RESOLVING TAXONOMIC DIFFICULTIES BETWEEN POECILIOPSIS

PLEUROSPILUS AND POECILIOPSIS GRACILIS

(CYPRINODONTIFORMES: POECILIIDAE)

By

Sarah Jean Ward

A Thesis submitted to the Faculty

of Southeastern Louisiana University
in Partial Fulfillment of the Requirements
for the Degree of Master of Science
in Biology

Southeastern Louisiana University

Hammond, Louisiana

July 2020
 ProQuest Number: 28027358

All rights reserved

INFORMATION TO ALL USERS

The quality of this reproduction is dependent on the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if material had to be removed,
a note will indicate the deletion.

ProQuest 28027358

Published by ProQuest LLC ( 2020 ). Copyright of the Dissertation is held by the Author.

All Rights Reserved.

This work is protected against unauthorized copying under Title 17, United States Code
Microform Edition © ProQuest LLC.

ProQuest LLC
789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, MI 48106 - 1346
 Copyright by

Sarah Jean Ward

2020

i
 RESOLVING TAXONOMIC DIFFICULTIES BETWEEN POECILIOPSIS

PLEUROSPILUS AND POECILIOPSIS GRACILIS

(CYPRINODONTIFORMES: POECILIIDAE)

By

Sarah Jean Ward

Approved:

Kyle R. Piller April M. Wright

Graduate Coordinator and Professor Assistant Professor of Biological
of Biological Sciences Sciences
(Director of Thesis) (Committee Member)

Brian I. Crother Christopher K. Beachy

Professor of Biological Sciences Department Head and Professor of
(Committee Member) Biological Sciences

Daniel R. McCarthy
Dean of the College of Science and
Technology

ii
Name: Sarah Jean Ward

Previous Degrees: B.S., Bob Jones University, 2017, (Zoo and Wildlife Biology)

Date of Current Degree: July 31, 2020

Institution: Southeastern Louisiana University

Major Field: Biological Sciences

Major Professor: Dr. Kyle R. Piller

Title of Study: RESOLVING TAXONOMIC DIFFICULTIES BETWEEN

POECILIOPSIS PLEUROSPILUS AND POECILIOPSIS GRACILIS
(CYPRINODONTIFORMES: POECILIIDAE)

Pages in Study: 54

Candidate for Degree of Master of Science

Poeciliopsis (Cyprinodontiformes: Poeciliidae) is a genus of freshwater fishes

inclusive of 25 species. Several well-known taxonomic uncertainties are present within

the genus, especially in relation to the status of Poeciliopsis pleurospilus and Poeciliopsis

gracilis, however, to date, no studies have been conducted to specifically address the

taxonomic status of these two species. The goal of this study was to examine the

taxonomic validity of P. pleurospilus and P. gracilis using next-generation sequence data

(ddRADSeq) in both phylogenetic and population genetic frameworks. Multiple analyses

support the recognition of both taxa as distinct species, but revises their respective

distributions. The results from phylogenetic and population genetic analyses showed

clear evidence that individuals of P. gracilis are distributed from the Isthmus and

Tehuantepec and north in Atlantic basin systems in Mexico, whereas individuals of P.

pleurospilus are distributed in both Atlantic and Pacific basin systems south and east of

the Isthmus of Tehuantepec, from southern Mexico to Honduras. Additionally, the results

iii
from this study provide genetic evidence that P. pleurospilus and P. gracilis are not sister

to one another as originally assumed, and instead are each sister to additional undescribed

species of Poeciliopsis.

Key words: phylogenetics, poeciliids, SNPs, ddRADseq

iv
 DEDICATION

An education is never completed in isolation, and I am grateful to the many, many

people who played a role in me getting to the point of having the privilege to complete a

master’s thesis. First, I would like to thank my parents, Rusty and Teresa Ward, and my

siblings, Debbi Swiger and Ray Ward, for their love and support throughout my life and

higher education.

I would also like to thank some of the many mentors I’ve had that helped me

reach the level I am at now. I am thankful to Drs. Vincenzo Antignani, David Boyd, and

Chris Carmichael of Bob Jones University for their exemplary training at the

undergraduate level. Dr. A took notice of me when I was nothing more than a struggling

freshman, and gave me the encouragement and help I needed to stick with STEM. Dr.

Boyd pushed me outside of my comfort zone and challenged me to grow in so many

ways – and will be happy to hear that I now sometimes actually ask questions in class.

Dr. C taught me so much I don’t even know where to begin, from teaching some of the

best classes I’ve taken in my entire life, to giving me a shot in the serpentarium, to

always being willing to answer whatever random question I text his way. I am so grateful

to each one of them, and continue to lean on each for advice and support, even years after

I graduated. I would also like to thank Craig Presar, for dealing with me when I was a

mouthy teenager, and yet somehow still seeing the best in me. His kindness to me means

more than he’ll ever know, and I am deeply appreciative for his heart of service to the

teens in our community.

v
 Lastly, I would like to thank my incredible friends, who can always be counted on

to make my day a little brighter. Tiffany Roach, Emily Guyaux, Rachel McManus,

Lauren Farnsworth, Mira Tucker, and Josh Rivera have always been there to offer love

and encouragement when I need it, and I am grateful for their support and their memes.

And, of course, my loves Wheatley, Tad Cooper, and Alexander Hamilton, who forever

have my adoration, whether they want it or not.

vi
 ACKNOWLEDGEMENTS

First, I would like to thank my academic advisor, Dr. Kyle Piller, for fostering an

environment where I could not only learn, but truly thrive. I’ve learned a lot about

myself, science, and fish – and I’m a better person now than I was when he took a chance

on me. I would also like to thank my committee members, Dr. April Wright and Dr.

Brian Crother, who taught useful classes and provided me invaluable help as I learned

how to put my research together.

And of course, I am forever grateful for the Piller Lab Fam that I’ve grown to

cherish. I didn’t know how influential my peers would be in my own development until I

had the privilege to work alongside these wonderful people. I want to thank Jerry

Kattawar, Kearstin Findley, Steve Sheldon, Aaron Krolow, Megan Ryba, Laurel Nave-

Powers, and Aaron Smith for various contributions of help with field work, bench work,

bioinformatic work, and love and support when the getting got hard (bye!).

I would also like to thank Pablo Gesundheit for assisting with field work and

teaching me all of the important Spanish words. That trip to México has been one of the

most incredible weeks of my life, and I made memories that will last a lifetime.

I would also like to thank the Louisiana Board of Reagents for access to the

Louisiana Optical Network Infrastructure (LONI), without which several of my analyses

would have been impossible to complete. I would also like to thank Caleb McMahan and

the Field Museum for providing guidance and tissue samples for my project, as well as

Prosanta Chakrabarty and Wilfredo Matamoros for providing additional tissue samples as

well. Finally, I would like to thank the American Museum of Natural History Theodore

Roosevelt Memorial Grant for providing funding for this research.

vii
 TABLE OF CONTENTS

DEDICATION .................................................................................................................. v

ACKNOWLEDGEMENTS ............................................................................................ vii

LIST OF TABLES ........................................................................................................... ix

LIST OF FIGURES .......................................................................................................... x

CHAPTER

I. INTRODUCTION ................................................................................... 2

II. MATERIALS AND METHODS ............................................................. 8

Taxon Sampling ....................................................................................... 8

DNA Extractions and ddRAD Library Prep and Sequencing ............... 12

ddRAD Assembly and Filtering ............................................................ 14

Phylogenetic Inference .......................................................................... 15

Population Structure............................................................................... 16

III. RESULTS .............................................................................................. 19

Phylogenetic Inference ........................................................................... 19

Population Structure ............................................................................... 34

IV. DISCUSSION ......................................................................................... 39

Conclusion .............................................................................................. 44

V. LITERATURE CITED ........................................................................... 45

viii
 LIST OF TABLES

1 Samples of ingroup taxa used in this study collected from El Salvador,

Guatemala, Honduras, and México ................................................................. 9

2 Other poeciliid species used in the phylogenetic analysis ........................... 11

3 Unique PstI oligos used for ligation of ddRADseq samples ......................... 13

4 Weir and Cockerham unweighted pairwise FST between clades of ingroup

individuals .................................................................................................... 38

ix
 LIST OF FIGURES

1 Female (upper) and male (lower) specimens of P. pleurospilus collected from

the Río Ostuta in Oaxaca, México in Fall 2019 ............................................ 5

2 Female (upper) and male (lower) specimens of P. gracilis collected from the

Río Ajal in Oaxaca, México in Fall 2019 ..................................................... 6

3 Collecting specimens of P. gracilis in the Río Tolosita, Oaxaca, México

(November 2019) ........................................................................................ 12

4 Collapsed ddRADseq cladogram ................................................................. 20

5 Distribution map of samples by clusters ...................................................... 21

6 Phylogram (Clade I) among individuals of Poeciliopsis infans from Manantial

Minzita, Michoacan, México ....................................................................... 22

7 Phylogram (Clades II and III) among individuals of Poeciliopsis fasciata and

P. turrubarensis ........................................................................................... 22

8 Phylogram (Clade IV; AM; a) depicting relationships among individuals NE

of the Isthmus of Tehuantepec ..................................................................... 24

9 Phylogram (Clade IV; AM; b) depicting relationships among individuals NE

of the Isthmus of Tehuantepec ..................................................................... 25

10 Phylogram (Clade V; PM; a) depicting relationships among individuals NW

of the Isthmus of Tehuantepec ..................................................................... 27

11 Phylogram (Clade V; PM; b) depicting relationships among individuals NW

of the Isthmus of Tehuantepec ..................................................................... 28

12 Phylogram (Clade V; PM; c) depicting relationships among individuals NW

of the Isthmus of Tehuantepec ..................................................................... 29

x
13 Phylogram (Clade VI; PSM) depicting relationships among individuals from

the Río Ostuta in Oaxaca, México (Pacific basin) ....................................... 31

14 Phylogram (Clade VII; MCA) depicting relationships among individuals south

of the Isthmus of Tehuantepec ..................................................................... 33

15 Discriminant Analysis of Principal Components (DAPC) of populations of P.

gracilis and P. pleurospilus .......................................................................... 35

16 Composite stacked bar plot of populations of all individuals in the ingroup

dataset .......................................................................................................... 37

xi
 I. INTRODUCTION

Middle America is a biologically and geologically diverse region that includes

México and the seven countries of Central America (Belize, Costa Rica, El Salvador,

Guatemala, Honduras, Nicaragua, Panama), as well as the islands of the West Indies

(Winker 2011; Matamoros et al. 2015). Various volcanic and tectonic events have shaped

this dynamic landscape and resulted in the formation of many geographic barriers, which

have, in turn, affected the biodiversity of the region (Mann 2007; Marshall 2007). For

example, the closure of the narrow land-bridge at the Isthmus of Panama had direct

consequences for global ocean currents, thereby affecting climate patterns and altering

the tropical ecosystems of the region (Schmidt 2007), and the formation of the Trans-

Mexican Volcanic Belt has been demonstrated to be a substantial barrier to gene flow in

populations of freshwater fishes in México (Mateos 2005; Pérez-Rodríguez et al. 2009;

Zúñiga‐Vega et al. 2014).

