Reproductive Toxicology 26 (2008) 138–145

Contents lists available at ScienceDirect

Reproductive Toxicology
journal homepage: www.elsevier.com/locate/reprotox

Endosulfan modulates estrogen-dependent genes like a non-uterotrophic dose

of 17␤-estradiol
Jorgelina Varayoud, Lucas Monje, Tania Bernhardt, Mónica Muñoz-de-Toro,
Enrique H. Luque, Jorge G. Ramos ∗
Laboratorio de Endocrinología y Tumores Hormonodependientes, School of Biochemistry and Biological Sciences, Universidad Nacional del Litoral, Santa Fe, Argentina

a r t i c l e i n f o a b s t r a c t

Article history: The estrogenic activity of environmentally relevant doses of endosulfan was investigated using an ani-
Received 28 May 2008 mal model. Ovariectomized adult rats were injected once a day for 3 days with sesame oil (control),
Received in revised form 28 July 2008 0.02 mg/kg/day 17␤-estradiol (an uterotrophic dose; UE2 ), 0.0002 mg/kg/day 17␤-estradiol (a non-
Accepted 15 August 2008
uterotrophic dose; NUE2 ), or 0.006, 0.06, 0.6 or 6 mg/kg/day endosulfan. After 24 h of treatment, the
Available online 23 August 2008
uteri were weighed (uterotrophic assay) and the luminal epithelial cell height (LECH) and progesterone
receptor (PR), and estrogen receptor alpha (ER␣) protein levels were measured. PR, ER␣, and complement
Keywords:
factor-3 (C3) mRNAs were evaluated using real-time PCR. Uterine weight and LECH were only increased
Endosulfan
Uterus
in UE2 -treated rats. PR, ER␣ and C3 expression levels were modified in most of the endosulfan-treated
17␤-Estradiol groups, showing an identical pattern of expression to the NUE2 -group. Our results show that the pesti-
Progesterone receptor cide endosulfan mimics non-uterotrophic E2 actions, strengthening the hypothesis that endosulfan is a
Estrogen receptor widespread xenoestrogen.
Complement factor-3 © 2008 Elsevier Inc. All rights reserved.
Xenoestrogens

1. Introduction Some in vitro approaches have demonstrated that endosul-

Environmental estrogens (xenoestrogens) are a diverse group of
chemicals that have been associated with adverse effects on wildlife
and domestic animals, and may potentially produce adverse health
effects on humans by interfering with the endocrine system [1–4].
Endosulfan is a manufactured organochlorine pesticide that is used
to control a number of insects on food crops such as grains, tea,
fruits, and vegetables, and on nonfood crops such as tobacco and
cotton. Human exposure to organochlorine compounds has been
extensively documented in different world regions, especially those
with intensive agricultural activity [4–7]. An acceptable oral ref-
erence dose (RfD) of 0.006 mg/kg/day endosulfan has been set by
different regulatory agencies [8]. The RfD and the acceptable daily
intake (ADI) were established on the basis of a no observed effect
level (NOEL) of 0.6 mg/kg/day and the application of an uncertainty
factor of 100 to account for inter- and intra-species variability [8,9].
∗ Corresponding author at: Laboratorio de Endocrinología y Tumores Hor-
monodependientes, School of Biochemistry and Biological Sciences, Universidad
Nacional del Litoral, Casilla de Correo 242, 3000 Santa Fe, Argentina.
Tel.: +54 342 4575207; fax: +54 342 4575207.
E-mail address: gramos@fbcb.unl.edu.ar (J.G. Ramos).
fan shows estrogenic properties. Endosulfan was able to activate
the AF2 function of ER␣ in vitro and showed agonist activity in
estrogen-responsive myometrial cells as determined by the induc-
tion of proliferation and increased PR message levels [10]. Using
an ER␣-transfected HELN cell line, it has been shown that endo-
sulfan competes with estradiol for binding to ER␣, and that it is
able to transactivate ER␣ and induce the transcription of an ERE-
dependent gene construct [11]. In contrast, very few reports have
tackled the problem of endosulfan’s estrogenic activity using in vivo
conditions and doses mimicking human exposure. Using imma-
ture CD-1 mice subcutaneously injected with a wide range of doses
of endosulfan, Newbold et al. have shown that this pesticide did
not increase the uterine wet weight or the epithelial cell height
[12]. However, using a very high dose (10 mg/kg/day) the authors
showed that endosulfan was able to increase the uterine gland
number, lactoferrin and C3 protein expression, and PCNA-labelled
cells. These results suggest that endosulfan acts as an estrogen at
very high doses; however, little is known about the hormone activ-
ity of this compound at environmentally relevant low doses.
A previous study evaluated the reproductive effects of perinatal
exposure to endosulfan on the male offspring born from Wistar rats
exposed to 1.5 and 3.0 mg/kg/day from day 15 of pregnancy to post-
natal day (PND) 21 of lactation [13]. The authors reported adverse
reproductive effects (e.g., decreases in the daily sperm production

