Gene 522 (2013) 89–95

Contents lists available at SciVerse ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Familial porphyria cutanea tarda in Spain: Characterization of eight novel mutations

in the UROD gene and haplotype analysis of the common p.G281E mutation
Sara Gómez-Abecia a, María-Josefa Morán-Jiménez a, Eva Ruiz-Casares b, Nuno Henriques-Gil b,
Inmaculada García-Pastor a, María-Concepción Garrido-Astray a, c,
Rafael Enríquez de Salamanca a, d, Manuel Méndez a,⁎
a
Centro de Investigación, Instituto de Investigación Hospital 12 de Octubre, Madrid, Spain
b
Área de Genética, Facultad de Medicina, Universidad CEU San Pablo, Campus de Montepríncipe, Madrid, Spain
c
Departamento de Ciencias Morfológicas y Biomedicina, Facultad de Ciencias de la Salud, Universidad Europea de Madrid, Villaviciosa de Odón, Madrid, Spain
d
Facultad de Medicina, Universidad Complutense, Madrid, Spain

a r t i c l e i n f o a b s t r a c t

Article history: Porphyria cutanea tarda (PCT) results from decreased activity of uroporphyrinogen decarboxylase (UROD) in
Accepted 16 March 2013 the liver. Deficiency in this enzyme results in accumulation of highly carboxylated porphyrins responsible for
Available online 29 March 2013 the disease. PCT usually occurs in adulthood and is characterized by cutaneous photosensitivity,
hyperpigmentation, skin fragility and hypertrichosis. Familial PCT (F-PCT) occurs in 20–30% of patients in
Keywords:
whom UROD gene mutations in heterozygosity decrease the enzymatic activity to about 50% in all tissues.
Porphyria
Uroporphyrinogen decarboxylase
The rare homozygous form of F-PCT (hepatoerythropoietic porphyria) has more severe clinical features
Mutation analysis and onset in childhood. In Spain, F-PCT is molecularly heterogeneous and the most frequent UROD mutation
Splicing defect is p.G281E. In the present study, we searched for the molecular defect causing F-PCT in a group of Spanish
Prokaryotic expression patients and investigated whether the p.G281E mutation in the Spanish population came from a single or
Haplotype analysis various origins. Among seventeen F-PCT patients, sixteen UROD mutations were identified, including eight
novel ones: six missense (p.A23V, p.L78P, p.W180G, p.T196I, p.E278G and p.V279M), one frameshift
(c.233delT) and one splice site mutation (c.774G>C). Prokaryotic expression studies showed the detrimental
effect for each missense mutation, whereas reverse transcription-PCR and sequencing demonstrated that the
novel splice site mutation caused exon 7 skipping. Moreover, haplotype analysis performed in Spanish fam-
ilies with the p.G281E mutation indicated that this lesion is associated with at least five haplotype back-
grounds. These results extend knowledge on the molecular heterogeneity of F-PCT and suggest multiple
origins of the p.G281E mutation.
© 2013 Elsevier B.V. All rights reserved.

1. Introduction and is frequently associated with exposure to known precipitating

Porphyria cutanea tarda (PCT; OMIM: 176100) is the most com-
mon type of porphyria and results from decreased activity of
uroporphyrinogen decarboxylase (UROD; E.C.4.1.1.37). This cytosolic
protein is the fifth enzyme of the heme biosynthetic pathway and cat-
alyzes the sequential decarboxylation of the four acetate side chains
of uroporphyrinogen to form coproporphyrinogen (Anderson et al.,
2001; Jackson et al., 1976). The disease usually occurs in adult life
Abbreviations: UROD, uroporphyrinogen decarboxylase; PCT, porphyria cutanea
tarda; F-PCT, familial porphyria cutanea tarda; S-PCT, sporadic porphyria cutanea tarda;
HEP, hepatoerythropoietic porphyria.
⁎ Corresponding author at: Centro de Investigación, Instituto de Investigación Hospital
12 de Octubre, Avenida de Córdoba s/n, 28041 Madrid, Spain. Tel.: +34 91 390 8768;
fax: +34 91 390 8544.
E-mail address: mmendez@h12o.es (M. Méndez).
factors, including iron overload, alcohol abuse, use of estrogens, hep-
atitis C virus infection and certain polyhalogenated compounds
(Anderson et al., 2001; Bulaj et al., 2000; Cruz-Rojo et al., 2002;
Elder, 1998; Fargion et al., 1992; Méndez et al., 2005; Morán et al.,
1998; Muñoz-Santos et al., 2010; Nordmann and Puy, 2002). Hepatic
siderosis is a common finding and the inheritance of mutations in the
hemochromatosis gene (HFE) is frequently observed in PCT patients
(Alla and Bonkovsky, 2005; Bulaj et al., 2000; Nordmann and Puy,
2002). Moreover, a highly inducible genotype in the cytochrome
P450 1A2 gene (Cyp1A2) may also be associated with susceptibility
to PCT (Wickliffe et al., 2011). The clinical expression of PCT is a con-
sequence of a markedly enzymatic deficiency in the liver caused by a
competitive UROD inhibitor (uroporphomethene) generated in an
iron-dependent oxidation reaction of uroporphyrinogen (Phillips
et al., 2007). In patients with PCT porphyrinogens are accumulated
in the liver, mainly uroporphyrinogen and heptaporphyrinogen,
which are oxidized to the corresponding porphyrins that circulate in