The dispersal ability of freshwater fishes, in particular, is highly limited by their

dependence on direct connections between drainage basins (Miller 1966; Myers 1966;

Rosen 1975; Briggs 1984; Bussing 1985; Rauchenberger 1988). Alterations to river

systems, through stream capture or artificial modifications to streamflow, can affect the

dispersal ability of freshwater fishes (Albert and Reis 2011; Lyons et al. 2020).

Furthermore, sea-level rise has disconnected lower portions of rivers, thereby isolating

obligate freshwater fish species in particular drainage basins or river systems (Zúñiga‐

Vega et al. 2014; Bagley et al. 2015). These issues have been highlighted by studies of

freshwater fish diversity, which have historically played an important role in

understanding the biogeographic history of Middle America (Lundberg et al. 1998;

2
Arbogast and Kenagy 2001; Perdices et al. 2002; McMahan et al. 2013; Albert et al.

2014; Martínez-Aquino et al. 2014; Matamoros et al. 2015; Beltrán-López et al. 2018).

One of the most ubiquitous groups of freshwater fishes in Middle America is

Poeciliidae (Bonaparte 1831), a family of New World cyprinodontiform fishes (Bragança

et al 2018). Poeciliids have a widespread geographic distribution that extends beyond

Middle America (Rosen and Bailey 1963; Parenti 1981; Lucinda 2003; Palacios et al.

2016) and the group possesses a variety of biologically significant adaptations, such as

diversity in maternal provisioning, sexual selection, and courtship behaviors (Reznick et

al. 2017). Poeciliids have been broadly studied in vicariance biogeography due to parallel

patterns of distributions being noted for some poeciliids, reptiles, and plants (Rosen

1975), and much is known about phylogenetic relationships within Poeciliidae (Hrbek et

al. 2007; Alda et al. 2013; Bagley et al. 2015; Reznick et al. 2017; Barts et al. 2018;

Conway et al. 2019; Thomaz et al. 2019; Rodriguez-Silva & Weaver 2020). Poeciliidae

currently consists of 276 species in 27 recognized genera (Lucinda 2003; Reznick et al.

2017; Fricke et al. 2020), including Poeciliopsis (Regan 1913) with 25 species (Mateos et

al. 2002; Conway et al. 2019). The genus inhabits a wide range of environments from

lowlands to highlands, in rivers and streams, lakes, and springs. The genus is primarily

distributed in Pacific slope drainages (Rosen and Bailey 1963, Bussing 2002, Miller et al.

2005, McMahan et al. 2013), but several species have been documented in Atlantic basin

streams (Rosen and Bailey 1963; Miller et al. 2005; Mateos et al. 2018). Much work has

been done regarding the biogeographic history of the genus and phylogenetic

relationships among the species (Mateos et al. 2002; Lucinda and Reis 2005; Ho et al.

2016; Weaver et al. 2016; Mateos et al. 2018; van Kruistum et al. 2020), but some

3
species have been excluded in phylogenetic analyses. These exclusions are due to several

well-known taxonomic uncertainties present within Poeciliopsis (Miller et al. 2005),

especially in relation to the status of Poeciliopsis pleurospilus and Poeciliopsis gracilis.

Poeciliopsis pleurospilus was originally described as Girardinus pleurospilus by

Günther (1866) from the Lago Dueñas in Guatemala (Pacific Basin). Historically, P.

pleurospilus has been treated as a synonym of P. gracilis (Rosen and Bailey 1963;

Contreras and Escalante 1984; Contreras-MacBeath and Ramirez Espinoza 1996),

however, Miller et al. (2005) identified a distinction between the species based on the

separation of their native distributions as well as variation in pigmentation. Individuals of

P. pleurospilus are recognized by lateral markings that are large, dark, oval spots which

are larger than the diameter of the pupil, in addition to sometimes possessing one to three

crescent-shaped bars (Fig. 1; Miller et al. 2005). In the current literature, native

populations of P. pleurospilus are hypothesized to inhabit Pacific Basin systems from

México to Honduras, as well as Atlantic Basin systems including the Río Grijalva

(México), upper Río Motagua (Guatemala), and Río Ulua Basins (Honduras) (Miller et

al. 2005; Matamoros et al. 2009; McMahan et al. 2013). Specimens are typically

collected in pools (up to 0.6 meters deep; often shallower) of streams that have no to

moderate currents, edges of lowland rivers, and ponds that have clear to muddy water; the

substrate is either mud, sand, gravel, or rock; and vegetation is sparse, although green

algae are common and water hyacinth (Eichhornia spp.) is sporadic (Miller et al. 2005).

4
Figure 1 – Female (upper) and male (lower) specimens of P. pleurospilus collected from
the Río Ostuta in Oaxaca, México in Fall 2019.

Poeciliopsis gracilis was described as Xiphophorus gracilis by Heckel (1848)

from Orizaba, México. Individuals of P. gracilis are recognized by lateral markings that

are small spots that are no larger than the diameter of the pupil, or more frequently,

horizontal dashes that are sometimes doubled or fused (Fig 2; Miller et al. 2005). Native

populations of P. gracilis are hypothesized to be restricted to the Atlantic Basin in the

states of Veracruz and Oaxaca, México, as well as having been introduced in the Ríos

Pánuco (Atlantic) and Balsas (Pacific) within México (Miller et al. 2005). Specimens are

typically collected in streams, flood-water ponds, lagoons, pools in creeks, and edges of

lowland rivers, in clear to muddy water, with no to moderate current; substrate can be

clay, mud, sand, gravel, or rock; and vegetation is none to sparse, although green algae is

common with watermilfoil (Myriophyllum spp.) and pondweed (Potamogeton spp.),

occasionally with water hyacinth (Eichhornia spp.) (Miller et al. 2005).

5
Figure 2 – Female (upper) and male (lower) specimens of P. gracilis collected from the
Río Ajal in Oaxaca, México in Fall 2019.

Although P. pleurospilus and P. gracilis are morphologically and ecologically

similar species, to date, no studies have been conducted to specifically address the

taxonomic status these two species. Much of this taxonomic uncertainty stems back to

the age-old question of, “What is a species?” While there are differing opinions on what

constitutes a species, multiple authors underscore the importance of recognizing species

as the fundamental components to understanding biodiversity and accurately reflecting

their interrelationships through taxonomic and phylogenetic classifications (Hennig 1965;

Mayden 1997; Mayden 1999; Mayr 1942; Mayr 1957; Mishler and Donoghue 1982;

Wiley 1978). For the purpose of this study I will be following the Phylogenetic Species

Concept (Cracraft 1983) sensu Mishler and Theriot (2000), such that a species is the

smallest diagnosable unit in a phylogenetic inference, and is recognized by the presence

of monophyletic clades.

6
 The goal of this study was to examine the taxonomic validity of P. pleurospilus

and P. gracilis using next-generation sequence data. I tested the monophyly of each

species by collecting double digest restriction-site associated DNA (ddRADseq)

(Peterson et al. 2012) data from multiple populations and localities across their proposed

ranges. The ddRADseq data provides a robust multilocus data set from which I was able

to perform a Maximum Likelihood phylogenetic inference, which allowed me to infer the

evolutionary relationships present among populations of each species sampled across

their respective ranges in México, Guatemala, El Salvador, and Honduras (Miller et al.

2005; Matamoros et al. 2009; McMahan et al. 2013; Gómez-González et al. 2015). In

addition, I performed several population genetic tests to examine the amount of genetic

diversity and genetic structure within and among the recovered lineages. The results from

this study will provide insight into the long-standing taxonomic issue of these two

congeners.

7
 II. MATERIALS AND METHODS

Taxon Sampling

A total of 148 individuals were used in this study after filtering samples for low

call quality, including 134 individuals currently recognized as either Poeciliopsis

pleurospilus or Poeciliopsis gracilis (Table 1), 13 samples of other species of

Poeciliopsis (fasciata, n=5; infans, n=4; turrubarensis, n=4) (Table 2), and a single

outgroup sample of Brachyrhaphis rhabdophora (Table 2). Tissue samples (fin clips or

whole specimens) were collected from various localities throughout México in November

2019 as follows: P. pleurospilus and P. gracilis were collected from nine localities in

Oaxaca and one locality in Veracruz; specimens of P. turrubarensis were collected from

four localities in Oaxaca; and specimens of P. fasciata were collected from one locality

in Oaxaca. Each site was sampled using a standard 10’ x 6’ seine (Figure 3) for

approximately 15 to 60 minutes until a minimum of 10 specimens of the target species

were captured, and tissue samples were immediately preserved in 95% ethanol.

Additional specimens from river systems in México, Guatemala, El Salvador, and

Honduras were obtained from the tissue collections at Southeastern Louisiana University

(SLU), the Field Museum of Natural History (FMNH), Louisiana State University

Vertebrate Museum (LSUMZ), and the Universidad de Ciencias y Artes de Chiapas

Museo de Zoología (UNICACH). Specific locality information for each specimen

currently recognized as P. pleurospilus and P. gracilis is included in Table 1. Samples

marked with a “G” represent specimens that were identified in the field as P. gracilis; all

others represent specimens that were identified in the field as P. pleurospilus.