0890-6238/$ – see front matter © 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.reprotox.2008.08.004
 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
and percentage of seminiferous tubules with complete spermato-
genesis) in the male offspring of rats exposed to 3.0 mg/kg/day of
endosulfan. Surprisingly, in another report these authors showed
a significant increase in the relative epididymis weight in the
male offspring pre- and post-natally exposed to 0.5 mg/kg/day
of endosulfan, but not in the offspring exposed to a higher dose
(1.5 mg/kg/day) [14]. These results suggest the hypothesis that low
doses of endosulfan, like many other endocrine disruptors, may
interfere with endocrine-related processes.
The in vivo estrogenic activity of an endocrine disruptor is
often determined by comparing the tested compound with a posi-
tive control substance (like 17␤-estradiol or diethylstilbestrol). The
doses used in positive control groups are selected to effectively pro-
duce the classic and expected estrogenic response. However, the
low dose effects of endocrine disruptor compounds are often diffi-
cult to interpret due to, at least in part, the design of the positive
controls [15,16]. In this report, we demonstrate that, at a molecular
level of organization, an uterotrophic dose of E2 produces different
responses than a non-uterotrophic dose. Moreover, endosulfan is
able to mimic the sub-uterotrophic E2 actions, strengthening the
hypothesis that this compound is a widespread xenoestrogen.
2. Materials and methods
2.1. Chemicals
17␤-Estradiol was purchased from Sigma Chemical Co. (St. Louis, MO, USA) and
endosulfan (98% of purity) was provided by Chem Service (West Chester, PA, USA).
2.2. Experimental design
Sexually mature female rats (90 days old) of an inbred Wistar-derived strain bred
at the Department of Human Physiology (Santa Fe, Argentina) were used. Animals
were maintained under a controlled environment (22 ± 2 ◦ C; lights on from 06:00 to
20:00 h) and had free access to pellet laboratory chow (Cooperación, Buenos Aires,
Argentina) and tap water. All rats were handled in accordance with the principles
and procedures outlined in the Guide for the Care and Use of Laboratory Animals
issued by the US National Academy of Sciences. The concentration of phytoestrogens
in the diet was not evaluated; however, because feed intake was equivalent for con-
trol and experimental rats (unpublished observations) we assumed that all animals
were exposed to the same levels of phytoestrogens. To minimize additional expo-
sures to endocrine-disrupting chemicals, rats were housed in stainless steel cages
with wood bedding, and tap water was supplied ad libitum in glass bottles with rub-
ber stoppers surrounded by a steel ring. All experimental rats were ovariectomized
(OVX) and then rested for 14 days. Those animals that exhibited at least 7 days of
atrophic vaginal smears [17] were sc injected for three consecutive days with one
of the following treatments: sesame oil (control group: 100 ␮l/animal), E2 (with an
uterotrophic dose of 0.02 mg/kg/day in the UE2 group or a non-uterotrophic dose
of 0.0002 mg/kg/day in the NUE2 group); or varying doses of endosulfan: 0.006,
0.06, 0.6 or 6 mg/kg/day (Endo0.006, Endo0.06, Endo0.6, and Endo6 groups, respec-
tively). All animals (6–8 rats/group) were sacrificed 24 h after the last injection and
uteri were isolated. One uterine horn from each rat was placed immediately in liquid
nitrogen and stored at −80 ◦ C for RNA extraction. The other uterine horn (1.5 cm) was
weighed (uterotrophic assay) and then fixed by immersion in 10% formalin buffer
for 6 h at 4 ◦ C, embedded in paraffin, and used for immunohistochemical staining.
2.3. RNA extraction and reverse transcription
Each experimental group was comprised of 6–8 uterine horns. Individual uterine
horns were homogenized in TRIzol reagent and total RNA was extracted following
the manufacturer’s protocol (Invitrogen, Carlsbad, CA, USA). The concentration of
total RNA was assessed by A260 and the sample was stored at −80 ◦ C until needed.
Equal quantities (4 ␮g) of total RNA were reverse-transcribed in three indepen-
dent experiments for 90 min at 37 ◦ C using 200 pmol of random hexamer primers
(Promega, Madison, WI, USA), 100 nmol deoxynucleotide triphosphates and 300 U
Moloney Murine Leukemia Virus reverse transcriptase (Promega) in a final volume
of 30 ␮l of 1× MMLV-RT buffer. Each reverse-transcribed product was diluted with
RNase-free water to a final volume of 60 ␮l.
2.4. Quantitative real-time polymerase chain reaction (QPCR)
ER␣, PR and C3 mRNA expression was quantified by real-time RT-PCR using the
Real-Time DNA Engine Opticon System (Bio-Rad Laboratories Inc., Waltham, MA,
USA) and SYBR Green I dye (Cambrex Corp., East Rutherford, NJ, USA). These genes
139
were selected as classical targets of estrogen action in the OVX rat uterus [18]. Two
