Received: 9 October 2019 | Revised: 27 February 2021 | Accepted: 5 April 2021

DOI: 10.1002/jcb.29938

RESEARCH ARTICLE

GPR30 knockdown weakens the capacity of CAF in

promoting prostate cancer cell invasion via reducing
macrophage infiltration and M2 polarization

Ran Zhang1,2 | Jiaojiao Zong1 | Yanfei Peng3 | Jiandang Shi1 |

Xiaoling Du1 | Haitao Liu4 | Yongmei Shen1 | Jiasong Cao1 | Bona Jia5 |
Feng Liu6 | Ju Zhang1

1
Department of Biochemistry and Molecular Biology, College of Life Sciences, Bioactive Materials Key Lab of Ministry of Education, Nankai
University, Tianjin, China
2
Shandong Provincial Key Laboratory of Radiation Oncology, Cancer Research Center, Shandong Cancer Hospital and Institute, Shandong First
Medical University and Shandong Academy of Medical Sciences, Jinan, Shandong, China
3
School of Integrative Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin, China
4
Shanghai First People's Hospital Shanghai Jiaotong University, Shanghai, China
5
Key Laboratory of Breast Cancer Prevention and Therapy (Ministry of Education), Tianjin Key Laboratory of Medical Epigenetics, Department of
Biochemistry and Molecular Biology, Collaborative Innovation Center of Tianjin for Medical Epigenetics, Tianjin Medical University, Tianjin, China
6
Key Laboratory of Infection and Immunity of Shandong Province and Department of Immunology, School of Biomedical Sciences, Shandong
University, Jinan, Shandong, China

Correspondence
Yanfei Peng, School of Integrative
Medicine, Tianjin University of
Traditional Chinese Medicine,
300193 Tianjin, China.
Email: pengyanfei@tjutcm.edu.cn
Ju Zhang, Department of Biochemistry
and Molecular Biology, College of Life
Sciences, Bioactive Materials Key Lab of
Ministry of Education, Nankai University,
300071 Tianjin, China.
Email: zhangju@nankai.edu.cn
Funding information
National Natural Science Foundation of
China, Grant/Award Numbers: 81672527,
81872087
Abstract
Cancer‐associated fibroblasts (CAFs) can promote the development and me-
tastasis of prostate cancer partly by mediating tumor‐associated inflammation.
An increasing amount of studies have focused on the functional interactions
between CAFs and immune cells in the tumor microenvironment (TME). We
previously reported that G protein‐coupled receptor 30 (GPR30) was highly
expressed in prostate CAFs and plays a crucial role in prostate stromal cell
activation. However, the effect and underlying mechanism of GPR30 expres-
sion in prostate CAFs affecting the interaction between CAFs and tumor‐
associated macrophages (TAMs) need further elucidation. Here, we found
that, compared with CAF‐shControl, CAF‐shGPR30 inhibited macro-
phage migration through transwell migration assays, which should be attrib-
uted to the decreased expression of C‐X‐C motif chemokine ligand 12
(CXCL12). In addition, macrophages treated with a culture medium of CAF‐
shGPR30 exhibited attenuated M2 polarization with downregulated M2‐like
markers expression. Moreover, macrophages stimulated with a culture med-
ium of CAF‐shGPR30 were less efficient in promoting activation of fibroblast
cells and invasion of PCa cells. Finally, cocultured CAF‐shGPR30 and mac-
rophages suppressed PCa cell invasion compared to cocultured CAF‐

J Cell Biochem. 2021;1–19. wileyonlinelibrary.com/journal/jcb © 2021 Wiley Periodicals LLC | 1

2 | ZHANG ET AL.

shControl and macrophages by decreasing interleukin‐6 (IL‐6) secretion, and

this effect could be abrogated with rescue expression of IL‐6. Our results
pinpoint the function of GPR30 in prostate CAFs on regulating the CAF‐TAM
interaction in the TME and provide new insights into PCa therapies via reg-
ulating TME.

KEYWORDS
cancer‐associated fibroblasts, G protein‐coupled receptor 30, prostate cancer, tumor‐
associated macrophages

