Original Article

Effects of Genes, Lifestyles, and Noise Kurtosis on Noise-

Induced Hearing Loss
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Xiaoyu Yin1, Zheng Li2, Tianyu Zhao3, Lei Yang1

1
School of Public Health, Hangzhou Normal University, Hangzhou, China, 2Wu Yun Shan Hospital of Hangzhou, Hangzhou, China, 3Central People’s Hospital of
Zhanjiang, Zhanjiang, China
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Abstract
Objective: To explore the association of lifestyles, caspase gene (CASP), and noise kurtosis with noise-induced hearing loss (NIHL).
Design: Three hundred seven NIHL individuals and 307 matched controls from factories in Chinese factories participated in this case–control
study. Age, sex, noise exposure, exfoliated oral mucosa cells, and lifestyles of participants were gathered by the authors. The single nucleotide
polymorphisms (SNPs) were genotyped using the Kompetitive Allele Specific polymerase chain reaction (KASP) method. Results: The risk
of NIHL was higher for people who worked in the complex noise environment than for people exposed to steady noise environment (adjusted:
OR = 1.806, P = 0.002). Smoking and regular earphone use increased the risk of NIHL (adjusted: OR = 1.486, P = 0.038). The GG genotype
of the recessive model and G allele in rs1049216, together with the TT genotype of the recessive model in rs6948 decreased the NIHL risk
(adjusted: OR = 0.659, P = 0.017). Oppositely, the AA genotype of additive model in rs12415607 had a higher NIHL risk (adjusted:
OR = 1.804, P = 0.024). In the additive models, there was a positive interaction between noise kurtosis and CASP3 polymorphisms
(RERI = 1.294, P = 0.013; RERI = 1.198, P = 0.031). Conclusions: Noise kurtosis, three SNPs (rs1049216, rs6948, and rs12415607),
smoking and earphone use were found to be related to NIHL, and there was a positive interaction between noise kurtosis and CASP3. Results
from this study can be used to prevent and detect NIHL and for genetic testing.

Keywords: CASP, interaction, lifestyle, NIHL, noise kurtosis

INTRODUCTION The cumulative noise exposure (CNE) index combines the

equivalent sound level and duration of noise reception to
Hearing impairment is one of the most common human
assess the risk of hearing loss. The current international
disabilities, and presents great risk to everyday life. In
standards for noise exposure rely entirely on one energy
2005, the WHO estimated that 278 million people
indicator (ISO-1999, 2013). The equal energy hypothesis
worldwide were living with disabling hearing impairment.
is used to establish and enforce noise criteria. This
In 2012, the WHO released new estimates of disabling
hypothesis assumes that the effect of noise on the cochlea
hearing impairment based on 42 population-based
is proportional to the noise exposure energy intensity
studies.[1,2] There are approximately 30 million employees
multiplied by the exposure duration. Noise in industries,
in the Americas and Europe who are exposed to potentially
such as the sort produced by machines, is complex,
hazardous noise levels, and there are about 400 million
fluctuating, and unstable, so equal energy hypothesis does
employees who are in danger of hearing loss.[3] Noise-
not work for this type of noise.[8] To address this discrepancy,
induced hearing loss (NIHL) results from interactions
between genetic and environmental factors.[4] The main
contributing factors to hearing impairment are non- Address for correspondence: Lei Yang, School of public health,
occupational and occupational noise exposure, and Hangzhou Normal University, No.58, Haishu Rd, Cangqian,
Hangzhou 310000, Zhejiang, China.
individual characteristic such as sex, age, smoking, E-mail: yanglei62@hznu.edu.cn
medical problems, and hearing protection device (HPD)
usage.[5-7] Received: 13 November 2022 Revised: 16 May 2023
Accepted: 1 June 2023 Published: 28 September 2023

This is an open access journal, and articles are distributed under the terms of the
Access this article online Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows
Quick Response Code: others to remix, tweak, and build upon the work non-commercially, as long as
Website: appropriate credit is given and the new creations are licensed under the identical
www.noiseandhealth.org terms.

For reprints contact: reprints@medknow.com

DOI: How to cite this article: Yin X, Li Z, Zhao T, Yang L. Effects of Genes,
10.4103/nah.nah_65_22 Lifestyles, and Noise Kurtosis on Noise-Induced Hearing Loss. Noise
Health 2023;25:143-57.