genes were tested to normalize RNA inputs: ribosomal protein L19 (L19) and 18S
rRNA. Gene-specific primer sequences are shown in Table 1 and were synthesized
by Invitrogen.
For amplifications, 5 ␮l of diluted cDNA were combined with a mixture con-
taining 2.5 U Platinum Taq-DNA polymerase (Invitrogen), 2 mM MgCl2 (Invitrogen),
0.2 mM of each of the four dNTPs (Promega), 1 ␮l of 10× SYBR Green I and 10 pmol
of each primer (Invitrogen) in a final volume of 25 ␮l of 1× PCR buffer. The cycling
conditions were as follows: after initial denaturation at 97 ◦ C for 1 min, the reaction
mixture was subjected to successive cycles of denaturation at 97 ◦ C for 30 s, anneal-
ing at 60 ◦ C for 30 s, and extension at 72 ◦ C for 30 s. Product purity was confirmed
by dissociation curves and random agarose gel electrophoresis. Controls containing
no template DNA were included in all assays, yielding no consistent amplification.
All PCR products were cloned using the TA cloning kit (Invitrogen) and specificity
was confirmed by DNA sequencing (data not shown). For each analysis, a standard
curve was prepared from eight serial dilutions of a standard sample containing equal
amounts of cDNA from the different experimental groups. All standards and samples
of each independent experiment were assayed in triplicate.
2.5. ER˛ and PR quantitative immunohistochemistry
Uterine sections (5 ␮m in thickness) were deparaffinized and dehydrated
in graded ethanols. A standard immunohistochemical technique (avidin–biotin-
peroxidase) was used to visualize ER␣ and PR immunostaining intensity and
distribution following a previously described protocol [18,19]. Immunostaining of
steroid receptors was performed using a rabbit anti-human PR (A/B isoforms)
antibody (1:500 dilution; Dako Corp., Carpinteria, CA, USA) and a mouse anti-
human ER␣ antibody (clone 6F-11, 1:200 dilution; Novocastra, Newcastle upon
Tyne, UK). Anti-rabbit/anti-mouse secondary antibodies (biotin conjugated) were
purchased from Sigma. Reactions were developed using a streptavidin–biotin per-
oxidase method and diaminobenzidine (Sigma) as a chromogen substrate. Negative
controls were performed by replacing the primary antibody with non-immune goat
serum (Sigma).
A well-established quantitative approach was performed whereby total ER␣ and
PR protein expression was measured as a linear combination of the relative area
occupied by the immunostained cells and the optical density as shown by immunos-
taining [20,21]. This linear combination constitutes the integral optical density (IOD)
value, which is proportional to the protein content of each histological compart-
ment [22]. The IOD was evaluated in digital images of each tissue section using a
Spot Insight V3.5 color video camera (Diagnostic Instruments, Sterling Heights, MI,
USA) attached to an Olympus BH2 microscope (illumination: 12-V halogen lamp,
100 W, equipped with a stabilized light source) with a Dplan 40× objective (numer-
ical aperture = 0.65) (Olympus Optical Co. Ltd., Tokyo, Japan). The IODs of ER␣ and
PR immunostaining were evaluated in the entire luminal and glandular epithelium
of each tissue section and in the subepithelial stroma defined as a 300-␮m-wide
area adjacent to the epithelium, from the basement membrane toward the outer
layers. The image analysis was performed using the Image Pro-Plus 4.1.0.1® sys-
tem (Media Cybernetics, Silver Spring, MA, USA), as previously described [21]. At
least 10 fields of each histological compartment were recorded in each section and
two sections per animal were evaluated. Correction of unequal illumination (shad-
ing correction) and calibration of the measurement system were performed with a
reference slide.
2.6. Luminal epithelial cell height
Uterine epithelial cell height was measured in Harris hematoxylin-stained uter-
ine sections from the apical (luminal) surface to the basement membrane. All
measurements were made in areas where luminal folds were not present and care
was taken to avoid measuring sections that were cut obliquely. To spatially cal-
ibrate the Image Pro-Plus analyzer square grids from Neubauer chamber images
were captured as in the above-described experimental conditions.
2.7. Data analysis
All data were calculated as the mean ± S.E.M. We performed Kruskal–Wallis
analysis to obtain the overall significance (testing the hypothesis that the response
was not homogeneous across treatments), and differences between groups were
determined using the Dunn post hoc test. P < 0.05 was accepted as significant.
3. Results
3.1. Uterotrophic assay
The results of the uterotrophic assay are summarized in Table 2.
It is interesting to note that only the high dose of E2 (UE2 ) induced a
significant increase (threefold) in the uterine wet weight (P < 0.05).
140 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145