1 | INTRODUCTION tumor growth via secreting growth factors, cytokines, and

Prostate cancer (PCa) is one of the leading causes of cancer‐
related death in men.1 Tumor initiation and progression is
not only dependent on the biological features of malignant
cells but also supported by the multifaceted tumor micro-
environment (TME).2,3 As the most abundant components
of the tumor stroma, cancer‐associated fibroblasts (CAFs)
play important roles in influencing PCa progression, in-
cluding promoting the survival, proliferation, and invasion of
cancer cells by regulating extracellular matrix (ECM) de-
position, epithelial differentiation, tumor inflammation, and
angiogenesis.4–6
G protein‐coupled receptor 30 (GPR30), an orphan
receptor, can mediate non‐genomic signaling and play a
significant role in several types of human cancer.7 In
addition, GPR30 is associated with smooth muscle cell
(SMC) differentiation in several types of human
tissue.8–10 GPR30 in breast cancer CAFs mediates an-
giogenesis and migration ability.11,12 Furthermore, the
expression level of GPR30 is much higher in castration‐
resistant prostate cancer (CRPC) metastases (n = 123)
than in primary cancers.13 Our previous results have
revealed the higher expression levels of GPR30 in pros-
tate CAFs than in normal fibroblasts, which are centrally
involved in prostate stromal cell activation. Moreover,
GPR30 overexpression in stromal cells promotes PCa cell
proliferation and migration in a paracrine manner.8
Tumor‐associated macrophages (TAMs) have been re-
garded as the major inflammatory component of the tumor
stroma for both primary and secondary tumors.14 TAMs are
derived from tissue‐resident macrophages and infiltrating
monocytes, with the latter being the major source.15,16 There
are two polarized subtypes of TAMs.17 The “classically
activated TAM” exhibits an M1‐like phenotype and a pro‐
inflammatory effect, and these cells exist predominantly in
the early stage of tumor progression; the “alternatively
activated TAM” exhibits an M2‐like phenotype and is anti‐
inflammatory. The number of M2‐polarized TAMs is sig-
nificantly increased in TME and promotes the progression of
chemokines, such as vascular endothelial growth factor
(VEGF), C‐X‐C motif chemokine ligand 10 (CXCL‐10),
monocyte chemoattractant protein‐1 (MCP‐1), and C‐C
motif chemokine ligand 22 (CCL‐22).15,18 An increasing
number of studies have reported that chronic inflammation
leads to the initiation and progression of PCa,19,20 and TAMs
have been considered an attractive treatment target in clin-
ical oncology due to their stimulatory role in prostate tu-
morigenesis, angiogenesis, and metastasis.15 A higher
mortality rate has also been shown for PCa patients with M2
macrophage infiltration.21
In multiple tumor types, both the infiltration of mono-
cytes and the M2‐polarization of TAMs are modulated by a
complex network of cytokine‐based interactions.22 TAMs
infiltration can be used as an indicator of poor prognosis for
PCa patients who have undergone hormone therapy and
increased TAMs infiltration has been observed in CRPC
tissues.23 Coupled with the fact that the distribution of TAMs
and CAFs tends to be similar in PCa,24 the cell‐cell inter-
action between TAMs and CAFs plays a critical role in the
TME and accelerates PCa progression.25 Several molecules,
including macrophage colony stimulating factor (M‐CSF),
VEGF, transforming growth factor‐β (TGF‐β), matrix me-
talloproteinases (MMPs), and ECM proteins secreted from
both TAMs and CAFs have been reported to promote tumor
cell malignancy and lead to the deterioration of nontumor
stromal cells.26
In this study, we investigated the effects of CAF‐
shGPR30 on macrophage infiltration and M2 polariza-
tion. On the other hand, the effects of macrophages sti-
mulated with CAF‐shGPR30 on normal fibroblast
activation and PCa cell invasion were studied. Further-
more, the combined effect of CAF‐shGPR30 with mac-
rophages in the TME on PCa cell invasion and the
underlying molecular mechanisms were also determined.
Here, we reported the inhibitory effects of
CAF‐shGPR30 on macrophage infiltration and M2 po-
larization, as well as the effects on normal fibroblast
activation. Furthermore, CAF‐shGPR30 combined with
ZHANG ET AL.
macrophages in the TME exhibited less efficiency in
promoting PCa cell invasion.
2 | MATERIALS A ND METHODS
2.1 | Cell culture
Human prostate fibroblasts cell lines CAF and normal‐
associated fibroblast (NAF) were hTERT‐immortalized
and isolated from prostatectomy specimens using stromal
cell‐selective culture conditions. The cells were received
from the Department of Urology, Medical University of
Innsbruck, Austria. The CAF cell line was cultured from
a tumor tissue sample extracted from tumor foci,
whereas the NAF cell line was isolated from non-
malignant tissue sample distant to tumor areas. Extrac-
tion sites were identified by an experienced pathologist
and histologically confirmed. The primary cultures were
established using a tissue explant method as reported in
detail.8,27 Mus‐CAF cell was prepared as a primary cul-
ture from 36‐weeks‐old TRAMP mice and immortalized
by SV40 large T‐antigen. It was a kind gift from Sex
Hormone Research Center, Tianjin Institute of Urology,
Tianjin, China.28,29 These cells were cultured in Dul-
becco's modified Eagle's medium (DMEM) phenol
red‐free medium (Sigma‐Aldrich) supplemented with
100 U/ml penicillin/streptomycin (P/S, Invitrogen) and
10% fetal bovine serum (FBS, Invitrogen). The normal
prostate stromal cell line WPMY‐1, which was defined as
myofibroblasts, derived from normal stromal cells of the
peripheral zone in the adult prostate, was purchased
from the American Type Culture Collection (ATCC) and
maintained in DMEM phenol red‐free medium supple-
mented with P/S and 5% FBS. Four PCa cell lines, PC3,
22RV1, Du145, and LnCaP were purchased from the
ATCC and maintained in RPMI‐1640 (Gibco) with 10%
FBS. The human monocyte cell line THP‐1 and the
mouse macrophage cell line RAW264.7, were purchased
from the ATCC and cultured in DMEM and RPMI‐1640
with 10% FBS respectively. Mouse primary peritoneal
macrophage was harvested from male C57BL/6 mice 4
days after thioglycollate (BD) injection, and cultured in
DMEM supplemented with 5% FBS. All of these cell lines
were cultured at 37°C under 5% CO2.
TABLE 1 Sequences of shRNA
Code number Sequences of GPR30 shRNA (5′–3′)
shGPR30 #1 CCGGAGCTGTACATTGAGCAGAAATTAAGTTCTCTAATTTCTGCTCAATGTACAGC
shGPR30 #2 CCGGATGAGCTTCGACCGCTACATCCTCAAGTTCTCTGAGGATGTAGCGGTCGAAGCTCA
shCtrl ACCTCGGGTATTTAGGCTACGATAGTTCAAGAGACTATCGTAGCCTAAATACCCTT
| 3
2.2 | Lentiviral‐mediated knockdown of
GPR30
Production of lentiviral particles was carried out in 293T
cells using the packaging plasmids pVSVG, pRSV‐REV,
pMDLG, and the lentiviral vector pLK0.1‐TRC cloning
vector containing GPR30‐specific shRNA (small‐hairpin
RNA) and control shRNA, respectively. Two sequences
of shRNA (Table 1) were tested and both showed sig-
nificant targeted knockdown; representative results are
shown in Results. All of the transfections were performed
using Lipofectamine3000 reagent (Invitrogen). For len-
tiviral infection, CAF cells were cultured until reaching
~70% confluence, CM containing lentiviral particles was
added to the cells with 8 μg/ml polybrene. The medium
was changed at 24 h after infection and puromycin se-
lection was initiated 48 h post‐infection.
2.3 | Migration assay
CAF‐shControl (CAF‐shCtrl) or CAF‐shGPR30 cells
were cultured in 24‐well plates. After 24 h, macrophages
were seeded on the inserted transwells with a 5‐μm pore
size (BD Biosciences). After another 24 h of co‐
incubation, transwells were washed with phosphate‐
buffered saline (PBS) and fixed with 4% paraformalde-
hyde. Then, macrophages remaining on the inner
transwell surface were wiped off and transwell mem-
branes were stained with 1% crystal violet (w/v). Cells
that migrated were counted in five randomly selected
fields per transwell via microscope (×100 fold).
2.4 | Real‐time reverse‐transcription
polymerase chain reaction (RT‐PCR) assay
Total RNA was extracted using TRIzol reagent (In-
vitrogen). SYBR Green‐based real‐time quantitative
PCR was performed on an MJ Research DNA Engine
Opticon Continuous Fluorescence Detection System
(Opticon Monitor II, MJ Research, Inc.) using the
specific primer pairs listed in Table 2. The relative
gene expressions were detected using the comparative
CT method and normalized to the mouse gene ACTB
4 | ZHANG ET AL.

TABLE 2 Nucleotide sequences of primers used in real‐time TABLE 2 (Continued)

RT‐PCR
Primer name Sequence (5′–3′)
Primer name Sequence (5′–3′)
R: GGGCCACACTGCACTATGAT
Homo AMAC‐1 F: GCTGCCTCGTCTATACCTCCT
Homo TGF‐β1 F: TGGACATCAACGGGTTCACT
R: GGTCGCTGATGTATTTCTGGA
R: GCAGAAGTTGGCATGGTAGC
Homo AR F: GGAATTCCTGTGCATGAAA
Homo TGF‐β2 F: GCAGATCCTGAGCAAGCTG
R: CGAAGTTCATCAAAGAATT
R: GTAGGGTCTGTAGAAAGTGG
Homo Arg‐1 F: CAAGGTGGCAGAAGTCAAGAAG
Homo TGF‐β3 F: AAGTGGGTCCATGAACCTAA
R: GTGGTTGTCAGTGGAGTGTTG
R: GCTACATTTACAAGACTTCAC
Homo Calponin F: TTGAGGCCAACGACCTGTTT
Homo TNC F: AGGCTCACAATCTCACGG
R: TTTCCGCTCCTGCTTCTCTG
R: CCTCAGACACGGCTAAATC
Homo CCL‐2 F: AGCAGCAAGTGTCCCAAAGA
Homo Wnt5α F: AGTGGCTTTGGCCATATTTTTC
R: TTTGCTTGTCCAGGTGGTCC
R: CATACCTAGCGACCACCAAGAAT
Homo CCL‐5 F: CGGCACGCCTCGCTGTCATC
Homo α‐SMA F: GGGACATCAAGGAGAAACTG
R: GCAAGCAGAAACAGGCAAAT
R: TGATGCTGTTGTAGGTGGTT
Homo CCL‐22 F: AAACTAATGTCCCTCCCCTCTC
Mus CD80 F: ACCCCCAACATAACTGAGTCT
R: TTTGGGGCTTCACATTGACC
R: AACCAAGAGAAGCGAGG
Homo CD44 F: TCCAACACCTCCCAGTATG
Mus CD86 F: GTTTCCGTGGAGACGCAAG
R: TTCTGGACATAGCGGGTG
R: CAGCTCACTCAGGCTTATGTTTT
Homo COX‐2 F: GATCCCCAGGGCTCAAACAT
Mus COX‐2 F: CAGCAAATCCTTGCTGTTCC
R: GAAAAGGCGCAGTTTACGCT
R: TGGGCAAAGAATGCAAACATC
Homo CTGF F: AATGCTGCGAGGAGTGGGT
Mus CXCL10 F: CTTAACCACCATCTTCCCAA
R: CGGCTCTAATCATAGTTGGGTCT
R: GATGACACAAGTTCTTCCA
Homo CXCL12 F: TGAACGCCAAGGTCGTGGT
Mus CXCL11 F: GGCTGCGACAAAGTTGAAGTGA
R: GAATCGGCATGGGCATCTGT
R: GGCACAGAGTTCTTATTGGAG
Homo CSF‐1 F: CCTGCGTCCGAACTTTCTAT
Mus Fizz‐1 F: CCAATCCAGCTAACTATCCCTCC
R: TCACTGCTAGGGATGGCTTT
R: ACCCAGTAGCAGTCATCCCA
Homo ERα F: GGACCATATCCACCGAGTCCTG
Mus IL‐10 F: CCAAGCCTTATCGGAAATGA
R: GCCTCCCCCGTGATGTAATAC
R: TTCACAGGGGAGAAATCG
Homo FAP F: CCCTGCGTATGTAGGTCC
Mus MCP‐1 F: TCCCAATGAGTAGGCTGGAG
R: TGTCTGCCAGTCTTCCCT
R: AAGTGCTTGAGGTGGTTGTG
Homo FIZZ1 F: ACAGTCCCTCTCCTATAAGCAAG
Mus MHCII F: GCGACGTGGGCGAGTACC
R: ACCACAGCCATAGCCACAAG
R: CATTCCGGAACCAGCGCA
Homo GPR30 F: TTGTGGGCAACATCCTGA
Mus VEGF‐A F: TTTACTGCTGTACCTCCACCA
R: CGATGTAGCGGTCGAAGC
R: ATCTCTCCTATGTGCTGGCTTT
Homo GAPDH F: AATGTCACCGTTGTCCAGTTG
Mus VEGF‐B F: CCTGGAAGAACACAGCCAAT
R: GTGGCTGGGGCTCTACTTC
R: GGAGTGGGATGGATGATGTC
Homo IL‐1β F: TGGCTTATTACAGTGGCAATGAG
Mus TNF‐α F: AATGGCCTCCCTCTCATCAGTT
R: GTAGTGGTGGTCGGAGATTCG
R: CGAATTTTGAGAAGATGATCTGA
Homo IL‐6 F: AACTCCTTCTCCACAAGCGCC
Mus β‐actin F: CGCCCTAGGCACCAGGGTGTG
R: CCGTCGAGGATGTACCGAAT
R: TCGGTGAGCAGCACAGGGTG
Homo SM22α F: GGTTAGGCCAAGGCTCTACTGT
ZHANG ET AL. | 5