8
Table 1. Samples of ingroup taxa used in this study collected from El Salvador,
Guatemala, Honduras, and México.

Specimen Basin Lat. Long. Locality

El Salvador
ES_R Pacific 14.25 -89.48 Depart. Santa Ana, Lago Guija
ES_V Pacific 14.32 -89.46 Depart. Santa Ana, Laguna Metapan
Guatemala
Guat_B Pacific 14.27 -90.90 Esquintla, Río Achiguate
Guat_C Pacific 13.88 -90.00 Jutiapa, Río Negro
Guat_E Pacific 13.88 -90.00 Jutiapa, Río Negro
Guat_F Pacific 14.27 -90.90 Esquintla, Río Achiguate
Honduras
Hond_M Atlantic 13.48 -87.10 Depart. de Choluteca, Orocuina
Hond_Q Atlantic 14.74 -87.97 Depart. Comayagua, Río Tepemechin
Hond_X Atlantic 14.91 -89.01 Depart. de Copan, Río Amarillo
Hond_Y Pacific 13.83 -87.69 Depart. de Valle, Nacaome
México
Mex_01 Atlantic 16.20 -92.19 Chiapas, Río Ojo de Agua
Mex_11 Pacific 15.59 -93.06 Chiapas, Río Margaritas
Mex_15 Pacific 14.67 -92.23 Chiapas, Río Cosalapa
Mex_16 Pacific 15.67 -92.01 Chiapas, Río El Manguito
Mex_17 Pacific 15.69 -92.31 Chiapas, Río Borbollon
Mex_18 Atlantic 15.77 -91.98 Chiapas, Río Paso Hondo
Mex_19 Pacific 15.97 -96.46 Oaxaca, Río Mateo Pina
Mex_ 21 Pacific 16.33 -95.24 Oaxaca, Río Tehuantepec
Mex_23 – 33, 35, 37 Pacific 16.50 -94.44 Oaxaca, Río Ostuta
Mex_39, 41 – 44 Pacific 16.34 -95.24 Oaxaca, Río Tehuantepec
Mex_ 46 – 47 Pacific 16.34 -95.24 Oaxaca, Río Tehuantepec
Mex_48 – 53 Pacific 16.41 -95.60 Oaxaca, Río Tequesistlan
Mex_55 – 57 Pacific 16.41 -95.60 Oaxaca, Río Tequesistlan

9
 Mex_58 – 66 Pacific 16.56 -96.03 Oaxaca, Río de la Virgen
Mex_68 – 71, 73, 77 Pacific 16.67 -96.27 Oaxaca, Río Totolapan
Mex_80 – 84, 86, 87 Pacific 16.79 -96.67 Oaxaca, Río Octlan
Mex_89, 92 – 101 Pacific 16.60 -96.74 Oaxaca, Río Coapa
Mex_103– 105 Pacific 16.60 -96.74 Oaxaca, Río Coapa
Mex_107 – 112 Pacific 16.60 -96.74 Oaxaca, Río Coapa
Mex_G02 Pacific 17.27 -99.55 Guerrero, Unnamed Arroyo
Mex_G03 Pacific 17.04 -97.91 Oaxaca, Puente Tierra Azul
Mex_G05 Pacific 16.35 -97.09 Oaxaca, Río Las Flores
Mex_G08 Atlantic 19.40 -96.65 Veracruz, Río del Plan
Mex_G1 Pacific 15.83 -96.33 Oaxaca, Río Huatulco
Mex_G6 Atlantic 16.10 -97.07 Oaxaca, Río Flor de Café
Mex_G9, G11, G20 Atlantic 17.28 -95.07 Oaxaca, Unnamed Arroyo
Mex_G13 Atlantic 18.17 -96.10 Oaxaca, Río Papaloapan
Mex_G14, G15, G17 Atlantic 17.39 -95.06 Veracruz, Río Jaltepec
Mex_G19 Pacific 17.94 -99.59 Guerrero, Río Mezcala
Mex_G22 Atlantic 18.58 -96.67 Oaxaca, Río Barranca
Mex_G23 Atlantic 18.52 -96.43 Oaxaca, Río Amapa
Mex_G26 Atlantic 19.47 -96.47 Veracruz, Río Actopan
Mex_G36 – 38 Atlantic 17.20 -95.05 Oaxaca, Río Tolosita
Mex_G40 – 43, G45 Atlantic 17.20 -95.05 Oaxaca, Río Tolosita
Mex_G47 – G55 Atlantic 18.74 -96.45 Veracruz, Río Blanco
Mex_G57 – G65 Atlantic 17.20 -95.05 Oaxaca, Río Tolosita
Mex_G68 – G72 Atlantic 16.77 -95.02 Oaxaca, Río Ajal
Mex_G74, G76 Atlantic 16.77 -95.02 Oaxaca, Río Ajal

10
Table 2. Other poeciliid species used in the phylogenetic analysis.

Family Genus Species Specimen Locality

Poeciliidae

Brachyrhaphis

rhabdophora brhab N/A

Poeciliopsis

fasciata

Mex_F1 México, Río Ajal

Mex_F2 México, Río Ajal

Mex_F3 México, Río Ajal

Mex_F4 México, Río Ajal

Mex_F5 México, Río Ajal

infans

pinfans_1 México, Man. Mintzita

pinfans_2 México, Man. Mintzita

pinfans_3 México, Man. Mintzita

pinfans_4 México, Man. Mintzita

turrubarensis

Mex_T10 México, Río Tehuantepec

Mex_T15 México, Río Tequesistlan

Mex_T20 México, Río de la Virgen

Mex_T25 México, Río Totolapan

11
Figure 3. Collecting specimens of P. gracilis in the Río Tolosita, Oaxaca, México
(November 2019).

DNA Extractions and ddRAD Library Prep and Sequencing

Whole genomic DNA was extracted from fin clips using the Qiagen DNeasy

Tissue Extraction Kit following the manufacturer’s recommendations. Three double

digest restriction enzyme DNA (ddRAD) libraries were prepared following a modified

version of the protocol from Peterson et al. (2012). Briefly, the DNA was normalized to

approximately equal concentrations by either adding nuclease-free H20 or drying the

sample until it contained 20 μL of DNA at 15 ng/μL concentration. I then digested each

sample with MspI and PstI restriction enzymes and ligated them to common (5’-

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT - 3’) and unique oligos (Table

3).

12
Table 3. Unique PstI oligos used for ligation of ddRADseq samples.
Location Barcode Location Barcode Location Barcode
1A AACAATG 6B CACCTAGA 11C TTGTCTAACA
1B CCACCGT 6C TTGTACCG 11D AGTGGAGCCA
1C TTGTTCA 6D GGTCGGTA 11E GAACCGTCCA
1D CGTGGAA 6E AACGAATA 11F CCTAACAGCA
1E GAACAAT 6F CCAACTCG 11G TTCTGTCACA
1F ACCATCG 6G TTGGTCAA 11H GAGGTGGACA
1G TTGGCTA 6H CGTTGAGG 12A AGAACATCCA
1H ACTTGGT 7A GAACAGTCA 12B CCTCATCGCA
2A GGAACTG 7B ACCACTGCA 12C TTCTTCAGCA
2B CACCAGT 7C TTGTTGACA 12D GTGGCGGCCA
2C TGTTGCA 7D GGTGGACCA 12E AGAAGCTACA
2D CTGGTAG 7E AACATCGCA 12F CACCATAGCA
2E GAACCTA 7F CCACGCTCA 12G TCTTGACACA
2F ACCAAGT 7G TTGTATCCA 12H GCGGTGGCAA
2G ATTGTCG 7H GGTGCGACA
2H CGGTGAT 8A AACAAGTCA
3A TAACACG 8B CCACCTGCA
3B GCCACTA 8C TTGGTACCA
3C CTTGTGA 8D GGTTGCACA
3D TCGTGAG 8E AACAATAGA
3E GGAATCT 8F CCACTAGAA
3F AACCGAT 8G TTGTCCTCA
3G TGTGCGA 8H GGTAGGCAA
3H CTGTATG 9A AACGAATGA
4A GAACATCA 9B CCACTGACA
4B ACCATACG 9C TTGTCTGAA
4C TTGTCGCA 9D CGTGGCCGA
4D AGTGGCCG 9E GAACCTCCA
4E GAACTACG 9F ACCAACTGA
4F CCTAAGCA 9G TTGTGAGCA
4G TTCTGCCA 9H CGTGTGAAT
4H GAGGCTCG 10A GAACACTACA
5A AGAACATA 10B ACCACTAGCA
5B CCTCACAG 10C TTGTTAGCCA
5C TTCTTGGA 10D GGTAGGCACA
5D GGAGGTCG 10E AACGAATCCA
5E AAGAACTA 10F CCACCTAGCA
5F CCTCCACG 10G TTGTTCCACA
5G TTCTGTAG 10H GGTGAGGCCA
5H GCGGTGGA 11A AACAGATGCA
6A AGAACTAG 11B CCACTCCGCA

13
 I then pooled the samples into 24 lots and performed a pre-PCR clean-up using

the Qiagen QIAquick PCR Purification Kit following the manufacturer’s

recommendations. After cleaning each lot, I PCR amplified each with the following

thermocycler conditions: 1 cycle of initial denaturation at 98°C for 30 seconds; 12 cycles

of denaturation at 98°C for 30 seconds, annealing at 62°C for 30 seconds, extension at

72°C for 30 seconds; and 1 cycle of final extension at 72°C for 10 minutes. After

verifying the quality of the amplified products with a 1% agarose-gel electrophoresis, I

then pooled the samples to 4 lots and performed another clean-up using the QIAquick

PCR Purification Kit. I then pooled the lots down to a single sample and performed

another clean-up with the same protocol, and then size selected for 300 – 500bp fragment

lengths using a Blue Pippen. Libraries were sent to the University of Oregon’s Genomic

and Cell Characterization Core Facility (GC3F) for Illumina Sequencing on the Hiseq

4000 for 100 bp single end reads.

ddRAD Assembly and Filtering

The raw data files returned from GC3F were run through FASTQC v0.11.3

(Andrews 2010) to check the overall quality of the reads from the Illumina run. The

FastQ file output from the previous step was input into IPYRAD (Eaton and Overcast

2020) pipeline for assembly and initial filtering. Reads that contained more than 5 bases

with a low quality phred score (<33) were excluded. Reads were then clustered based on

an 85% similarity threshold and reads with less than 6x coverage were filtered out. A

maximum of 5 ambiguous base calls and 5 heterozygous sites per read were allowed

during filtering. Additional filtering using VCF TOOLS (Danecek et al. 2011) excluded

14
individuals with more than 95% missing data, and loci (SNPs) with a 60% call rate or

lower.