© 2023 Noise & Health | Published by Wolters Kluwer - Medknow 143

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL
Erdreich et al. proposed to classify complex noise according
to peak value statistics. The kurtosis was defined as the ratio
of fourth moment to the squared second moment of the
distribution from the sampled amplitudes of the noise.[9]
The larger the peak value, the higher the impulse property
of complex noise. Thus, the time-domain variables (peak
value, duration, and interval between pulses) that affect
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
hearing are reduced to a simple, easy-to-calculate noise
classification.[10] A study has shown that kurtosis has a
dose–response relationship with the detection rate of high-
frequency NIHL in noise exposed workers.[11]
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024
The term NIHL refers to the death and destruction of cochlear
hair cells. In apoptosis, a specific gene controls an orderly,
cell-independent death program. Activation of the apoptosis
cascade results in hair cell death.[12] Downstream of the
apoptosis cascade, caspase-3, and caspase-7 are apoptotic
effectors that are activated by the upstream promoter.[13,14] A
study has shown that there is a certain correlation between
mutations in HSP70-1, HSP70-2, and HSP70-hom and
susceptibility to NIHL.[15] However, an earlier meta-
analysis on the relationship between HSP70 genes and
susceptibility to NIHL found no direct correlation between
these genes and NIHL in the Chinese population. Only
rs1061581 and rs2227956 were directly associated with
NIHL in male North Caucasian populations.[16] Several
studies suggest that functional differences between
polymorphic variants of apoptosis-related genes may alter
transcription factor binding, thereby inducing apoptosis and
repressing primary cell transformation.[17] Additionally,
previous studies demonstrate that lifestyle habits such as
smoking, drinking, and earphone use are associated with
hearing loss.[18,19] Many epidemiological studies have
shown that a lack of physical activity is associated with
hearing loss, possibly because less physical activity may
result in a reduced flow of blood, oxygen, and nutrients to
the cochlea, leading to degeneration of the stria vascularis
(SV). The blood vessels in the SV are necessary for delivering
oxygen and nutrients such as glucose to the cochlea.[20,21]
Using a case–control study, we evaluated the relationship
between noise (introducing noise kurtosis), lifestyle factors,
CASP, and their interaction with NIHL in Chinese
populations. As a result of these studies, genetic screens
for hearing loss could be developed.
MATERIALS AND METHODS
Participants
We developed a database of individuals exposed to high level
occupational noise (environmental noise >85 dB) from three
factories in Ningbo and Wenzhou, Zhejiang Province, from
October 2017 to December 2017 and from two factories in
Hangzhou, Zhejiang Province, from October 2018 to
December 2018. These are participant standards: (1)
people who have only worked in one factory and in the
same working conditions; (2) test difference of hearing
threshold less than 30 dB at each frequency between the
144
left and right ears; (3) no history of army service; (4) no
hearing loss family history; (5) no ototoxic drug use; (6) no
ear disease history; and (7) no diabetes. In our study 307
hearing loss patients had an average hearing threshold
>25 dB (A) at high frequencies in both ears (3000, 4000,
and 6000 Hz). An additional 307 age (±3 years) and gender-
matched individuals with normal hearing were selected from
this database and used as controls.
Questionnaire survey
Study participants filled out the form in a survey about noise
exposure. We gathered the following information: (1)
demographic information (age, sex, etc.); (2) noise
exposure information (working factory, working time,
duration of daily noise exposure, etc.); (3) lifestyle
information (tobacco using, drinking, and earphone use).
Variables were defined as follows: (1) smoking: smoking
one or more cigarettes every day and for at least 1 year; (2)
drinking: average daily alcohol consumption, for example,
more than 50 g liquor, more than 150 g red wine, or more than
500 g beer, and lasting for at least 1 year; (3) earphone use:
average weekly earphone use over 1 year; (4) health of the
ears (ear disease history, drugs that cause ototoxicity intake
history). Hangzhou Normal University’s Science Ethics
Committee approved the study (2017LL107). All study
participants signed informed consent forms. Trained
investigators assisted participants to complete study
questionnaires in a face-to-face meeting.
Noise exposure measurement
We used ASV5910-R digital noise dosimeter (Hangzhou
Aihua Instrument Co., LTD.) to measure the continuous
equivalent A-weighted sound level (LAeq, 8h) at 48 khz as
the sampling rate for 8 hours. The noise dosimeter is equipped
with a 1/4 inch microphone and has a frequency response
range of 10 Hz to 20 kHz and a measurement range of
40–141 dB (A). Before and after each sampling period, we
calibrated the noise dosimeter with a sound level calibrator
machine (AWA6221B, HangzhouAihua Instrument
Company). The noise dosimeter was worn on the shoulder
of the worker with the microphone facing up (Supplementary
material 1). After collected noise exposure data, we loaded
the data from the noise dosimeter to computer and finished
the follow-up analysis.
CNE was used to quantify each worker’s noise exposure by
using Formula 1:
As the environment study participants worked in was the
same, n equals 1. Formula 1 could be transformed into
Formula 2:
In Formulae 1 and 2, n is the total number of jobs exposed to
noise, LAeq, 8h is the equivalent 8-hour working day
Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023
 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL
continuous A level-weighted noise exposure level, and Ti is
the noise exposure time (in years). The CNE unit is dB (A) per
year.
MATLAB (Natick, MA) was used to calculate the sampling
kurtosis of the continuous 40-second time window for the
entire shift. The Formula 3 showed the formula of calculating
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
kurtosis:
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024
where xi is the i-th value, xÌ is the sample mean, and b is the
noise kurtosis. In principle, when b = 3, the noise is Gaussian
(steady) noise, while b > 3 indicates complex noise. Kurtosis
is proportional to the noise impulse energy. We defined b ≥
10 as complex noise and b < 10 as steady noise. Kurtosis
depends on two factors: the sampling rate of the noise
waveform and the length of the calculation window. The
40-second window not only takes into account the
computational efficiency, but also reflects the dynamic
characteristics of complex noise. In addition, the 40-
second window was determined based on a previous
animal study.[22]
Hearing test and hearing loss diagnosis
To assess NIHL, experienced audiologists performed pure-
tone audiometry for the left and right ears of each
participant, according to the requirements of the
}Occupational Noise-induced Hearing Loss Diagnostic
Criteria} (GBZ49-2014). In a soundproof room with
background noise <25 dB (A), the test was performed on
both ears with pure tone at different frequencies
(Supplementary material 2). Before the test, all the
subjects were asked to be outside the worksite for at least
16 hours. The results of pure sound measurements were
adjusted to age and gender according to the requirements in
Appendix A of the ISO1999:2013 standard. High-frequency
NIHL (hNIHL) was diagnosed based on the binaural hearing
threshold level at 3, 4, and 6 kHz (HTL 3, 4, 6 kHz) using the
following formula:
Participants with HTL3,4,6kHz >25 dB HL were diagnosed
with hearing loss of binaural high frequency. Patients with
HTL3,4,6kHz  25 dB HL were diagnosed with non-binaural
high frequency hearing loss.
SNP selection
SNPs were selected from previous studies reporting
associated hearing loss and hearing loss-associated genes
from the GeneCard databases (http://www.genecards.org)
and PubMed (http://www.ncbi.nlm.nih.gov/snp). Five SNPs
were selected in the CASP3 and CASP7 genes, including
rs1049216, rs6948, and rs1127687 at the 3’ end, rs12415607
in the 2kb-upstream region, and rs2227310 in the exon region
(Table S1).
Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023
DNA extraction and genotyping
All the participants‘ oral mucosa cells were collected by
Yongming flocking swabs. We extracted DNA by using
Tiangen Oral Mucosa Genomic DNA extraction kits
(Tiangen Biotech, Beijing, China) (Supplementary
material 3). The genotyping analysis was done using the
Kompetitive allele-specific polymerase chain reaction
(KASP) method by Hangzhou Hechuan Biological
Technology Co., Ltd. (Table S2). To control the quality,
we randomly selected 10% of the samples and re-classified
the genes, and the concordance of five SNPs was 100%.
Statistical analysis
To perform statistical analysis, we used SPSS 24.0. Continuous
variables for normal distribution were expressed as
mean ± standard deviation (SD) and were analyzed by
Student’s t-test, non-normally distributed continuous
variables distribution were expressed as median (P25, P75)
and were analyzed by Mann–Whitney U test. Categorical
variables were described as percentage and analyzed by Chi-
squared (x2) test. We used binary logistic regression to conduct
association analysis in noise exposure, gene, lifestyle choice,
and NIHL. The association analysis was reported in the form of
OR and 95% CI. We used crossover analysis to explore the
interactions of noise, genes, and lifestyles, then determined by
Microsoft Excel according to Knol et al.[23] P < 0.05 indicated
that the difference was statistically significant (showed in bold
in tables). The multiple comparison method was the
Benjamini–Hochberg procedure.
RESULTS
General characteristics
This research involved 307 NIHLs and 307 controls, with a
median age of 36 and 34 years, respectively. The median
kurtosis in the NIHL group [7.25 (4.63–14.30)] was
significantly higher than that in the control group [5.85
(4.06–12.51); P = 0.006]. The proportion of individuals
exposed to complex noise was significantly greater in the
NIHLs than that in the control group. The chi-squared (x2)
test found a significant difference for smoking (P = 0.043).
The median threshold shift in the control group was lower
than that in the NIHL group (Table 1).
Different genetic models of three SNPs
We searched for the association between CASP
polymorphisms and NIHL. There are four of the five SNPs
in Hardy–Weinberg equilibrium in the control subjects (P >
0.05) as shown in Table S1. Table 2 shows the three positive
SNPs. The Chi-squared (x2) test found the proportion of
people carrying the AA+AG genotype of the rs1049216
recessive model as well as the A allele of the rs1049216
allele model in the NIHL group was significantly higher than
in the control group (P < 0.05). But we did not find
significant differences in the rs6948 and rs12415607
genetic models in this research. [Table 2]
145
 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table 1: General characteristics, noise exposure, and lifestyles distribution between NIHL and control groups
Characteristics Total (n = 614) NIHL (n = 307) Control(n = 307) x2/z P
Sex, n (%) 0.000 1.000
Male 474 (77.2) 237 (38.6) 237 (38.6)
Female 140 (22.8) 70 (11.4) 70 (11.4)
Age, median (P25–P75), y −1.959
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