0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.gene.2013.03.074
90 S. Gómez-Abecia et al. / Gene 522 (2013) 89–95
plasma and are excreted in urine (Anderson et al., 2001; Elder, 1998).
The overproduction of porphyrins causes the principal clinical mani-
festations of the disease, cutaneous photosensitivity leading to blis-
tering on areas exposed to sun, skin fragility, hyperpigmentation,
and hypertrichosis (Anderson et al., 2001).
There are two main forms of PCT: sporadic (S-PCT or type I) and fa-
milial (F-PCT or type II) (Anderson et al., 2001; de Verneuil et al., 1978;
Elder et al., 1989). Familial PCT (20–30% of patients) is an autosomal
dominant disorder with low penetrance in which heterozygosity for
mutations in the UROD gene reduce the UROD activity to about 50% in
all tissues predisposing carriers to clinical manifestations. Most patients
have the sporadic form of PCT, that is not associated to mutations in the
UROD gene and the enzyme deficiency is restricted to the liver. Another
form of PCT can be distinguished (type III), in which diminished UROD
activity is also limited to the liver but, while the S-PCT does not show a
familial pattern, this third type of PCT is associated with a positive fam-
ily history for the disease (Elder et al., 1989). The rare homozygous form
of F-PCT is referred to as hepatoerythropoietic porphyria (HEP), and is
characterized by the onset in early childhood with more severe clinical
features than PCT, resembling that of congenital erythropoietic por-
phyria (Anderson et al., 2001).
The human UROD gene has been mapped to chromosomal region
1p34 (Dubart et al., 1986), spans a genomic interval of 3.6 kb, contains
a single promoter, and 10 exons (Morán-Jiménez et al., 1996; Romana
et al., 1987). Its mRNA has 1.2 kb and encodes a 367 amino acid poly-
peptide with a molecular weight of approximately 41 kDa (Romeo et
al., 1986). The native human UROD protein is a homodimer that be-
longs to the (α/β)8 barrel family (Whitby et al., 1998). So far, 113
disease-associated mutations have been described in the UROD gene
found in F-PCT and/or HEP patients (Human Gene Mutation Database
(HGMD), http://www.hgmd.cf.ac.uk/ac/index.php, accessed in No-
vember 2012). In addition to these mutations, several polymorphisms
in coding and noncoding regions of the gene were also reported
(Aarsand et al., 2009; Brady et al., 2000; Cappellini et al., 2001;
Christiansen et al., 2000; Méndez et al., 1998, 2000). In Spain, F-PCT
shows a high molecular heterogeneity with 28 different UROD muta-
tions identified to date (Badenas et al., 2009; Christiansen et al.,
1999; Méndez et al., 2007; Roberts et al., 1995). Among these muta-
tions, p.G281E is the most common and was identified in both F-PCT
and HEP patients (Darwich et al., 2010; Méndez et al., 2007;
Morán-Jiménez et al., 1996; Roberts et al., 1995).
In the present study, we searched for the molecular defect causing
F-PCT in seventeen unrelated Spanish patients. Moreover, we
performed haplotype analysis in Spanish families with the p.G281E
mutation to investigate whether this mutation could have a single or-
igin or resulted from a number of independent origins.
2. Material and methods
2.1. Patients and biochemical determinations
This study included seventeen unrelated Spanish F-PCT patients,
thirteen males and four females diagnosed at Hospital 12 de Octubre
(Madrid, Spain). In addition, eight subjects (3 probands and 5 rela-
tives) were also included for haplotype analysis of the p.G281E
mutation, four males and four females who came from three Spanish
families previously reported and attended the same hospital
(Méndez et al., 2007; Morán-Jiménez et al., 1996; Roberts et al.,
1995). All individuals provided informed consent before inclusion in
the study and the whole project, which conformed to the guidelines
of the Declaration of Helsinki, was approved by the institutional Ethics
Committee of Hospital 12 de Octubre.
PCT diagnosis was established on the basis of typical cutaneous
lesions associated with elevated amounts of porphyrins in plasma
(porphyrin emission peak at 618 nm) and increased excretion of
porphyrins in urine with predominance of uroporphyrin and
heptaporphyrin. All the patients were asked about the presence of
disease-precipitating factors, and this information was completed
from their clinical histories. The onset age of clinical manifestations
and family history of the disease were also recorded.
Erytrocyte UROD activity was measured using pentaporphyrinogen I
(Porphyrins Products Inc., Logan, UT, USA) as substrate, as previously
described (de Verneuil et al., 1984). The resulting porphyrinogens
were oxidized to the corresponding porphyrins by white light illumina-
tion for 20 min. The samples were then clarified by centrifugation, fil-
tered through 0.2 μm filters (Whatman Int., Maidstone, UK) and
analyzed by high-performance liquid chromatography (HPLC) in a
Shimadzu apparatus (Shimadzu, Kyoto, Japan), using a C18 reverse-
phase Hypersil ODS (5 μm, 250 mm × 4.6 mm) column (Hichrom
Ltd., Reading, UK), in accordance with the method of Lim et al. (1983).
Porphyrins were detected fluorometrically with excitation at 400 nm
and emission at 618 nm. The specific activity was calculated as pmol
of coproporphyrinogen I/h/mg hemoglobin.
2.2. Mutation analysis of the UROD gene
Blood samples were collected in tubes containing ethylenediamine
tetraacetic acid (EDTA) as anticoagulant, and genomic DNA was
extracted using the Speedtools DNA extraction kit (Biotools, Madrid,
Spain). The entire UROD gene was amplified either, in a single amplicon
by Long Range PCR or in five overlapping PCR fragments, using primer
pairs and conditions described by Méndez et al. (1998, 2000). PCR prod-
ucts were purified using the Speedtools PCR clean up kit (Biotools), and
sequenced using the Big Dye Terminator V3.1 Cycle Sequencing kit
(Applied Biosystems, Foster City, CA, USA) following the manufacturer's
instructions. Sequencing reactions were purified using the Montage
SEQ96 Sequencing Reaction Cleanup Kit (Millipore, Billerica, MA, USA)
and analyzed on an ABI 3130 xl Genetic Analyzer (Applied Biosystems).
All mutations were confirmed by sequencing both strands of at least
two different PCR products. Nucleotides were numbered according to
the cDNA sequence derived from the UROD genomic sequence
(GenBank accession no. AF047383 (Méndez et al., 1998)), in which
the A of the ATG translation-initiation codon is numbered as +1.
2.3. RNA analysis
To determine if the mutation c.774G>C causes aberrant splicing, the
patient's UROD mRNA was studied by reverse transcription-PCR
(RT-PCR) and sequencing. Leukocytes were isolated from EDTA-
anticoagulated blood using Ficoll–Paque Plus (Amersham Biosciences,
Uppsala, Sweden), and total RNA was extracted using TRIzol Reagent
(Invitrogen, Carlsbad, CA, USA). Reverse transcription was carried out
with an oligo(dT) primer and eAMV reverse transcriptase (Sigma-
Aldrich, Inc. St. Louis, MO, USA). Subsequently, the full-length UROD
cDNA was amplified with the primers previously published (Méndez
et al., 1998), and the RT-PCR products were run on a 1% agarose gel.
Each band was cut out of the gel and the DNA was purified using the
Speedtools PCR clean up kit (Biotools), and sequenced as described in
Section 2.2.
2.4. Prokaryotic expression of missense mutations
Eight missense mutations, the six novel and two previously
reported (p.G281E and p.W284R) were expressed in Escherichia coli
strain JM109 (Promega, Madison, WI, USA), using the expression vec-
tor pKK223-3 (Pharmacia Biotech Inc., Piscataway, NJ, USA). The
pKK–UROD-wt plasmid in which the wild-type human UROD cDNA
was cloned into the EcoRI–HindIII sites of the pKK223-3 was used as
the normal construct (Méndez et al., 2007). All mutant constructs