Phylogenetic Inference

The output VCF file from the IPYRAD pipeline was converted to FASTA format

using PGD Spider v 2.1.1.5 (Lischer and Excoffier 2012), and the resulting FASTA file

was used for phylogenetic analyses. Concatenated ddRAD loci were analyzed under

Maximum Likelihood using IQ Tree (Nguyen et al. 2015). The FASTA file output from

the previous step was input into Model Finder (Kalyaanamoorthy et al. 2017) within IQ

Tree to compute the log-likelihood of an initial parsimony tree for many different models

under the Akaike information criterion (AIC), corrected Akaike information criterion

(AICc), and the Bayesian information criterion (BIC). The AIC, AICc, and BIC output all

selected the General Time Reversible (GTR) model + empirical base frequency (F) +

FreeRate heterogeneity with 2 categories (R2) to be the best fit for the data. Ultrafast

bootstraps were run for 10,000 generations in IQ Tree. Ultrafast bootstrap support values

are thought to be more unbiased than standard nonparametric bootstrap values, but can be

over-inflated when compared to standard non-parametric bootstrap support values. As

such, ultrafast bootstrap support values should not be directly compared with standard

non-parametric bootstrap support values, and a clade should only be considered reliable if

the ultrafast bootstrap support value is 95% or above (Hoang et al. 2018). Additionally, a

Shimodaira – Hasegawa (SH) single branch test was run for 1,000 replicates to assess

branch supports. The resulting ultrafast bootstrapped tree was visualized using the

Interactive Tree of Life (iTOL) v4 (Letunic and Bork 2019) web interface.

15
Population Structure

Population structure analyses are useful to identify clusters or groups of

individuals that are more closely related due to a variety of factors that act as barriers to

gene flow among these groups, including extrinsic factors, such as environment and

topography, and intrinsic factors, such as mate recognition or reproductive compatibility

(Patterson et al. 2006; Petkova et al. 2016). Populations can be determined to be

structured by a variety of methods. To prepare the data for downstream analyses, I used

VCF TOOLS to exclude individuals with more than 95% missing data, loci (SNPs) with a

60% call rate or lower, along with excluding all outgroup individuals to produce a VCF

file of raw reads for 134 samples of P. pleurospilus and P. gracilis. I then loaded that

VCF file into RStudio 4.0.0 (RStudio Team 2015) and attached population information,

then converted the VCF file to a genlight object using VCFR V1.10.0 (Knaus and

Grünwald 2017).

The first method I employed for population genetic analysis was a Discriminant

Analysis of Principal Components (DAPC), following the methods of Grünwald et al.

(2016a). DAPC is a multivariate method that allows for the inference of population

structure by determining the number of groups or clusters that are observed without prior

knowledge of population structure (Pritchard et al. 2000; Jombart et al. 2010; Grünwald

and Goss 2011). The data is partitioned into a between-group and within-group

component in order to maximize the discrimination between groups, by first transforming

the data into PCA and then by identifying clusters using discriminant analysis (Jombart

and Ahmed 2011). DAPC benefits from using a limited number of principal components,

to reduce the issues of overfitting and instability of membership probabilities which can

16
become problematic if too many components are included for the number of individuals

in the data set. I used POPPR V 2.8.5 (Kamvar et al. 2014; Kamvar et al. 2015) and its

required packages ADEGENET V2.1.3 (Jombart 2008; Jombart and Ahmed 2011) and ADE4

(Dray and Dufour 2007), as well as APE 5.0 (Paradis and Schliep 2018), to conduct a

DAPC analysis on the genlight object produced in the initial filtering step. I then

visualized the cumulative percent of variance explained by PCA as well as the

discriminant analysis eigenvalues, following the methods of Jombart and Collins (2015),

and chose to retain 25 principal components and three discriminant functions.

I used RESHAPE2 (Wickham 2007) to convert the DAPC object into the correct

data frame format for visualization, and then used the RCOLORBREWER v.1.2.1 (Neuwirth

and Brewer 2014) color-blind friendly palette DARK2 and GGPLOT2 (Wickham 2016)

within the TIDYVERSE 1.3.0 (Wickham et al. 2019) to visualize the resulting DAPC

analysis. The DAPC object created included population membership probability of each

sample to the populations I manually assigned. To visualize the posterior assignment of

each sample within the DAPC object, I created a composite stacked bar plot using the

COMPOPLOT function within the ADEGENET V2.1.3 package, and visualized the resulting

plot using RCOLORBREWER v.1.2.1 and GGPLOT2, following the methods of Grünwald et

al. (2016b).

Finally, I calculated an unweighted Weir and Cockerham (1984) pairwise FST

between clades of ingroup individuals. The FST value is directly related to the variation

from the mean allele frequencies among populations and the degree of resemblance

among individuals within populations, such that small FST values indicate that allele

frequencies within each population are similar whereas large FST values indicate different

17
allelic frequencies within each population (Holsinger and Weir 2009). An unweighted

Weir and Cockerham pairwise FST allows for the analysis of between-group variation

present among the major clades recovered in previous analyses (Weir and Hill 2002;

Weir and Goudet 2017).

18
 III. RESULTS

Phylogenetic Inference

The dataset including outgroups was used to infer a Maximum Likelihood

phylogenetic tree under the GTR+F+R2 model. A collapsed cladogram rooted with

Brachyrhaphis rhabdophora inferred seven major clades, four of which represented

ingroup taxa (Fig. 4). Clades grouped by geographic locality (Fig. 5), and are named and

colored as follows: individuals colored with green were collected from streams from

Atlantic basin systems in eastern México (AM); individuals colored with orange were

collected from streams from Pacific basin systems in western México (PM); individuals

colored with purple were collected from a Pacific stream in southern México (PSM); and

individuals collected systems south of the Isthmus of Tehuantepec in México and further

south into Central America were colored in pink (MCA).

19
 infans
P.
turrub.
P.
fasciata
P.
gracilis
P.
sp. 1
P.
sp. 2
P.
pleuro.
P.
Figure 4. Collapsed ddRADseq cladogram with SH-test and ultrafast bootstrap values for P. gracilis (AM), P. species 1 (PM),
P. species 2 (PSM), and P. pleurospilus (MCA) (colorized clades). Images adjacent to the phylogeny were provided by J. Lyons, C.D.
McMahan, and K.R. Piller.

20
Figure 5. Distribution map of samples by clusters. Green circles AM; orange circles PM;
purple circles PSM; pink circles MCA. The yellow diamond represents the type locality
of P. gracilis; the blue diamond represents the type locality of P. pleurospilus.

Clade I consisted of four individuals of Poeciliopsis infans sampled from

Manantial Mintzita, Michoacán, México and is sister to all other samples of Poeciliopsis

included in this study. Clade I has 100% SH-test and 100% ultrafast bootstrap support

value (Fig. 4; Fig. 6). Clade II consists of four individuals of P. turrubarensis collected

from multiple localities, including the Ríos de la Virgen, Tehuantepec, Tequesistlan, and

Totolapan, from the Pacific coast of Oaxaca, México (Fig. 7). Clade III consists of five

individuals of P. fasciata collected from the Río Ajal in Oaxaca, México (Fig. 7). Clades

II and III were each monophyletic and sister to one another, having 100% SH-test and

100% ultrafast bootstrap support (Fig. 4; Fig. 7). Clades I – III and the taxon

Brachyrhaphis rhabdophora were removed from subsequent phylogeny visualizations for

clarity.

21
Figure 6. Phylogram (Clade I) among individuals of Poeciliopsis infans from Manantial
Minzita, Michoacan, México. Node values correspond to SH-test and ultrafast bootstrap
support.

turrub.
P.
fasciata
P.

Figure 7. Phylogram (Clades II and III) among individuals of Poeciliopsis fasciata and P.
turrubarensis. Node values correspond to SH-test and ultrafast bootstrap support.

22
 Within each of the ingroup clades (Clades IV – VII), branch lengths were

extremely short, making it difficult to resolve the relationships among the individuals

within each clade. Little geographic structure was recovered within any of the four

clades, although clear geographic structure was recovered among clades. The ultrafast

bootstrap values are also lower at terminal nodes within Clades IV-VII, in comparison to

deeper nodes. Deeper splits among the four clades are supported by higher SH-test (91 –

100%) and ultrafast bootstrap values (91 – 100 UFBoot), signifying more robust clade

assignments.

Clade IV (AM) consisted exclusively of specimens collected from Atlantic basin

river systems (n=44) (Fig. 8 – 9) in the states of Veracruz and Oaxaca, México. All

individuals were identified in the field as P. gracilis. Specimens were obtained from

seven localities in Oaxaca, México including three specimens from an unnamed arroyo

(Mex_G9, G11, G20), and specimens from the Ríos Ajal (Mex_G68-72, G74, G76),

Amapa (Mex_G23), Barranca (Mex_G22), Papaloapan (Mex_G13), and two localities on

the Río Tolosita (G36-38, 40-43, 45, 57-65); as well as from three localities in Veracruz,

México including the Ríos Actopan (Mex_G26), Blanco (Mex_G47-55), and Jaltepec

(Mex_14, 15, 17). The type locality of P. gracilis is the Río Orizaba in Veracruz, México

(indicated by a yellow diamond on Fig. 5), which is a tributary to the Río Blanco,

indicating that this clade most likely represents individuals of topotypic P. gracilis.

Ultrafast bootstrap support values ranged from 43% - 100% and SH values ranged from

12 – 100%, indicating varying degrees of phylogenetic resolution within Clade IV.

23
Figure 8. Phylogram (Clade IV; AM; a) depicting relationships among individuals NE of
the Isthmus of Tehuantepec. Samples are from the Ríos Jaltepec (7), Tolosita (9), and
Ajal (10) in Oaxaca, México (Atlantic basin).

24
Figure 9. Phylogram (Clade IV; AM; b) depicting relationships among individuals NE of
the Isthmus of Tehuantepec. Samples are from the Ríos del Plan (1), Barranca (4),
Amapa (5), Papaloapan (6), Jaltepec (7), and an unnamed arroyo (8) in Oaxaca (Atlantic
basin); and the Ríos Actopan (2) and Blanco (3) in Veracruz, México (Atlantic basin).