35 (30–43) 36 (30–43) 34 (30–42) 0.050

Education, n (%)
High School/University 347 (56.5) 168 (27.4) 179 (29.2) 0.802 0.371
Illiteracy/Primary school / 267 (43.5) 139 (22.6) 128 (20.8)
Junior high school
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Working years, 3.00 (1.43–6.00) 3.00 (1.20–6.00) 3.00 (2.00–6.00) −1.002 0.317
median (P25–P75), y
Threshold shift, dB 25.00 (17.83–36.96) 36.83 (29.83–49.83) 17.83 (14.17–21.00) −21.442 <0.001
Kurtosis, median (P25–P75) 16.10 (9.99–28.33) 17.10 (9.23–24.95) 14.76 (9.23–24.95) −2.81 0.005
n (%) Steady noise 154 (25.1) 61 (9.9) 93 (15.1) 8.875 0.003
Complex noise 460 (74.9) 246 (40.1) 214 (34.9)
CNE, median 93.69 (89.48–97.57) 93.73 (89.67–98.24) 93.62 (89.07–96.88) −1.23 0.219
(P25–P75), dB (A)
<85 52 (8.5) 28 (4.6) 24 (3.9) 0.336 0.562
≥85 562 (91.5) 279 (45.4) 283 (46.1)
Smoking, n (%)
No 325 (52.9) 150 (24.4) 175 (28.5) 4.086 0.043
Yes 289 (47.1) 157 (25.6) 132 (21.5)
Drinking, n (%) 1.786 0.181
No 437 (71.2) 211 (34.4) 226 (36.8)
Yes 177 (28.8) 96 (15.6) 81 (13.2)
Earphone, n (%) 2.125 0.145
Never 282 (45.9) 132 (21.5) 150 (24.4)
Regular 332 (54.1) 175 (28.5) 157 (25.6)

Associations of noise exposure–lifestyles–genetic
models interaction with risk of NIHL
We examined the association between noise exposure,
lifestyles, and genetic models with NIHL. In Table 3, with
adjustment of characters (sex, age, education background,
and duration years), we found that kurtosis, smoking, the
rs1049216 recessive and allele models, and the rs12415607
additive model were significantly associated with NIHL. The
people who were exposed to the environment of steady noise
(b < 10) had a lower risk of NIHL compared with those
workers who were exposed to the complex noise environment
(b ≥ 10). Smoking was more likely to cause NIHL in people
than those without smoking. This means that the risk of
people carrying the AA+AG genotype of rs1049216
developing NIHL is greater than that of those with the GG
genotype of rs1049216. In addition to the recessive model, we
found that the allele model of rs1049216 had a similar
situation. In the rs1049216 allele model, people who carry
the A allele have a high risk of developing NIHL than people
with the G allele. In the rs12415607 additive model,
compared with individuals who carry the CC genotype,
those carrying the AA genotype were more likely to cause
NIHL.
After adjusting gender, age, education, and duration years
(working years), we found significant differences between
NIHL and the control group in earphone use and the rs6948
recessive model. Compared to the people who have no
earphone use, regular earphone use posed a higher risk to
be NIHL. In the rs6948 recessive model, individuals who
carried the TT genotype were less likely to cause NIHL than
those carrying the GG+GT genotype.
Interaction
NIHL is a complex disease caused by a combination of
genetic and environmental factors. The interactions were
analyzed in terms of noise kurtosis, lifestyle details (like
smoking and earphone use), and three SNPs (rs1049216
recessive model, rs6948 recessive model, and rs12415607
additive model). The recessive model of SNP, which is
interacting with noise and lifestyle, is 2 × 2 level. While
interacting with other factors, the additive model is 2 × 3
level.
Association of noise-kurtosis-CASP-polymorphisms
interaction for the risk of NIHL
Table 4 shows the effects of the interaction between noise
kurtosis and CASP3 rs1049216, rs6948 recessive models on
the risk of NIHL. After we adjusted the sex, age, education,
and duration years (working years), the workers exposed to
complex noise environments who had the AA+AG genotype

146 Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table 2: Different genetic models of three SNPs between NIHL and control groups
Genotypes Total (n = 614) NIHL (n = 307) Control (n = 307) x2/z P
rs1049216, n (%) 5.080 0.079
Additive AA 19 (3.1) 10 (1.6) 9 (1.5)
AG 185 (30.1) 105 (17.1) 80 (13.0)
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

GG 410 (66.8) 192 (31.3) 218 (35.5)

Dominant AA 19 (3.1) 10 (1.6) 9 (1.5) 0.054 0.816
GG+AG 595 (96.9) 297 (48.4) 298 (48.5)
Recessive AA+AG 204 (33.2) 115 (18.7) 89 (14.5) 4.963 0.026
GG 410 (66.8) 192 (31.3) 218 (35.5)
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Allele A 223 (18.2) 125 (10.2) 98 (8.0) 3.994 0.046

G 1005 (81.8) 489 (39.8) 516 (42.0)
rs6948, n (%) 3.782 0.151
Additive GG 18 (2.9) 10 (1.6) 8 (1.3)
GT 164 (26.7) 92 (15.0) 72 (11.7)
TT 432 (70.4) 205 (33.4) 227 (37.0)
Dominant GG 18 (2.9) 10 (1.6) 8 (1.3) 0.229 0.632
TT+GT 596 (97.1) 297 (48.4) 299 (48.7)
Recessive GG+GT 182 (29.6) 102 (16.6) 80 (13.0) 3.780 0.052
TT 432 (70.4) 205 (33.4) 227 (37.0)
Allele G 201 (16.4) 111 (9.0) 90 (7.3) 2.623 0.105
T 1027 (83.6) 503 (40.1) 524 (42.7)
rs12415607, n (%) 4.831 0.089
Additive CC 222 (36.2) 101 (16.4) 121 (19.7)
CA 306 (49.8) 155 (25.2) 151 (24.6)
AA 86 (14.0) 51 (8.3) 35 (5.7)
Dominant CC 222 (36.2) 101 (16.4) 121 (19.7) 2.822 0.093
AA+CA 392 (63.8) 206 (33.6) 186 (30.3)
Recessive CC+CA 528 (86.0) 256 (41.7) 272 (44.3) 3.462 0.063
AA 86 (14.0) 51 (8.3) 35 (5.7)
Allele C 750 (61.1) 377 (30.7) 373 (30.4) 0.055 0.815
A 478 (38.9) 237 (19.3) 241 (19.6)