T A B L E 3 Antibody/fluorophore
Species Marker Fluorophore Clone Concentration (μg/ml) Catalog no.
conjugates used for flow cytometry
Human CD68 FITC Y1/82A 1.5 333805
Human CD206 APC 15‐2 2 321109
Human CD163 PE GHI/61 2 333605
Human CD86 PE BU63 2 374206

TABLE 4 Characteristics of primary

Name of primary
antibodies
antibodies Host species Dilution used Supplier catalog no.
α‐SMA Rabbit polyclonal 1:500 (WB) Abcam, ab5694
AR (N‐20) Rabbit polyclonal 1:300 (WB) Santa Cruz, sc‐816
CD44 Rabbit monoclonal 1:2000 (WB) Abcam, ab51037
CD68 Mouse monoclonal 1:200 (IF) Santa Cruz, sc‐20060
CD163 Mouse monoclonal 1:50 (IHC) Santa Cruz, sc‐20066
Calponin Mouse monoclonal 1:400 (WB) Santa Cruz, sc‐58707
CTGF Rabbit polyclonal 1:500 (WB) Santa Cruz, sc‐25440
CXCL12 Mouse monoclonal 1:300 (WB) Santa Cruz, sc‐74271
ERα Rabbit monoclonal 1:1000 (WB) Abcam, ab108398
FAP Rabbit polyclonal 1:500 (WB) Abcam, ab53066
GAPDH Mouse monoclonal 1:1000 (WB) Santa Cruz, sc‐166574
GPR30 Rabbit polyclonal 1:1000 (WB) Abcam, ab154069
1:100 (IHC)
TNC Mouse monoclonal 1:200 (WB) Santa Cruz, sc‐25328

(β‐actin) or human gene glyceraldehyde‐3‐phosphate M1‐type macrophages; or treated with 20 ng/ml IL‐4 and
dehydrogenase (GAPDH). 20 ng/ml IL‐13 for another 72 h to obtain M2‐type mac-
rophages. All of the reagents were purchased from
Sigma.
2.5 | Enzyme‐linked immunosorbent To get CAF‐shCtrl‐M (macrophage induced by CM of
assay (ELISA) CAF‐shCtrl) and CAF‐shGPR30‐M (macrophage induced
by CM of CAF‐shGPR30), M0‐type cells were treated
ELISA analyses of CXCL12 and interleukin‐6 (IL‐6) with 50% CM of CAF‐shCtrl or CAF‐shGPR30 cells for
(BioVision) were carried out in accordance with the in- 6 days and every 2 days the CM was changed. Then
structions of the manufacturers. washed with PBS and continued culturing with normal
cell medium or 2% FBS (serum starved) to get CM.

2.6 | Macrophage differentiation

According to the canonical methods, THP‐1 cells were
treated with 50 ng/ml phorbol 12‐myristate13‐acetate
(PMA; Sigma) to obtain THP‐1‐UaM (M0‐type) macro-
phages. For M1‐ and M2‐type macrophages, PMA was
removed after THP‐1 cells were treated with 50 ng/ml
PMA for 24 h, and then treated with 100 ng/ml
interferon‐γ and 100 ng/ml LPS for another 72 h to obtain
2.7 | Preparation of conditioned
media (CM)
Cells were cultured to sub‐confluence before collec-
tion of the CM. Then the media was changed to RPMI‐
1640 with 2% FBS (serum‐starved) and incubated for
48 h. CM was harvested, clarified, and frozen
at −80°C until use.
6 | ZHANG ET AL.

FIGURE 1 (See caption on next page)

ZHANG ET AL. | 7

2.8 | Flow cytometry
Macrophages induced and differentiated from THP‐1‐UaM
cells through different methods as mentioned above were
collected with a scraper. After blocking with HBSS con-
taining 5% FBS, the cells were incubated with human
fluorophore‐conjugated monoclonal antibodies (BioLegend)
for 30 min according to the manufacturers' instructions (lis-
ted in Table 3). For each sample at least 1 × 104 cells were
analyzed using the BD FACS‐Calibur cytometer (Becton
Dickinson). FlowJoV10 software was used to analyze
the data.
2.9 | Western blot analysis
WPMY‐1 cells derived from the experimental conditions
were lysed in RIPA lysis buffer to extract the total protein.
Protein was quantified using the bicinchoninic acid method.
Equal amounts of protein were separated by sodium dodecyl
sulfate‐polyacrylamide gel electrophoresis and then trans-
ferred onto a polyvinyl difluoride membrane (Millipore). The
membranes were incubated with primary antibodies over-
night at 4 °C (the primary antibodies and dilutions used are
given in Table 4). Proteins were detected by appropriate
secondary antibodies (goat anti‐rabbit or goat anti‐
mouse) conjugated with horseradish peroxidase (Bio‐Rad;
Cat #5178‐2504 or 1706515), followed by enhanced chemi-
luminescence detection (Pierce). The results were quantified
with Image J software and expressed as the mean of
triplicates ± SD.
inhibit cell growth. CMs from macrophages or coculture
systems were added to the bottom chamber. After 24 h in-
cubation at 37°C, the upper Matrigel layers were removed
and the membranes containing the invading cells were fixed
in 4% paraformaldehyde, and then stained with 1% crystal
violet. Cells were counted from five randomly selected fields
per transwell via microscope (×100 fold).
2.11 | Transwell coculture system
For coculture of macrophages and CAF cells, CAF cells were
seeded in the lower chamber while THP‐1‐UaM cells in the
upper insert of a 12‐well Tranwell apparatus (0.4 μm pore
size; BD Biosciences), the ratio of cell numbers is 1:1. After
48 h, both the THP‐1‐UaM cells and CM of the coculture
system were harvested for further biochemical analyses.
2.12 | Statistical analysis
Statistical analysis was performed using Excel and GraphPad
Prism 7.0. Two‐tailed Student's t test, one‐ or two‐way ana-
lysis of variance (ANOVA) was used to analyze the sig-
nificance of the results (ns, no significant difference; *p < .05
and **p < .01, significant). Data were expressed as the
mean ± standard deviation (SD). Pearson's correlation coef-
ficients were used to analyze the correlation.
3 | R ES U L T S

3.1 | GPR30 knockdown in CAF

2.10 | Invasion assay
Eight‐micrometer pore size transwells (BD Biosciences) were
coated with Matrigel (1:3 dilution, 50 μl; BD Biosciences) and
air‐dried overnight. Then, PCa cells were seeded in trans-
wells in a serum‐free medium with 10 ng/ml mitomycin C to
suppressed macrophage infiltration via
downregulating CXCL12 expression
Previous reports indicate that prostate CAFs engage in
malignant crosstalk with macrophages during PCa pro-
gression.25 In this study, we compared the effects of CAF

