1938 Electrophoresis 2014, 35, 1938–1946

Tom Killelea1,2,3 Research Article

Christine Saint-Pierre4
Céline Ralec1,2,3
Didier Gasparutto4
Ghislaine Henneke1,2,3
1 IFREMER, Laboratoire de
Microbiologie des
Environnements Extrêmes,
UMR 6197, Plouzané, France
2 Laboratoire de Microbiologie
des Environnements Extrêmes,
Université de Bretagne
Occidentale, UMR 6197,
Plouzané, France
3 CNRS, Laboratoire de
Microbiologie des
Environnements Extrêmes,
UMR 6197, Plouzané, France
4 Laboratoire Lésions des Acides
Nucléiques, Service de Chimie
Inorganique et Biologique,
Unité Mixte de Recherche E3,
Commissariat à l’Energie
Atomique et aux Energies
Alternatives–Université Joseph
Fourier, Institut Nanosciences et
Cryogénie, Grenoble, France
Received January 15, 2014
Revised March 13, 2014
Accepted March 13, 2014
Anomalous electrophoretic migration of
short oligodeoxynucleotides labelled with
5 -terminal Cy5 dyes
By using a fluorescent exonuclease assay, we reported unusual electrophoretic mobility of
5 -indocarbo-cyanine 5 (5 -Cy5) labelled DNA fragments in denaturing polyacrylamide gels.
Incubation time and enzyme concentration were two parameters involved in the formation
of 5 -Cy5-labelled degradation products, while the structure of the substrate was slightly
interfering. Replacement of positively charged 5 -Cy5-labelled DNA oligonucleotides (DNA
oligos) by electrically neutral 5 -carboxyfluorescein (5 -FAM) labelled DNA oligos abolished
the anomalous migration pattern of degradation products. MS analysis demonstrated that
anomalously migrating products were in fact 5 -labelled DNA fragments ranging from 1
to 8 nucleotides. Longer 5 -Cy5-labelled DNA fragments migrated at the expected position.
Altogether, these data highlighted, for the first time, the influence of the mass/charge
ratio of 5 -Cy5-labelled DNA oligos on their electrophoretic mobility. Although obtained by
performing 3 to 5 exonuclease assays with the family B DNA polymerase from Pyrococcus
abyssi, these observations represent a major concern in DNA technology involving most
DNA degrading enzymes.
Keywords:
Cyanine 5 dye / DNA polymerase assays / DNA probes / Exonuclease assays
/ Fluorescent-labelled oligodeoxynucleotides / Polyacrylamide–urea gel elec-
trophoresis
DOI 10.1002/elps.201400018

 Additional supporting information may be found in the online version of this

article at the publisher’s web-site

1 Introduction ical methods as recently reviewed [20]. Enzymatic methods,

Over four decades, major advances in the chemical synthesis
of DNA oligonucleotides (DNA oligos) [1–5] have expanded
their role in multiple areas of science and technology. Syn-
thetic DNA oligos are routine laboratory reagents used in a
wide variety of techniques [6–17].
Although label-free methods have been developed [18],
a plethora of molecular approaches utilise labelled DNA oli-
gos [19, 20]. Common labels are radioactive nuclei, haptens,
biotins, fluorophores and enzymes. Techniques for the con-
jugation of such labels mostly rely on enzymatic and chem-
Correspondence: Dr. Ghislaine Henneke, IFREMER, Laboratoire
de Microbiologie des Environnements Extrêmes, UMR 6197, ZI
de la pointe du diable CS 10070, 29280 Plouzané, France
E-mail: Ghislaine.Henneke@ifremer.fr
Fax: +33298224757
Abbreviations: 5 -Cy5, 5 -indocarbo-cyanine 5; DNA oligo,
DNA oligonucleotide; 5 -6-FAM, 5 -6-carboxyfluorescein; nt,
nucleotides; SB, stop buffer
including nick translation and 3 -end modification by ter-
minal transferase, are currently employed to label synthetic
DNA oligos with radioactive nuclei via radioactive deoxyri-
bonucleotide triphosphates (3 H, 125 I and 14 C). Radioactive
labelling at the 5 -end is carried out by phosphorylation using
␥ 32 P-ATP and T4 polynucleotide kinase [21]. These radioac-
tive nuclei are highly sensitive and generally do not cause
steric hindrance due to limited size footprint. However, radio-
labelling has several disadvantages such as hazards in manip-
ulation, short-half lives of some nuclei and time-consuming
autoradiography for in-gel detection and expense.
While these methodologies have been successful, cur-
rent trends in molecular approaches aim at replacing ra-
dioactivity by fluorescent DNA oligos [22] because of safety
and environmental concerns. In addition, DNA oligos la-
belled with radioactive phosphates are produced on a very
small scale precluding high-throughput applications. As a re-
sult, fluorescent-labelled DNA oligos have become increas-
ingly popular in many procedures, including sequencing
[23, 24], PCR and real-time PCR [25–27], diagnostics [28, 29],
forensics [30], as well as a wide variety of biochemistry


C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA. www.electrophoresis-journal.com
This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and
distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
Electrophoresis 2014, 35, 1938–1946 Nucleic Acids 1939