were obtained by replacing a fragment in pKK–UROD-wt with the
equivalent mutagenized fragment synthesized by PCR-based site
directed mutagenesis (Cormack, 1991; Méndez et al., 1998). The
 S. Gómez-Abecia et al. / Gene 522 (2013) 89–95
fragments of UROD cDNA containing the desired mutation and re-
striction sites for cloning were generated in one or two PCR steps
with the primers indicated in Table 1 and using the normal construct
as the template. For mutation p.A23V, an amplicon with the mutation
and restriction sites for EcoRI and KpnI was generated in one PCR step
using the primer pair S(A23V)/AS(E5). A similar procedure was
employed to obtain a fragment carrying the p.L78P mutation and re-
striction sites for PstI and AvaIII, using the primer pair S(L78P)/
AS(E9). For the mutations p.W180G, p.T196I, p.E278G, p.V279M,
p.G281E and p.W284R, two PCR steps were performed to obtain an
amplicon with the desired mutation and restriction sites for KpnI
and HindIII: firstly, two overlapping PCR fragments containing the
mutation and a restriction site for either, KpnI (in PCR-1) or HindIII
(in PCR-2) were generated individually and then, both PCR products
were ligated in a second PCR step (PCR-3). For each mutation, the
PCR-1 was performed using the primer sense S(E5) and the respec-
tive mutagenic antisense primer, whereas PCR-2 was done with the
corresponding mutagenic sense and the antisense AS(E10) primers.
The two PCR products were then used together as templates in the
PCR-3, using the primers S(E5) and AS(E10). Then, for each mutation
the final PCR product was digested with the respective restriction en-
donucleases (MBI Fermentas, Quimigen, Spain): EcoRI and KpnI (for
p.A23V), PstI and AvaIII (for p.L78P), and KpnI and HindIII (for the
remaining mutations). Each mutant fragment was purified using the
Speedtools PCR clean up kit (Biotools, Madrid, Spain) and ligated
using T4 DNA ligase (Roche, Mannheim, Germany) into the pKK–
UROD-wt cut with the same enzymes. The resulting plasmids were
transformed into E. coli JM109, thus generating the mutant constructs
pKK–UROD–A23V, pKK–UROD–L78P, pKK–UROD–W180G, pKK–
UROD–T196I, pKK–UROD–E278G, pKK–UROD–V279M, pKK–UROD–
G281E and pKK–UROD–W284R. The integrity of each expression con-
struct was checked by automated sequencing in an ABI 3130 xl Ge-
netic Analyzer (Applied Biosystems, Foster City, CA, USA), using the
Big Dye Terminator V3.1 Cycle Sequencing kit (Applied Biosystems).
Bacterial clones containing either the pKK223-3 vector or any of the
pKK–UROD expression constructs were grown to log phase and induced
with 5 mM isopropylthiogalactoside (IPTG) (MBI Fermentas, Quimigen,
Spain) for 3 h. The cells were harvested by centrifugation and washed
twice in phosphate-buffered saline. Cell pellets were resuspended in
Table 1
Primers used for expression studies.
Primer Sequence (5′ → 3′)
S (E5) GGTGACCATGGTACCTGGCAAAGG
AS (E5) CTTTGCCAGGTACCATGGTC
AS (E9) CTCAGATGCATACAAGGCACAGG
AS (E10) CCCAAGCTTTCAGTTCTGTCGAAG
S (A23V) CCGGAATTCATGGAAGCGAATGGGTTGGGACCTCAGGGTTTT
CCGGAGCTGAAGAATGACACATTCCTGCGAGCAGtCTGGGGA
S (L78P) GACTCTGCAGCCACTGCGTCGCTTCCCTCcGGATGCT
S (W180G) TCAGGCCAAGCGCgGGCTCTATCAGAGACCT
AS (W180G) AGGTCTCTGATAGAGCCcGCGCTTGGCCTGA
S (T196I) AGCTGCTTCGCATCCTCAtTGATGCTCTGGT
AS (T196I) ACCAGAGCATCAaTGAGGATGCGAAGCAGCT
S (E278G) CAAGCTGGCTATGgGGTGGTTGGGCTTGAC
AS (E278G) GTCAAGCCCAACCACCcCATAGCCAGCTTG
S (V279M) CAAGCTGGCTATGAGaTGGTTGGGCTTGAC
AS (V279M) GTCAAGCCCAACCAtCTCATAGCCAGCTTG
S (G281E) GGCTATGAGGTGGTTGaGCTTGACTGGACAG
AS (G281E) CTGTCCAGTCAAGCtCAACCACCTCATAGCC
S (W284R) GAGGTGGTTGGGCTTGACcGGACAGTGG
AS (W284R) CCACTGTCCgGTCAAGCCCAACCACCTC
The nucleotides underlined indicate the restriction sites for the endonucleases kpnI
(in S (E5) and AS (E5)), AvaIII (in AS (E9)), HindIII (in AS (E10)), EcoRI in S (A23V),
and PstI (in S (L78P)). In the mutagenic primers the mutated base is indicated by
bold lower case letters. S: sense; AS: antisense.
91
lysis buffer (250 mM potassium phosphate, pH 6.0, 0.1% Triton-X
100) and disrupted by sonication. The bacterial lysates were centrifuged
and the UROD activity was measured in the supernatants as was carried
out in the patients (de Verneuil et al., 1984; Lim et al., 1983). The
specific activity was calculated as nmol of coproporphyrinogen I/h/mg
protein. Residual activity was determined from the mean specific
activities (SA) of four independent experiments by dividing 100 ×
(SA − SA[pKK223-3]) by (SA[pKK–UROD-wt] − SA[pKK223-3]).
To study the thermal stability of UROD mutants p.A23V, p.T196I,
p.V279M and p.G281E, the supernatants containing normal or mutant
UROD enzymes were diluted in 250 mM potassium phosphate pH 7.0
to obtain the same protein concentration (1 mg/ml). They were
preincubated for varying times, from 0 to 60 min. at 55 °C, then
placed on ice, and UROD activity was measured as described above.
2.5. Haplotype analysis
The c.842G>A (p.G281E) mutation identified in a proband of this
study, had been found previously in three Spanish probands who
attended Hospital 12 de Octubre, two homozygous HEP (born from
non-consanguineous parents) and one F-PCT (Méndez et al., 2007;
Morán-Jiménez et al., 1996; Roberts et al., 1995). To investigate whether
the mutation in these patients came from a common origin or arose
from independent mutational events, haplotype analysis was carried
out. The analysis was performed in the four probands and their available
relatives using five polymorphic CA-repeat markers from the short arm
of chromosome 1, around the UROD gene (Dib et al., 1996); (Centre
d'Etude du Polymorphisme Humain (CEPH), http://www.cephb.fr/en/
cephdb/browser.php). Moreover, the entire UROD gene was sequenced
in all individuals (as described in Section 2.2) to search for possible in-
tragenic polymorphisms. The order of the five markers surrounding
the UROD gene were: D1S193 (41.14)–D1S211 (42.35)–D1S2713
(42.63)–UROD gene (43.59)–D1S2797 (45.05)–D1S2724 (47.35), with
the respective chromosomal localizations (Mbp) depicted in parenthe-
ses (HuRef-Primary Assembly, http://www.ncbi.nlm.nih.gov/unists).
Each flanking marker was PCR-amplified and analyzed on polyacryl-
amide gel electrophoresis as previously described (Gelb et al., 1995;
Gyapay et al., 1994). Alleles were numbered consecutively according
to their decreasing sizes, number 1 being the longest identified.
3. Results
3.1. Mutations identified in the UROD gene
In each proband, we have identified a mutation in heterozygous
state: eight were previously described and eight were novel findings
of which one was found in two probands (Table 2). Of the already
known mutations, four (g.645del1053ins10, p.G156D, p.M165R and
p.W284R) had not been found before in Spain. The novel mutations
included: six missense mutations, a single thymine deletion and a
splicing defect (Table 2, Supplementary Fig. 1). The novel deletion oc-
curred at position c.233 in exon 4, a change designated c.233delT. This
microdeletion causes a frameshift generating a premature translation
termination signal 20 codons downstream, in exon 5. The novel splic-
ing mutation was identified as a single nucleotide substitution G>C at
nucleotide c.774, the last base of exon 7 (Supplementary Fig. 1c).
RT-PCR performed on RNA from the patient's leukocytes gave two
products, one of normal size and another smaller one. Sequencing of
these products revealed that the normal size product had the
wild-type sequence, whereas the entire 138 bp exon 7 was missing
in the smaller product and exon 6 was joined directly to exon 8 (Sup-
plementary Fig. 1d). This exon skipping maintains the downstream
reading frame and predicts the synthesis of a polypeptide lacking 46
amino acids (residues 213 to 258).
92 S. Gómez-Abecia et al. / Gene 522 (2013) 89–95