F I G U R E 1 GPR30 knockdown in CAF reduced the macrophage migration. (A) CAF, NAF, or PC3 cells were cultured in 24‐well plates
for 24 h and then added macrophages in inserted upper transwells (5‐μm pore size) for another 24 h. The macrophages' migration rate
toward CAF versus NAF or PC3 was compared. (B) CAF‐shCtrl or CAF‐shGPR30 cells were cultured in 24‐well plates for 24 h and
macrophages were added in inserted upper transwells (5‐μm pore size) for another 24 h. Macrophages' migration rate toward CAF‐shGPR30
versus CAF‐shCtrl was compared. (C, D) GPR30 knockdown decreased the expression of CXCL12 and IL‐6 in CAF. (C) Gene profiles of
macrophage attraction‐related chemokines/cytokines between CAF‐shGPR30 and CAF‐shCtrl were compared by RT‐PCR. (D) The
production of CXCL12 and IL‐6 from CAF‐shGPR30 and CAF‐shCtrl were detected by ELISA by measuring their concentrations in the CM.
(E, F) GPR30 knockdown in CAFs downregulated CXCL12 expression and consequently decreased macrophage infiltration. (E) CAF‐
shGPR30 and CAF‐shCtrl were cultured in the bottom wells and incubated with CXCL12‐neutralizing antibody (5 μg/ml, R&D Systems) or
recombinant protein (100 ng/ml, R&D Systems). After 24 h, macrophages were added into the inserted upper transwells that also contained
CXCL12‐neutralizing antibody or recombinant protein. IgG was used as control. Images were collected at ×100 magnification. Scale
bar = 200 μm. Quantification is at right. The data within one group (IgG, Anti‐CXCL12 or Add CXCL12 in E) were analyzed by two‐tailed
Student's t test, and the data between different groups were analyzed by ANOVA (A–E). *p < .05; **p < .01; ns, no significant
difference. CAF, cancer‐associated fibroblast; CM, conditioned media; ELISA, enzyme‐linked immunosorbent assay; GPR30, G protein‐
coupled receptor 30; IL‐6, interleukin‐6; NAF, normal‐associated fibroblast; RT‐PCR, reverse‐transcription polymerase chain reaction
8 | ZHANG ET AL.

FIGURE 2 (See caption on next page)

ZHANG ET AL. | 9

cells with NAF cells and PC3 cells on macrophage in-
filtration by transwell migration assay. As shown in
Figure 1A, the CAF and PC3 exhibited an almost
equivalent pro‐infiltrating effect on THP‐1‐UaM (M0‐
type macrophage induced from THP‐1), while no pro‐
infiltrating effect was observed in the NAF group. Similar
results were obtained in the mouse RAW264.7
macrophage.
Lentiviral‐mediated GPR30 gene knockdown was in-
duced in CAF (CAF‐shGPR30) to explore the potential
role of GPR30 in CAF cells on macrophage infiltration
(Figures S1A‐B and S2A‐B). As seen in Figure 1B, CAF‐
shGPR30 significantly inhibited the migration of THP‐1‐
UaM and RAW264.7 macrophages. Similar results were
obtained when THP‐1‐UaM or RAW264.7 were replaced
by mouse primary peritoneal macrophage
(Figure S2A,B). In addition, GPR30 knockdown in Mus‐
CAF (Mus‐CAF‐shGPR30) suppressed the infiltration of
RAW264.7 cells (Figure S3A–C). We also compared the
macrophages recruitment ability of CAF‐shCtrl and
CAF‐shGPR30 with/without 17‐beta‐estradiol (E2)
treatment and found that E2 treatment did not alter the
inhibitory effect of CAF‐shGPR30 on macrophage in-
filtration (Figure S4).
To further elucidate the key regulatory molecular(s)
by which CAF‐shGPR30 suppressed macrophage in-
filtration, the mRNA levels of several macrophage
migration‐related chemokines and cytokines, including
the interleukin (IL) and C‐C motif chemokine ligand
(CCL) genes, were detected using RT‐PCR assays. As
shown in Figure 1C, IL‐6 and CXCL12 were the most
significantly downregulated genes in the CAF‐shGPR30
group compared to those in the CAF‐shCtrl group. The
ELISA results further confirmed that both IL‐6 and
CXCL12 protein levels were lower in the CM from CAF‐
shGPR30 compared to CAF‐shCtrl (Figure 1D).
To further analyze the role of decreased CXCL12 and
IL‐6 expression in CAF‐shGPR30 on macrophage che-
motaxis, recombinant proteins and neutralizing anti-
bodies were used. The results showed that recombinant
CXCL12 protein restored the capacity of CAF‐shGPR30
to recruit macrophages, while recombinant IL‐6 protein
didn't have the function. In addition, treatment with
CXCL12‐neutralizing antibody mimicked the inhibitory
effects of CAF‐shGPR30 on macrophage infiltration. In
contrast, no significant effect was observed upon IL‐6
neutralizing antibody treatment (Figures 1E and S5).
Together, these results suggested that CAF and PC3
cells had equivalent abilities to recruit macrophages.
More importantly, knocking down GPR30 in CAF could
reduce this effect via decreasing CXCL12 expression.
3.2 | GPR30 knockdown in CAFs
inhibited M2 macrophage polarization
Previous research indicates that M2‐type macrophages in
PCa have a positive relationship with extracapsular tumor
extension and biochemical recurrence after radical prosta-
tectomy.30 Moreover, it has been reported that prostate CAFs
can promote monocyte trans‐differentiation toward the
M2‐like macrophage phenotype.25,31,32 Therefore, we ex-
amined the mRNA expression of M2‐ and M1‐like
macrophage‐related markers in THP‐1‐UaM cells after
treatment with CM of CAF‐shCtrl or CAF‐shGPR30 for 48 h.
As shown in Figure 2A, CM‐CAF‐shGPR30 (CM of CAF‐
shGPR30) treatment reduced the expression of M2‐like
markers (Fizz1, AMAC‐1, Arg‐1 and CCL22) and increased
the expression of M1‐like markers (CCL‐5 and IL‐1β) com-
pared to CM‐CAF‐shCtrl (CM of CAF‐shCtrl) treatment. To
further determine the effect of knocking down GPR30 in
CAFs for the long‐term induction of macrophage polariza-
tion, THP‐1‐UaM cells or mouse primary peritoneal macro-
phage were differentiated for 6 days using CM‐CAF‐shCtrl
and CM‐CAF‐shGPR30 cells. Then, flow cytometry assays
were performed to detect the expression levels of molecular
markers on the macrophage surface. As seen in Figure 2B,C,
the percentage of cells expressing CD206 and CD163 (M2
markers) was reduced, whereas the percentage of cells ex-
pressing CD86 (M1 marker) was increased in the CAF‐
shGPR30‐M group compared to those in the CAF‐shCtrl‐M
group. As IL‐10high/IL‐12low and IL‐10low/IL‐12high

F I G U R E 2 GPR30 knockdown in CAF attenuates the activated (M2) macrophage phenotype. (A) CAF‐shGPR30 decreased the
expression of M2‐type markers in the CM treated macrophages. The mRNA expressions of M2‐ and M1‐type markers in THP‐1‐UaM cells
were assayed by RT‐PCR after treated with CM from CAF‐shCtrl or CAF‐shGPR30 at 50% by volume for 48 h. (B) The schematic diagram of
THP‐1‐UaM differentiation induced by CM. Methods of inducing macrophages differentiation and treatments by CM were described in
detail in Section 2. (C) Flow cytometry assays were performed to compare the CD206, CD163, and CD86 expressions in CAF‐shGPR30‐M
versus CAF‐shCtrl‐M. M1‐type (M1) and M2‐type (M2) macrophages were also detected. (D) ELISA assay was performed to compare the
protein levels of IL‐10 and IL‐12 in CM of CAF‐shCtrl‐M versus CAF‐shGPR30‐M. CM from M1‐ and M2‐type macrophages were also
detected. The group treated by unCM as CON. The data between different groups were analyzed by ANOVA (A–D). *p < .05; **p < .01; ns,
no significant difference. ANOVA, analysis of variance; CAF, cancer‐associated fibroblast; CM, conditioned media; CON, control; ELISA,
enzyme‐linked immunosorbent assay; GPR30, G protein‐coupled receptor 30; IL‐10, interleukin‐10; unCM, unconditioned medium
10 | ZHANG ET AL.