Table 1. Spectroscopic and physicochemical properties of fluorescent dyes

Fluorophore Formula (dye and linker) Molecular Net charge Excitation max Emission E lambda max
weight (Da) (nm) max (nm) (L/mol·cm)

Fluorescein C68 H79 N4 O12 PSf) 1207.5 0 494 521 75 000

6-FAMa) C46 H58 N3 O10 Pf) 843.95 0 495 521 75 000
HEXb) C46 H52 N3 O10 Cl6 Pf) 1050.62 0 537 556 96 000
Cy3c) C58 H70 N4 O4 PClf) 953.64 1 547 563 136 000
Cy5d) C60 H72 N4 O4 PClf) 979.68 1 646 662 250 000
ROXe) C37 H33 N3 O7 g) 631.67 0 576 601 82 000
Alexa 488 C39 H44 F4 N4 O11 S2 g) 884.91 0 490 520 73 000

a) 6-carboxyfluorescein.
b) Hexachloro-fluorescein.
c) Indocarbo-cyanine 3.
d) Indocarbo-cyanine 5.
e) Carboxy-X-rhodamine.
f) Phosphoramidite.
g) N-hydroxysuccinimide.

and molecular biology studies [31–33]. Rapid progress in
developing the attachment of non-radioactive labels to DNA
oligos, for instance fluorescent-dyes, was concurrent with
major improvements in the chemical synthesis of DNA oli-
gos [34, 35]. A broad range of fluorophores can be attached
to DNA oligos, with labelling carried out during or at the
final stage of the synthesis of DNA oligos [35, 36], allowing
the introduction of single or multiple fluorescent dye attach-
ments at the 5 - or 3 -ends of DNA oligos as well as within the
sequence. To properly select dyes for a given application, it
is important to consider not only their spectroscopic charac-
teristics (fluorescence excitation/emission spectra, extinction
coefficient, fluorescence quantum yield, quenching and
photobleaching) but also their physicochemical proper-
ties (molecular weight and charge). Fluorescent dyes used
in DNA oligo technologies are particularly large organic
molecules that are only water soluble with ionic functional
groups (e.g. SO3 − and COO− ). Fluorescein and its deriva-
tives (6-carboxyfluorescein, hexachloro-fluorescein, carboxy-
X-rhodamine and carboxy-tetrachloro-fluorescein) are the
most commonly used fluorescent dyes for labelling DNA
oligos. However, their susceptibility to photobleaching, the
absence of fluorescence at low pH and their broad emis-
sion spectra have favoured the development of novel fluores-
cent dyes. Cyanines dyes (Cy dyes) [37], BODIPY dyes [38],
Alexa dyes [39] and ATTO dyes [40] are versatile groups of
fluorescent dyes with greater sensitivity, stability and lower
background interferences. Table 1 lists the spectroscopic and
physicochemical features of these fluorescent dyes.
Although the use of fluorescence has overtaken radioac-
tivity in many experimental strategies, its utilization is not
straightforward and often requires adapted protocols [41, 42].
Similarly, the position of bulky fluorescent dyes at the ends
of DNA oligos is dependent on the enzymatic assay to be
performed. For instance, a 5 -fluorescent dye labelled primer
annealed to a template is preferentially used for measuring
DNA synthesis [32,43], although 3 -end labelling is not totally
excluded [35]. Similarly, major concerns exist about the de-
tection of fluorescent end-labelled DNA oligos in gel-based
assays. Several studies have shown that the structure of the
fluorescent dye may impact on the electrophoretic mobility
of DNA oligos [44–46].
In this study, we analysed the unusual pattern mobility
of DNA fragments produced by exonuclease activity. Family
B DNA polymerase from Pyrococcus abyssi (PabPolB) is the
enzyme representative of these exonuclease assays. PabPolB
consists of two functional domains, the DNA polymerase
(palm, finger and thumb) and the 3 –5 exonuclease do-
mains [47]. Both domains confer the high accuracy and ro-
bustness of the enzyme in PCR [48]. Although not well stud-
ied, we sought to examine the 3 –5 exonuclease activity of
PabPolB using DNA oligos labelled at the 5 -end with fluo-
rescent dyes. We show that 5 -indocarbo-cyanine 5 (5 -Cy5)
labelled degradation products, ranging from one to eight
nucleotides (nt) in length, have altered electrophoretic mo-
bility in denaturing polyacrylamide gels. Their occurrence
is dependent on the incubation time and the enzyme con-
centration, but not upon the structure of the substrate. This
anomalous migration is abolished when the electrically neu-
tral 5 -6-carboxyfluorescein (5 -6-FAM) labelled DNA oligos
are used. Altogether, these results highlight the influence of
size/charge of 5 -Cy5 dye labelled DNA oligos on their elec-
trophoretic mobility.
2 Materials and methods
2.1 Polymerase production and purification
Wild-type P. abyssi family B DNA polymerase was overex-
pressed and purified as described previously [49]. Oligonu-
cleotide substrates: Oligonucleotides were purchased from
Eurogentec (Seraing, Belgium) and are listed in Tables 2 and
3, respectively. Oligonucleotide purification was carried out
by RP-HPLC with the exception of 5 -Cy5/5 -6-FAM 87 mark-
ers, which were purified by PAGE.