Table 2
UROD gene mutations identified in this study.

Patienta (Sex) Onset (years) UROD activityb Mutationc (Predicted effect) Location Reference

P1 (M) 32 48 g.645del1053ins10 (removal of nearly half of the polypeptide) Exons 2–6 Méndez et al. (1998)
P2 (M) 55 51 c.65C>T (p.A22V) Exon 2 Badenas et al. (2009)
P3 (F) 44 43 c.68C>T (p.A23V) Exon 2 This study
P4 (M) 37 59 IVS3-2A>T (skipping of exon 4) Intron 3 Christiansen et al. (1999)
P5 (M) 35 45 c.233T>C (p.L78P) Exon 4 This study
P6 (M) 39 44 c.233delT (frameshift and stop +20) Exon 4 This study
P7 (M) 33 75 c.467G>A (p.G156D) Exon 5 Phillips et al. (2001)
P8 (F) 58 52 IVS5-2A>G (skipping of exon 6) Intron 5 Christiansen et al. (1999)
P9 (M) 48 46 c.494T>G (p.M165R) Exon 6 Méndez et al. (1998)
P10 (M) 42 51 c.538T>G (p.W180G) Exon 6 This study
P11 (M) 32 52 c.587C>T (p.T196I) Exon 6 This study
P12 (M) 30 67 c.774G>C (skipping of exon 7) Exon 7 This study
P13 (F) 57 46 c.833A>G (p.E278G) Exon 8 This study
P14 (M)
P15 (M)
41
36
55
59 g c.835G>A (p.V279M) Exon 8 This study

P16 (M) 48 20 c.842G>A (p.G281E) Exon 8 de Verneuil et al. (1986)

P17 (F) 29 67 c.850T>C (p.W284R) Exon 8 Aarsand et al. (2009)
a
Potential precipitating factors could be identified in ten of these patients: five (P1, P6, P9, P11 and P14) were alcohol abusers (intake ≥60 g/day), two (P5 and P10) had
non-alcoholic hepatic steatosis, one (P4) presented with hepatopathy due to hepatitis C virus, one (P16) was compound heterozygote for the p.H63D and p.C282Y mutations in
the HFE gene, and one (P17) used estrogens (in oral contraceptives). Moreover, five patients (P4, P9, P11, P12 and P13) had at least one relative with overt PCT.
b
UROD: Erythrocyte uroporphyrinogen decarboxylase activity is expressed as the percentage of normal value (mean ± SD: 95.4 ± 15.7 pmol coproporphyrinogen I/h/mg
hemoglobin).
c
Absence of these sequence deviations was confirmed in 50 unrelated healthy (non-porphyric) individuals of Spanish origin. Reference sequence: GenBank accession number
AF047383 (Méndez et al., 1998).

3.2. Prokaryotic expression of UROD missense mutations
The novel missense mutations and two previously reported
(p.G281E and p.W284R) were expressed in E. coli to study their func-
tional consequences. As shown in Table 3, these mutant alleles
expressed polypeptides with decreased residual activities ranging
from near 2% to 74% of normal. The p.A23V mutant enzyme displayed
the highest residual activity, although this protein had decreased ther-
mal stability (Fig. 1). The p.G281E mutant allele also expressed high re-
sidual activity (71%), and the mutant polypeptide was markedly
thermolabile (Fig. 1). The p.T196I and p.V279M mutant enzymes
exhibited similar residual activity (about 43%). However, the p.V279M
protein was much more thermolabile than the p.T196I (Fig. 1). The
remaining mutant alleles encode polypeptides that retained less than
25% of the normal activity (Table 3).
3.3. Haplotype analysis of the c.842G>A (p.G281E) alleles
The p.G281E mutation was identified in four probands of Spanish
origin who attended Hospital 12 de Octubre: two F-PCT (one from
this study) and two homozygous HEP (from non-consanguineous par-
ents) (Méndez et al., 2007; Morán-Jiménez et al., 1996; Roberts et al.,
1995). To investigate whether the mutant alleles derive from a single
or various mutational events, haplotype analysis was performed in
these families and the results are presented in Table 4. With the excep-
tion of the c.842G>A mutation, present in eight individuals, the se-
quences of the UROD gene of all the nine individuals analyzed were
identical and matched to the wild-type sequence. By contrast, distinct
haplotype combinations were observed in the flanking microsatellite
markers for both chromosomes in the two HEP probands, and the
combinations were also different between the probands of families
A, B and C (Table 4). In family A, the alleles of markers D1S193–
D1S211–D1S2713–D1S2797–D1S2724 in the mutant chromosome
from each of the proband's parents can be inferred from family segre-
gation data (Table 4). Then, the mutation co-segregates with haplo-
types 1–3–6–1–5 (from the mother) and 1–4–7–1–3 (from the
father). Of note, the novel F-PCT proband (family D) share one allele
at each marker with the mutant chromosome from the mother in
the family A. However the haplotype combination linked to the muta-
tion in the family D cannot be determined because no relatives were
available to perform the analysis. In family B, the analysis of the
proband's mother allows the deduction of the haplotype combination

Table 3
Prokaryotic expression of UROD mutations.