F I G U R E 3 GPR30 knockdown in CAF suppressed the M2‐like polarization of mouse primary peritoneal macrophage.
(A) CAF‐shGPR30 reduced the expression of M2‐type markers in the CM‐treated primary peritoneal macrophage. The mRNA expression
levels of M2‐type and M1‐type markers in primary peritoneal macrophage cells were assayed by RT‐PCR after being treated with CM from
CAF‐shCtrl or CAF‐shGPR30 at 50% by volume for 48 h. (B) CD206, CD163, and CD86‐positive macrophage rates were assayed by flow
cytometry after treated with CM‐CAF‐shCtrl or CM‐CAF‐shGPR30. The group treated with an unconditioned medium was used as control.
Quantitative data are shown left. (C) The productions of IL‐10 and IL‐12 in CM of macrophages were pretreated with CM‐CAF‐shCtrl or
CM‐CAF‐shGPR30. The data between different groups were analyzed by ANOVA. *p < .05; **p < .01. ANOVA, analysis of variance;
CAF, cancer‐associated fibroblast; CM, conditioned media; GPR30, G protein‐coupled receptor 30; IL‐10, interleukin‐10; mRNA, messenger
RNA; RT‐PCR, reverse‐transcription polymerase chain reaction

production are regarded as representative characteristics of
M2‐ and M1‐type macrophages, respectively, we measured
the expression of IL‐10 and IL‐12 by ELISA. The results
revealed significantly lower IL‐10 expression levels and
higher IL‐12 expression levels in CM‐CAF‐shGPR30‐M than
in CM‐CAF‐shCtrl‐M (Figure 2D), which indicated an atte-
nuated M2‐like phenotype and an enhanced M1‐like
phenotype.
Consistently, in mouse primary peritoneal mac-
rophage and RAW264.7 cells, the M2‐like markers
(IL‐10, CXCL10, VEGF‐B, CD80, MCP‐1, Fizz1,
MHCII, VEGF‐A, and YM1) were downregulated and
the M1‐like markers (COX‐2, CXCL11, CD86, TNF‐α,
iNOS, and CD11c) were upregulated in the CM‐CAF‐
shGPR30 group compared to CM‐CAF‐shCtrl treat-
ment (Figures 3A and S6A). In addition, similar
ZHANG ET AL. | 11

FIGURE 4 (See caption on next page)

12 | ZHANG ET AL.

results were obtained when using CM of Mus‐CAF‐
shGPR30 (Figure S6B). The percentage of cells with
reduced CD206 and CD163 expression and increased
CD86 expression was presented in the CM‐CAF‐
shGPR30 group compared to CM‐CAF‐shCtrl group
(Figure 3B). Lower IL‐10 expression levels and higher
IL‐12 expression levels were shown in the CM‐CAF‐
shGPR30 group compared to the CM‐CAF‐shCtrl
group (Figure 3C).
These results suggested that GPR30 knockdown in
CAFs effectively inhibited the M2‐like polarization of
macrophages by skewing TAMs polarization from the
M2‐like phenotype toward the M1‐like phenotype.
Furthermore, immunohistochemistry assays were
performed to analyze GPR30 and M2‐type marker
CD163 expression levels in human PCa tissue speci-
mens. Higher CD163 expression was observed in the
stromal regions with high GPR30 expression, and
lower CD163 expression in the regions with relatively
lower GPR30 expression was shown (Figure S7A,B).
These results suggested a correlative relationship be-
tween GPR30 and CD163 expression may exist in the
stroma of human PCa tissue.
3.3 | Macrophage stimulated with CAF‐
shGPR30 exhibited an attenuated effect of
activating fibroblasts to CAF‐like cells
A previous study reveals that M2‐type macrophages can
elicit enhanced stromal fibroblast reactivity.25 To further
investigate the role of abrogating GPR30 in CAFs on
promoting normal fibroblast activation by regulating
TAM polarization in the TME, CM from CAF‐shCtrl‐ or
CAF‐shGPR30‐stimulated macrophages was collected.
After treating the normal human prostate fibroblast cell
line WPMY‐1 using the CM, the mRNA and protein ex-
pression levels of TNC, FAP, CTGF, and SDF‐1 (makers
of activated fibroblasts8,33–35) were determined
(Figure 4A). Interestingly, the expression levels of these
genes were significantly downregulated following treat-
ment with CM of CAF‐shGPR30‐M. Furthermore, the
expression levels of these genes were closer to those
treated with CM‐M1 rather than the CM‐M2 group
(Figure 4B,C).
To detect the characteristic phenotypic changes of
fibroblasts after treatment with CM from macrophages
mentioned above, the expression levels of several SMC
differentiation markers were examined. The results de-
monstrated that the expressions of α‐SMA and calponin
were upregulated in WPMY‐1 cells treated with CM of
CAF‐shGPR30‐M. The expression of CD44, a prostate‐
resident mesenchymal stem cell (MSC) marker,36 was
also downregulated following treatment with CM of
CAF‐shGPR30‐M (Figure 4D,E).
Previous data show that GPR30 promotes prostate
stromal cell activation via the suppression of ERα
expression. 8 Therefore, the expression of GPR30 and
ERα in WPMY‐1 cells treated with CM from macro-
phages was evaluated. The group treated with CM of
CAF‐shGPR30‐M exhibited lower expression of
GPR30 and higher ERα expression. However, the ex-
pression levels of GPR30 and ERα in the CM of CAF‐
shGPR30‐M treated group were closer to those in the
CM‐M1 group rather than the CM‐M2 group. The
expression of the androgen receptor (AR), which is
considered to be protective in the prostate
stroma, 37–39 was also evaluated. The results showed
that AR expression was upregulated when treated
with CM of M2 (Figure 4F, G).
Taken together, the data above indicated that mac-
rophages stimulated with CM of CAFs with GPR30
knockdown had an attenuated effect on inducing normal
stromal cell activation.
3.4 | Macrophages stimulated with
CAF‐shGPR30 were less efficient in
promoting invasion of PCa cells
To further detect the pro‐invasion effect of macrophages
stimulated by CAF‐shGPR30, transwell invasion experi-
ments were performed using PCa epithelial cell lines,
including PC3, DU145 and LNCaP (Figure 5A). The re-
sults showed less number of invaded cells when CM of
CAF‐shGPR30‐M were added to the bottom chamber

F I G U R E 4 CAF‐shGPR30‐stimulated macrophages exhibited an attenuated effect on inducing fibroblast activation. (A) The schematic
diagram of WPMY‐1 stimulated with CM from CAF‐shCtrl‐M and CAF‐shGPR30‐M. (B, D, and F) RT‐PCR and (C, E, and G) Western blot
analysis was performed to compare the expression levels of fibroblasts activation‐related genes in WPMY‐1 cells treated with CM from
CAF‐shGPR30‐M versus CAF‐shCtrl‐M and M1 versus M2. “CM‐M1” refers to “CM from M1‐type macrophage” and “CM‐M2” refers to
“CM from M2‐type macrophage.” The group treated by unCM as CON. The data were analyzed by ANOVA. *p < .05; **p < .01. ANOVA,
analysis of variance; CAF, cancer‐associated fibroblast; CM, conditioned media; CON, control; RT‐PCR, reverse‐transcription polymerase
chain reaction
ZHANG ET AL. | 13

FIGURE 5 (See caption on next page)

14 | ZHANG ET AL.

compared to CAF‐shCtrl‐M. In addition, the invaded
cells number in the group added CM of CAF‐shGPR30‐M
was close to CM of M1 (Figure 5B). The Transwell co-
culture system was also used to examine the effect of
macrophages stimulated with CAF‐shGPR30 on invasion
in PCa cells (PC3 and LNCaP) and showed similar results
(Figure 5C). The above results suggested that CAF‐
shGPR30‐M was less efficient in promoting invasion of
PCa cells.
3.5 | CAF‐shGPR30 and THP‐1‐UaM
coculture suppressed the invasion of PCa
cells compared to CAF‐shCtrl and
THP‐1‐UaM coculture via decreasing IL‐6
secretion from both CAFs and TAMs
to CAF‐shCtrl (Figure S8A–C). These results suggested
that CAF‐shGPR30 had a reduced ability to stimulate
IL‐6 secretion from THP‐1‐UaM cells. When IL‐6 re-
combinant proteins were added, the inhibitory effect of
CM from the THP‐1‐UaM/CAF‐shGPR30 coculture sys-
tem on PC3 cell invasion was restored. Moreover, PC3
cell invasion mediated by CM of the CAF‐shCtrl and
THP‐1‐UaM coculture system was diminished after
adding the IL‐6 neutralizing antibodies (Figure 6D).
Together, these results confirmed that GPR30
knockdown in CAFs decreased IL‐6 secretion from both
CAFs and the neighboring macrophages in the TME,
which could suppress PCa cell invasion.
4 | D I S C US S I O N