C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA. www.electrophoresis-journal.com
1940 T. Killelea et al. Electrophoresis 2014, 35, 1938–1946

Table 2. Oligonucleotide sequence or the substrates used in this study and the 5 modification present

Substrate 5 Dye Sequence (5 –3 )

2 p(dT)a) Cy5 TT
4 p(dT) Cy5 TTTT
6 p(dT) Cy5 TTTTTT
8 nt Cy5 CGATCACG
17 nt Cy5 TGCCAAGCTTGCATGCC
34 tp – GGATCCTGCGACCTGCAGGCATGCAAGCTTGGCA
34 p(dT) Cy5/6-FAM TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
87 tp – CAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCA
51 nt ATTO647N TGATGGACCTGCTGGCCCTTTTTTTTTTTTTTTCCCGGTCGTCCAGGTAGA

a) p(dT) are dT polymers with varying lengths.

Table 3. Oligonucleotide size markers

Substrate 5 Dye Sequence (5 –3 )

dCTP Cy5 dCTP

8 – T T T Ta) T T T
17 Cy5/6-FAM TGCCAAGCTTGCATGCC
34 Cy5/6-FAM TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
87 Cy5/6-FAM CAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCA

a) T labelled with Cy5.

2.2 Exonuclease activity assay
Oligonucleotide substrates (single stranded and primer-
template) at a final concentration of 20 nM were pre-incubated
for 10 min at 55°C in reaction buffer (RB): 20 mM HEPES
pH 7.0, 10 mM KCl, 2 mM MnCl2 and 0.1 mg/mL BSA. The
reactions were initiated by the addition of the polymerase and
were carried out at 55°C. For time course experiments, the
polymerase was added at a final concentration of 0.2 ␮M,
with 20 ␮L aliquots of reaction mix being removed at each
time point. Comparative analysis of exonuclease activity was
conducted with 0.1 units of the following enzymes: Isis DNA
polymerase (MP Biomedicals), KOD HiFi (Novagen), T4 DNA
polymerase (NEB), Klenow fragment (Sigma-Aldrich), Taq
DNA polymerase (MP Biomedicals) and exonuclease VII
(USB Biochemicals). Reaction were carried out at 37°C for
mesophilic (T4 DNA pol, exonuclease VII, Klenow) and at
55°C for thermophilic (KOD, Isis, Taq) enzymes for 30 min.
For PabPolB concentration gradient reactions, the indicated
concentrations of polymerase were added to give final reac-
tion volumes of 20 ␮L and reactions were left at 30 min at
55°C. All reactions were stopped by the addition of 2 ␮L of
0.25 M EDTA and 50% formamide stop buffer (SB). Control
samples lacking the polymerase (–ve) were left to incubate for
the full duration of the time course before the addition of SB.
Assay samples and control oligonucleotides (20 nM stock)
were diluted to a final concentration of 10 nM by the addi-
tion of 18 ␮L of 75% glycerol coloured with Orange G, before
heating at 95°C for 10 min. Eight microlitre of each sample
was applied to an 18% acrylamide (19:1 acrylamide:bis acry-
lamide), 7 M urea denaturing gel. Migration was carried out
using a 1× TBE running buffer at 5 W per gel for approx-
imately 4.5 h. Gel analysis was conducted using a Typhoon
9400 imager and the software ImageQuant TL (GE Health-
care).
2.3 Primer-template extension assay
Indicated amounts of T4 DNA polymerase (NEB) were incu-
bated at 37°C for 30 min with 25 nM primer-template sub-
strate (5 -Cy5 17 nt/87 pt) and 200 ␮M dNTPs in extension
buffer (10 mM Tris pH 7.9, 50 mM NaCl, 10 mM MgCl2 ,
1 mM DTT). The reactions were quenched by the addition
of EDTA at a final concentration of 25 ␮M and by placing
them on ice. Analysis was carried out on a 17% acrylamide
(19:1 acrylamide:bis-acrylamide), 8 M urea denaturing gel.
Migration was carried out using a 1× TBE running buffer at
4 W per gel for approximately 4 h. Gel analysis was conducted
using a Typhoon 9400 imager and the software ImageQuant
TL (GE Healthcare).
2.4 Sample preparation for PAGE and MALDI-TOF
MS analyses
Typically, 750 nM of 34 p(dT) labelled at the 5 position with
Cy5 was pre-incubated in RB for 10 min at 55°C. The exonu-
clease reaction was initiated by the addition of PabPolB at a
final concentration of 1 ␮M and was incubated at 55°C for
the duration of the time course. A total of 50 ␮L aliquots were
removed at each time point and the reaction was quenched