25
 Clade V (PM) consisted exclusively of specimens collected from Pacific basin

river systems (n=64) (Fig. 10 – 12). Individuals identified in the field as P. pleurospilus

were collected from six localities in Oaxaca, México, including the Ríos Coapa (Mex_89,

92 – 101, 103 – 105, 107 – 112), de la Virgen (Mex 58-66), Octlan (Mex 80 – 84, 86,

87), Tehuantepec (Mex 21, 39, 41 – 44, 46 – 48), Tequesistlan (Mex 48 – 53, 55 – 57),

and Totolapan (Mex 68 – 71, 73, 77). Also included in this clade are individuals

identified in the field as P. gracilis that were collected from four localities in Oaxaca,

México, including the Ríos Huatulco (Mex G1) and Las Flores (Mex G03) and Puente

Tierra Azul (Mex G05), Flor de Café (Mex G6); as well as an unnamed arroyo (Mex

G02) in Guerrero, México. Branch lengths were extremely short within this clade, and the

bootstrap support values ranged from 33% – 100% with the SH values ranging from

16% – 100%, indicating varying degrees of phylogenetic resolution in the data.

26
Figure 10. Phylogram (Clade V; PM; a) depicting relationships among individuals NW of
the Isthmus of Tehuantepec. Samples are from the Ríos Huatulco (7), Totolapan (8), de la
Virgen (9), Tequisitlan (10), and Tehuantepec (11) in Oaxaca, México (Pacific basin).

27
Figure 11. Phylogram (Clade V; PM; b) depicting relationships among individuals NW of
the Isthmus of Tehuantepec. Samples are from an unnamed arroyo (1) in Guerrero; and
the Ríos Tierra Azul (2), Ríos Las Flores (3), Flor de Café, Octlan (5), Coapa (6),
Totolapan (8), and de la Virgen (9) in Oaxaca, México (Pacific basin).

28
Figure 12. Phylogram (Clade V; PM; c) depicting relationships among individuals NW of
the Isthmus of Tehuantepec. Samples are from the Río Coapa (6) in Oaxaca, México
(Pacific basin).

29
 Clade VI (PSM) consisted exclusively of specimens collected from the Río Ostuta

(n=13) (Mex 23 – 33, 35, 37) in Oaxaca, México (Pacific basin) (Fig. 13). All individuals

were identified in the field as P. pleurospilus. Branch lengths were short in this clade, and

the bootstrap support values ranged from 33% - 100% with SH-test values ranging from

27 – 100%, indicating varying degrees of phylogenetic resolution.

30
Figure 13. Phylogram (Clade VI) depicting relationships among individuals from the Río
Ostuta in Oaxaca, México (Pacific basin).

31
 Clade VII (MCA) consisted of specimens collected from both the Pacific (n=8)

and Atlantic (n=5) basin river systems (Fig. 14). The Pacific basin specimens included

individuals from the Lago Guija (ES_R) and Laguna Metapan (ES_V) in El Salvador;

individuals from the Río Achiguate (Guat_B, Guat_F) and Río Negro (Guat_C, Guat_E)

in Guatemala; and the Río Margaritas in Chiapas, México. The Atlantic basin specimens

included individuals from the Ríos Amarillo, Choluteca, Nacaome, and Tepemechin in

Honduras; and the Ríos Ojo de Agua and Paso Hondo, in Chiapas, México.

The type locality of P. pleurospilus is Lago Dueñas on the Pacific slope of

Guatemala. This lake no longer exists; however, the historical location of the lake is

indicated by a blue diamond (Fig. 5). The historical location of Lago Dueñas is just under

12 km from the headwaters of the Río Achiguate, indicating that this clade most likely

represents individuals of topotypic P. pleurospilus. Ultrafast bootstrap support values

ranged from 87% - 100% and SH values ranged from 70 – 100%, indicating relatively

robust phylogenetic resolution within Clade VII.

32
Figure 14. Phylogram (Clade VII; MCA) depicting relationships among individuals south
of the Isthmus of Tehuantepec. Samples are from the Ríos Margaritas (1), Ojo de Agua
(2), and Paso Hondo (3) in Chiapas, México; the Ríos Achiguate (4) and Negro (5) in
Guatemala; Lago Guija (6) and Laguna Metapan (7) in El Salvador; and the Ríos
Amarillo (8), Tepemechin (9), Nacaome (10), and Orocuina (11), in Honduras. Asterisks
(*) represent Atlantic basin samples; all other are Pacific basin samples.

33
Population Structure

Various population genetic metrics were used to assess genetic variability among

individuals and clusters of P. gracilis and P. pleurospilus. The first method employed

was a Discriminant Analysis of Principal Components (DAPC). The first three axes of

the DAPC analysis explained 15.95, 9.65, and 6.47% of the variability, respectively, and

four distinct clusters were recovered. The 95% confidence ellipses showed no overlap

among DAPC clusters, with the clustering showing varying distances from one another in

the DAPC space (Fig. 16). The pink (MCA) and purple (PSM) clusters corresponded to

samples collected south and east of the Isthmus of Tehuantepec. The green (AM) and

orange (PM) clusters corresponded to samples collected from the Isthmus of Tehuantepec

and north and east, and clustered more closely with one another than with either of the

other populations, with one AM individual recovered in the PM cluster.

34
 PSM

PM

AM MCA

Figure 15. Discriminant analysis of principal components (DAPC) of populations of P. gracilis and P. pleurospilus for the first three
axes, which explain 15.95, 9.65, and 6.47% of the variation, respectively. Ellipses represent 95% confidence intervals.

35
 I then used the DAPC object to visualize the population assignment of each

sample and created a composite stacked bar plot (Fig. 17). In a stacked bar plot, the

probability of population membership is illustrated on the y-axis, from 0 to 100%

probability of belonging to a specific population. The x-axis contains a bin of each

sample. Colors represent the pre-assigned populations by clade, whereas the groupings

represent the populations inferred from the DAPC object. The composite stacked bar

plots also recover the four distinct clusters revealed by the DAPC analysis. The orange

cluster corresponds to samples collected on the Pacific slope of México north of the

Isthmus of Tehuantepec, and is completely pure, with no admixture with any of the other

clusters. The green cluster corresponds to samples collected from the Atlantic slope of

México north of the Isthmus of Tehuantepec, and is nearly pure, with a single orange

sample (Mex_G6) from the Río Flor de Café in Oaxaca, México clustering most closely

with this group. The purple and pink clusters were completely pure, with no admixture

with any of the other clusters.

36
 PM AM
Posterior Membership Probability

PSM MCA

Figure 16. Composite stacked bar plot of populations of all individuals from the ingroup dataset.

37
 An unweighted Weir and Cockerham pairwise FST was calculated between

clusters of ingroup individuals, where values closer to zero represent no genetic

differentiation and values of one represent fixation of populations. The pairwise FST

values calculated between the four major clusters ranged from 0.10602 to 0.29637, with

the lowest pairwise FST being between the MCA and PSM clades and the highest being

between the AM and PSM clusters (Table 4).

Table 4. Weir and Cockerham unweighted pairwise FST between clades of ingroup
individuals.

AM PM PSM MCA

AM -

PM 0.12889 -

PSM 0.13785 0.29637 -

MCA 0.15229 0.24187 0.10602 -

38
 IV. DISCUSSION

The family Poeciliidae represents one of the most ubiquitous groups of fishes in

Middle America (Miller et al. 2005). Species in the family have been heavily studied

from both taxonomic and phylogenetic perspectives (Mateos et al. 2002; Reznick et al.

2017; Mateos et al. 2018; Conway et al. 2019), using morphological and mitochondrial

DNA data sets. Despite this flurry of activity, there remains much taxonomic uncertainty

within the family. In many groups of organisms, inclusion of next-generation sequence

data has proven to be an informative approach to resolve relationships among taxa and

identify evolutionary lineages among taxonomically difficult groups and recently

diverged lineages (Lal et al. 2016; Harris et al. 2018; Tonzo et al. 2020). Therefore, the

overall goal of this study was to examine the taxonomic validity of P. pleurospilus and P.

gracilis using next-generation sequence data in both phylogenetic and population genetic

frameworks.

In the current literature, native populations of P. pleurospilus are hypothesized to

inhabit Pacific Basin systems from México to Honduras, as well as Atlantic Basin

systems including the Río Grijalva (México), upper Río Motagua (Guatemala), and Río

Ulua Basins (Honduras) (Miller et al. 2005; Matamoros et al. 2009; McMahan et al.

2013). Native populations of P. gracilis are hypothesized to be restricted to the Atlantic

Basin in the states of Veracruz and Oaxaca, México, as well as having been introduced in

the Rios Pánuco (Atlantic) and Balsas (Pacific) within México (Miller et al. 2005). Based

on the results of my study, I propose a distributional revision. The recognition of

populations of P. gracilis (AM group/clade) should be restricted to Atlantic basin streams

from the Isthmus of Tehuantepec in México and north in the states of Oaxaca and

39
Veracruz (green clade/clusters). A genetically distinctive, undescribed species (PM

group/clade) (Poeciliopsis sp. 1) was found to be sister to P. gracilis in the phylogenetic

analysis, and should be recognized in Pacific basin streams from the Isthmus of

Tehuantepec in México, and north and west in the states of Oaxaca and Guerrero (orange

clade/clusters). Sister to these were a clade of two other species, P. pleurospilus and a

second undescribed species (Poeciliopsis sp. 2) (PSM group/clade). Based on my data,

Poeciliopsis sp. 2 is restricted to the Río Ostuta, a Pacific basin stream from Oaxaca,

México (purple clade/clusters). Finally, populations of P. pleurospilus (MCA

group/clade) should be recognized from both Pacific and Atlantic streams south and east

of the Isthmus of Tehuantepec, from Chiapas, México to Honduras, and include all

specimens from all rivers in Guatemala and El Salvador (pink clade/clusters).

Poeciliopsis gracilis was originally described from the Rio Orizaba on the

Atlantic Slope of Veracruz, Mexico (Heckel 1848). The Río Orizaba is a tributary to the

Rio Blanco, which is the sampling location of nine individuals used in this study (G47 –

55). The samples grouped in the AM cluster/clade in all of the phylogenetic and

population genetic analyses, indicating that this cluster/clade represents individuals of

topotypic P. gracilis. The other samples that grouped in this cluster/clade were all north

and west of the Isthmus of Tehuantepec, on both the Pacific and Atlantic slopes of

Mexico. The samples from the AM clade were sister to the PM clade. The population

genetic analyses both recover two distinct clusters north and west of the Isthmus of

Tehuantepec, but the FST values between these two groups is low relative to the

populations south of the Isthmus. Miller et al. (2005) recognized an undescribed species

that is sister to P. gracilis in the Río Verde in Oaxaca, México (Pacific basin). This

40
species is still undescribed and likely represents individuals corresponding to my PM

cluster/clade.