Table 1
Primers and PCR products for gene expression analysis by Real-Time QPCR

Gene Primer sequence (5 –3 ) Product size (bp) Genbank accession no.

Estrogen receptor ␣ Forward: ACTACCTGGAGAACGAGCCC

153 NM 012689
(ER␣) Reverse: CCTTGGCAGACTCCATGATC
Progesterone receptor Forward: GACCAGTCTCAACCAACTAGGC
137 L16922
(PR) Reverse: ACACCATCAGGCTCATCCAG
Complement Forward: CTACCCCTTACCCCTCACTC
169 NW 047936
component 3 (C3) Reverse: GTCTCTTCACTCTCCAGCCG
Ribosomal protein L19 Forward: AGCCTGTGACTGTCCATTCC
99 NM 031103
(L19) Reverse: TGGCAGTACCCTTCCTCTTC
Forward: TAAGTCCCTGCCCTTTGTACACA
18s rRNA 71 M11188
Reverse: GATCCGAGGGCCTCACTAAAC

Neither the low dose of E2 (NUE2 ) nor the varying doses of
endosulfan resulted in a positive uterotrophic assay.
3.2. Morphometric analysis
In the uterus of the OVX rodent, the increase in LECH is a hall-
mark of estrogen action and correlates with uterine wet weight
induction. An approximate twofold increase in epithelial cell height
was measured in the UE2 -treated animals compared with vehicle-
injected, NUE2 and endosulfan-treated rats (P < 0.05, Table 2). No
differences were obtained between NUE2 , endosulfan-treated rats
and control animals (Table 2).
3.3. Changes in the uterine estrogen-dependent genes elicited by
estradiol and endosulfan
Relative changes in uterine gene expression were determined
using real-time RT-PCR analysis. Two control genes (L19 and 18S
rRNA) were tested to confirm that RNA concentrations were similar
across groups. L19 varied by no more than 1.2-fold across groups,
whereas 18S rRNA showed an increase of 2.5-fold in the UE2 -treated
animals (data not shown). Taking into account these results the
L19 ribosomal protein cDNA was selected as an adequate internal
control.
Complement factor-3 is a classical estrogen regulated gene; its
transcription is induced in the presence of estrogens via estrogen
response elements in the promoter region [23]. As expected, the
UE2 group had more than fourfold the uterine C3 mRNA content as
control (P < 0.05, Fig. 1A). Surprisingly, the non-uterotrophic dose of
E2 induced a significant decrease in C3 expression (NUE2 -treated
animals compared to controls, P < 0.05, Fig. 1A). The same result
was observed in most of the endosulfan-treated groups, where the
C3 mRNA expression was significantly reduced (Fig. 1A). Only the
highest dose of endosulfan (Endo6) did not cause differences in C3
mRNA expression compared to control rats. A very similar profile
was obtained when the PR mRNA expression was examined. E2 was
able to induce a 2.5-fold increase in PR mRNA in the UE2 -treated
animals (P < 0.05, Fig. 1B), while samples from animals treated with
the low dose of E2 and all endosulfan doses showed a decrease in
PR gene expression (Fig. 1B). It is important to emphasize that all
endosulfan-treated animals showed significant differences in C3
and PR mRNA expression with UE2 -treated rats, however no dif-
ferences could be detected between any endosulfan-treated group
and the NUE2 group (Fig. 1A and B). Moreover, both doses of E2 and
all endosulfan-treated groups showed a clear down-regulation of
ER␣ mRNA compared with control rats (P < 0.05, Fig. 1C).
3.4. ER˛ and PR protein expression in different uterine
histological compartments
To determine if the influence of different E2 and endosulfan
doses on estrogen-sensitive genes mRNA expression were extensive
to protein expression, we quantified the relative ER␣ and PR protein
levels in uterine horns of all experimental animals. In accordance
with previous results [18], the high dose of E2 down-regulated
ER␣ protein in all histological compartments as compared to
vehicle-treated animals (P < 0.05, Fig. 2A–C). On the other hand, the
non-uterotrophic dose of E2 down-regulated ER␣ only in the subep-
ithelial stroma (P < 0.05, Fig. 2C). It is very interesting to note that
most of the endosulfan-treated groups showed an identical pattern
of changes when compared to the NUE2 -group (P > 0.05), exhibiting
a down-regulation of ER␣ protein in the subepithelial stroma with-
out changes in the luminal or glandular epithelium compared with
control animals (P < 0.05, Fig. 2A–C). Fig. 4A–D shows ER␣ changes
in different cellular compartments of the uterus.
The immunohistochemical analysis showed that PR protein was
strongly induced in the stroma of UE2 -treated animals, while a
clear down-regulation was observed in the luminal and glandular
epithelia (P < 0.05, Fig. 3A–C). In contrast, in NUE2 -treated animals,
a significant decrease in PR was detected only in glandular epithelial
cells without changes in the luminal epithelium or stroma com-
pared with vehicle injected animals (P < 0.05). Once again, in all
endosulfan-treated groups, the PR protein was modulated as in
the non-uterotrophic E2 -treated rats (P > 0.05), with a decrease in
the glandular epithelial expression (P < 0.05, Fig. 3A–C). Fig. 4E–H
illustrates the PR protein changes observed in different cellular
compartments.

Table 2
Uterine wet weights after 3 day administration of E2 or endosulfan to OVX adult rats

Experimental group Dose (mg/kg/day) Uterine wet weight (mg/kg BW) Epithelial cell height (␮m)

Control (vehicle) – 113.92 ± 6.93a 12.39 ± 0.93a

UE2 (high dose of E2 ) 0.02 340.14 ± 38.27b 25.41 ± 1.37b
NUE2 (low dose of E2 ) 0.0002 98.20 ± 8.66a 12.28 ± 1.27a
Endo6 6 70.97 ± 12.33a 12.54 ± 0.81a
Endo0.6 0.6 73.29 ± 12.49a 12.52 ± 0.96a
Endo0.06 0.06 73.62 ± 6.57a 13.64 ± 1.05a
Endo0.006 0.006 77.14 ± 7.89a 12.72 ± 0.83a