C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA. www.electrophoresis-journal.com
Electrophoresis 2014, 35, 1938–1946
Figure 1. Electrophoretic migration of degradation products pro-
duced by the exonuclease activity of PabPolB. The DNA poly-
merase (200 nM) was added to the single-stranded 5 -Cy5
34 p(dT) (20 nM) and time course experiment was performed at
55°C. Products were resolved on 18% polyacrylamide–7 M urea
denaturing gel. Lane 1 (M) corresponds to 5 -Cy5-labeled oligonu-
cleotide ladders (8, 17, 34 and 87 nt). Lane 12 (−ve) denotes the
absence of enzyme. Lanes 13, 14 and 15 are the migration profiles
of chemically synthesised dT polymers, 6, 4 and 2 nt in length,
respectively, 5 -labelled with a Cy5 dye.
by the addition of 10 ␮L of SB. A 2 ␮L sample from each time
point was removed and diluted in 48 ␮L of 30% glycerol, Or-
ange G solution before being analysed using denaturing gel
electrophoresis as described above.
2.5 MALDI-TOF MS measurements
The MALDI-TOF mass spectra were obtained in the negative
mode on a TOF Microflex mass spectrometer (Bruker, Wis-
sembourg, France) equipped with a 337 nm nitrogen laser
and pulsed delay source extraction. The matrix was prepared
by dissolving 3-hydroxypicolinic acid in 10 mM ammonium
citrate buffer. Prior to MALDI mass analysis, oligonucleotide
solutions were purified and concentrated on ZipTip pipette
tips (Millipore). A mixture of purified DNA sample (1 ␮L)
was added to matrix (1 ␮L) and spotted on a polished stain-
less target plate using the dried droplet method. Spectra were
calibrated using reference oligonucleotides of known masses.
3 Results and discussion
3.1 Detection and identification of aberrant
electrophoretic migration of Cy5-labelled
DNA oligos
PabPolB, containing a fully functional 3 –5 exonuclease do-
main, was used to cleave the phosphodiester chain of a
5 -Cy5-labelled 34 nucleotide poly dT (34 p(dT)) during a
time-dependent exonucleolytic experiment. Figure 1 shows

C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA.
Nucleic Acids 1941
the migration profiles of the products obtained at each time
point during exonuclease activity. It was observed that a rapid
shortening of the starting oligonucleotide occurs, producing
a cleaved product that migrates at a position below the 17
control oligonucleotide (compare lane 2 with lane 3) and
is consistent with the results expected for exonucleolysis
(T = 1 min). However, subsequent products from the ex-
onucleolytic degradation, generated between 5 and 120 min
(lanes 4–11), exhibit slower migration than those seen at
T = 1 min (lane 3). The electrophoretic mobility gradually
decreases such that resolving products migrate at a rate com-
parable to the larger 17–87 oligonucleotide markers. This is
especially pronounced at the final time point (lane 11, T =
120 min) where the only visible products migrate slower than
the initial starting oligonucleotide, 34 p(dT) (lane 2). Interest-
ingly, the morphology of the products was not typical of the
observed 5 -Cy5 end-labelled oligonucleotides (⬎10 in length)
that usually results in very sharp bands (lane 1) rather than
broadened bands (lane 11).
To identify the anomalously migrating products, a time
course experiment of the exonuclease activity of PabPolB was
conducted as in Fig. 1, but shorter incubation times were
chosen in order to capture a broad range of products within
a single reaction (Fig. 2A). The mobility profiles observed
at short incubation times (15–45 s) (Fig. 2A, lanes 3–5) is
unambiguously indicative of exonuclease activity, in which
the enzyme carries out phosphodiester cleavage as would be
expected from an enzyme possessing 3 –5 exonuclease ac-
tivity. Mostly, these degradation products (⬎10 nt) are sepa-
rated according to their size in the gel. Oligonucleotides be-
tween the range of 10–7 nt in length (Fig. 2B, MS trace 3)
seemingly migrate at approximately the same rate (Fig. 2A,
lane 7), suggesting that this region represents a tipping point
for migration. Upon prolonged incubation (⬎1.5 min), the
products which migrate in an aberrant manner are clearly
detectable (Fig. 2A, lanes 8–10). However, analysis by MS
(Fig. 2B, MS traces 4–6) indicates that these products are in
fact 6–2 nt in length and are consistent with the products that
should be produced following prolonged degradation by an
exonuclease.
Whilst initial experiments focused on enzymatic activity
to produce aberrantly migrating products, it is shown in Fig. 2
that the enzyme is not the cause of the aberrant migration.
Chemically synthesised short oligonucleotides, labelled at the
5 -end with Cy5, were also observed to migrate in an identical
manner to those arising from enzymatic activity (Fig. 1, com-
pare lanes 4–11 with lanes 13–15). This corroborates the MS
results and the aberrantly migrating products are shortened
5 -Cy5-labelled oligonucleotides, less than 8 nt in length.
We next conducted a careful inspection of the elec-
trophoretic mobility of 5 -end Cy5-labelled DNA fragments
with decreasing length (Supporting Information Fig. 1). The
relative mobility is plotted versus the log of DNA fragments
molecular weight (Fig. 2C). The resulting curve highlighted
two sets of migration species: DNA fragments between 8
and 95 nt, which separated as expected for their sizes as al-
ready described [50], and shorter DNA fragments exhibiting
www.electrophoresis-journal.com
1942 T. Killelea et al. Electrophoresis 2014, 35, 1938–1946