Poeciliopsis pleurospilus was originally described from Lago Dueñas on the

Pacific slope of Guatemala (Günther 1866). The historical location of this lake is

approximately 12 km from the headwaters of the Rio Achiguate, which was the sampling

location of two samples used in this study (Guat_B, Guat_F). These samples grouped in

the MCA cluster/clade in all phylogenetic and population genetic analyses, indicating that

this cluster/clade represents individuals of topotypic P. pleurospilus. The other samples

that were sister to this clade in the phylogenetic analysis were all south of the Isthmus of

Tehuantepec, in southern Mexico, El Salvador, Guatemala, and Honduras. The samples

from the PSM cluster/clade consistently were sister to the MCA clade in all of the

phylogenetic and population genetic analyses, with the phylogenetic analysis having a

100% SH-test and 92% ultrafast bootstrap support value for these two clades. The

population genetic analyses also support the existence of two clusters distinct clusters,

with specimens of Poeciliopsis. sp. 2 being restricted to Pacific systems and specimens of

P. pleurospilus being widely distributed in both Atlantic and Pacific populations.

Despite the fact that both P. gracilis and P. pleurospilus were described more

than 150 years ago (Heckel 1848, Günther 1866), these two species have long remained

taxonomically problematic and multiple reasons account for this. First, no comprehensive

morphological or molecular study of either P. gracilis or P. pleurospilus has been

published. Although both species are widespread and abundant, the lack of studies

attempting to refute or support their taxonomic validity have led to continued taxonomic

uncertainty for these species. Next, throughout Middle America non-native introductions

41
of freshwater fishes have been rampant further leading to taxonomic uncertainty. For

example, several species of poeciliids (i.e. Gambusia, Poecilia, and Xiphophorus spp.)

have been introduced for mosquito control and have successfully colonized over 40

countries (Contreras and Escalante 1984, Welcomme 1992). Additionally, poeciliids have

been incidentally released through the stocking of tilapia (Oreochromis and Tilapia spp.),

which have been introduced into multiple water bodies throughout Mexico and Central

America (Contreras-MacBeath et al. 1998; Beltran-Lopez et al. 2018). Native poeciliids

often inhabit stock ponds with tilapia and then are inadvertently introduced into other

drainage basins as tilapia are stocked and often confound taxonomic identity, as many

species of poeciliids are diagnosed by variations in male gonopodia (Miller et al. 2005).

Finally, an additional regional aspect to consider is the active history of inter-

basin hydrological exchanges from headwater stream capture or across the flood plains of

lowlands in Middle America. The area near the Isthmus of Tehuantepec represents one of

the lowest elevation points between the Atlantic and Pacific basins in the New World.

Many of the headwater reaches of Atlantic and Pacific basin streams come into close

proximity in the region and could allow for crossing over from one basin to the other

during rainy seasons. In addition, it is well known that some species of freshwater fishes

can tolerate low salinities and are therefore able disperse along the flood plains of

lowland regions during ecologically appropriate time periods (Albert and Reis 2011,

McMahan et al. 2017) and this is particularly true for some species of poeciliids, which

can often be found in low salinity habitats (Miller et al. 2005). All of these factors

together increase the likelihood that the neotropical freshwater ichthyofauna may have

42
much wider distributions than originally proposed, especially for generalist species such

as Poeciliopsis, and leaves room for distributional revisions as new data is presented.

The results of this study are consistent with multiple other studies, which have

demonstrated the Isthmus of Tehuantepec to be an important biogeographical zone where

major changes occur in the distributional patterns of many groups (Miller 1966; Croizat

1976; Huidobro et al. 2006; Mulcahy et al. 2006; Choudhury et al. 2016; Morcillo et al.

2016). These distributional changes may stem in part from the fact that Isthmus of

Tehuantepec represents a geologically complex zone that has been subjected to various

tectonic events, which in turn have changed the environmental conditions available to

organisms, such as sea-level changes connecting or isolating various aquatic systems

(Ferrusquia-Villafranca 1993). With current sea-levels, the result has been many the

occurrence of many small basins which are typically isolated from one another, but which

were occasionally connected by sea-level fluctuations in the past (Myers 1966; Coney

1982; Rosen 1985; De Cserna 1989). This would have allowed for inter-basin transfers to

occur across the Isthmus, not only between basins but also from Atlantic to Pacific basins

systems and vice versa. In addition to being a region that may facilitate crossing over

during periods of high-water, the Isthmus may also have acted as a geologic barrier that

separated P. gracilis and P. pleurospilus, as it has been demonstrated to do in various

other taxa (Mulcahy et al. 2006; Warren et al. 2008; Rodriguez-Gomez et al. 2013).

43
Conclusion

Poeciliopsis pleurospilus and P. gracilis are morphologically and ecologically

similar species, which have had a widely debated taxonomic history and geographic

distribution. This study presented comprehensive next-generation sequence evidence that

was analyzed in both a phylogenetic and population genetic framework to shed light on

the taxonomic status of both species. The results from phylogenetic and population

genetic analyses showed clear evidence that individuals of P. gracilis are distributed from

the Isthmus and Tehuantepec and north in Atlantic basin systems in Mexico, whereas

individuals of P. pleurospilus are distributed in both Atlantic and Pacific basin systems

south and east of the Isthmus of Tehuantepec, from southern Mexico to Honduras.

Additionally, the results from this study provide genetic evidence that P. pleurospilus and

P. gracilis are not sister to one another as originally assumed, and instead are each sister

to additional undescribed species of Poeciliopsis (PM and PSM groups/clades). Future

work should focus on quantifying pigmentation patterns, gonopodial variation, and

meristic differences across basins and between species to determine whether there are

morphologically identifiable characters to consistently distinguish between these four

distinct evolutionary lineages of poeciliid fishes.

44
 V. LITERATURE CITED

Albert, J.S., W.G.R. Crampton, D.H. Thorsen, and N.R. Lovejoy (2014). Phylogenetic
systematics and historical biogeography of the Neotropical electric fish
(Teleostei: Gymnotidae). Systematics and Biodiversity, 2, 375 – 417.

Albert, J.S. and R.E. Reis (2011). Historical biogeography of neotropical freshwater
fishes. Berkley, California: University of California Press.

Alda, F., R.G. Reina, I. Doadrío, and E. Bermingham (2013). Phylogeny and
biogeography of the Poecilia sphenops species complex (Actinopterygii,
Poeciliidae) in Central America. Molecular Phylogenetics and Evolution, 66,
1011 – 1026.

Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence
Data [Online]. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/

Arbogast, B.S. and G.J. Kenagy (2001). Comparative phylogeography as an integrative

approach to historical biogeography. Journal of Biogeography, 28, 819 – 825.

Bagley, J.C., F. Alda, M.F. Breitman, E. Bermingham, E.P. van den Berghe, and J.B.
Johnson (2015). Assessing species boundaries using multilocus species
delimitation in a morphologically conserved group of neotropical freshwater
fishes, the Poecilia sphenops species complex (Poeciliidae). PLoS One, 10(4):
e0121139.

Barts, N., R. Greenway, C.N. Passow, L. Arias-Rodriguez, J.L. Kelly, and M. Tobler
(2018). Molecular evolution and expression of oxygen transport genes in
livebearing fishes (Poeciliidae) from hydrogen sulfide rich springs. Genome, 61,
273 – 286.

Beltrán-López, R.G., O. Domínguez-Domínguez, R. Perez-Rodriguez, K.R. Piller, and I.

Doadrío (2018). Evolving in the highlands: The case of the Neotropical Lerma
live-bearing Poeciliopsis infans (Woodman, 1894) (Cyprinodontiformes:
Poeciliidae) in Central México. BMC Evolutionary Biology, 18, 56.

Bonaparte, C. L. (1831). Saggio di una distribuzione metodica degli animali vertebrati.

78 pp. Giornale Arcadico di Scienze Lettere ed Arti, 52, 155 – 189.

Bragança, P.H.N, P.F. Amorim, W.J.E.M. Costa (2018). Pantanodontidae (Teleostei,

Cyprinodontiformes), the sister group to all other cyprinodontoid killifishes as
inferred by molecular data. Zoosystematics and Evolution, 94, 137 – 145.

Briggs, J.C. (1984). Freshwater fishes and biogeography of Central America and the
Antilles. Systematic Zoology, 33, 428 – 435.

45
Bussing, W.A. (2002). Peces de las aguas continentales de Costa Rica/Freshwater Fishes
of Costa Rica, 2nd ed. University de Costa Rica, San Jose.

Bussing, W.A. (1985). Patterns of the distribution of the Central American ichthyofauna.
In: Stehli, F.G., Webb, S.D. (Eds.), The Great American Biotic Interchange.
Plenum Press, New York, pp. 453 – 473.

Choudhury, A., M. Garcia-Varela, G. Perez-Ponce de Leon (2016). Parasites of the

freshwater fishes and the Great American Biotic Interchange: a bridge too far?
Journal of Helminthology, 91, 1 – 23.

Coney, P.J. (1982). Plate tectonic constraints on the biogeography of Middle America
and the Caribbean region. Annals of the Missouri Botanical Garden, 69, 432 – 44.

Contreras, B.S. and M.A. Escalante (1984). Distribution and known impacts of exotic
fishes in México. In: Courtenay, W.R. and J.R. Stauffer (eds), Distribution,
Biology, and Management of Exotic Fishes. London: The Show Hopkins
University Press, 102 – 129.

Contreras-MacBeath, T., H. Mejia-Mojica, R. Carrillo-Wilson (1998). Negative impact

on the aquatic ecosystems of the state of Morelos, Mexico from introduced
aquarium and other commercial fish. Aquarium Science Conservation, 2, 67 – 78.

Contreras-MacBeath, T. and H. Ramirez Espinoza (1996). Some aspects of the

reproductive strategy of Poeciliopsis gracilis (Osteichthyes: Poeciliidae) in the
Cuautla River, Morelos, México. Journal of Freshwater Ecology, 11, 327 – 338.

Conway, K. W., M. Mateos, R. C. Vrijenhoek (2019). A new species of the live-bearing

fish genus Poeciliopsis from northern México (Cyprinodontiformes, Poeciliidae).
Zookeys, 88, 91 – 118.