Construct UROD specific activity

(nmol coproporphyrinogen I/h/mg)

Mean ± SD Range Residual activity (%)

pKK223-3 1.29 ± 0.25 0.98–1.52 0

pKK–UROD-wt 55.58 ± 11.60 39.85–66.38 100
pKK–UROD–A23V 42.26 ± 10.87 33.60–57.94 74.26
pKK–UROD–L78P 8.01 ± 0.54 7.53–8.69 12.38
pKK–UROD–W180G 13.47 ± 0.87 12.42–14.54 22.44
pKK–UROD–T196I 24.51 ± 4.33 20.40–30.46 42.78
pKK–UROD–E278G 2.28 ± 0.49 1.55–2.56 1.83
pKK–UROD–V279M 24.49 ± 2.27 22.22–27.60 42.73
pKK–UROD–G281E 39.92 ± 2.62 36.13–42.10 71.16
Fig. 1. Thermostability of wild-type UROD (●) and mutants p.A23V (▲), p.T196I (○),
pKK–UROD–W284R 14.51 ± 1.21 13.36–15.70 24.36
p.V279M (■) and p.G281E (□). UROD activity is expressed as the percentage of the ini-
UROD specific activity was determined in four independent experiments. tial activity (Mean ± SD from four independent experiments).
 S. Gómez-Abecia et al. / Gene 522 (2013) 89–95 93

Table 4
Haplotype analysis of the UROD mutation p.G281E.

Family A B C D

Proband/relativea P M F S B P M P P

UROD gene (c.842G>A)b A/A G/A G/A G/A G/G A/A G/A G/A G/A

Flanking markers D1S193 (AFM057xf4) 1–1 1–3 1–4 1–3 3–4 3–5 3–5 3–5 1–4
D1S211 (AFM122xe1) 3–4 3–5 1–4 4–5 1–5 3–6 3–6 2–5 3–6
D1S2713 (AFMa349yb5) 6–7 2–6 6–7 2–7 2–6 1–4 1–5 7–8 3–6
D1S2797 (AFMb359wd1) 1–1 1–2 1–1 1–2 1–2 1–3 1–1 1–1 1–1
D1S2724 (AFMb015wc9) 3–5 5–7 3–6 3–7 6–7 2–4 1–4 2–4 2–5

Shared haplotypes are underlined for families A and D.

Families A, B and C were described in previous studies (Méndez et al., 2007; Morán-Jiménez et al., 1996; Roberts et al., 1995).
a
P: proband; M: mother; F: father; S: sister, B: brother.
b
Allelic status of the UROD gene at position of the mutation p.G281E. The remaining gene sequence in all individuals is identical to the published wild-type genomic sequence,
GenBank accession number AF047383 (Méndez et al., 1998).