Values are means ± S.E.M. (n = 6–8 rats/group). Different letters indicate statistically significant differences (p < 0.05).
 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Fig. 1. Real-time RT-PCR analysis was done to determine uterine expression levels of
C3 (A), PR (B), and ER␣ (C) after treatment. Controls were injected with vehicle, UE2
and NUE2 rats were injected with uterotrophic and non-uterotrophic doses of E2 ,
respectively. Endosulfan-treated rats received 0.006, 0.06, 0.6 or 6 mg/kg/day. The
vertical axis corresponds to the relative mRNA level of each target gene normalized
to L19 expression. The mRNA level of the control group is expressed as 1. Values are
showed as mean ± S.E.M. (6–8 rats/group) and significant effects are depicted with
different letters (p < 0.05).
4. Discussion
A growing body of evidence demonstrates that endocrine
disruptors can interfere with endocrine-related systems at envi-
ronmentally relevant doses [24–26]. These findings demand studies
141
Fig. 2. Quantification of ER␣ protein in the uterine luminal epithelium (A), glandu-
lar epithelium (B), and stroma (C). Data are expressed as IOD, which is measured as
a linear combination between the average immunostained density and the relative
area occupied by positive cells in each histological compartment. Each column rep-
resents the mean ± S.E.M. of 6–8 rats/group (means with different letters represent
statistically significant differences p < 0.05).
that investigate biological effects of hormonally active compounds
using a wide range of doses and with appropriate positive controls
[16]. In this work, we show that endosulfan is able to modulate
uterine estrogen-sensitive genes at the mRNA and protein levels
using a model of adult OVX rats. An interesting result is the obser-
vation that endosulfan mimics the effects of a non-uterotrophic
low dose of E2 but fails to reproduce the effects observed after
the injection of a high, uterotrophic dose of the hormone. To our
knowledge this is the first report that demonstrates that endosul-
142 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Fig. 3. Quantification of PR protein expression in uterine sections of experimental
animals. Data are expressed as IOD in the luminal epithelium (A), glandular epithe-
lium (B), and stroma (C). Each column represents the mean ± S.E.M. of 6–8 rats/group
and significant effects are depicted with different letters (p < 0.05).
fan can influence ER␣ and PR expression in the rat uterus at doses
100 times smaller than the NOEL dose and similar to the acceptable
daily intake level established by the US Environmental Protection
Agency [8,9]. Our results have to be interpreted with care since
we are unaware if endosulfan exposure produces alterations in the
reproductive tract physiology. However, since ER␣ and PR are cru-
cial molecules in the endocrine control of many uterine processes,
and due to the widespread use of endosulfan in many agriculture-
based economies, our results might be used as a starting point for
in vivo experiments investigating the effects of low doses of endo-
sulfan in the development and function of the female reproductive
tract.
Most of the previous works have shown that endosulfan inter-
feres with reproductive processes at doses several orders of
magnitude over the Rfd or the tolerated daily intake [12,13]. This
kind of work is useful to establish the endocrine action of endosul-
fan and the possible biological targets influenced by its hormonal
activity using in vivo conditions. However, low dose studies are
essential to clarify whether exposure to environmentally relevant
doses of hormonally active compounds constitutes a public health
problem.
The effects of endocrine disruptors, like endosulfan, have to be
evaluated at different levels of organization [27]. In the present
work, the uterotrophic assay was selected as a classic test to eval-
uate estrogenic activity at a level of organization that includes
the whole organ. In accordance with previous findings [12],
endosulfan was not able to increase the uterus wet weight at
any of the evaluated doses. The uterotrophic actions of estro-
genic substances involve multiple events like fluid imbibition,
hypertrophy/hyperplasia, secretory protein production, and cellu-
lar proliferation [28,29]. The events that contribute to the increase
in uterine wet weight are regulated by different gene cascades and
multiple molecular pathways. The uterotrophic bioassay implies
that an estrogenic compound must act at most of the molecular
and cellular levels that lead to an increase in uterine wet weight. It
is well known that activating most or all of these low level mech-
anisms is dependent not only of the chemical properties of the
substance but the dose utilized in the experiment. In this work,
we observed that a low dose of E2 was not able to induce changes
in biological responses at a high level of organization (such as uter-
ine wet weight and epithelial cell height), but was very active in
inducing changes in individual estrogen-responsive genes such as
ER␣, C3 and PR. While the UE2 dose of E2 induced an increase in
PR and C3 mRNA expression, the non-uterotrophic dose produced a
down-regulation of these genes. The mechanisms underlying these
effects are unknown; however, the similarities observed between
NUE2 and endosulfan actions on estrogen-sensitive genes suggest
that both substances could activate similar molecular pathways.
Several molecules have been implicated in the control of
estrogen-sensitive gene transcription [30]. Although in vitro studies
have shown that many chemicals such as phthalates, alkylphenols,
bisphenol A and dichlorodiphenyltrichloroethane (DDT) display
estrogenic actions, mainly through their binding to estrogen recep-
tors [31], it is not clear how endocrine disruptors directly affect
hormonal functions through receptor-mediated transcription in
vivo. These receptors form homodimers or heterodimers with other
members of the nuclear receptor superfamily and directly asso-
ciate with specific DNA sequences known as hormone-responsive
elements located in the promoters of specific genes [32,33].
The DNA–receptor complex interacts with basal transcriptional
machinery and nuclear receptor coactivator proteins, resulting in
the ligand-dependent induction of transcription [33,34]. Some ele-
gant studies have demonstrated that many endocrine disruptor
chemicals and selective estrogen receptor modulators (SERMs)
can change transcription cofactor levels in the promoter region of
estrogen-dependent genes, modifying the transcription rate and
the association with repressors [35,36]. An active repressor action
as a result of changes in corepressor recruitment in the promoter
region of C3 and PR genes could explain the diminished expres-
sion observed in endosulfan and NUE2 -treated animals. Previous
works have demonstrated that endosulfan can transactivate ER␣ in
vitro [10]. In our experiments, the down-regulation of ER␣ protein
observed in the UE2 , NUE2 and endosulfan-treated animals sug-
gests that ER␣ is involved in endosulfan action. Many experiments
are being performed in our lab to elucidate these hypotheses.
 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145 143