Crosstalk between macrophages and CAFs in the tumor
ecological niche can promote cancer cell invasion.25,32 In
this study, CAF or CAF‐shGPR30 were cocultured with
THP‐1‐UaM macrophages in a transwell system for 48 h
and CM of this coculture system was collected to de-
termine the effects on the invasiveness of human PCa
cell lines (PC‐3 and 22RV1). As illustrated, CM of the
CAF‐shGPR30 and THP‐1‐UaM coculture system sup-
pressed PCa cell invasion significantly compared to CM
from coculture of CAF‐shCtrl and THP‐1‐UaM
(Figure 6A).
The metastatic‐related gene profile expression of
macrophages cultured on the upper layer of the coculture
system was analyzed, and the results showed that IL‐6
was the most downregulated gene (Figure 6B). Ad-
ditionally, the IL‐6 protein level was decreased in the CM
of the CAF‐shGPR30 and THP‐1‐UaM coculture system
(Figure 6C). The mRNA and protein levels of IL‐6 in CAF
and macrophages cocultured or separately were detected.
Both CAF‐shGPR30 and its cocultured THP‐1‐UaM
showed downregulated IL‐6 expression levels compared
Carcinomas with abundant stroma show high degrees of
malignancy.4,5 As the major stromal component, CAFs
promote tumor progression involving inflammation and
angiogenesis by recruiting macrophages.40 CAFs affect
the recruitment of TAMs and their acquisition of an
immunosuppressive phenotype (M2) through the pro-
duction of several chemokines.32,41 Yeh et al.42 report
that ERα overexpression in CAFs suppresses macrophage
infiltration, leading to the reduced invasiveness of
neighboring PCa cells. Our previous study has illustrated
the critical role of GPR30 in prostate stromal cell acti-
vation via negatively regulating ERα expression, and also
proves that GPR30 overexpression or ERα knockdown in
stromal cells promoted PCa cell proliferation and mi-
gration. Moreover, normal prostate stromal cell line
WPMY‐1 overexpressing GPR30 exhibits CAF‐like char-
acteristics, with upregulation of FAP, CD44, and smooth
muscle myosin heavy chain (SMemb) and down-
regulation of α‐SMA, SM22α, calponin, and MYH11.8
The data presented here demonstrate that down-
regulation of GPR30 in CAF suppressed macrophage

F I G U R E 5 Macrophages stimulated with CAF‐shGPR30 were less efficient in promoting invasion of PCa cells. (A) The schematic
diagram of the method for the experiment. (B) Transwell invasion assay was performed to detect the effect of CM obtained from
CAF‐shGPR30‐M versus CAF‐shCtrl‐M and M1 versus M2 on promoting the invasion in PCa cells (LNCaP, DU145, and PC3), unCM
as CON. CM was placed into the lower chamber of the 24‐well plates and PCa cells were seeded into inserted transwell pre‐coated with
Matrigel, in serum‐free medium with 10 ng/ml mitomycin C to inhibit cell growth. After 24 h incubation, the transwell inserts were fixed
and stained before light microscopy visualization and cell number counting. Scale bar = 200 μm. (C) For coculture of macrophages and CAF
cells, macrophages stimulated with CAF‐shGPR30 or CAF‐shCtrl were seeded in the lower chamber, while PCa cells were seeded into
inserted transwell pre‐coated with Matrigel, in serum‐free medium with 10 ng/ml mitomycin C to inhibit cell growth. After 24 h incubation,
the transwell inserts were fixed and stained before light microscopy visualization and cell number counting. Scale bar = 100 μm.
Quantification was shown in the lower panel. The data within one group (C) were analyzed by a two‐tailed Student's t test, and the data
between different groups were analyzed by ANOVA (B). *p < .05; **p < .01. “CAF‐shCtrl‐M” refers to “macrophages stimulated with
CM‐CAF‐shCtrl”; “CAF‐shGPR30‐M” refers to “macrophages stimulated with CM‐CAF‐shGPR30.” ANOVA, analysis of variance;
CAF, cancer‐associated fibroblast; CM, conditioned media; CON, control; PCa, prostate cancer; unCM, unconditioned medium
ZHANG ET AL. | 15

FIGURE 6 (See caption on next page)

16 | ZHANG ET AL.

infiltration and differentiation toward M2 macrophages
and illustrate its interaction with the macrophage sub-
sequently leading to the reduction of PCa cell invasive-
ness. Our work has enhanced the understanding of the
vital role of GPR30 in inflammation‐mediated PCa
progression.
Numerous studies have demonstrated that CAFs can
recruit immune cells into tumor areas via regulating the
expression of CXCL12,25 IL‐6,32 CCL2,15 and NF‐κB.40 It
has been reported that CXCL12 secretion from prostate
CAFs induces monocyte recruitment toward tumor cells
and M2 phenotype differentiation.25 In this study, we
found that knocking down GPR30 inhibited CXCL12
expression in prostate CAFs. Moreover, the capacity of
CAF‐shGPR30 to recruit macrophages was partially re-
stored after adding recombinant CXCL12 protein. Ad-
ditionally, incubating CAFs with CXCL12‐neutralizing
antibody could mimic the inhibitory effect of
CAF‐shGPR30 on macrophage infiltration. These results
verified that knocking down GPR30 in prostate CAFs
suppressed macrophage infiltration via downregulating
CXCL12 expression.
IL‐6 is a well‐known pro‐inflammatory cytokine in
numerous cancer types.43 Previous articles have reported
the synergistic effect of CAF and TAM on promoting
prostate carcinoma progression.3,24,25 Cho et al.32 re-
cently reported that CAFs induce monocyte M2‐like
phenotype differentiation, infiltration, and metastasis via
releasing IL‐6 and GM‐CSF in colon carcinoma mouse
models. It has been proven that GPR30 knockdown in
CAFs eliminates IL‐6 expression and suppresses breast
cancer cell invasion.44,45 Yeh et al.42 report that CAF ERα
suppresses PCa cell invasion partly through reducing
IL‐6 expression in both TAMs and CAFs. Here, we found
the protein levels of IL‐6 secreted from each cell type
(THP‐1‐UaM and CAFs) in coculture conditions were
higher than monoculture (Figure S8C), which indicated
there existed the synergistic effect of the two cells on
increasing IL‐6 secretion. This GPR30‐independent me-
chanism in the synergy of IL‐6 secretion was presumed to
be attributed to the enrichment in reactive CAFs and
macrophages and the complex interaction between them
may establish a suitable microenvironment for the se-
cretion of IL‐6. The detailed mechanism still needs fur-
ther exploration. However, as IL‐6 expression from each
cell type was significantly downregulated after CAF‐
shGPR30 and THP‐1‐UaM cocultured (Figure S8C),
knocking down GPR30 in CAF partially inhibited this
synergistic function (Figure 6C). These results provided
new insights into the molecular mechanism of CAFs and
TAMs synergistically regulating tumor progression.
Furthermore, adding recombinant IL‐6 protein to CM
of CAF‐shGPR30/THP‐1‐UaM restored PCa cell inva-
siveness. Consistently, PCa cell invasiveness was dimin-
ished after addition of the IL‐6 neutralizing antibody to
the CM of the CAF/THP‐1‐UaM coculture systems.
These results suggested decreased IL‐6 expression in the
coculture system leading to the inhibition of PCa cell
invasion. However, unlike CXCL12, IL‐6‐neutralizing
antibody had no significant effect on macrophage in-
filtration induced by CAFs. Therefore, we speculated that
knocking down GPR30 in CAFs could suppress PCa cell
invasion by decreasing the expression of IL‐6 in the co-
culture system, and this effect was unrelated to the re-
duction of macrophage infiltration.
CAFs has been widely known to promote macro-
phage infiltration and differentiation toward M2
macrophages. Notably, previous research reports that
M2‐polarized macrophages can provide an im-
munosuppressive microenvironment by converting nor-
mal fibroblast cells into CAFs, and the reciprocal
interaction between CAFs and M2 macrophages can

