Function
Now that you are familiar with all of the heart’s major structures and how they are
connected, examine what happens in the heart during each cardiac cycle.
Begin by listening to your own heartbeat using a stethoscope.
Place the chest piece of the stethoscope to the left of your
sternum in the shaded area shown in the picture shown.
Breathe normally and listen.
à What parts of the heart are producing the two heart

sounds? Discuss this with your team and record your best
guesses here.
Measuring blood pressure

Place the cuff of the blood pressure monitor on your left arm with the tube extending
toward your hand. Follow the instructions provided beside each blood pressure monitor.
Have your partner help you put on and take off the cuff, and remember to breathe
normally before and during the measurement.
The higher number is your systolic pressure, and the lower number is your diastolic
pressure. The blood pressure monitors will also measure your heart rate. Write your
blood pressure and heart rate in Table A3 below as systolic over diastolic pressure.
Table A3: Heart rates and blood pressures of your teammates.

Heart Blood Pressure Blood Pressure
Rate Systolic Diastolic
(Beats per (mm Hg) (mm Hg)
minute)
Blood pressure varies with age, sex, genetic factors, and environmental (including
behavioural) factors. Blood pressure of 120/80 mm Hg is often considered normal.
Hypertension (high blood pressure) is normally indicated by diastolic pressures above
90 mm Hg, or systolic pressure that is continually above 140 mm Hg. Keep in mind
blood pressure can vary from one measurement to the next. Accurate measurements
are best made by medical professionals.
à What environmental factors might lead to an increase or decrease in blood

pressure?
Activity A4: Mammalian Blood Vessels

Instructions
For this activity, you will be examining the structures of mammalian arteries and veins.
Perform the activities and discuss the activities with your team.
Structures of Arteries and Veins in Cross section

Examine the prepared slide of cross-sectioned arteries and veins under the microscope
and identify an artery and a vein. Use Figure A5 as a guide. Note: arteries tend to be
rounder, and less distorted by the sectioning process, than veins.
Figure A5. Cross section of mammalian artery and vein
à What structural differences did you notice between the tissue layers of arteries
and veins?
The structural differences between arteries and veins are connected with differences in
how they move blood through the body.
à Explain how blood flows through arteries.
à Explain how blood flows through veins.
à CHALLENGE. Blood pressure is normally measured in the brachial artery.

Explain why blood pressure is not measured in your brachial vein.
Activity A5 - Comparing Three Types of Mammalian Muscle Tissues
For this activity, numerous prepared slides of mammalian muscle tissues are provided in
the lab.
Descriptions of Each Type of Mammalian Muscle Tissue.
(1) Skeletal muscle
Skeletal muscle is under our voluntary control. It moves our skeleton and some internal
organs, like the tongue. It is also found in the throat or pharynx and around the anus, to
control the passage of materials.
Each muscle bundle (e.g. your bicep muscle), consists of numerous muscle fibers
bound together by connective tissue. Each muscle fiber is one long cell with several
nuclei and many mitochondria. Skeletal muscle fibers can be very long. For example,
each of the muscle fibers in your thigh muscle runs from your hip to your knee.
The muscle fibers themselves are made up of even smaller units called myofibrils and
each myofibril contains myofilaments of contractile proteins. The chief myofilament
proteins are actin and myosin, and the pattern of banding (seen in skeletal muscle
longitudinal sections when viewed under the compound microscope) is the result of the
regular arrangement of thick myosin and thin actin myofilaments.
(2) Smooth muscle

Smooth muscle cells are under the involuntary control of the peripheral or autonomic
nervous systems. Smooth muscle is found in the walls of the gastrointestinal tract and
uterus, where they are responsible for the movement of materials, and in blood vessels,
where they control the flow of blood.
Smooth muscle cells are spindle-shaped, lack the banded pattern of skeletal muscle
cells, and contain a single nucleus per cell.
(3) Cardiac Muscle