Fig. 4. Representative photomicrographs of immunohistochemical detection of uterine ER␣ (A–D) and PR (E–H) from adult OVX rats injected with: sesame oil (control; A
and E), E2 in an uterotrophic dose of 0.02 mg/kg/day (UE2 group; B and F), E2 in a non-uterotrophic dose of 0.0002 mg/kg/day (NUE2 group; C and G); or 0.006 mg/kg/day of
endosulfan (Endo0.006; D and H). Control rats showed a high constitutive expression of ER␣ (A); in contrast the UE2 rats showed a down-regulation of ER␣ protein in all
histological compartments (B). NUE2 (C) and endosulfan-treated rats (D) only exhibited ER␣ down regulation in the subepithelial stroma. PR protein was strongly induced
in the stroma of UE2 -treated while the luminal and glandular epithelium showed a clear down regulation compared to controls (E vs. F). In NUE2 (G) and Endo0.006 (H)
rats a significant decrease in PR was detected only in glandular epithelial cells without changes in the luminal epithelium and stroma. LE, luminal epithelium; GE, glandular
epithelium; St, subepithelial stroma. Scale bar: 50 ␮m.
144 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
Another possible mechanism involved in the xenoestrogen-
mediated disruption is differential promoter usage of ER target
genes. In a previous work, we showed that perinatal exposure to
xenoestrogens can change the promoter region that regulates ER␣
gene transcription in the rat preoptic brain [19]. In other work,
we demonstrated that low and high doses of E2 can differentially
regulate the splicing of the rat ER␣ mRNA coding region [18].
Selective promoter usage and alternative mRNA splicing events are
estrogen-dependent mechanisms of ER␣ gene variation, and could
be involved in the differential response of estrogen-sensitive genes
to different doses of E2 or to hormonally active substances. It has
been demonstrated that an estrogen-sensitive gene could be differ-
entially regulated depending on the composition and kinetics of the
transcription machinery assembly on the promoter regions of the
gene [30,37]. SERMs are able to interact with estrogen receptors,
but produce different biological actions than natural estrogens like
E2 . One of the mechanisms that underlie these events is the differ-
ential cofactor recruitment of the transcription control machinery
that SERMs substances could induce in the regulatory regions of
estrogen-dependent targets [36,38]. In addition, it has been shown
that the differential occupancy of the two described estrogen recep-
tors (ER␣ and ER␤) could be a possible mechanism of action of
SERMs that influences the recruitment patterns of coregulators
[39]. Taking into account our results, it will be interesting to know
whether endosulfan and estradiol at non-uterotrophic doses recruit
the same cofactors in the promoter regions of PR and C3.
Endosulfan exposure during critical reproductive events like
early gestation could disrupt many molecular interactions between
the uterine wall and the embryos. Previous results showed that
endosulfan exposure to pregnant mice affects the implantation rate,
however the mechanisms underlying this disruption is not well
understood [40]. According to our results an altered expression of
critical genes like ER␣ and/or PR in different uterine compartments
of endosulfan exposed animals could contribute to an increase in
the implantation failures.
It is interesting to comment that women harboring uterine
neoplasias have higher serum burdens of some organochlorine
pesticides, such as endosulfan, than unaffected women [41]. A com-
mon feature of organochlorines is their persistence and tendency
to accumulate in fatty tissues, a characteristic that makes them
arguably suspect as etiological agents in cancer of reproductive
tissues.
Endocrine disruptor toxicology has brought new insights in the
comprehension of hormone action at different levels of tissue orga-
nization. The actions of hormonally active substances at very low
doses and the importance of the careful selection of the biological
targets constitute new paradigms that demonstrate the complex-
ity of the interactions between the environment and the individual
components of an ecosystem.
Conflict of interest
The authors declare that there are no conflicts of interest.
Acknowledgements
The authors thank Mr. Juan C. Villarreal and Mr. Juan Grant