of rs1049216 or the GG+GT genotype of rs6948 were at a
higher risk of NIHL compared with people exposed to steady
noise who carried the GG genotype of rs1049216 or the TT
genotype of rs6948. Within the strata of complex noise,
workers carrying the AA+AG genotype of rs1049216 or
the GG+GT genotype of rs6948 had a higher tendency of
NIHL than those individuals who carrying the GG genotype
of rs1049216 or the TT genotype of rs6948. At the level of
risk genotype, the population in complex noise environment
showed a greater risk of NIHL than the population in stable
noise environment. We found a positive result from an
interaction between noise kurtosis and CASP3
polymorphisms in the additive models.
Table S3 shows the effects of the interaction between CASP7
rs12415607 addictive model and noise kurtosis for the risk of
NIHL in the 2 × 3 level analysis. When we adjusted for sex,
age, education background and duration years (working
years), compared with individuals carrying CC genotype
who worked in steady noise environment, those who
worked in complex noise environment carrying CA
genotype or AA genotype of rs12415607 had a higher
tendency of NIHL. Compared with those working in a
steady noise environment, individuals with the CA
genotype who worked in complex noise environment had a
higher NIHL risk. In the additive models, we did not find an
interaction between the rs12415607 polymorphism and noise
kurtosis (P-value of RERI >0.05).
Association of CASP polymorphisms–lifestyles
interaction for the risk of NIHL
It shows the interaction effects between CASP3 rs6948
recessive model and lifestyle choice for the NIHL risk in
Table 5. Compared with the TT genotype group who had no
smoking or using earphone, the GG+GT genotype group
performing smoking or regular earphone use were at a
higher risk of NIHL. Within the strata of TT, individuals
who had the smoking habit had a higher risk of NIHL than
those without smoking. In the GG+GT genotype people using
earphone regular was 1.396 times higher than those no
earphone use. Within the strata of regular earphone use,
the people carrying GG+GT genotype were at higher
NIHL risk compared with those carrying the TT genotype.
The interaction was not found between rs6948 polymorphism
and lifestyle choice.

Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023 147

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table 3: Associations of noise exposure, lifestyles, and genetic models with risk of NIHL
Variables Unadjusted OR (95% CI) Unadjusted P Adjusted OR (95% CI) Adjusted P
Kurtosis Complex noise/Steady noise 1.753 (1.209–2.540) 0.003 1.806 (1.235–2.643) 0.002
CNE* ≥85/<85 0.845 (0.478–1.494) 0.562 0.808 (0.454–1.437) 0.468
Smoking
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Yes/No 1.388 (1.010–1.907) 0.043 1.486 (1.021–2.161) 0.038

Drinking
Yes/No 1.269 (0.894–1.802) 0.182 1.273 (0.869–1.865) 0.215
Earphone
Regular/Never 1.267 (0.922–1.741) 0.145 1.460 (1.031–2.067) 0.033
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

rs1049216
Additive AG/AA 1.181 (0.459–3.043) 0.730 1.262 (0.485–3.285) 0.634
GG/AA 0.793 (0.316–1.991) 0.621 0.814 (0.321–2.064) 0.664
Dominant GG+AG/AA 0.897 (0.359–2.239) 0.816 0.931 (0.370–2.343) 0.879
Recessive GG/AA+AG 0.682 (0.486–0.956) 0.026 0.659 (0.468–0.927) 0.017
Allele G/A 0.743 (0.555–0.995) 0.046 0.728 (0.543–0.977) 0.034
rs6948
Additive GT/GG 1.022 (0.384–2.722) 0.965 1.050 (0.391–2.821) 0.923
TT/GG 0.722 (0.280–1.866) 0.502 0.725 (0.279–1.888) 0.511
Dominant TT+GT/GG 0.795 (0.309–2.041) 0.633 0.802 (0.310–2.076) 0.649
Recessive TT/GG+GT 0.708 (0.500–1.003) 0.052 0.694 (0.489–0.986) 0.042
Allele T/G 0.778 (0.574–1.055) 0.106 0.764 (0.563–1.038) 0.085
rs12415607
Additive CA/CC 1.230 (0.870–1.739) 0.242 1.273 (0.897–1.806) 0.176
AA/CC 1.746 (1.054–2.892) 0.031 1.804 (1.080–3.014) 0.024
Dominant AA+CA/CC 1.327 (0.954–1.846) 0.093 1.371 (0.982–1.914) 0.064
Recessive AA/CC+CA 1.548 (0.975–2.459) 0.064 1.567 (0.979–2.506) 0.061
Allele A/C 0.973 (0.773–1.224) 0.815 0.986 (0.782–1.243) 0.906
Adjusted for gender, age, education, and working years. *: Adjusted for gender, age and education. P-value < 0.05 was considered statistically significant and
maintains significance using the Benjamini–Hochberg procedure with the false discovery rate at 0.14.

The effects of the interaction for NIHL tendency between
CASP3 rs1049216 recessive model and lifestyle choice are
shown in Table S4. Compared with individuals carrying the
GG genotype who have not tobacco using or earphone use,
those carrying the AA+AG genotype who had smoking or
regular earphone use had a greater NIHL risk. Within the
strata of AA+AG, people who performed regular earphone
use had a higher NIHL tendency than those never using
earphone. Within the strata of regular earphone use, people
carrying the AA+AG genotype were more likely to be NIHL
than those GG genotype. We did not find the interaction
between rs1049216 and lifestyles in the additive models.
Table 6 shows the effects of the interaction between CASP7
rs12415607 additive model and lifestyles for the risk of NIHL
in the 2×3 level analysis. When we adjusted for sex, age,
education background, and duration years (working years)
compared with the CC genotype workers who had no tobacco
using or earphone use with those carrying the CA genotype
who had smoking or regular earphone use had a higher NIHL
tendency, and those having the AA genotype who used
earphone regularly also had a higher NIHL risk. Within
the strata of risk lifestyles (smoking or regular earphone
use), the AA genotype workers were easier to cause NIHL
than those workers with the CC genotype. The interaction was
not found between rs12415607 and lifestyle choice in the
addictive models.
Association between noise-kurtosis and lifestyle
choice interaction for the NIHL tendency
The effects which interacted by noise kurtosis and lifestyle
choice for the NIHL tendency are shown in Table 7.
Compared with individuals who worked in steady noise
environment and also had no smoking or earphone use
with those people who worked in a complex noise factory
and had smoking or regular earphone use had a greater NIHL
risk. In the complex noise group, the smoking people had a
greater NIHL risk compared with the no smoking people.
Within the strata of risk lifestyles (smoking or regular
earphone use), people exposed to complex noise were
more likely to cause NIHL compared with steady noise
group. We did not find the interaction between lifestyles
and noise kurtosis in the addictive models.
DISCUSSION
NIHL is a complex disease caused by genetic and
environmental factors. However, NIHL is mainly
determined by the level of biological damage, which is
caused by noise. We investigated the relation between

148 Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table 4: Interaction between noise kurtosis and CASP3 polymorphisms for the risk of NIHL
Steady noise (b < 10) Complex noise (b ≥ 10) OR (95% CI) for RERI (95% CI) P-value
Genotypes NIHL/ OR (95% CI) NIHL/Control OR (95% CI) complex noise within
Control (n) (n) strata of genotypes

rs1049216 1.294 0.013

Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

(0.269–2.319)
Non-genotype (GG) 44/63 148/155
1 1.402 1.402 (0.887–2.215)
(0.887–2.215)
P = 0.148 P = 0.148
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Risk genotype (AA+AG) 17/30 98/59