Figure 2. Detection and identification of aberrant electrophoretic migration of 5 -Cy5 products. (A) Electrophoretic profiles of exonuclease
products produced by PabPolB. The DNA polymerase (200 nM) was added to the single-stranded 5 -Cy5 34 p(dT) (20 nM) and time course
experiment was performed at 55°C. Products were resolved on 18% polyacrylamide–7 M urea denaturing gel. Lane 1 (M) corresponds
to 5 -Cy5 labelled oligonucleotide ladders (17, 34 and 87 nt). Numbering underneath the lanes indicates the corresponding MS traces.
(B) MS traces highlighting the size of the 5 -Cy5 p(dT) exonucleolysis products. (C) Relative mobility of products as a function of the
logarithmic molecular weight.

abnormal mobility. The plot for each fragment sets (grey
circles and black squares) seems to be linear down to the in-
flection point that occurs at 7–8 nt in length. Interestingly,
they exhibited distinct migration rates with shorter products
(grey circles) migrating at a rate two times faster.
3.2 Occurrence of electrophoretic migration
aberrations
We investigated the formation of anomalous migration pro-
ducts by using structurally different 5 -Cy5-labelled DNA
substrates in exonuclease reactions. Figure 3 highlights the
results obtained with DNA substrates of two different single-
stranded DNA lengths (8 nt or 17 nt) or primer/template
DNA (17 nt/34 nt). Regardless of the starting substrate, aber-
rant products were detected by the completion of each time
course, with the shortest substrate (8 nt) producing the high-
est heterogeneous population of DNA fragments (Fig. 3, lane
6). Up to 83% of starting 8 nt single-stranded DNA substrate
remains after 1 min incubation while efficient degradation
occurs with the two other DNA substrates (Fig. 3, compare
lane 4 with lanes 9 and 14). The substrates in these exper-
iments were present at the same molecular concentrations.
Therefore, one possible explanation for this result, which is
in agreement with the previous literature [51] and results
obtained in Fig. 1, is that PabPolB preferentially binds single-
stranded DNA substrate with a minimal length of 17 nt. This
leads to rapid association and efficient degradation of the
DNA substrate. On the other hand, the data also indicated
that the formation of the anomalous migration products is
not dependent on the nucleotide sequence of the DNA sub-
strates but rather on their structure (Fig. 3, compare lanes
8–11 to lanes 13–16).
We sought to determine whether the anomalous mi-
gration of short 5 -Cy5-labelled products was confined to


C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA. www.electrophoresis-journal.com
Electrophoresis 2014, 35, 1938–1946
Figure 3. Electrophoretic migration profiles of differing 5 -Cy5-
labelled substrates (single stranded and primer-template). The
DNA polymerase (200 nM) was added to the substrates (20 nM)
and the degradation of the 5 -Cy5-labelled oligonucleotides mea-
sured. Time course experiments were performed at 55°C with
single-stranded 8 nt DNA oligonucleotide (lanes 2–6), single-
stranded 17-nt DNA oligonucleotide (lanes 7–11) and 17-nt/34-
nt primer/template (lanes 12–16). Products were resolved on 18%
polyacrylamide–7 M urea denaturing gel. Lane 1 (M) corresponds
to 5 -Cy5-labelled oligonucleotide ladders (8, 17, 34 and 87 nt).
For each DNA substrate, the percentage of remaining substrate
against time is shown.
exonuclease reactions. To address this question, primer ex-
tension assays were carried out with the mesophilic bacte-
riophage T4 DNA polymerase carrying both exonuclease and
polymerase activities [52]. Visualisation of the migration pro-
files of the resulting DNA fragments highlighted the pres-
ence of both full-length primer extension products 87 nt in
length (Supporting Information Fig. 2A, lanes 2–4), along-
side aberrantly migrating 2 nt products (Supporting Infor-
mation Fig. 2A, lanes 3–4). Incubating the DNA polymerase
and primer-template in the presence of dNTPs should result
in the production of fully extended primer [52]. However,
if unannealed primer is present in the reaction mix, or if
the dNTP source is exhausted before the termination of the
reaction, then the DNA polymerase can switch to exonucle-
ase mode [53]. Traditionally, when using the radioactive nu-
clei 32 P labelling method for visualising DNA products on
a polyacrylamide gel, the size of a product would directly
impact on its migration, hence products of exonucleolysis
would migrate at a faster rate than those observed for primer
extension reactions [53]. However, as discussed above, Cy5-
labelled exonucleolysis DNA fragments do not migrate in a
traditional manner. Instead, they overlap with, and interfere
with the identification of primer extension products, as such,
the choice of label must be taken into account even when
exonucleolysis is not the main focus of the experiment.
To further emphasise this anomalous migration phe-
nomenon, a comparative study with routine enzymes used
in laboratories was achieved by carrying out exonuclease as-
says. As observed, the migration anomalies of DNA products