for their technical assistance and animal care. This study was
supported by grants from the Argentine National Council for Sci-
ence and Technology (CONICET, CIC Grant 652/04), the Argentine
National Agency for the Promotion of Science and Technology
(ANPCyT) (PICT 2003, No. 13-4737) and the Universidad Nacional
del Litoral (CAI+D 2005 019/118 and 019/119). L.M. and T.B are
fellows of the CONICET and the Universidad Nacional del Litoral
respectively. J.V., E.H.L., and J.G.R. are career investigators of the
CONICET.
References
[1] Colborn T, vom Saal FS, Soto AM. Developmental effects of endocrine-disrupting
chemicals in wildlife and humans. Environ Health Perspect 1993;101:378–84.
[2] Ramos JG, Varayoud J, Kass L, Rodriguez H, Costabel L, Muñoz-de-Toro M, Luque
EH. Bisphenol A induces both transient and permanent histofunctional alter-
ations of the hypothalamic–pituitary–gonadal axis in prenatally exposed male
rats. Endocrinology 2003;144:3206–15.
[3] Stoker C, Rey F, Rodriguez H, Ramos JG, Sirosky P, Larriera A, Luque EH,
Muñoz-de-Toro M. Sex reversal effects on Caiman latirostris exposed to environ-
mentally relevant doses of the xenoestrogen bisphenol A. Gen Comp Endocrinol
2003;133:287–96.
[4] Muñoz-de-Toro M, Beldomenico HR, Garcia SR, Stoker C, De Jesus JJ, Bel-
domenico PM, Ramos JG, Luque EH. Organochlorine levels in adipose tissue
of women from a littoral region of Argentina. Environ Res 2006;102:107–12.
[5] Sutherland TD, Home I, Weir KM, Russell RJ, Oakeshott JG. Toxicity and residues
of endosulfan isomers. Rev Environ Contam Toxicol 2004;183:99–113.
[6] Blasco C, Lino CM, Pico Y, Pena A, Font G, Silveira MI. Determination of
organochlorine pesticide residues in honey from the central zone of Portugal
and the Valencian community of Spain. J Chromatogr A 2004;1049:155–60.
[7] Carreño J, Rivas A, Granada A, Jose Lopez-Espinosa M, Mariscal M, Olea N, Olea-
Serrano F. Exposure of young men to organochlorine pesticides in Southern
Spain. Environ Res 2007;103:55–61.
[8] ATSDR Toxicological profile for endosulfan. Agency for Toxic Substances and
Disease Registry, Division of Toxicology, Atlanta, GA, 2000.
[9] Marshall I, Rutherford S. Health investigation level for endosulfan in soil. In:
Proceedings of the fifth national workshop on the assessment of site contami-
nation. 2003. p. 217–23.
[10] Hunter DS, Hodges LC, Vonier PM, Fuchs-Young R, Gottardis MM, Walker CL.
Estrogen receptor activation via activation function 2 predicts agonism of
xenoestrogens in normal and neoplastic cells of the uterine myometrium. Can-
cer Res 1999;59:3090–9.
[11] Lemaire G, Mnif W, Mauvais P, Balaguer P, Rahmani R. Activation of alpha- and
beta-estrogen receptors by persistent pesticides in reporter cell lines. Life Sci
2006;79:1160–9.
[12] Newbold RR, Jefferson WN, Padilla-Banks E, Walker VR, Pena DS. Cell response
endpoints enhance sensitivity of the immature mouse uterotropic assay. Reprod
Toxicol 2001;15:245–52.
[13] Dalsenter PR, Dallegrave E, Mello JRB, Langeloh A, Oliveira RT, Faqi AS. Reproduc-
tive effects of endosulfan on male offspring of rats exposed during pregnancy
and lactation. Hum Exp Toxicol 1999;18:583–9.
[14] Dalsenter PR, de Araujo SL, de Assis HC, Andrade AJ, Dallegrave E. Pre and post-
natal exposure to endosulfan in Wistar rats. Hum Exp Toxicol 2003;22:171–5.
[15] Ashby J, Tinwell H, Odum J, Lefevre P. Natural variability and the influence of
concurrent control values on the detection and interpretation of low-dose or
weak endocrine toxicities. Environ Health Perspect 2004;112:847–53.
[16] vom Saal FS, Welshons WV. Large effects from small exposures. II. The impor-
tance of positive controls in low-dose research on bisphenol A. Environ Res
2006;100:50–76.
[17] Montes GS, Luque EH. Effects of ovarian steroids on vaginal smears in the rat.
Acta Anat (Basel) 1988;133:192–9.
[18] Varayoud J, Ramos JG, Monje L, Bosquiazzo V, Muñoz-de-Toro M, Luque
EH. The estrogen receptor alpha sigma3 mRNA splicing variant is differen-
tially regulated by estrogen and progesterone in the rat uterus. J Endocrinol
2005;186:51–60.
[19] Monje L, Varayoud J, Luque EH, Ramos JG. Neonatal exposure to bisphenol A
modifies the abundance of estrogen receptor {alpha} transcripts with alter-
native 5 -untranslated regions in the female rat preoptic area. J Endocrinol
2007;194:201–12.
[20] Ramos JG, Varayoud J, Sonnenschein C, Soto AM, Munoz De Toro M, Luque EH.