0.836 2.532 2.826
(0.409–1.709) (1.515–4.231) (1.427–5.597)
P = 0.623 P < 0.001 P = 0.003
OR (95% CI) for risk genotype within 0.836 1.820
strata of kurtosis (0.409–1.709) (1.221–2.713)
P = 0.623 P = 0.003
rs6948 1.198 0.031
(0.109–2.288)
Non-genotype (TT) 44/64 161/163
1 1.477 1.477 (0.939–2.323)
(0.939–2.323)
P = 0.092 P = 0.092
Risk genotype (GG+GT) 17/29 85/51
0.872 2.546 2.773
(0.425–1.786) (1.503–4.313) (1.370–5.613)
P = 0.707 P =0.001 P = 0.005
OR (95% CI) for risk genotype within 0.872 1.741
strata of kurtosis (0.425–1.786) (1.150–2.636)
P = 0.707 P = 0.009

Adjusted for gender, age, education, and working years. P-value < 0.05 was considered statistically significant and maintains significance using the
Benjamini–Hochberg procedure with the false discovery rate at 0.14.

noise characteristics and hearing loss (HL). Steady and
complex noise can be distinguished by kurtosis simply and
effectively. We used kurtosis which can transform noise pulse
peak, duration, and pulse interval distribution into simple
variables. Kurtosis make noise classification greatly simple.
We showed that the NIHL group‘s median noise kurtosis was
higher than the control group‘s, and corresponded to the
proportion of complex noise group. Univariate logistic
regression analysis showed that workers exposed to
complex noise have a 1.753 times higher risk of
developing NIHL compared to workers exposed to steady
noise. After adjusted to age, sex, education, and duration
years (working years), additional multivariate analysis
indicated the NIHL risk in the complex noise group have a
1.806 times higher compared to individuals in the steady
noise group. These results are consistent with studies by
Theiry et al. and Xie et al.[8,24] Noise with a high kurtosis
value damages the auditory system by direct mechanical force
and disruption of metabolism.[25] However, we did not
observe an association between CNE and NIHL.
Cochlear hair cell damage and death caused NIHL. Apoptosis
is one mechanism underlying noise-induced hair cells
death.[12] Caspase activation is a critical step leading to
apoptosis. Proteins in the caspase family are cysteine
proteases that target specific aspartic acid residues. After
activation, caspase cleaves specific substrates, leading to
apoptosis. The process of apoptosis is actually a cascade
amplification of the caspase hydrolysis substrate. Here, we
selected SNPs of the apoptotic effector genes CASP3 and
CASP7 for population epidemiological studies. Our analysis
demonstrates that the three SNPs rs1049216 (CASP3), rs6948
(CASP3), and rs12415607 (CASP7) are associated with noise,
and are related to hearing loss.
The rs1049216 SNP is an A→G mutation located in the
CASP3 3’ untranslated region (UTR). At present, there are
few studies on the correlation between rs1049216 and NIHL,
in Chinese populations. Most studies regarding this locus
focus on cervical and prostate cancer. The A and G alleles in
this study individuals were 18.2% and 81.8%, which were
basically consistent with Chinese population A (19.4%) and T
(80.6%) alleles. But they were not consistent with European
individuals A (73.4%) and T (26.6%) alleles. The results
indicated that there may be racial differences in the locus
allele frequency of rs1049216. Further, our study indicates a
polymorphism in the rs1049216 locus in Chinese individuals.
The case group and the control group showed three genotypes

Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023 149

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table 5: Interaction between rs6948 polymorphism and lifestyles for the risk of NIHL
Non-risk genotype (TT) Risk genotype (GG+GT) OR (95% CI) for risk RERI (95% CI) P­value
NIHL/ OR (95% CI) NIHL/Control OR (95% CI) genotype within strata
Control (n) (n) of lifestyles

Smoking −0.0433 0.945

Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

(−1.2709–1.143)
No 97/129 53/46
1 1.556 1.556 (0.964–2.514)
(0.964–2.514)
P = 0.071 P = 0.071
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Yes 108/98 49/34

1.561 2.073 1.295
(1.019–2.392) (1.196–3.595) (0.769–2.182)
P = 0.041 P = 0.009 P = 0.331
OR (95% CI) for smoking within strata of 1.561 1.812
genotype (1.019–2.392) (0.879–3.736)
P = 0.041 P = 0.331
Earphone 0.7089 0.241
(−0.4767–1.8944)
Never 87/105 45/45
1 1.264 1.264 (0.760–2.103)
(0.760–2.103)
P = 0.367 P = 0.367
Regular 118/122 57/35
1.364 2.338 1.687
(0.904–2.058) (1.372–3.986) (1.029–2.764)
P = 0.139 P = 0.002 P = 0.038
OR (95% CI) for regular earphone use within 1.364 2.396
strata of genotype (0.904–2.058) (1.238–4.638)
P = 0.139 P = 0.009

Adjusted for gender, age, education, and working years. P-value < 0.05 was considered statistically significant and maintains significance using the
Benjamini–Hochberg procedure with the false discovery rate at 0.14.

(AA, AG, and GG). After adjusted to age, sex, education, and
duration years (working years), multivariate analysis
indicated individuals carrying the GG genotype have a
0.682 times lower risk of developing NIHL compared to
individuals with the AA+AG genotypes. Similarly, the risk of
developing NIHL in individuals carrying the G allele is 0.743
times lower than individuals carrying the A allele. Our data
showed the GG genotype of the recessive model and the G
genotype of the allele model have protective effect against
NIHL. However, it is inconsistent with the findings of Wu
et al.[26] The rs6948 SNP is a G→T mutation located in the
CASP3 3’ UTR. At present, there are few studies which
research East Asian or European people on the correlation
between rs6948 and NIHL. In this study people, the G and T
alleles were 16.4% and 83.6%, which were difference from
European population which is G (54.4%) and T (45.6%), but
were almost same with East Asian population G (18.8%) and
T (81.2%) alleles. These data indicated that there might be
ethnic differences in the locus allele frequency of rs6948.
Further, our studies indicate a polymorphism in the rs6948
locus in Chinese individuals. The case group and the control
group showed three genotypes (GG, GT, and TT). After
adjusting to age, sex, education, and duration years
(working years), multivariate analysis indicated individuals
carrying the TT genotype have a 0.694 times lower risk of
developing NIHL compared to individuals with the GG+GT
genotypes. Our data illustrated that the TT genotype of the
recessive model is protective against NIHL. Caspase-3 is
encoded by CASP3, and plays a central role in apoptosis
initiation. The rs1049216 locus is located in the CASP3 3’
UTR. Recent studies have found that the 3’ UTR regulates
mRNA stability,[27-29] translation efficiency, and protein
localization independent of RNA localization.[30] Thus, the
3’ UTR mutation caused by rs1049216 does not affect the
encoded amino acid. However, the mutation regulates
caspase number and location in cells of the inner ear,
thereby playing a role in hearing loss.
The rs12415607 SNP is a C→A mutation located in the
CASP7 2kb upstream region. At present, there are few
studies on the correlation between rs12415607 and NIHL,
in East Asian or European people. The main researches
regarding this locus focus on lung cancer and cervical
cancer.[30,31] The C and A alleles in this study people were
61.1% and 38.9%. These were not similar with European
population C (75.8%) and A (24.2%) alleles. These data were
basically consistent with East Asian population C (59.1%)
and A (40.9%) alleles. This showed that there maybe ethnic