F I G U R E 6 CM of the CAF‐shGPR30 and THP‐1‐UaM coculture system suppressed the invasion of PCa cells compared to CM of the
CAF‐shCtrl and THP‐1‐UaM coculture. (A) The schematic diagram in the right panel displays the coculture and invasion transwell system.
CM was collected from 48 h monocultured or cocultured CAF‐shCtrl, CAF‐shGPR30, and THP‐1‐UaM. CM was added to 24‐well plates and
the PCa cells (PC3 and 22RV1) were seeded into inserted transwells pre‐coated with matrigel. After 24 h incubation, invaded PCa cells were
counted and compared. Quantification was shown in the below panel. (B) The mRNA expression levels of metastatic‐related genes (IL‐6,
Wnt5α, TGF‐β1, TGF‐β2, and TGF‐β3) in macrophages (THP‐1‐UaM) cocultured with CAF‐shGPR30 or CAF‐shCtrl were compared by RT‐
PCR. (C) The productions of IL‐6 in CM from cocultured THP‐UaM and CAF‐shCtrl versus CAF‐shGPR30 were detected by ELISA assay,
each cell line cultured alone as control. (D) For the invasion assay, IL‐6 neutralizing antibody or recombinant protein or IgG was added into
the CM collected from the coculture system, and PC3 cells were seeded into inserted transwells pre‐coated with matrigel. Scale
bar = 200 μm. Quantification was shown in the right panel. Images were taken at ×100 magnification. The data within one group (A‐B, D)
were analyzed by two‐tailed Student's t test, and the data between different groups were analyzed by ANOVA. *p < .05; **p < .01. ns, no
significant difference. “THP‐1‐UaM/CAF‐shCtrl” refers to “cocultured THP‐1‐UaM and CAF‐shCtrl”; “THP‐1‐UaM/CAF‐shGPR30” refers
to “cocultured THP‐1‐UaM and CAF‐shGPR30.” ANOVA, analysis of variance; CAF, cancer‐associated fibroblast; CM, conditioned media;
ELISA, enzyme‐linked immunosorbent assay; IgG, immunoglobulin G; IL‐6, interleukin‐6; mRNA, messenger RNA; PCa, prostate cancer;
RT‐PCR, reverse‐transcription polymerase chain reaction; TGF‐β, transforming growth factor‐β
ZHANG ET AL.
promote tumor progression.25 We proved that macro-
phages stimulated with CAF‐shGPR30 had an attenuat-
ing effect on the promotion of normal fibroblast cell
transition toward a CAF‐like phenotype, as evidenced by
their decreased expression of TNC, FAP, CTGF, SDF‐1,
CD44, and GPR30 but increased expression of calponin
(the marker of SM differentiation) and α‐SMA. As re-
ported, α‐SMA expression correlates with the activation
of myofibroblasts, which is a form of fibroblast cells that
have partially differentiated into a smooth muscle phe-
notype. The differentiation between fibroblasts and
myofibroblasts represents a key event during healing and
tissue repair.46,47 Whether the CM of M1 and M2 (as well
as the CAF‐shGPR30‐M and CAF‐shCtrl‐M) affects the
differentiation of the normal fibroblast cell into secretory
and mesenchymal subtypes, respectively, needs further
exploration. These results indicated that knocking down
GPR30 in CAFs inhibited the M2 polarization of TAMs
and subsequently attenuated the activation of normal
stromal cells induced by TAMs, finally leading to the
inhibition of PCa cell invasion.
As GPR30 could mediate rapid non‐genomic es-
trogenic signaling as a receptor, its selective agonists
have been widely found recently. Estrone and E2 have
been described to bind to GPR30 as the agonists to
induce the activation of signaling pathways. G‐1, the
selective agonist of GPR30, was reported to stimulate
the proliferation of tissues in culture. Other agonists
for GPR30 include therapeutic agents such as ta-
moxifen, raloxifene, fulvestrant, diethylstilbestrol,
ethynylestradiol, and xenoestrogens.48 The ligand in
the current study may be the estrogen existing in the
serum when cultured with CAF cells, and the ob-
served various effects induced by GPR30 knockdown
in vitro may be caused by the failure of ligand estro-
gen to bind to the receptor. Additionally, these phe-
nomena may also be attributed to the direct
downregulation of the GPR30 receptor, as it was also
found to be implicated in transcriptional regulation.
The participation of the specific ligand in meditating
the phenomena above needs to be further studied.
The GPR30‐specific agonist (G‐1) can inhibit PCa
cell proliferation. 49 In G‐1‐treated LNCaP xenograft
castration‐resistant tumor models, upregulation of
inflammation‐mediated cytokines and neutrophil‐
related chemokines led to neutrophil infiltration‐
associated necrosis. 13 Although there are some re-
ports indicating a possible antitumor role of GPR30,
there also exist several research studies presenting
complete opposite results. Therefore, it's difficult to
propose a specific conclusion for GPR30 and addi-
tional thorough research in this field is still urgently
needed. 48,50 Our previous study demonstrated that
| 17
GPR30 overexpression in CAF cells could promote
proliferation and migration of PCa cells.8 Con-
sistently, the current study further emphasized that
GPR30 knockdown in CAFs suppressed the infiltra-
tion and M2 polarization of TAMs, contributing to the
inhibition of PCa cell invasion. Considering the op-
posing effect of GPR30 in stromal and epithelial on
PCa progression indicated by the aforementioned
studies, the possible clinical significance of GPR30
agonist treatment needs to be further explored.
AC KNOW LEDGM ENTS
We thank Wiley Editing Services (http://wileyediting
services.com) for its linguistic assistance during the
preparation of this manuscript. This study was sup-
ported by grants from the National Natural Science
Foundation of China (NO. 81672527 and NO.
81872087 to J Zhang).
A U T H O R C O N TR I B U T I O N S
Ran Zhang, Jiaojiao Zong, and Yanfei Peng participated in
the cell culture, RT‐PCR, WB and Transwell expreiments.
Ran Zhang and Jiaojiao Zong were responsible for data
collection, analysis and designed the experiments. Xiaoling
Du and Haitao Liu performed IHC. Yongmei Shen and
Jiasong Cao performed and analyzed FASC. Bona Jia and
Feng Liu optimized and generated WB and ELISA data.
Yongmei Shen, Jiasong Cao, and Jiaojiao Zong participated
in data analysis. Yanfei Peng and Feng Liu participated in
data analysis and manuscript writing and editing. Ju Zhang
and Jiandang Shi conceived of the research strategy, secured
financing of the study, participated in experimental design,
data analysis, figure preparation and writing and editing of
the manuscript. All authors read and approved the final
manuscript.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are
available from the corresponding author upon reasonable
request.
ORC ID
Ran Zhang http://orcid.org/0000-0002-5036-7121
REFER ENCES
1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA
Cancer J Clin. 2018;68:7‐30.
2. Ziani L, Chouaib S, Thiery J. Alteration of the antitumor im-
mune response by cancer‐associated fibroblasts. Front
Immunol. 2018;9:414.
3. Chiarugi P. Cancer‐associated fibroblasts and macrophages:
friendly conspirators for malignancy. Oncoimmunology. 2013;
2:e25563.
18 | ZHANG
4. Ayala G, Tuxhorn JA, Wheeler TM, et al. Reactive stroma as a
predictor of biochemical‐free recurrence in prostate cancer.
Clin Cancer Res. 2003;9:4792‐4801.
5. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer.
2006;6:392‐401.
6. Kuzet SE, Gaggioli C. Fibroblast activation in cancer: when
seed fertilizes soil. Cell Tissue Res. 2016;365:607‐619.
7. Barton M, Filardo EJ, Lolait SJ, Thomas P, Maggiolini M,
Prossnitz ER. Twenty years of the G protein‐coupled estrogen
receptor GPER: historical and personal perspectives. J Steroid
Biochem Mol Biol. 2018;176:4‐15.
8. Jia B, Gao Y, Li M, et al. GPR30 promotes prostate stromal cell
activation via suppression of ERalpha expression and its
downstream signaling pathway. Endocrinology. 2016;157:
3023‐3035.
9. Li F, Yu X, Szynkarski CK, et al. Activation of GPER induces
differentiation and inhibition of coronary artery smooth