Prenatal exposure to low doses of bisphenol A alters the periductal stroma and
glandular cell function in the rat ventral prostate. Biol Reprod 2001;65:1271–7.
[21] Ramos JG, Varayoud J, Bosquiazzo VL, Luque EH, Muñoz-de-Toro M. Cellular
turnover in the rat uterine cervix and its relationship to estrogen and proges-
terone receptor dynamics. Biol Reprod 2002;67:735–42.
[22] Castleman KR. Digital image processing. Englewood Cliffs, NJ: Prentice Hall
Press; 1996.
[23] Vik DP, Amiguet P, Moffat GJ, Fey M, Amiguet-Barras F, Wetsel RA, Tack BF. Struc-
tural features of the human C3 gene: intron/exon organization, transcriptional
start site, and promoter region sequence. Biochemistry 1991;30:1080–5.
[24] vom Saal FS, Hughes C. An extensive new literature concerning low-dose effects
of bisphenol A shows the need for a new risk assessment. Environ Health Per-
spect 2005;113:926–33.
[25] Durando M, Kass L, Piva J, Sonnenschein C, Soto AM, Luque EH, Muñoz-de-
Toro M. Prenatal bisphenol A exposure induces preneoplastic lesions in the
mammary gland in Wistar rats. Environ Health Perspect 2007;115:80–6.
[26] Kilian E, Delport R, Bornman MS, Jager C. Simultaneous exposure to low concen-
trations of dichlorodiphenyltrichloroethane, deltamethrin, nonylphenol and
phytoestrogens has negative effects on the reproductive parameters in male
Spraque–Dawley rats. Andrologia 2007;39:128–35.
 J. Varayoud et al. / Reproductive Toxicology 26 (2008) 138–145
[27] Vandenberg LN, Wadia PR, Schaeberle CM, Rubin BS, Sonnenschein C, Soto AM.
The mammary gland response to estradiol: monotonic at the cellular level,
non-monotonic at the tissue-level of organization? J Steroid Biochem Mol Biol
2006;101:263–74.
[28] Branham WS, Zehr DR, Sheehan DM. Differential sensitivity of rat uterine
growth and epithelium hypertrophy to estrogens and antiestrogens. Proc Soc
Exp Biol Med 1993;203:297–303.
[29] Buchanan DL, Setiawan T, Lubahn DB, Taylor JA, Kurita T, Cunha GR, Cooke
PS. Tissue compartment-specific estrogen receptor-alpha participation in the
mouse uterine epithelial secretory response. Endocrinology 1999;140:484–91.
[30] Barnes CJ, Vadlamudi RK, Kumar R. Novel estrogen receptor coregulators and
signaling molecules in human diseases. Cell Mol Life Sci 2004;61:281–91.
[31] Cooper RL, Kavlock RJ. Endocrine disrupters and reproductive development: a
weight-of-evidence overview. J Endocrinol 1997;152:159–66.
[32] Evans RM. The steroid and thyroid hormone receptor superfamily. Science
1988;240:889–95.
[33] Mangelsdorf DJ, Evans RM. The RXR heterodimers and orphan receptors. Cell
1995;83:841–50.
[34] McKenna NJ, O’Malley BW. Combinatorial control of gene expression by nuclear
receptors and coregulator. Cell 2002;108:465–74.
[35] Inoshita H, Masuyama H, Hiramatsu Y. The different effects of endocrine-
disrupting chemicals on estrogen receptor-mediated transcription through
145
interaction with coactivator TRAP220 in uterine tissue. J Mol Endocrinol
2003;31:551–61.
[36] Fleming FJ, Hill AD, McDermott EW, O’Higgins NJ, Young LS. Differential
recruitment of coregulator proteins steroid receptor coactivator-1 and silencing
mediator for retinoid and thyroid receptors to the estrogen receptor-estrogen
response element by beta-estradiol and 4-hydroxytamoxifen in human breast
cancer. J Clin Endocrinol Metab 2004;89:375–83.
[37] Martini PG, Katzenellenbogen BS. Modulation of estrogen receptor activity by
selective coregulators. J Steroid Biochem Mol Biol 2003;85:117–22.
[38] Sasaki H, Hayakawa J, Terai Y, Kanemura M, Tanabe-Kimura A, Kamegai H, Seino-
Noda H, Ezoe S, Matsumura I, Kanukura Y, Sakata M, Tasaka K, Ohmichi M.
Difference between genomic actions of estrogen versus raloxifene in human
ovarian cancer cell lines. Oncogene 2008;27:2737–45.
[39] Chang EC, Charn TH, Park SH, Helferich WG, Komm B, Katzenellenbogen
JA, Katzenellenbogen BS. Estrogen receptors alpha and beta as determinants
of gene expression: influence of ligand, dose, and chromatin binding. Mol
Endocrinol 2008;22:1032–43.
[40] Hiremath MB, Kaliwal BB. The anti-implantation action of endosulfan in albino
mice: possible mechanisms. J Basic Clin Physiol Pharmacol 2002;13:329–40.
[41] Saxena SP, Khare C, Farooq A, Murugesan K, Buckshee K, Chandra J. DDT and its
metabolites in leiomyomatous and normal human uterine tissue. Arch Toxicol
1987;59:453–5.