150 Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

 nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Table 6: Interaction between rs12415607 polymorphism and lifestyles for the risk of NIHL
Behaviors Genotype ORs (95% CI) for CA ORs (95% CI) for AA
within strata of within strata of
lifestyles lifestyles
CC CA AA
NIHL/control OR (95% CI) NIHL/control OR (95% CI) NIHL/control (n) OR (95% CI)
(n) (n)
Smoking No 52/64 71/84 27/27
1 1.084 1.272 1.084 (0.664–1.768); 1.272 (0.660–2.454);
(0.664–1.768); (0.660–2.454); P = 0.748 P = 0.472
P = 0.748 P = 0.472
Yes 49/57 84/67 24/8
1.154 1.688 3.828 1.484 (0.897-2.456); 3.471 (1.403–8.589);
(0.659–2.022); (1.005–2.837); (1.552–9.444); P =0.125 P = 0.007
P = 0.617 P = 0.048 P = 0.004
ORs (95% CI) for smoking 1.154 1.608 1.622
within strata of genotype (0.659–2.022); (0.940–2.754); (0.495–5.317);
P = 0.617 P = 0.083 P = 0.424
RERI (95% CI) 0.452 2.400

Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

(−0.367–1.270); (−0.883–5.684);
P = 0.279 P = 0.152
Earphone Never 43/58 70/73 19/19
1 1.350 1.523 1.350 (0.804–2.269); 1.523 (0.710–3.266);
(0.804–2.269); (0.710–3.266); P = 0.257 P = 0.280
P = 0.257 P = 0.280
Regular 58/63 85/78 32/16
1.466 1.799 3.060 1.179 (0.733–1.897); 2.134 (1.047–4.346);
(0.843–2.548); (1.061–3.050); (1.464–6.397); P = 0.497 P = 0.037
P = 0.175 P = 0.029 P = 0.003
Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

ORs (95% CI) for earphone 1.466 1.482 1.719

use within strata of (0.843–2.548); (0.893–2.461); (0.656–4.503);
genotype P = 0.175 P = 0.128 P = 0.270
RERI (95% CI) −0.018 1.069
(−0.997–0.961); (−1.099–3.2363);
P = 0.971 P = 0.334
Adjusted for gender, age, education, and working years. P-value < 0.05 was considered statistically significant and maintains significance using the Benjamini–Hochberg procedure with the false discovery rate at
0.14.

151
 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table 7: Interaction between noise kurtosis and lifestyles for the risk of NIHL
Steady noise (b < 10) Complex noise (b ≥ 10) OR (95% CI) for RERI (95% CI) P-value
NIHL/ OR (95% CI) NIHL/Control (n) OR (95% CI) complex noise within
Control (n) strata of lifestyles

Smoking 0.891 0.074

Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

(−0.086–1.868)
No 31/49 119/126
1 1.458 1.458 (0.863–2.464)
(0.863–2.464)
P = 0.159 P = 0.159
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Yes 30/44 127/88

1.077 (0.554–2.095) 2.425 (1.393–4.221) 2.175
(1.244–3.805)
P = 0.827 P = 0.002 P = 0.006
ORs (95% CI) for smoking 1.077 (0.554–2.095) 1.585 (1.012–2.484)
within strata of kurtosis
P = 0.827 P = 0.044
Earphone 0.478 0.335
(−0.496–1.455)
Never 29/47 103/103
1 1.627 1.627 (0.942–2.811)
(0.942–2.811)
P = 0.081 P = 0.0.81
Regular 32/46 143/111
1.257 (0.646–2.446) 1.810 2.362 (1.376–4.056)
(1.069–3.065)
P = 0.502 P = 0.002 P = 0.027
ORs (95% CI) for earphone 1.257 (0.646–2.446)< 1.440 (0.962–2.156)<
use within strata of kurtosis break/>P = 0.502 break/>P = 0.076

Adjusted for gender, age, education, and working years. P-value < 0.05 was considered statistically significant and maintains significance using the
Benjamini–Hochberg procedure with the false discovery rate at 0.14.

differences in the rs12415607 locus allele frequency. Further,
our results indicate a polymorphism in the rs12415607 locus
in Chinese individuals. The case group and the control group
showed three genotypes (CC, CA, and AA). After adjusting to
age, sex, education, and working years, multivariate analysis
pointed out the NIHL risk in people carrying AA genotype
was 1.804 times higher than those people carrying CC
genotype. Our data illustrated that the AA genotype of the
addictive model is risk against NIHL. CASP7 encodes
Caspase-7, which plays a central role in the initiation of
apoptosis. The rs12415607 locus is located in the 2 kb
upstream region of CASP7. Although this locus does not
encode amino acids, it may affect promoter function, thus
affecting the CASP7 expression.
This study analyzed the associations between lifestyle factors,
including smoking, drinking, and earphone use, and the
incidence of NIHL. After adjusting by sex, age, education,
and working years, NIHL was significantly associated with
smoking and earphone use, which increases the NIHL risk,
consistent with previous studies.[32,33]. Smoking-induced HL
is likely due to vascular changes, including capillary
contraction, increased blood viscosity, and cochlear
anoxia.[34] Previous studies have also shown that long-term
earphone use may impair hearing function, and the prevalence
of hearing loss may increase significantly over time.[35,36]
In this study, the relative excess risk of interaction (RERI) is
used. We reported the RERI value, 95% CI, and P-value. We
selected positive multivariate analysis results, including
interactions between noise kurtosis, earphone use, and the
three SNPs (rs1049216 [recessive model], rs6948 [recessive
model], and rs12415607 [additive model]) to analyze
environmental and genetic interactions. We selected
positive multivariate analysis results for interactions
between each of the following factors: noise kurtosis,
earphone use, and the three SNPs (rs1049216 [recessive
model], rs6948 [recessive model], and rs12415607
[additive model]) to evaluate the combined effect of
environmental and genetic factors.
We determined for the first time that there is interaction to
affect NIHL between noise kurtosis, genetics, and lifestyle.
We found a positive interaction between noise kurtosis and
rs1049216 and rs6948 (CASP3). These results showed that
the NIHL tendency in people worked in complex noise
environment (b ≥ 10) carrying the rs1049216 AA+AG or
rs6948 GG+GT genotype is higher than the combined risk in
individuals with the rs1049216 AA+AG or rs6948 GG +GT
genotype alone and complex noise alone group. Used the
interaction measurement recommended by Knol, it showed
some stratified analysis results. Among the complex noise
group, those carrying the rs1049216 AA+AG genotype or the

152 Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

rs6948 GG+GT genotype had the higher risk of NIHL. No.2015C03039), Hangzhou Major Science and
Similarly, among people carrying the rs1049216 AA+AG Technology Innovation Project (No. 20132015A01),
genotype or rs6948 GG+GT genotype, those exposed to General Research Project of Education Department of
complex noise environment (b ≥ 10) were at greater risk Zhejiang(Y201943082).
of NIHL than exposed to steady noise (b < 10).
NIHL is a multifactorial disease influenced by the interaction Financial support and sponsorship
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

of genetic and environmental factors. In our research, it Nil.