of markers D1S2713–D1S2797–D1S2724 in each mutant chromosome
(Table 4), being 1–1–4 (from the mother) and 4–3–2 (from the
father).
4. Discussion
In the present study, among seventeen F-PCT probands, a total of six-
teen distinct UROD gene mutations were identified, eight novel and
eight previously reported. These mutations consisted of eleven mis-
sense, three splicing defects, a single base deletion and a large deletion
(Table 2). One of the novel findings was a frameshift mutation located
in exon 4 (c.233delT) that introduces a premature stop codon of trans-
lation in exon 5. Therefore this mutation predicts the degradation of the
mutant transcript by nonsense-mediated mRNA decay (Hentze and
Kulozik, 1999; Maquat, 1996, 2005). The remaining novel lesions were
single nucleotide substitutions in exons: one splicing defect and six mis-
sense mutations. The splicing mutation occurred in the last base of exon
7 (c.774G>C) and changed the amino acid encoded by codon 258, from
methionine to isoleucine. However due to its location it altered the
donor splice site of intron 7 from ATGgtgagg to ATCgtgagg (consensus
sequence: (A/C)AGgt(a/g)agt) and caused aberrant splicing with skip-
ping of exon 7 as was demonstrated by RT-PCR experiments (Supple-
mentary Fig. 1). The exon 7 deletion removes 46 amino acids from the
translated polypeptide, without changing the downstream reading
frame. Since this deletion removes 12.5% of the polypeptide, it would
be expected to result in an inactive and/or unstable protein. The other
splicing mutations found in this study, IVS3-2A>T and IVS5-2A>G,
were previously reported and demonstrated to result in exon skipping
(Christiansen et al., 1999). The six novel missense mutations identified
were: p.A23V, p.L78P, p.W180G, p.T196I, p.E278G and p.V279M. All ex-
cept two (p.A23V and p.V279M), markedly altered the nature of the
encoded amino acids. Moreover, mutations p.T196I and p.V279M
change residues that are highly conserved in eukaryotes and in some
prokaryotic species (Whitby et al., 1998), (Protein Knowledgebase
(UniProtKB), http://www.uniprot.org). Prokaryotic expression studies
revealed that all six mutant proteins had decreased activity (Table 3),
demonstrating the deleterious effect of these mutations for the struc-
ture and/or function of the enzyme. The p.E278G mutant protein
exhibited the lowest residual activity in E. coli (b2%). This mutation is lo-
cated in the S6-strand of the (α/β)8 barrel and leads to the replacement
of a negatively charged glutamic acid by the uncharged glycine in a po-
sition where an acidic residue is highly conserved throughout evolution
(Whitby et al., 1998), (Protein Knowledgebase (UniProtKB), http://
www.uniprot.org). The p.L78P allele, in which a hydrophobic and ali-
phatic leucine is substituted by the rigid proline, expressed weak resid-
ual activity (12%). This mutation affects a residue located in the
transition between the H1-helix and the S2-strand of the (α/β)8 barrel,
close to several highly conserved amino acids such as the invariant
aspartic acid 79 (Whitby et al., 1998). Mutation p.W180G replaced a
large residue for the tiny glycine and reduced the enzymatic activity
to about 22% of normal. This mutation introduces a nonconservative
change within the HH-helix of UROD, on the dimer interface (Whitby
et al., 1998). Two mutations, p.T196I and p.V279M, placed in the
H3-helix and the S6-strand of the barrel, respectively, exhibited the
same residual activity but different stabilities. Mutation p.T196I is a
polar to hydrophobic substitution whereas mutation p.V279M results
in a minor change in the nature of the amino acid. Both mutant proteins
retained approximately 43% of the activity expressed by the normal al-
lele and exhibited reduced thermal stability, with the p.V279M mutant
being markedly thermolabile (Fig. 1). The p.A23V mutant protein
exhibited the highest residual activity (74%), but it was thermolabile
(Fig. 1). This mutation results in a minor amino acid change placed at
the side of the invariant alanine 22, in the HA-helix of UROD (Whitby
et al., 1998). Interestingly, the same amino acid change at the adjacent
alanine (p.A22V), also identified in the present study, was previously
reported and was found to have similar activity in a prokaryotic system
(Badenas et al., 2009). Two published mutations were expressed in this
study, p.G281E and p.W284R, that were described by de Verneuil et al.
and Aarsand et al., respectively (Aarsand et al., 2009; de Verneuil et
al., 1986). Mutation p.G281E was previously demonstrated to result in
a protein that is rapidly degraded, as was found in another mutation
at the same residue (p.G281V) (de Verneuil et al., 1986; Garey et al.,
1989). In our expression studies the mutant protein p.W284R exhibited
a residual activity of 24%, whereas the p.G281E protein retained 71% of
normal activity and was markedly thermolabile (Table 3, Fig. 1). The
other missense mutations identified in this study, p.G156D and
p.M165R were previously reported and found to be 30% active and inac-
tive, respectively, when they were expressed in a prokaryotic system
(Méndez et al., 1998; Phillips et al., 2001).
Of the eight known mutations identified in this study, four are de-
scribed for the first time in Spain: a large deletion and three missense
mutations (p.G156D, p.M165R and p.W284R). The deletion is a complex
gene rearrangement designated g.645del1053ins10, identified previ-
ously in an Argentinean F-PCT proband and in compound heterozygos-
ity with the mutation p.V166A causing HEP in members of a family in
USA (Cantatore-Francis et al., 2010; Méndez et al., 1998). The three mis-
sense mutations were identified in F-PCT patients: p.M165R was identi-
fied in four probands from Argentina, two probands from Italy and one
proband from USA; and the p.G156D and p.W284R mutations were
found in one proband from USA and in three probands from Norway, re-
spectively (Aarsand et al., 2009; Martinez di Montemuros et al., 2002;
Méndez et al., 1998, 2012; Phillips et al., 2001). The remaining known
mutations identified in our series, p.A22V, IVS3-2A>T, IVS5-2A>G and
p.G281E, had already been reported in Spain. To date the first three
mutations were found solely in Spanish patients, whereas p.G281E
was found in three populations. Mutations p.A22V and IVS3-2A>T
were previously identified in one F-PCT proband each, and IVS5-2A>G
in two F-PCT probands (Badenas et al., 2009; Christiansen et al., 1999;
94 S. Gómez-Abecia et al. / Gene 522 (2013) 89–95
Méndez et al., 2007). Mutation p.G281E is the most common UROD
gene mutation in the Spanish population, which has been previously
identified in a total of eight probands of Spanish descent (including
three attended Hospital 12 de Octubre): five with HEP and three with
F-PCT (Darwich et al., 2010; Méndez et al., 2007; Morán-Jiménez
et al., 1996; Roberts et al., 1995). Outside Spain, this mutation was
first described in a homozygous HEP patient from Tunisia and was
also identified in a patient with F-PCT from Chile (de Verneuil et al.,
1986; Poblete-Gutiérrez et al., 2004). Haplotype analysis performed in