C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA.
Nucleic Acids 1943
arose independently of the nature of the DNA polymerases
tested (Supporting Information Fig. 2B, lanes 3–9). The popu-
lation of the degradation fragments was more heterogeneous
in their apparent lengths for PabPolB (lane 3) and its com-
mercially equivalent Isis DNA polymerase (lane 4) when com-
pared with the homologous family B DNA polymerase from
Thermococcus kodakaraensis (KOD) (lane 5). Degradation frag-
ments generated by the two thermophilic enzymes (Isis and
KOD) were shorter than those obtained with the mesophilic
counterparts T4 DNA polymerase and Klenow (Supporting
Information Fig. 2B, compare lanes 4 and 5 with lanes 6 and
7). Although this observation likely accounts for the different
specific activity of the enzymes, it is clear that the aberrantly
migration products are the result of exonuclease activity. In-
deed, when the proofreading-deficient Taq DNA polymerase
was used, no apparent degradation products were detectable
(Supporting Information Fig. 2B, lane 8). As a positive con-
trol, the hydrolysis reaction with exonuclease VII was car-
ried out, which consequently led to shorter aberrantly mi-
gration products (Supporting Information Fig. 2B, lane 9).
Overall these data indicated that the abnormal electrophoretic
migration is independent of the nature of enzymes and is not
restricted to exonuclease assays.
3.3 Possible alternatives to avoid aberrantly
migration products
Because the electrophoretic migration anomalies can create
interpretation difficulties, we sought to investigate the basis
of this phenomenon and propose possible solutions. A close
examination of the physicochemical properties of popular
fluorophores reveals that cyanines are charged fluorescent
dyes (Table 1). Thus, a possible explanation for the occur-
rence of the aberrantly migrating products is the influence of
the positive charge of the Cy5 dye. Supporting Information
Fig. 1B highlights a comparison in theoretical mass/charge
ratios between unlabelled and 5 -Cy5 oligos from 2 to 95 nt in
length. As can be seen, for unlabelled DNA oligo (grey circle),
the mass/charge ratio remains almost constant, regardless of
size, suggesting that oligonucleotide size is the main driving
force behind migration rate. However, the introduction of
Cy5 drastically alters the trace, with the mass/charge ratio in-
creasing in proportion to decreasing DNA oligo length. This
suggests that the introduction of a constant positive charge
alters the mass/charge dynamics of the DNA oligo.
To test this hypothesis, two oligonucleotides of identi-
cal size and base composition, but carrying a neutral or
+1 charged dye at the 5 -end, 6-FAM or Cy5, respectively,
were submitted to exonuclease assays. The result, shown
in Fig. 4, demonstrated the influence of increasing enzyme
amounts on the occurrence of the altered migration prod-
ucts. As expected, the charged 5 -Cy5-labelled DNA prod-
ucts (⬎8 nt in length) migrated in general accordance with
their size, regardless of the enzyme concentration range of
0.5–10 nM (Fig. 4A, lanes 3–7). The migration anomaly
started at 25 nM (Fig. 4A, lane 8) and was further enhanced
www.electrophoresis-journal.com
1944 T. Killelea et al. Electrophoresis 2014, 35, 1938–1946

Figure 4. Electrophoretic migration profiles of the exonuclease products produced by increasing concentrations of PabPolB on oligonu-
cleotides differentially labelled at the 5 position. The DNA polymerase was added to the substrates (20 nM) at the indicated amounts
and the degradation of the 5 -Cy5-labelled oligonucleotides observed. (A) 5 Cy5 34 p(dT) utilised as a starting substrate. Lane 1 (M)
corresponds to 5 -Cy5-labelled oligonucleotide ladders (8, 17, 34 and 87nt). (B) 5 -6-FAM 34 p(dT) utilised as a starting substrate. Lane 1
(M) corresponds to 5 -6-FAM-labelled oligonucleotide ladders (17, 34 and 87 nt).

at higher PabPolB concentrations (Fig. 4A, lanes 9–13). Re-
sults are consistent with those obtained in Fig. 1 showing
the same heterogeneity of abnormal migration products aris-
ing with an enzyme concentration of 200 nM. Therefore, the
enzyme concentration is a factor that can influence the oc-
currence of altered migration products. As expected, 5 -end
6-FAM-labelled products migrated according to their size and
their oligo length (Fig. 4B). To trigger full degradation of the
starting single-stranded substrate, 2.5 nM of enzyme was suf-
ficient and products less than 17 nt in length were generated
(Fig. 4B, lane 5). Increasing amounts of PabPolB produced
DNA fragments of decreasing lengths (Fig. 4B, lanes 6–7). In
the range of enzyme concentration of 25–1000 nM, the pop-
ulation size of degradation products remained constant and
fragment were mainly 1–2 nt in length (Fig. 4B, lanes 8–13).
Comparison of Cy5 and 6-FAM panels obviously stressed the
altered and reduced mobility of 5 -Cy5-labelled short DNA
fragments (⬍8 nt in length). Thus, correct visualisation and
sizing of exonuclease degradation products became possible
with the use of neutrally charged 6-FAM dye.
4 Concluding remarks
This study highlights the abnormal migration of 5 -Cy5-
labelled DNA products during denaturing PAGE. The migra-
tion anomaly is observed for 5 -Cy5-labelled oligonucleotides
⬍8 nt in length. Locating a positively charged Cy5 dye on
an oligonucleotide of any length impacts the mass/charge
dynamics; however, once the tipping point of 8 nt is
passed, a rapid slowdown in the migration rate is observed.
As expected, the migration anomaly is almost completely
removed when Cy5 dye is replaced by the neutrally charged
6-FAM dye, allowing more accurate fragment sizing determi-
nations. This anomalous migration phenomenon detected
upon carrying DNA polymerase and exonuclease assays rep-
resents a major concern for research scientists. Indeed,
numerous laboratories now utilise fluorescent probes for
labelling DNA instead of radioisotopes, thereby eliminat-
ing or significantly reducing the use of radioactive materi-
als. Any scientist working with molecular biology enzymes
and fluorescent-labelled oligonucleotides could potentially
be affected by the anomalous electrophoretic migration of
positively charged fluorescent dye attached to the 5 -end of
short DNA fragments (⬍8 nt in length). Although not ex-
plicitly investigated in this study, ATTO 647N, which is de-
scribed as a spectroscopic equivalent of Cy5, gave rise to the
same anomalous migration phenomenon (Supporting Infor-
mation Fig. 3). While the company synthesising the fluores-
cent probe is prevented from sending the chemical struc-
ture of the molecule, ATTO 647N is described as a cationic
dye (http://www.fluorophores.tugraz.at/). Careful considera-
tion of the molecular footprint of a fluorescent labels should
always precede experimental analysis, particularly when sci-
entific techniques exploit physical properties. Data interpreta-
tion, particularly the sizing of fluorescently labelled oligonu-
cleotides, requires careful interpretation by well-trained
scientists. In this regard, MS analyses could help in sorting
out complex relative migration patterns.
This work was supported by the French Institute of Ma-
rine Research and Exploitation (Ifremer). Dr. Tom Killelea and
Dr. Ghislaine Henneke were supported by the National Re-
search Agency ( ANR-10-JCJC-1501-01). Dr. Céline Ralec was