showed that CASP3 SNPs, lifestyle choice and working
noise environment are each correlated with NIHL. In Conflicts of interest
addition, our results proved there are interactions in NIHL There are no conflicts of interest.
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

between genes, environment, and lifestyle. Unfavorable

working factory and genetic susceptibility will likely step
up the risk of NIHL. With larger sample sizes combined with
laboratory experiments will clarify the interaction
mechanisms between mutations and environmental factors
for NIHL in the next studies.
There were some advantages in our study. We used kurtosis to
describe the noise pulse pattern and distinguish noise model
that is steady or complex. Using this indicator, we studied the
interactions between noise pulse pattern, genetics, and
lifestyle. Importantly, this is the first study to associate
kurtosis with these interactions. Previous studies focused
on CNE instead of kurtosis. We used the interaction
method to report the interaction index RERI, OR, and 95%
CI. Meanwhile, these tables also showed the number of
people in NIHL group and control group together with the
results of the stratified analysis. Thus, we can find a more
complete information of the raw data characteristics by the
table-form analysis. This study also had some limitations.
First, we analyze the interaction between single genetic
factors and working environmental factors by using
crossover analysis which is helpful. However, this analysis
requires both factors as two-category variables. Second, self-
reported data may caused data deviation which may affect
study effectiveness. At last, the sample size maybe not large
enough. In the future we validate our results with large
samples, also we will explore the molecular mechanisms
of interactions using functional assays.
CONCLUSION
Noise kurtosis, CASP SNPs (rs1049216, rs6948, and
rs12415607), smoking, and earphone use were related to
NIHL. We also indicated the interactions between noise
kurtosis and CASP3 polymorphisms. These results show a
theoretical basis which is useful on the prevention and genetic
testing of NIHL.
Acknowledgments
The authors thank all noise-exposed workers for participating
in the study.
Funding
This study was funded by Zhejiang Key Research and
Development Program of China (No. 2015C03050;
Tables S1–S4
REFERENCES
1. Olusanya BO. Addressing the global neglect of childhood hearing
impairment in developing countries. Plos Med 2007;4:626-30.
2. Stevens G, et al. Global and regional hearing impairment prevalence:
an analysis of 42 studies in 29 countries. Eur J Public Health
2013;23:146-52.
3. Jeffree MS, Ismail N, Lukman KA. Hearing impairment and
contributing factors among fertilizer factory workers. J Occup
Health 2016;58:434-43.
4. Yang Q, et al. Genetic variation in EYA4 on the risk of noise-induced
hearing loss in Chinese steelworks firm sample. Occup Environ Med
2016; 73:823-8.
5. Anton SD, et al. Successful aging: advancing the science of physical
independence in older adults. Ageing Res Rev 2015;24:304-27.
6. Shargorodsky J, et al. Change in prevalence of hearing loss in US
adolescents. JAMA J Am Med Assoc 2010;304(7):772-8.
7. Stanbury M, Rafferty AP, Rosenman K. Prevalence of hearing loss and
work-related noise-induced hearing loss in Michigan. J Occup Environ
Med 2008;50:72-9.
8. Xie H-W., et al. The use of the kurtosis-adjusted cumulative noise
exposure metric in evaluating the hearing loss risk for complex noise.
Ear Hear 2016;37:312-23.
9. Erdreich J. A distribution based definition of impulse noise. J Acoust
Soc Am 1986;79:990-8.
10. Qiu Wei MZ, Weichao X. The application of the kurtosis metric in
evaluating hearing trauma from complex noise exposures. J Otol.
2016;14:701-7.
11. Xie HW, et al. Dose-response relationship between noise kurtosis and
noise-induced hearing loss. Zhonghua lao dong wei sheng zhi ye bing
za zhi (Chin J Ind Hyg Occup Dis) 2021;39(7):493-7.
12. Op de Beeck K, Schacht J, Van Camp G. Apoptosis in acquired and
genetic hearing impairment: the programmed death of the hair cell.
Hear Res, 2011;281:18-27.
13. Fetoni AR, et al. Noise-induced hearing loss (NIHL) as a target of
oxidative stress-mediated damage: cochlear and cortical responses
after an increase in antioxidant defense. J Neurosci. 2013;33:4011-23.
14. Lee WK, et al. Polymorphisms in the Caspase7 gene and the risk of
lung cancer. Lung Cancer 2009;65:19-24.
15. Konings A, et al. Variations in HSP70 genes associated with noise-
induced hearing loss in two independent populations. Eur J Hum Genet
2009;17:329-35.
16. Lei S, et al. Association between polymorphisms of heat shock protein
70 genes and noise-induced hearing loss: a meta-analysis. Plos One
2017;12.
17. Yan S, et al. HuGE systematic review and meta-analysis demonstrate
association of CASP-3 and CASP-7 genetic polymorphisms with
cancer risk. Genet Mol Res 2013;12:1561-73.
18. Hussain T, et al., Early indication of noise-induced hearing loss in
young adult users of personal listening devices. Ann Otol Rhinol
Laryngol 2018;127:703-9.

Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023 153

 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

19. Wang X, et al. Alterations in gray matter volume due to unilateral
hearing loss. Sci Rep 2016;6:25811.
20. Joo Y-H., Han K-d, Park KH. Association of hearing loss
and tinnitus with health-related quality of life: the Korea National
Health and Nutrition Examination Survey. Plos One 2015;10:
e0131247.
21. Han C, et al. Effects of long-term exercise on age-related hearing loss
in mice. J Neurosci 2016;36:11308-19.
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
27. An JJ, et al. Distinct role of long 3 ’ UTR BDNF mRNA in spine
morphology and synaptic plasticity in hippocampal neurons. Cell
2008;134:175-87.
28. Jambhekar A, Derisi JL. Cis-acting determinants of asymmetric,
cytoplasmic RNA transport. RNA 2007;13:625-42.
29. Lau AG, et al. Distinct 3 ’ UTRs differentially regulate activity-
dependent translation of brain-derived neurotrophic factor (BDNF).
Proc Natl Acad Sci U S A 2010;107:15945-50.