the four c.842G>A (p.G281E) carrier families who attended Hospital
12 de Octubre revealed that two homozygous HEP probands (families
A and B) were born from unrelated parents (Table 4). In addition, the
mutant chromosomes in families A, B and C had different haplotypes
(Table 4). These suggest that the mutation could occur on at least five
distinct haplotype backgrounds. Unfortunately, no relatives from
F-PCT probands were available to perform this study, and the haplo-
types of mutant chromosomes could only be constructed, by segrega-
tion analysis, in family A and partially in family B. Nevertheless, the
study showed that the F-PCT proband of family D shares one allele at
each marker with the mutant maternal chromosome in family A
(Table 4). Therefore, we cannot exclude the possibility that the mutant
chromosome in this F-PCT proband and that of the mother in family A,
have a common haplotype for all markers tested. In these four families,
the sequencing of the entire UROD gene was little informative since, ex-
cept for the nucleotide at position c.842, in all individuals matched with
the common wild-type sequence. However, for the closely linked
flanking marker D1S2713 (0.96 Mb from the UROD gene), the mutation
cosegregates with at least four alleles (1, 4, 6 and 7, Table 4). In the op-
posite side of the UROD gene, for marker D1S2797 (1.46 Mb from the
UROD gene), the allele 1 is common and was found together with the
mutation in five chromosomes and with the wild-type sequence in
four chromosomes (Table 4). However, for this marker, the mutation
cosegregates with alleles 1 and 3 in family B. With regard to the next
marker analyzed in the same direction, D1S2724 (3.76 Mb from the
UROD gene), the mutation cosegregates with four alleles (2, 3, 4
and 5). Therefore, if the mutation p.G281E resulted from a common an-
cestral origin, the core haplotype would be less than 2.4 Mb. Even con-
sidering that hypothetical contraction mutation events had originated
the allele 3 in the marker D1S2797, the core haplotype would still be
less than 4.7 Mb. These results suggest either that the mutation is
very ancient or, more probably, that it may have arisen independently
multiple times.
In summary, all the mutations identified in the present study are
detrimental and then, were most likely the cause of reduced UROD
activity observed in the affected probands. The identification of the
mutation underlying the disease in these probands will allow us the
accurate diagnosis of asymptomatic carriers in their families, to pro-
vide counseling to those individuals to avoid disease-precipitating
factors. The identification of eight novel UROD mutations extends cur-
rent knowledge on the molecular heterogeneity of F-PCT worldwide.
Moreover, haplotype analysis in p.G281E carrier families from Spain
suggests multiple origins of this prevalent mutation.
Supplementary data to this article can be found online at http://
dx.doi.org/10.1016/j.gene.2013.03.074.
Disclosure statement
The authors declare no conflict of interest.
Acknowledgments
We are especially grateful to the patients and their families for
their interest and cooperation in carrying out this study. This research
was supported by grants from the Spanish Fundación Mutua
Madrileña. We also thank the Genomics Unit facility of Centro de
Investigación (Instituto de Investigación Hospital 12 de Octubre).
References
Aarsand, A.K., Boman, H., Sandberg, S., 2009. Familial and sporadic porphyria cutanea
tarda: characterization and diagnostic strategies. Clin. Chem. 55, 795–803.
Alla, V., Bonkovsky, H.L., 2005. Iron in nonhemochromatotic liver disorders. Semin.
Liver Dis. 25, 461–472.
Anderson, K.E., Sassa, S., Bishop, D.F., Desnick, R.J., 2001. Disorders of heme biosynthe-
sis: X-linked sideroblastic anemia and the porphyrias, In: Scriver, C.S., Beaudet,
A.L., Sly, W.S., Valle, D. (Eds.), The Metabolic and Molecular Bases of Inherited
Disease, 8th edition. McGraw-Hill, New York, pp. 2991–3062.
Badenas, C., To-Figueras, J., Phillips, J.D., Warby, C.A., Muñoz, C., Herrero, C., 2009. Iden-
tification and characterization of novel uroporphyrinogen decarboxylase gene
mutations in a large series of porphyria cutanea tarda patients and relatives. Clin.
Genet. 75, 346–353.
Brady, J.J., Jackson, H.A., Roberts, A.G., Morgan, R.R., Whatley, S.D., Rowlands, G.L., Darby,
C., Shudell, E., Watson, R., Paiker, J., Worwood, M.W., Elder, G.H., 2000. Co-inheritance
of mutations in the uroporphyrinogen decarboxylase and hemochromatosis genes
accelerates the onset of porphyria cutanea tarda. J. Invest. Dermatol. 115, 868–874.
Bulaj, Z., Phillips, J., Ajioka, R., Franklin, M., Griffen, L., Guinee, D., Edwards, C., Kushner,
J., 2000. Hemochromatosis genes and other factors contributing to the pathogene-
sis of porphyria cutanea tarda. Blood 95, 1565–1571.
Cantatore-Francis, J.L., Cohen, J., Balwani, M., Kahn, P., Lazarus, H.M., Desnick, R.J.,
Schaffer, J.V., 2010. Hepatoerythropoietic porphyria misdiagnosed as child abuse:
cutaneous, arthritic, and hematologic manifestations in siblings with a novel
UROD mutation. Arch. Dermatol. 146, 529–533.
Cappellini, M.D., Martinez di Montemuros, F., Tavazzi, D., Fargion, S., Pizzuti, A.,
Comino, A., Cainelli, T., Fiorelli, G., 2001. Seven novel point mutations in the
uroporphyrinogen decarboxylase (UROD) gene in patients with familial porphyria
cutanea tarda (f-PCT). Hum. Mutat. 17, 350.
Christiansen, L., Ged, C., Hombrados, I., Brons-Poulsen, J., Fontanellas, A., de Verneuil, H.,
Horder, M., Petersen, N.E., 1999. Screening for mutations in the uroporphyrinogen
decarboxylase gene using denaturing gradient gel electrophoresis: characterization
of six novel mutations associated with familial PCT. Hum. Mutat. 14, 222–232.
Christiansen, L., Bygum, A., Jensen, A., Brandrup, F., Thomsen, K., Horder, M., Petersen,
N.E., 2000. Uroporphyrinogen decarboxylase gene mutations in Danish patients
with porphyria cutanea tarda. Scand. J. Clin. Lab. Invest. 60, 611–615.
Cormack, B., 1991. Mutagenesis by the polymerase chain reaction. In: Ausubel, F.M.,
Brent, R., Kingston, R.E., Moore, D., Seidman, J.G., Smith, J.A., Struhl, K. (Eds.),
Current Protocols in Molecular Biology, vol. 1. John Wiley and Sons Inc., New York,
pp. 8.5.1–8.5.9.
Cruz-Rojo, J., Fontanellas, A., Morán-Jiménez, M.J., Navarro-Ordoñez, S., García-Bravo, M.,
Méndez, M., Muñoz-Rivero, M.C., Enríquez de Salamanca, R., 2002. Precipitating/
aggravating factors of porphyria cutanea tarda in Spanish patients. Cell. Mol. Biol.
48, 845–852.
Darwich, E., To-Figueras, J., Badenas, C., Herrero, C., 2010. Hepatoerythropoietic por-
phyria and familial porphyria cutanea tarda in Spanish patients: G281E mutation
in the uroporphyrinogen decarboxylase gene. Arch. Dermatol. 146, 1313–1314.
de Verneuil, H., Beaumont, C., Deybach, J.C., Nordmann, Y., Sfar, Z., Kastally, R., 1984.
Enzymatic and immunological studies of uroporphyrinogen decarboxylase in
familial porphyria cutanea tarda and hepatoerythropoietic porphyria. Am. J.
Hum. Genet. 36, 613–622.
de Verneuil, H., Aitken, G., Nordmann, Y., 1978. Familial and sporadic porphyria