C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA. www.electrophoresis-journal.com
Electrophoresis 2014, 35, 1938–1946
financially supported by Ifremer and the Brittany Regional Coun-
cil. Christine Saint-Pierre and Dr. Didier Gasparutto thank the
labex ARCANE (ANR-11-LABX-0003-01) for partial financial
support.
The authors have declared no conflict of interest.
5 References
[1] Agarwal, K. L., Buchi, H., Caruthers, M. H., Gupta, N.,
Khorana, H. G., Kleppe, K., Kumar, A., Ohtsuka, E., Ra-
jbhandary, U. L., Van de Sande, J. H., Sgaramella, V.,
Weber, H., Yamada, T., Nature 1970, 227, 27–34.
[2] Khorana, H. G., Science 1979, 203, 614–625.
[3] Matteucci, M. D., Caruthers, M. H., J. Am. Chem. Soc.
1981, 103, 3185–3191.
[4] Mcbride, L. J., Caruthers, M. H., Tetrahedron Lett. 1983,
24, 245–248.
[5] Beaucage, S. L., Iyer, R. P., Tetrahedron 1992, 48,
2223–2311.
[6] Malik, R., Roy, I., Expert Opin. Drug Discov. 2011, 6,
507–526.
[7] Jarad, G., Simske, J. S., Sedor, J. R., Schelling, J. R.,
Curr. Opin. Nephrol. Hypertens. 2003, 12, 415–421.
[8] Ridgwell, K., Vox. Sang. 2004, 87(Suppl 1), 6–12.
[9] Suggs, S. V., Wallace, R. B., Hirose, T., Kawashima, E.
H., Itakura, K., Proc. Natl. Acad. Sci. USA 1981, 78,
6613–6617.
[10] Chapdelaine, P., Ho-Kim, M. A., Tremblay, R. R., Dube, J.
Y., Int. J. Biochem. 1990, 22, 75–82.
[11] Maier, J., Schott, K., Werner, T., Bacher, A., Ziegler, I.,
Adv. Exp. Med. Biol. 1993, 338, 195–198.
[12] Kreil, D. P., Russell, R. R., Russell, S., Methods Enzymol.
2006, 410, 73–98.
[13] Wallace, R. B., Schold, M., Johnson, M. J., Dembek, P.,
Itakura, K., Nucleic Acids Res. 1981, 9, 3647–3656.
[14] Iwai, S., Nucleosides Nucleotides Nucleic Acids 2006, 25,
561–582.
[15] Gasparutto, D., Bourdat, A. G., D’Ham, C., Duarte, V.,
Romieu, A., Cadet, J., Biochimie 2000, 82, 19–24.
[16] Hughes, R. A., Miklos, A. E., Ellington, A. D., Methods
Enzymol. 2011, 498, 277–309.
[17] Mathur, D., Henderson, E. R., ACS Synth. Biol. 2013, 2,
180–185.
[18] Feng, K., Qiu, L. P., Yang, Y., Wu, Z. S., Shen, G. L., Yu,
R. Q., Biosens. Bioelectron. 2011, 29, 66–75.
[19] Beaucage, S. L., Current Protocols in Nucleic Acid Chem-
istry, 2001, Supplement, 18, 4.0.1–4.0.4.
[20] Hermanson, G. T., Bioconjugate Techniques. 3rd edition,
Academic Press, Boston 2013, pp. 959–987.
[21] Tabor, S., Struhl, K., Curr. Protoc. Hum. Genet. 2001, Ap-
pendix 3E, 1–6.
[22] Ballal, R., Cheema, A., Ahmad, W., Rosen, E. M., Saha,
T., J. Biomol. Tech. 2009, 20, 190–194.
[23] Ju, J., Ruan, C., Fuller, C. W., Glazer, A. N., Mathies, R.
A., Proc. Natl. Acad. Sci. USA 1995, 92, 4347–4351.