Cardiac muscle is also under the involuntary control of the peripheral nervous system.
They are found in the walls of the heart, where the cells must contract almost
simultaneously to efficiently pump blood.
Cardiac muscle cells have a banded appearance like skeletal muscle cells, but they are
short and may be branched, with usually one nucleus per cell. In addition, cardiac
muscle cells communicate with each other by electrical synapses, which appear as
dark lines called intercalated discs in longitudinal sections of cardiac muscle.
Figure A6. Three different kinds of mammalian muscle cells:
à Label the three parts of the figure with the appropriate types of muscle tissue.
à What morphological features did you use to identify these three kinds of
mammalian muscle cells?
à Explain how these morphological features help with the function for each kind
of muscle cell.
PART B— HEART RATE AND EXERCISE
For this activity, you will measure all of your team members’ heart rates, before and after
two short bursts of exercise.
à Given this scenario, come up with a research question you want to ask with
your group as well as a reasonable hypothesis.
Note: there are a few different ways, equally good, of seeing this experiment; this will
result in differences in what you consider to be your independent variable, dependent
variable, controls, replicates, and confounds. All of this is fine. Overall, aim for one
VERY simple research question, and do be specific, especially in your hypothesis,
about what you are testing.
à Research Question:
à Hypothesis:
à Independent Variable:
à Dependent Variable:
Now work with your team to collect your own data.
Measuring Heart Rate

Each teammate does this, all at the same time.
At Rest:
• Sit in a relaxed position and take your arterial pulse on your wrist. Help each
other out— taking a pulse can be tricky, so help talk each other through this. You
can instead take your pulse at your carotid artery (at your neck), if easier. Use
fingers, not thumbs. You can use the stethoscope if you prefer.
• When your team is ready, one person starts a timer for 30 seconds as you each
count the number of times your heart beats. Keep breathing normally.
• Multiply your counted heartbeats by 2 to get your heart rate in beats-per-minute,
and record the data below in Table B1.
Get a Little Exercise:
• If possible for you right now, here’s the plan: You’re going to get up and do the
same exercise, such as jumping jacks, then immediately take your pulse
afterwards.
o You’ll stand up, and exercise for one full minute. If not possible, do some
moderate physical activity while looking goofy. Yes, don’t be too cool for
school. Get into it, in the name of science!
o Then you’ll immediately sit down and take your pulse on your wrist (or
neck; same place as you did before)— take the pulse for 30 seconds, then
multiply by 2 to get your beats per minute (bpm).
o Record your bpm in Table B1.
Rest After Exercise:
• Take a 2-3 minutes rest. After this, re-measure your heart rate, and record it in
Table B1.
Finally, do 1 more minute of exercise, and take your heart rate again, recording it in
Table B1.
Table B1: Heart rates at rest and after moderate exercise

Heart Rate (beats per Team Team Team Team
minute) member 1 member 2 member 3 member 4
At rest (sitting down):
After 1 minute exercise:
After 2 minutes rest

(sitting down):
After 1 minute exercise:
Note: an average resting heart rate is 72 beats per minute, but this can vary widely for
lots of reasons that are just fine. If your heart rate numbers are making you nervous, first
recognize that you are not (likely) a medical professional. So, more so than any actual
medical concern, it’s much more probable that you’re just taking your pulse slightly
incorrectly. If you have concerns, take them to your doctor— we are not a medical
testing lab, so take all your self-diagnoses with a grain of salt.
à What is your body’s physiological goal of increasing heart rate during

exercise? (i.e., how does your heart’s physiological response to exercise support
its overall function in the body?)
àWhat environmental factors might lead to an increase or decrease in heart rate?
à Now let’s analyze your data. Given the raw data you have collected above,
consider how you might summarize/organize/process this data.
• Note: there are some choices to make about what things you average together.
• Big-picture, make sure your analysis/processing/organization is aligned with your
research question, so that your results will let you compare between the things
you need to compare, to answer your hypothesis.
• Specifically, make sure you clearly understand what you consider to be
replicates, to help you decide what to take averages of.
à Display your processed data with a graph below, including value(s) that we'd
normally calculate/use to show variability within your averages.
à Is your hypothesis supported? What might be some reasons for similarities or
differences between your averages?
Note: I’d encourage you to think about this as a place NOT for judgey opinions,
including of your own self or your teammates. If you are feeling self-conscious about
your heart rate, instead just think about it like a scientist, or like a friend to yourself.
Physiology is really interesting, and the more we can make connections with our own
physiology, the more we will learn the material. Plus, your body is helping you get to this
very place you are today, so it’s doing a great job, just as it is.
à Each person’s beats per minute measurements, for the two replicates at rest
were likely not identical to each other. Give some ideas as to why they might be
variable. Why is it important to know and communicate this variability?
2. Explain why respiratory and circulatory systems evolved in most animals.
3. Describe examples of challenges faced by most animals, and the structural features
of respiratory and circulatory systems that overcome these challenges.
4. Predict the direction in which oxygen and carbon dioxide will diffuse at any animal
exchange surface, and justify that prediction in terms of partial pressures and
diffusion.
5. Explain how partial pressure gradients are maintained at each capillary system.
6. Take your own pulse, and locate veins in your forearm.
7. Compare and contrast arteries and veins, in terms of the blood pressure within them
and the forces that push blood through them.
8. On a dissected rat, identify the organs/components of the respiratory and circulatory