cutanea: two different diseases. Hum. Genet. 44, 145–151.
de Verneuil, H., Grandchamp, B., Beaumont, C., Picat, C., Nordmann, Y., 1986.
Uroporphyrinogen decarboxylase structural mutant (Gly281 → Glu) in a case of
porphyria. Science 234, 732–734.
Dib, C., Fauré, S., Fizames, C., Samson, D., Drouot, N., Vignal, A., Millasseau, P., Marc, S.,
Hazan, J., Seboun, E., Lathrop, M., Gyapay, G., Morissette, J., Weissenbach, J., 1996. A
comprehensive genetic map of the human genome based on 5,264 microsatellites.
Nature 380, 152–154.
Dubart, A., Mattei, M.G., Raich, N., Beaupain, D., Romeo, P.H., Mattei, J.F., Goossens, M.,
1986. Assignment of human uroporphyrinogen decarboxylase (URO-D) to the p34
band of chromosome 1. Hum. Genet. 73, 277–279.
Elder, G.H., 1998. Porphyria cutanea tarda. Semin. Liver Dis. 18, 67–75.
Elder, G.H., Roberts, A.G., Enríquez de Salamanca, R., 1989. Genetics and pathogenesis
of human uroporphyrinogen decarboxylase defects. Clin. Biochem. 22, 163–168.
Fargion, S., Piperno, A., Cappellini, M., Sampietro, M., Fracanzani, A., Romano, R.,
Caldarelli, R., Marcelli, R., Vecchi, L., Fiorelli, G., 1992. Hepatitis virus and porphyria
cutanea tarda: evidence of a strong association. Hepatology 16, 1322–1326.
Garey, J.R., Hansen, J.L., Harrison, L.M., Kennedy, J.B., Kushner, J.P., 1989. A point muta-
tion in the coding region of uroporphyrinogen decarboxylase associated with
familial porphyria cutanea tarda. Blood 73, 892–895.
Gelb, B.D., Edelson, J.G., Desnick, R.J., 1995. Linkage of pycnodysostosis to chromosome
1q21 by homozygosity mapping. Nat. Genet. 10, 235–237.
Gyapay, G., Morissette, J., Vignal, A., Dib, C., Fizames, C., Millasseau, P., Marc, S., Bernadi,
G., Lathrop, M., Weissenbach, J., 1994. The 1993–94 Généthon human genetic link-
age map. Nat. Genet. 7 (2 Spec No), 246–339.
Hentze, M.W., Kulozik, A.E., 1999. A perfect message: RNA surveillance and nonsense-
mediated decay. Cell 96, 307–310.
Jackson, A.H., Sancovich, H.A., Ferramola, A.M., Evans, N., Games, D.E., Matlin, S.A.,
Elder, G.H., Smith, S.G., 1976. Macrocyclic intermediates in the biosynthesis of
porphyrins. Philos. Trans. R. Soc. Lond. B Biol. Sci. 273, 191–206.
Lim, C.K., Rideout, J.M., Wright, D.J., 1983. Separation of porphyrin isomers by high-
performance liquid chromatography. Biochem. J. 211, 435–438.
Maquat, L.E., 1996. Defects in RNA splicing and the consequence of shortened transla-
tional reading frames. Am. J. Hum. Genet. 59, 279–286.
 S. Gómez-Abecia et al. / Gene 522 (2013) 89–95
Maquat, L.E., 2005. Nonsense-mediated mRNA decay in mammals. J. Cell Sci. 118,
1773–1776.
Martinez di Montemuros, F., Di Pierro, E., Patti, E., Tavazzi, D., Danielli, M.G., Biolcati, G.,
Rocchi, E., Cappellini, M.D., 2002. Molecular characterization of porphyrias in Italy:
a diagnostic flow-chart. Cell. Mol. Biol. (Noisy-le-grand) 48, 867–876.
Méndez, M., Sorkin, L., Rossetti, M.V., Astrin, K.H., Batlle, A., Parera, V., Aizencang, G.,
Desnick, R.J., 1998. Familial porphyria cutanea tarda: characterization of seven
novel uroporphyrinogen decarboxylase mutations and frequency of common he-
mochromatosis alleles. Am. J. Hum. Genet. 63, 1363–1375.
Méndez, M., Rossetti, M.V., De Siervi, A., Batlle, A., Parera, V., 2000. Mutations in familial
porphyria cutanea tarda: two novel and two previously described for
hepatoerythropoietic porphyria. Hum. Mutat. 16, 269–270.
Méndez, M., Rossetti, M.V., Batlle, A., Parera, V., 2005. The role of inherited and ac-
quired factors in the development of Porphyria Cutanea Tarda in the Argentinean
population. J. Am. Acad. Dermatol. 52, 417–424.
Méndez, M., Poblete-Gutierrez, P., Garcia-Bravo, M., Wiederholt, T., Morán-Jiménez,
M.J., Merk, H.F., Garrido-Astray, M.C., Frank, J., Fontanellas, A., Enríquez de
Salamanca, R., 2007. Molecular heterogeneity of familial porphyria cutanea tarda
in Spain: characterization of 10 novel mutations in the UROD gene. Br. J. Dermatol.
157, 501–507.
Méndez, M., Rossetti, M.V., Gómez-Abecia, S., Morán-Jiménez, M.J., Parera, V., Batlle, A.,
Enriquez de Salamanca, R., 2012. Molecular analysis of the UROD gene in 17 Argen-
tinean patients with familial porphyria cutanea tarda: characterization of four
novel mutations. Mol. Genet. Metab. 105, 629–633.
Morán, M.J., Fontanellas, A., Brudieux, E., Hombrados, I., de Ledinghen, V., Couzigou, P.,
de Verneuil, H., De Salamanca, R., 1998. Hepatic uroporphyrinogen decarboxylase
activity in porphyria cutanea tarda patients: the influence of virus C infection.
Hepatology 27, 584–589.
Morán-Jiménez, M.J., Ged, C., Romana, M., Enríquez de Salamanca, R., Taiëb, A., Topi, G.,
D'Alessandro, L., de Verneuil, H., 1996. Uroporphyrinogen decarboxylase: complete
human gene sequence and molecular study of three families with hepatoerythropoietic
porphyria. Am. J. Hum. Genet. 58, 712–721.
95
Muñoz-Santos, C., Guilabert, A., Moreno, N., To-Figueras, J., Badenas, C., Darwich, E.,
Herrero, C., 2010. Familial and sporadic porphyria cutanea tarda: clinical and bio-
chemical features and risk factors in 152 patients. Med. (Baltimore) 89, 69–74.
Nordmann, Y., Puy, H., 2002. Human hereditary hepatic porphyrias. Clin. Chim. Acta
325, 17–37.
Phillips, J.D., Parker, T.L., Schubert, H.L., Whitby, F.G., Hill, C.P., Kushner, J.P., 2001. Func-
tional consequences of naturally occurring mutations in human uroporphyrinogen
decarboxylase. Blood 98, 3179–3185.
Phillips, J.D., Bergonia, H.A., Reilly, C.A., Franklin, M.R., Kushner, J.P., 2007. A
porphomethene inhibitor of uroporphyrinogen decarboxylase causes porphyria
cutanea tarda. Proc. Natl. Acad. Sci. U. S. A. 104, 5079–5084.
Poblete-Gutiérrez, P., Méndez, M., Wiederholt, T., Merk, H.F., Fontanellas, A., Wolf, C.,
Frank, J., 2004. The molecular basis of porphyria cutanea tarda in Chile: identifica-
tion and functional characterization of mutations in the uroporphyrinogen decar-
boxylase gene. Exp. Dermatol. 13, 372–379.
Roberts, A.G., Elder, G.H., Enríquez de Salamanca, R., Herrero, C., Lecha, M., Mascaro,
J.M., 1995. A mutation (G281E) of the human uroporphyrinogen decarboxylase
gene causes both hepatoerythropoietic porphyria and overt familial porphyria
cutanea tarda: biochemical and genetic studies on Spanish patients. J. Invest.
Dermatol. 104, 500–502.
Romana, M., Dubart, A., Beaupain, D., Chabret, C., Goossens, M., Romeo, P.H., 1987.
Structure of the gene for human uroporphyrinogen decarboxylase. Nucleic Acids
Res. 15, 7343–7356.
Romeo, P.H., Raich, N., Dubart, A., Beaupain, D., Pryor, M., Kushner, J.P., Cohen-Solal, M.,
Goossens, M., 1986. Molecular cloning and nucleotide sequence of a complete
human uroporphyrinogen decarboxylase cDNA. J. Biol. Chem. 261, 9825–9831.
Whitby, F.G., Phillips, J.D., Kushner, J.P., Hill, C.P., 1998. Crystal structure of human
uroporphyrinogen decarboxylase. EMBO J. 17, 2463–2471.
Wickliffe, J.K., Abdel-Rahman, S.Z., Lee, C., Kormos-Hallberg, C., Sood, G., Rondelli, C.M.,
Grady, J.J., Desnick, R.J., Anderson, K.E., 2011. CYP1A2*1 F and GSTM1 alleles are
associated with susceptibility to porphyria cutanea tarda. Mol. Med. 17 (3–4),
241–247.