C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA.
Nucleic Acids 1945
[24] MacBeath, J. R., Harvey, S. S., Oldroyd, N. J., Methods
Mol. Biol. 2001, 167, 119–152.
[25] Smith, L. M., Sanders, J. Z., Kaiser, R. J., Hughes, P.,
Dodd, C., Connell, C. R., Heiner, C., Kent, S. B., Hood,
L. E., Nature 1986, 321, 674–679.
[26] Tyagi, S., Kramer, F. R., Nat. Biotechnol. 1996, 14,
303–308.
[27] Kubista, M., Andrade, J. M., Bengtsson, M., Forootan, A.,
Jonak, J., Lind, K., Sindelka, R., Sjoback, R., Sjogreen,
B., Strombom, L., Stahlberg, A., Zoric, N., Mol. Aspects
Med. 2006, 27, 95–125.
[28] Darnell, D. K., Stanislaw, S., Kaur, S., Antin, P. B., RNA
2010, 16, 632–637.
[29] Hayes, J. L., Tzika, A., Thygesen, H., Berri, S., Wood, H.
M., Hewitt, S., Pendlebury, M., Coates, A., Willoughby,
L., Watson, C. M., Rabbitts, P., Roberts, P., Taylor, G. R.,
Genomics 2013, 102, 174–181.
[30] Jiang, X., Guo, F., Jia, F., Jin, P., Sun, Z., Forensic Sci. Int.
Genet. 2013, 7, 279–289.
[31] Killelea, T., Ghosh, S., Tan, S. S., Heslop, P., Firbank, S.
J., Kool, E. T., Connolly, B. A., Biochemistry 2010, 49,
5772–5781.
[32] Henneke, G., Biochem. J. 2012, 447, 271–280.
[33] Skinner, S. O., Sepulveda, L. A., Xu, H., Golding, I., Nat.
Protoc. 2013, 8, 1100–1113.
[34] Giusti, W. G., Adriano, T., PCR Methods Appl. 1993, 2,
223–227.
[35] Markiewicz, W. T., Groger, G., Rosch, R., Zebrowska, A.,
Markiewicz, M., Klotz, M., Hinz, M., Godzina, P., Seliger,
H., Nucleic Acids Res. 1997, 25, 3672–3680.
[36] Zearfoss, N. R., Ryder, S. P., Methods Mol. Biol. 2012,
941, 181–193.
[37] Levitus, M., Ranjit, S., Q. Rev. Biophys. 2011, 44,
123–151.
[38] Metzker, M. L., Lu, J., Gibbs, R. A., Science 1996, 271,
1420–1422.
[39] Rusinova, E., Tretyachenko-Ladokhina, V., Vele, O. E., Se-
near, D. F., Alexander Ross, J. B., Anal. Biochem. 2002,
308, 18–25.
[40] Kupstat, A., Ritschel, T., Kumke, M. U., Bioconjug. Chem.
2011, 22, 2546–2557.
[41] Wallner, G., Amann, R., Beisker, W., Cytometry 1993, 14,
136–143.
[42] Amann, R., Fuchs, B. M., Nat. Rev. Microbiol. 2008, 6,
339–348.
[43] Richardson, T. T., Gilroy, L., Ishino, Y., Connolly, B. A.,
Henneke, G., Nucleic Acids Res. 2013, 41, 4207–4218.
[44] Song, J. M., Yeung, E. S., Electrophoresis 2001, 22,
748–754.
[45] Tan, H., Yeung, E. S., Electrophoresis 1997, 18,
2893–2900.
[46] Tu, O., Knott, T., Marsh, M., Bechtol, K., Harris, D., Barker,
D., Bashkin, J., Nucleic Acids Res. 1998, 26, 2797–2802.
[47] Gouge, J., Ralec, C., Henneke, G., Delarue, M., J. Mol.
Biol. 2012, 423, 315–336.
[48] Dietrich, J., Schmitt, P., Zieger, M., Preve, B., Rolland, J.
L., Chaabihi, H., Gueguen, Y., FEMS Microbiol. Lett. 2002,
217, 89–94.
www.electrophoresis-journal.com
1946 T. Killelea et al. Electrophoresis 2014, 35, 1938–1946

[49] Gueguen, Y., Rolland, J. L., Lecompte, O., Azam, P., Le
Romancer, G., Flament, D., Raffin, J. P., Dietrich, J., Eur.
J. Biochem. 2001, 268, 5961–5969.
[50] Maniatis, T., Jeffrey, A., van deSande, H., Biochemistry
1975, 14, 3787–3794.
[51] Henneke, G., Flament, D., Hubscher, U., Querellou, J.,
Raffin, J. P., J. Mol. Biol. 2005, 350, 53–64.
[52] Frey, M. W., Nossal, N. G., Capson, T. L., Benkovic, S. J.,
Proc. Natl. Acad. Sci. USA 1993, 90, 2579–2583.
[53] Fidalgo da Silva, E., Reha-Krantz, L. J., Nucleic Acids Res.
2007, 35, 5452–5463.


C 2014 The Authors. Electrophoresis published by WILEY-VCH Verlag GmbH & Co. KGaA. www.electrophoresis-journal.com