Cracraft, J. (1983). Species concepts and speciation analysis. Current Ornithology, 1,

159 – 187.

Croizat, L. (1976). Biogeografia analitica y sintetica ("panbiogeografia") de las

Americas. Biblioteca de la Academia de Ciencias Fisicas, Matematicas y
Naturales, Caracas.

Daneck, P. et al., 100 Genomes Project Analysis Group (2011). The variant call format
and VCFtools. Bioinformatics, 27, 2156 – 2158.

De Cserna, S. (1989) An outline of the geology of Mexico. The geology of North

America. Vol. A. The geology of North America: an overview. The Geological
Society of America, Boulder, Colorado.

46
Dray, S. and A. Dufour (2007). The ade4 package: implementing the duality diagram for
ecologists. Journal of Statistical Software, 22, 1 – 20.

Eaton, D.A.R. and I. Overcast (2020). ipyrad: interactive assembly and analysis of
RADseq datasets. Bioinformatics, 36, 2592 – 2594.

Ferrusquia-Villafranca, I. (1993) Geology of Mexico: A synopsis. Biological diversity of

Mexico origins and distribution (ed. by T.P. Ramamoorthy, R. Bye, A. Lot and J.
Fa), pp. 3 – 107. Oxford University Press, Oxford

Fricke, R., W.N. Eschmeyer, and R. van der Laan (2020). Eschmeyer’s Catalog of
Fishes: Genera, Species,
References.(http://researcharchive.calacademy.org/research/ichthyology/catalog/fi
shcatmain.asp). Electronic version accessed May 20, 2020.

Gómez-González, A.E., E. Velázquez-Velázquez, M. de Jesús Anzueto Calvo, M.

Fabiola Maza-Cruz (2015). Fishes of the Grijalva River basin of México and
Guatemala. Check List, 11, 1726.

Günther, A. (1866). Catalogue of fishes in the British Museum. Catalogue of the

Physostomi, containing the families Salmonidae, Percopsidae, Galaxidae,
Mormyridae, Gymnarchidae, Esocidae, Umbridae, Scombresocidae,
Cyprinodontidae, in the collection of the British Museum. Vol. 6, London: British
Museum, 368 pp.

Grünwald N.J. and E.M. Goss (2011). Evolution and population genetics of exotic and re-
emerging pathogens: Novel tools and approaches. Annual Review of
Phytopathology, 49, 249 – 267.

Grünwald N.J., Z.N. Kamvar, and S.E. Everhart (2016a). Grünwaldlab/Population

Genetics and Genomics in R: First release [Tabima, J.F., B.J. Knaus, and N.J.
Grünwald. GBS Analysis].
https://grunwaldlab.github.io/Population_Genetics_in_R/gbs_analysis.html

Grünwald N.J., Z.N. Kamvar, and S.E. Everhart (2016b). Grünwaldlab/Population

Genetics and Genomics in R: First release [Knaus, B.J and N.J. Grünwald.
Clustering Plots].
https://grunwaldlab.github.io/Population_Genetics_in_R/clustering_plot.html

Harris, R.B., P. Alstrom, A. Odeen, A.D. Leache (2018). Discordance between genomic
divergence and phenotypic variation in a rapidly evolving avian genus
(Motacilla). Molecular Phylogenetics and Evolution, 120, 183 – 195.

47
Heckel, J. J. (1848). Eine neue Gattung von Poecilien mit rochenartigem
Anklammerungs-Organe (P. xiphophorus). In E. Band (Ed). Sitzungsberichte der
Kaiserlichen Akademie der Wissenschaften. Mathematisch-
Naturwissenschaftliche Classe v. 1 (pt 1-5) [1848]: 289 – 303, Pls. 8-9.

Hennig, W. (1965). Phylogenetic systematics. Annual Review of Entomology, 10, 97 –

116.

Ho, A.L.F.C., C.L. Pruet, and J. Lin (2016). Phylogeny and biogeography of Poecilia
(Cyprinodontiformes: Poeciliinae) across Central and South America based on
mitochondrial and nuclear DNA markers. Molecular Phylogenetics and
Evolution, 101, 32 – 45.

Hoang, D.T., O. Chernomor, A. von Haeseler, B.Q. Minh, and L.S. Vinh (2018).
UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology
and Evolution, 35, 518 – 522.

Holsinger, K.E. and B.S. Weir (2009). Genetics in geographically structured populations:
defining, estimating, and interpreting Fst. Nature Reviews Genetics, 10, 639 –
650.

Hrbek, T., J. Seckinger, and A. Meyer (2007). Molecular phylogeny of the Poeciliidae
(Teleostei, Cyprinodontiformes): biogeographic and life-history implications.
Molecular Phylogenetics and Evolution, 43, 986 – 98.

Huidobro, L., J.J. Morrone, J.L. Villalobos, and F. Alvarez (2006). Distributional patterns
of freshwater taxa (fishes, crustaceans and plants) from the Mexican Transition
Zone. Journal of Biogeography, 33, 731 – 741.

Jombart, T. (2008). adegenet: a R package for the multivariate analysis of genetic

markers, Bioinformatics, 24, 1403 – 1405.

Jombart, T. and I. Ahmed (2011). adegenet 1.3-1: new tools for the analysis of genome-
wide SNP data. Bioinformatics, 27, 3070 – 3071.

Jombart, T. and C. Collins (2015). A tutorial for Discriminant Analysis of Principal

Components (DAPC) using adegenet 2.0.0. Imperial College London MRC
Centre for Outbreak Analysis and Modeling.

Jombart, T., S. Devillard, and F. Balloux (2010). Discriminant analysis of principal

components: a new method for the analysis of genetically structured populations.
BMC Genetics, 11, 94.

Kalyaanamoorthy, S., B.Q. Minh, T.K.F. Wong, A. von Haeseler, and L.S. Jermiin
(2017). ModelFinder: fast model selection for accurate phylogenetic estimates.
Nature Methods, 14, 587 – 589.

48
Kamvar, Z.N., J.C. Brooks, and N.J. Grünwald (2015). Novel R tools for analysis of
genome-wide population genetic data with emphasis on clonality. Frontiers in
Genetics, 6, 208.

Kamvar, Z.N., J.F. Tabima, and N.J. Grünwald (2014). Poppr: an R package for genetic
analysis of populations with clonal, partially clonal, and/or sexual reproduction.
PeerJ, 2, e281.

Knaus, B.J. and N.J. Grünwald (2017). VCFR: a package to manipulate and visualize
variant cell format data in R. Molecular Ecology Resources, 17, 44 – 53.

Lal, M.M., P.C. Southgate, D.R. Jerry, K.R. Zenger (2016). Fishing for divergence in a
sea of connectivity: the utility of ddRADseq genotyping in a marine invertebrate,
the black-lip pearl oyster Pinctada margaritifera. Marine Genomics, 25, 57 – 68.

Lischer H.E.L. and L. Excoffier (2012). PGDSpider: an automated data conversion tool
for connecting population genetics and genomics programs. Bioinformatics, 28,
298 – 299.

Lucinda P.H.F. (2003). Family Poeciliidae (Livebearers). In: Reis R.E., S.O. Kullander,
C.J.J. Ferraris (eds). Check List of the Freshwater Fishes of South and Central
America. Porto Alegre, Brazil: EDIPUCRS, 555 – 81.

Lucinda, P.H.F. and R.E. Reis (2005). Systematics of the subfamily Poeciliinae
Bonaparte (Cyprinodontiformes: Poeciliidae), with an emphasis on the tribe
Cnesterodontini Hubbs. Neotropical Ichthyology, 3, 1 – 60.

Lundberg, J.G., L.G. Marshall, J. Guerrero, B. Horton, M.C.S.L. Malabarba, and F.

Wesselingh (1998). The stage for neotropical fish diversification: a history of
tropical South American rivers. In: Malabarba, L.R., R.E. Reis, R.P. Vari, Z.M.S.
Lucena, C.A.S. Lucena, Editors. Phylogeny and Classification of Neotropical
Fishes. Porto Alegre (Brazil): EDIPUCRS. 13 – 48.

Letunic, I. and P. Bork (2019). Interactive Tree of Life (iTOL) v4: recent updates and
new developments. Nucleic Acids Research, 47, 256 – 259.

Lyons, T.J., et al. (2020). The status and distribution of freshwater fishes in México.
Cambridge, UK and Albuquerque, New México, USA: IUCN and ABQ BioPark.

Mann, P. (2007). Overview of the tectonic history of northern Central America. The
Geological Society of America, Special Paper 428.

Marshall, J.S. (2007). The geomorphology and physiographic provinces of Central

America. In: Bundschuh J. and G.E. Alvarado (eds). Central America: geology,
resources, and hazards. London: Taylor and Francis Group, chapter three.

49
Martínez-Aquino, A., F.S. Ceccarelli, L.E. Eguiarte, E. Vázquez-Domínguez, G.P-P de
León (2014). Do the historical biogeography and evolutionary history of the
Digenean Margotrema spp. across Central México mirror those of their
freshwater fish hosts (Goodeinae)? PLoS ONE, 9, e101700.

Matamoros, W.A, J.F. Schaefer, and B.R. Kreiser (2009). Annotated checklist of the
freshwater fishes of continental and insular Honduras. Zootaxa, 2307, 1 – 38.

Matamoros, W.A., C.D. McMahan, P. Chakrabarty, J.S. Albert, and J.F. Schaefer (2015).
Derivation of the freshwater fish fauna of Central America revisited: Myers’s
hypothesis in the twenty-first century. Cladistics, 31, 177 – 188.

Mateos M. (2005). Comparative phylogeography of livebearing fishes in the genera

Poeciliopsis and Poecilia (Poeciliidae: Cyprinodontiformes) in central México.
Journal of Biogeography, 32, 775 – 780.

Mateos, M., O. Domínguez‐Domínguez, A. Varela-Romero (2018). A multilocus

phylogeny of the fish genus Poeciliopsis: solving taxonomic uncertainties and
preliminary evidence of reticulation. Ecology and Evolution, 9, 1845 –1857.

Mateos, M., O.I. Sanjur, R.C. Vrijenhoek (2002). Historical biogeography of the
livebearing fish genus Poeciliopsis (Poeciliidae: Cyprinodontiformes). Evolution,
56, 972 – 84.