systems, and list other organs/components to which they attach.
9. Identify each structure of the mammalian heart, and explain its role during a cardiac
cycle.
10. Describe the major events of a cardiac cycle, and relate these events to the heart
sounds that we can detect externally.
11. Identify an artery or vein by looking at its cross section, and justify your answer by
pointing out the structural features that are observable under a microscope.
12. When given a slide of a mammalian muscle tissue, identify the type of muscle, and
justify your answer by describing several structural features that this tissue has for
its particular functions.
13. Measure your heart rate and blood pressure.
14. Give possible reasons why an individual’s heart rate or blood pressure might be
higher or lower than average.

BISC Lab Manual

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

BISC Lab Manual

Uploaded by

Copyright:

Available Formats

BIOLOGICAL SCIENCES 101

Fall 2023 Edition

© Thong and Lam, with additions & modifications

Student Name: ____________________________________

Student Number: ____________________________________

Student email: ______________________________________

Lab section: Day ________________________

Tutorial Section: Day ________________________

Lab Instructor: Name ____________________________________

TA: Name ____________________________________

WEEK ONE. Sept 4-6. NO LABS

BISC 101 LAB + TUTORIAL MARK BREAKDOWN FALL 2023

7% LAB & TUTORIAL PREPARATION & PARTICIPATION (INCLUDING TUTORIAL

• Apply the scientific method to explore a research question

• Connect structure to function at the level of molecules, cells and organisms

• Perform basic lab skills common in a biology laboratory

• Demonstrate safe, professional, and collaborative laboratory conduct

• Communicate effectively in written and oral formats, employing a scientific

1. Weekly Lab Preparation Exercises, to complete before your lab

Here are the details for each:

1. Lab Preparation Exercises

2. In-Lab Activities. This is what you will do IN lab each week.

Attendance and Punctuality

• cannot come to campus due to symptoms of COVID-19 or exposure to a

If you are unsure about something, ask your TA or Lab Instructor.

LAB PREPARATION EXERCISES

For Lab Preparation Exercises each week, you should:

PART A— WHEN AND HOW TO USE LAB EQUIPMENT

What are they used for?

2. Attach the pipette to a pump or bulb

3. Draw the liquid into the pipette slowly

4. Dispense the liquid into the receiving container slowly

6. Look out for decimal places

What are they used for?

1. Attach the pipette to a rubber bulb

2. Draw the liquid into the pipette slowly

3. Dispense the liquid into the receiving container slowly

Why is this done?

1. Place a small drop of your sample in the middle of a glass slide.

What is this used for?

What are they used for?

1. Label a clean test tube and place it in a test tube rack.

To view objects at 40x, 100x, or 400x magnification (e.g. to see cells!)

Note: Once an object is in focus with the 4x objective, it will be approximately in

What are they used for?

1. Transfer your sample into a new cuvette.

What are they used for?

3. Turn the main POWER switch on, if it is not already on.

5. Close the centrifuge lid firmly and wait for it to lock.

8. Press the START/STOP button to start the centrifuge.

**End of Lab Preparation Exercises**

First, meet the people sitting around you!

SAFETY SCAVENGER HUNT

Other important things to write on the floor plan:

ACTIVITY A— EXAMINING AND IDENTIFYING AN UNKNOWN HOMOGENATE

What your team should do

2. Perform your planned procedures, one at a time.

Lab Section: D1_ _

Team member names: _______________________________

Homogenate identity: _______________________________

LAB PREPARATION EXERCISES

PART A— EXPERIMENTAL DESIGN BACKGROUND

Research Question and Hypothesis

End of Lab Preparation Exercises

End of Lab Preparation Exercises

End of Lab Preparation Exercises

à RBCs from Tube viewed under microscope at _ magnification.