22. Hamernik RP, Ahroon WA. Sound-induced priming of the chinchilla
auditory system. Hear Res 1999;137:127-36.
23. Knol MJ, VanderWeele TJ. Recommendations for presenting analyses
of effect modification and interaction. Int J Epidemiol. 2012;41:514-
20.
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024
30. Berkovits BD, Mayr C. Alternative 3 ’ UTRs act as scaffolds to regulate
membrane protein localization. Nature 2015;522:363.
31. Cao S., et al. Prognostic assessment of apoptotic gene polymorphisms
in non-small cell lung cancer in Chinese. J Biomed Res 2013;27:231-8.
32. Mofateh M, et al. Effect of smoking on hearing loss in refractory’s

24. Thiery L, Meyer-Bisch C. Hearing loss due to partly impulsive
industrial noise exposure at levels between 87 and 90dB (A). J
Acous Soc Am 1988;84:651-9.
25. Zhao YM, et al. Application of the kurtosis statistic to the evaluation of
the risk of hearing loss in workers exposed to high-level complex noise.
Ear Hear 2010;31:527-32.
26. Wu Y, et al. Associations of genetic variation in CASP3 gene with
noise-induced hearing loss in a Chinese population: a case-control
study. Environ Health, 2017;16:78.
factory male worker with occupational noise exposure in Iran. J Pak
Med Associat 2017;67:605-8.
33. Zhao F, et al. Music exposure and hearing disorders: an overview. Int J
Audiol 2010;49:54-64.
34. Lowe GD, et al. The effects of age and cigarette-smoking on blood and
plasma viscosity in men. Scottish Med J 1980;25:13-7.
35. Kim MG, et al. Hearing threshold of korean adolescents associated
with the use of personal music players. Yonsei Med J 2009;50:771-6.
36. Vogel I, et al. Young people’s exposure to loud music − a summary of
the literature. Am J Prev Med 2007;33:124-33.

Table S1: Gene information

SNP Gene Chromosome Position Functional consequence Allele MAFa MAFb HWE p
rs1049216 CASP3 4 184628935 3 Prime UTR Variant A>G G=0.403 0.159609 0.615864
rs6948 CASP3 4 184627976 3 Prime UTR Variant G>T G=0.426 0.143322 0.431081
rs12415607 CASP7 10 113678445 2KB Upstream Variant C>A A=0.268 0.359935 0.237056
rs2227310 CASP7 10 113729393 Missense Variant C>G G=0.250 0.138436 2.29E-63
rs1127687 CASP7 10 113730350 3 Prime UTR Variant G>A A=0.230 0.247557 0.954635
HWE indicates Hardy–Weinberg equilibrium; MAF, minor allele frequency. a: 1000genomes; b: Data form this study.

154 Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

 nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Table S2: Primer information A

ID PrimeAllele FAM Primer Allele HEX Primer Common
rs1049216 AGTAATTGTGAAAAAGTTAAACATTGAAGTAAT AGTAATTGTGAAAAAGTTAAACATTGAAGTAAC CAGTCTTAAGTGGGGGGAAT<break/>TCATAAAA
rs6948 GGAGGCCAGAGCTGAGCC CGGAGGCCAGAGCTGAGCA AGCCTGCCTCCCGGGCTGA
rs2227310 GAGGATCTGCATGATTTCCAGG GAGGATCTGCATGATTTCCAGC CCATCCTGGAGGAGCACGGAAA
rs12415607 AATGGAGTACATGCTTAGTGGTCG GAATGGAGTACATGCTTAGTGGTCT AGAAGATGGCGTTCTTGCCTGGTAT
rs1127687 CACTCCATCTCAGTCAGTGGC CTCACTCCATCTCAGTCAGTGGT TGGAAAATGGAGCCATGACAAGAACAAA

Table S2: Primer information B

ID Allele FAM Allele HEX Sequence CG%_FAM CG%_HEX CG% Common
rs1049216 A G GGGGAATATCATAAAAATTC[A/G]TTACTTCAATGTTTAACTTT 21.2 24.2 37.9
rs6948 G T AGCCTGCCTCCCGGGCTGAG[G/T]GCTCAGCTCTGGCCTCCGGC 72.2 68.4 73.7
rs2227310 C G CTGGAGGAGCACGGAAAAGA[C/G]CTGGAAATCATGCAGATCCT 47.8 47.8 59.1
rs12415607 C A TGGCGTTCTTGCCTGGTATC[C/A]GACCACTAAGCATGTACTCC 45.8 42.3 48
rs1127687 G A GGAGCCATGACAAGAACAAA[G/A]CCACTGACTGAGATGGAGTG 58.3 52.2 39.3

Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

155
 Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

Table S3: Interaction between rs12415607 polymorphism and noise kurtosis for the risk of NIHL
Genotype ORs (95% CI) ORs (95% CI)
CC CA AA for CA within for AA within
NIHL/ OR NIHL/control OR (95% CI) NIHL/control OR (95% CI) strata of strata of
control (n) (95% CI) (n) (n) kurtosis kurtosis
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Kurtosis Steady 20/35 30/50 11/8

noise
1 1.091 2.547 1.091 2.547
(0.532–2.236); (0.863–7.524); (0.532–2.236); (0.863–7.524);
P = 0.812 P = 0.091 P = 0.812 P = 0.091
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024

Complex 81/86 125/101 40/27

noise
1.708 2.332 (1.254- 2.769 (1.310- 1.342 (0.896- 1.630 (0.905-
(0.903- 4.337); 5.856); 2.010); 2.937);
3.229); P = 0.007 P = 0.008 P = 0.154 P = 0.104
P = 0.100
ORs (95% CI) for 1.708 2.028 (1.185- 0.986 (0.310-
kurtosis within (0.903- 3.472); 3.137);
strata of genotype 3.229); P = 0.010 P = 0.980
P = 0.100
RERI (95% CI) 0.534 −0.484
(−0.451–1.520); (−3.375–2.4.7);
P = 0.288 P = 0.743

Adjusted for gender, age, education and working years. P-value < 0.05 was considered statistically significant and maintains significance using the
Benjamini–Hochberg procedure with the false discovery rate at 0.14.

156 Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

 nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 02/29/2024
Downloaded from http://journals.lww.com/nohe by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW

Table S4: Interaction between rs1049216 polymorphism and lifestyles for the risk of NIHL
Non-risk genotype (GG) Risk genotype (AA+AG) OR (95% CI) for risk genotype RERI (95% CI) P-value
within strata of lifestyles
NIHL/control (n) OR (95% CI) NIHL/control (n) OR (95% CI)
Smoking 0.068 (−1.123–1.259) 0.911
No 94/126 56/49
1 1.584 (0.988–2.539) 1.584 (0.988–2.539)
P = 0.056 P = 0.056
Yes 98/92 59/40
1.525 (0.983–2.366) 2.177 (1.291–3.674) 1.433 (0.870–2.360)
P = 0.060 P = 0.004 P = 0.158
OR (95% CI) for smoking within 1.525 (0.983–2.366) 1.610 (0.836–3.103)
strata of genotype
P = 0.060 P = 0.154
Earphone 0.994 (−0.220–2.208) 0.109
Never 81/98 51/52
1 1.248 (0.763–2.040) 1.248 (0.763–2.040)
P = 0.378 P = 0.378

Noise & Health ¦ Volume 25 ¦ Issue 118 ¦ July-September 2023

Regular 111/120 64/37
1.306 (0.860–1.983) 2.548 (1.502-4.321) 1.912 (1.178-3.103)
P = 0.211 P = 0.001 P = 0.009
OR (95% CI) for regular earphone 1.306 (0.860–1.983) 2.443 (1.300–4.591)
use within strata of genotype
P = 0.211 P = 0.006
Adjusted for gender, age, education and working years. P-value < 0.05 was considered statistically significant and maintains significance using the Benjamini–Hochberg procedure with the false discovery rate at 0.14.
Yin, et al.: Genes, llyfestyles, noise kurtosis and NIHL

157