Mayden, R.L. (1997). A hierarchy of species concepts: the denouement in the saga of the
species problem. In: M.A. Claridge, H.A. Dawah, and M.R. Wilson, eds. Species:
the units of diversity, pp. 381 – 424. London: Chapman and Hall.

Mayden, R.L. (1999). Consilience and a hierarchy of species concepts: advances toward
closure on the species puzzle. Journal of Nematology, 31, 95 – 116.

Mayr, E. (1942). Systematics and the origin of species from the viewpoint of a zoologist.
New York: Columbia University Press.

Mayr, E. (1957). Species concepts and definitions. In: E. Mayr, ed. The Species Problem,
publication no. 50, pp. 1 – 22. Washington, DC: American Association for the
Advancement of Science.

McMahan, C.D., L. Ginger, M. Cage, K. David, P. Chakrabarty, M. Johnston, and W.

Matamoros (2017). Pleistocene to Holocene expansion of the black-belt cichlid in
Central America, Vieja maculicauda (Teleostei: Cichlidae). PLoS ONE, 12,
e0178439.

McMahan, C.D., W.A. Matamoros, F.S. Alvarez Calderon, W. Yamileth Henriquez, H.

M. Recinos, P. Chakrabarty, E. Barraza, and N. Herrera (2013). Checklist of the
inland fishes of El Salvador. Zootaxa, 3608, 440 – 456.

50
Miller, R.R. (1966). Geographic distribution of Central American freshwater fishes.
Copeia, 4, 773 – 802.

Miller, R.R., W.L. Minckley, and S.M. Norris (2005). Freshwater fishes of México. The
University of Chicago Press, Chicago and London.

Mishler, B.D. and M.J. Donoghue (1982). Species concepts: a case for pluralism.
Systematic Zoology, 31, 491 – 503.

Mishler, B.D. and E.C. Theriot (2000). The phylogenetic species concept (sensu Mishler
and Theriot): monophyly, apomorphy, and phylogenetic species concepts. In:
Q.D. Wheeler and R. Meier, eds. Species concepts and phylogenetic theory: a
debate, pp. 44 – 54. New York: Columbia University Press.

Morcillo, F., C.P. Ornelas-Garcia, L. Alcaraz, W.A. Matamoros, I. Doadrío (2016).

Phylogenetic relationships and evolutionary history of the Mesoamerican endemic
freshwater fish family Profundulidae (Cyrpinodontiformes: Actinoptergii).
Molecular Phylogenetics and Evolution, 95, 242 – 51.

Mulcahy, D.G., B.H. Morrill, J.R. Mendelson III (2006). Historical biogeography of
lowland species of toads (Bufo) across the Trans Mexican Neovolcanic Belt and the
Isthmus of Tehuantepec. Journal of Biogeography, 33, 1889 –1904

Myers, G.S. (1966) Derivation of the freshwater fish fauna of Central America. Copeia,
4, 773 – 802.

Neuwirth, E. and C. Brewer (2014). RColorBrewer: ColorBrewer Palettes,

https://CRAN.R-project.org/package=RColorBrewer.

Nguyen, L.T., H.A. Schmidt, A. von Haeseler, B.Q. Minh (2015). IQ-TREE: A fast and
effective stochastic algorithm for estimating maximum likelihood phylogenies.
Molecular Biology and Evolution, 32, 268 – 274.

Palacios, M., G. Voelker, L.A. Rodriguez, M. Mateos, M. Tobler (2016). Phylogenetic

analyses of the subgenus Mollienesia (Poecilia, Poeciliidae, Teleostei) reveal
taxonomic inconsistencies, cryptic biodiversity, and spatio-temporal aspects of
diversification in Middle America. Molecular Phylogenetics and Evolution, 103,
230 – 44.

Paradis E. and K. Schliep (2018). ape 5.0: an environment for modern phylogenetics and
evolutionary analyses in R. Bioinformatics, 35, 526 – 528.

Parenti, L.R. (1981). A phylogenetic and biogeographic analysis of cyprinodontiform

fishes (Teleostei, Atherinomorpha). Bulletin of the American Museum of Natural
History, 168, 335 – 557.

51
Patterson, N., A.L. Price, and D. Reich (2006). Population structure and eigenanalysis.
PLoS Genetics, 2, e190.

Perdices, A., E. Bermingham, A. Montilla, and Ignacio Doadrío (2002). Evolutionary

history of the genus Rhamdia (Teleostei: Pimelodidae) in Central America.
Molecular Phylogenetics and Evolution, 25, 172 – 189.

Pérez-Rodríguez R., O Domínguez-Domínguez, G. Pérez-Ponce de León, I. Doadrío

(2009). Phylogenetic relationships and biogeography of the genus Algansea
Girard (Cypriniformes: Cyprinidae) of central México inferred from molecular
data. BMC Evolutionary Biology, 223, pp. 28.

Peterson, B.K., J. N. Weber, E. H. Kay, H. S. Fisher, and H. E. Hoekstra (2012). Double

digest RADseq: an inexpensive method for de novo SNP discovery and
genotyping in model and non-model species. PLoS one, 7, e37135.

Petkova, D., J. Novembre, and M. Stephens (2016). Visualizing spatial population

structure with estimated effective migration surfaces. Nature Genetics, 48, 94 –
100.
Pritchard, J.K., M. Stephens, and P. Donnelly (2000). Inference of population structure
using multilocus genotype data. Genetics, 155, 945 – 959.

Rauchenberger, M. (1988). Historical biogeography of Poeciliid fishes in the Caribbean.

Systematic Zoology, 37, 356 – 365.

Regan, C.T. (1913). A revision of the cyprinodont fishes of the subfamily Poeciliinae.
Proceedings of the Zoological Society of London B, 4, 977 – 1018.

Reznick, D.N., A.I. Furness, R.W. Meredith, M.S. Springer (2017). The origin and
biogeographic diversification of fishes in the family Poeciliidae. PLoS ONE, 12,
e0172546.

Rodriguez-Gomez, F., C. Gutierrez-Rodriguez, and J.F. Ornel (2013). Genetic,

phenotypic and ecological divergence with gene flow at the Isthmus of
Tehuantepec: the case of the azure-crowned hummingbird (Amazilia
cyanocephala). Journal of Biogeography, 40, 1360 – 1373.

Rodriguez-Silva, R. and P.F. Weaver (2020). A new livebearing fish of the genus Limia
(Cyprinodontiformes: Poeciliidae) from Lake Miragoane, Haiti. Journal of Fish
Biology, 1 – 10.

Rosen, D.E. (1975). Vicariance model of Caribbean biogeography. Systematic Zoology,

24, 431 – 64.

Rosen, D.E. (1985) Geological hierarchies and biogeographical congruence in the

Caribbean. Annals of the Missouri Botanical Garden, 72, 636 – 659.

52
Rosen, D.E. and R.M. Bailey (1963). The poeciliid fishes (Cyprinodontiformes), their
structure, zoogeography, and systematics. Bulletin of the American Museum of
Natural History, 126, 1 – 176.

RStudio Team (2015). RStudio: Integrated Development for R. RStudio, Inc., Boston,
MA. URL: https://www/rstudio.com/

Schmidt, D.N. (2007). The closure history of the Central American seaway: evidence
from isotopes and fossils to models and molecules. In M. Williams, A.M.
Haywood, F.J. Gregory, and D.N. Schmidt (eds.), Deep-time perspectives on
climate change: marrying the signal from computer models and biological
proxies, Geological Society of London, pp. 427 – 442.

Thomaz, A.T., T.P. Carvalho, L.R. Malabarba, and L.L. Knowles (2019). Geographic
distributions, phenotypes, and phylogenetic relationships of Phalloceros
(Cyprinodontiformes: Poeciliidae): Insights about diversification among
sympatric species pools. Molecular Phylogenetics and Evolution, 132, 265 – 274.

Tonzo, V., A. Papadopoulou, J. Ortego (2020). Genomic footprints of an old affair: single
nucleotide polymorphism data reveal historical hybridization and the subsequent
evolution of reproductive barriers in two recently diverged grasshoppers with
partly overlapping distributions. Molecular Ecology, 29, 1 – 15.

van Kruistum, H., M.W. Guernsey, J.C. Baker, S.L. Kloet, M.A.M. Groenen, B.J.A.
Pollux, H.J. Megens (2020). The genomes of the livebearing fish species
Poeciliopsis retropinna and Poeciliopsis turrubarensis reflect their different
reproductive strategies. Molecular Biology Evolution, 37, 1376 – 1386.

Warren, D.L., R.E. Glor, M. Turelli (2008). Environmental niche equivalency versus
conservatism: quantitative approaches to niche evolution. The Society for the
Study of Evolution, 62, 2868 – 2883.
Weaver, P.F., A. Cruz, S. Johnson, J. Dupin, K.F. Weaver (2016). Colonizing the
Caribbean: biogeography and evolution of livebearing fishes of the genus Limia
(Poeciliidae). Journal of Biogeography, 43, 1808 – 1819.

Weir, B.S. and C.C. Cockerham (1984). Estimating F-statistics for the analysis of
population structure. Evolution, 38, 1358 – 1370.

Weir, B.S. and J. Goudet (2017). A unified characterization of population structure and
relatedness. Genetics, 206, 2085 – 2103.

Weir, B.S. and W.G. Hill (2002). Estimating F-statistics. Annual Reviews of Genetics, 36,
721 – 50.

Welcomme, R.A. (1992). History of international introductions of inland aquatic species.

ICES Marine Science Symposium, 194, 3 – 14.

53
Wickham, H. (2016). ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New
York. ISBN 978-3-319-24277-4, https://ggplot2.tidyverse.org.

Wickham, H. (2007). Reshaping data with the reshape package. Journal of Statistical
Software, 21, 1 – 20.

Wickham, H., et al. (2019). Welcome to the tidyverse, Journal of Open Source Software,
4, 1686.

Wiley, E.O. (1978). The evolutionary species concept reconsidered. Systematic Zoology,
27, 17 – 26.

Winker, K. (2011). Middle America, not Mesoamerica, is the accurate term for
biogeography. Condor, 113, 5 – 6.

Zúñiga‐Vega, J.J., S.J. Ingley, P.J. Unmack, and J.B. Johnson (2014). Do freshwater
ecoregions and continental shelf width predict patterns of historical gene flow in
the freshwater fish Poecilia butleri? Biological Journal of the Linnaean Society,
112, 399 – 41.

54