muscle cell proliferation. PLOS One. 2013;8:e64771.
10. Zhang Z, Wang L, Mei M, et al. Both nongenomic and geno-
mic effects are involved in estradiol's enhancing the pheno-
type of smooth muscle cells in cultured prostate stromal cells.
Prostate. 2010;70:317‐332.
11. De Francesco EM, Sims AH, Maggiolini M, Sotgia F, Lisanti MP,
Clarke RB. GPER mediates the angiocrine actions induced by
IGF1 through the HIF‐1alpha/VEGF pathway in the breast tumor
microenvironment. Breast Cancer Res. 2017;19:129.
12. Madeo A, Maggiolini M. Nuclear alternate estrogen receptor
GPR30 mediates 17beta‐estradiol‐induced gene expression
and migration in breast cancer‐associated fibroblasts. Cancer
Res. 2010;70:6036‐6046.
13. Lam HM, Ouyang B, Chen J, et al. Targeting GPR30 with G‐1:
a new therapeutic target for castration‐resistant prostate can-
cer. Endocr Relat Cancer. 2014;21:903‐914.
14. Bingle L, Brown NJ, Lewis CE. The role of tumour‐associated
macrophages in tumour progression: implications for new
anticancer therapies. J Pathol. 2002;196:254‐265.
15. Mantovani A, Marchesi F, Malesci ALaghi L.Allavena P. Tu-
mour‐associated macrophages as treatment targets in oncol-
ogy. Nat Rev Clin Oncol. 2017;14:399‐416.
16. Silzle T, Kreutz M, Dobler MA, Brockhoff G, Knuechel R,
Kunz‐Schughart LA. Tumor‐associated fibroblasts recruit
blood monocytes into tumor tissue. Eur J Immunol. 2003;33:
1311‐1320.
17. Murray PJ, Wynn TA. Protective and pathogenic functions of
macrophage subsets. Nat Rev Immunol. 2011;11:723‐737.
18. Lewis CE, Pollard JW. Distinct role of macrophages in dif-
ferent tumor microenvironments. Cancer Res. 2006;66:
605‐612.
19. De Marzo AM, Platz EA, Sutcliffe S, et al. Inflammation in
prostate carcinogenesis. Nat Rev Cancer. 2007;7:256‐269.
20. Lucia MS, Torkko KC. Inflammation as a target for prostate
cancer chemoprevention: pathological and laboratory ratio-
nale. J Urol. 2004;171:S30‐S35.
21. Erlandsson A, Carlsson J, Lundholm M, et al. M2 macro-
phages and regulatory T cells in lethal prostate cancer.
Prostate. 2019;79:363‐369.
22. Ruffell B, Affara NI, Coussens LM. Differential macrophage
programming in the tumor microenvironment. Trends
Immunol. 2012;33:119‐126.
ET AL.
23. Sfanos KS, Yegnasubramanian S, Nelson WG, De, Marzo AM.
The inflammatory microenvironment and microbiome in
prostate cancer development. Nat Rev Urol. 2018;15:11‐24.
24. Komohara Y, Takeya M. CAFs and TAMs: maestros of the
tumour microenvironment. J Pathol. 2017;241:313‐315.
25. Comito G, Giannoni E, Segura CP, et al. Cancer‐associated
fibroblasts and M2‐polarized macrophages synergize during
prostate carcinoma progression. Oncogene. 2014;33:2423‐2431.
26. Solinas G, Germano G, Mantovani A, Allavena P. Tumor‐
associated macrophages (TAM) as major players of the cancer‐
related inflammation. J Leukoc Biol. 2009;86:1065‐1073.
27. Madar S, Brosh R, Buganim Y, et al. Modulated expression of
WFDC1 during carcinogenesis and cellular senescence.
Carcinogenesis. 2009;30:20‐27.
28. Slavin S, Yeh CR, Da J, et al. Estrogen receptor alpha in
cancer‐associated fibroblasts suppresses prostate cancer inva-
sion via modulation of thrombospondin 2 and matrix me-
talloproteinase 3. Carcinogenesis. 2014;35:1301‐1309.
29. Wikström P, Lindahl C, Bergh A. Characterization of the au-
tochthonous transgenic adenocarcinoma of the mouse pros-
tate (TRAMP) as a model to study effects of castration therapy.
Prostate. 2005;62:148‐164.
30. Lanciotti M, Masieri L, Raspollini MR, et al. The role of M1
and M2 macrophages in prostate cancer in relation to extra-
capsular tumor extension and biochemical recurrence after
radical prostatectomy. BioMed Res Int. 2014;2014:486798‐6.
31. Kalluri R. The biology and function of fibroblasts in cancer.
Nat Rev Cancer. 2016;16:582‐598.
32. Cho H, Seo Y, Loke KM, et al. Cancer‐stimulated CAFs enhance
monocyte differentiation and protumoral TAM activation via IL6
and GM‐CSF secretion. Clin Cancer Res. 2018;24:5407‐5421.
33. Cooper CR, Chay CH, Gendernalik JD, et al. Stromal factors
involved in prostate carcinoma metastasis to bone. Cancer.
2003;97:739‐747.
34. Tuxhorn JA, Ayala GE, Smith MJ, Smith VC, Dang TD,
Rowley DR. Reactive stroma in human prostate cancer: in-
duction of myofibroblast phenotype and extracellular matrix
remodeling. Clin Cancer Res. 2002;8(9):2912‐2923.
35. Yang F, Tuxhorn JA, Ressler SJ, McAlhany SJ, Dang TD,
Rowley DR. Stromal expression of connective tissue growth
factor promotes angiogenesis and prostate cancer tumorigen-
esis. Cancer Res. 2005;65:8887‐8895.
36. Kim W, Barron DA, San Martin R, et al. RUNX1 is essential for
mesenchymal stem cell proliferation and myofibroblast differ-
entiation. Proc Natl Acad Sci USA. 2014;111:16389‐16394.
37. Henshall SM, Quinn DI, Lee CS, et al. Altered expression of
androgen receptor in the malignant epithelium and adjacent
stroma is associated with early relapse in prostate cancer.
Cancer Res. 2001;61:423‐427.
38. Li Y, Li CX, Ye H, et al. Decrease in stromal androgen receptor
associates with androgen‐independent disease and promotes
prostate cancer cell proliferation and invasion. J Cell Mol Med.
2008;12:2790‐2798.
39. Wikström P, Marusic J, Stattin P, Bergh A. Low stroma an-
drogen receptor level in normal and tumor prostate tissue is
related to poor outcome in prostate cancer patients. Prostate.
2009;69:799‐809.
40. Erez N, Truitt M, Olson P, Arron ST, Hanahan D. Cancer‐
associated fibroblasts are activated in incipient neoplasia to
ZHANG ET AL.
orchestrate tumor‐promoting inflammation in an NF‐kappaB‐
dependent manner. Cancer Cell. 2010;17:135‐147.
41. Sica A, Schioppa T, Mantovani A, Allavena P. Tumour‐
associated macrophages are a distinct M2 polarised population
promoting tumour progression: potential targets of anti‐cancer
therapy. Eur J Cancer. 2006;42:717‐727.
42. Yeh CR, Slavin S, Da J, et al. Estrogen receptor alpha in cancer
associated fibroblasts suppresses prostate cancer invasion via
reducing CCL5, IL6 and macrophage infiltration in the tumor
microenvironment. Mol Cancer. 2016;15:7.
43. Guo Y, Xu F, Lu T, Duan Z, Zhang Z. Interleukin‐6 signaling
pathway in targeted therapy for cancer. Cancer Treat Rev.
2012;38:904‐910.
44. De Francesco EM, Lappano R, Santolla MF, Marsico S, Caruso A,
Maggiolini M. HIF‐1alpha/GPER signaling mediates the expres-
sion of VEGF induced by hypoxia in breast cancer associated
fibroblasts (CAFs). Breast Cancer Res. 2013;15:R64.
45. Ren J, Guo H, Wu H, et al. GPER in CAFs regulates hypoxia‐
driven breast cancer invasion in a CTGF‐dependent manner.
Oncol Rep. 2015;33:1929‐1937.
46. Sugimoto H, Mundel TM, Kieran MW, Kalluri R. Identifica-
tion of fibroblast heterogeneity in the tumor microenviron-
ment. Cancer Biol Ther. 2006;5:1640‐1646.
47. Cherng S, Young J, Ma H. Alpha‐smooth muscle actin (α‐
SMA). J Am Sci. 2008;4:7‐9.
48. Hernández‐Silva CD, Villegas‐Pineda JC, Pereira‐Suárez AL.
Expression and role of the G protein‐coupled estrogen
| 19
receptor (GPR30/GPER) in the development and immune
response in female reproductive cancers. Front Endocrinol.
2020;20(11):544.
49. Chan QKY, Lam HM, Ng CF, et al. Activation of GPR30 inhibits
the growth of prostate cancer cells through sustained activation of
Erk1/2, c‐jun/c‐fos‐dependent upregulation of p21, and induction
of G(2) cell‐cycle arrest. Cell Death Differ. 2010;17:1511‐1523.
50. Bonkhoff H. Estrogen receptor signaling in prostate cancer: Im-
plications for carcinogenesis and tumor progression. Prostate.
2018;78:2‐10.
SU PPOR T ING INF OR MATI ON
Additional Supporting Information may be found online
in the supporting information tab for this article.
How to cite this article: Zhang R, Zong J, Peng
Y, et al. GPR30 knockdown weakens the capacity
of CAF in promoting prostate cancer cell invasion
via reducing macrophage infiltration and M2
polarization. J Cell Biochem. 2021;1‐19.
https://doi.org/10.1002/jcb.29938