Conservation Genet Resour
DOI 10.1007/s12686-013-0119-y
MICROSATELLITE LETTERS
Isolation and characterization of 8 polymorphic microsatellite
markers from the Greater Short-horned Lizard
(Phrynosoma hernandesi)
Zijian Sim • Brandon K. Booker • Michelle Viengkone
Corey S. Davis • Magdalene N.-Y. Leung •
Anthony P. Russell • Cynthia A. Paszkowski
Received: 16 December 2013 / Accepted: 25 December 2013
Ó Springer Science+Business Media Dordrecht 2013
Abstract The Greater Short-horned Lizard (Phrynosoma
hernandesi) is a small reptile endemic to western North
America that is classified as endangered in Canada. Here, we
describe the development of 8 microsatellite markers for P.
hernandesi. Observed allelic diversity varied from 2 to 11
while observed heterozygosity and expected heterozygosity
ranged from 0.370–0.852 to 0.486–0.856, respectively.
These markers will facilitate studies that address conserva-
tion of the species, such as levels of genetic diversity and
population structure.
Keywords Greater Short-horned Lizard  Phrynosoma
hernandesi  Microsatellite
The Greater Short-horned Lizard (Phrynosoma hernandesi) is
small reptile endemic to western North America. The species
has a wide distribution, extending from Canada to Mexico,
and from Nebraska and South Dakota in the east to Nevada in
the west. While not considered vulnerable to extirpation over
much its global range, in Canada, where P. hernandesi reaches
its northern range limits in southern Alberta and Saskatche-
wan, the species is designated as ‘‘endangered’’ due to low
numbers, and high levels of habitat fragmentation and dis-
turbance (COSEWIC 2007). The development of microsat-
ellite markers will contribute to the conservation of P.
Z. Sim (&)  B. K. Booker  M. Viengkone 
C. S. Davis  C. A. Paszkowski
Department of Biological Sciences, University of Alberta,
116 St and 85 Ave, Edmonton, AB T6G 2R3, Canada
e-mail: zsim@ualberta.ca
M. N.-Y. Leung  A. P. Russell
Department of Biological Sciences, University of Calgary,
2500 University Drive NW, Calgary, AB T2N 1N4, Canada
•
hernandesi in Canada by elucidating how human activities on
the prairie landscape have influenced gene flow and levels of
population isolation and substructuring. Here, we describe the
isolation and characterization of 8 microsatellite loci from the
Greater Short-horned Lizard.
Two GT and CT enriched microsatellite libraries were
constructed from a single individual from Weld County,
Colorado following the protocol of Hamilton et al. (1999)
and 96 clones were sequenced on an ABI 3730 DNA ana-
lyzer (Applied Biosystems) using T7 and T3 primers and the
BigDye Terminator kit v3.1 (Life Technologies). Sequences
were assembled using SeqMan (Lasergene) and consensus
sequences were examined for the presence of tandem
repeats. Primers were designed for 45 clones found to con-
tain dinucleotide repeats [10 units using the software Pri-
mer3 (Rozen and Skaletsky 2000) with forward primers
tailed with M13 sequences (Schuelke 2000). Total genomic
DNA was isolated from 30 individuals from Manyberries,
Alberta using the Qiagen DNeasy Blood and Tissue Kit
(Qiagen). Polymerase chain reactions were performed using
an Eppendorf EP thermocyler (Eppendorf) in 15 ll volumes
consisting of: 1X PCR buffer (10 mM Tris pH 8.8, 0.1 %
Triton X-100, 50 mM KCl, 0.16 mg/ml BSA), 1 U of Taq
polymerase, 2.4 mM MgCl2, 0.08 lM forward primer,
0.32 lM reserve and M13 primer, 0.2 lM of each dNTP, and
about 10 ng DNA. Cycling conditions were as follows:
94 °C for 5 min, followed by 30 cycles of 30 s at 94 °C, and
45 s at 72 °C, and 8 cycles of 30 s at 94 °C, 45 s at 1 °C
below TA, 45 s at 72 °C, and finally 10 min at 72 °C.
PCR products were coloaded and fragment analysis per-
formed on an ABI 3730 DNA analyzer with GeneScan 500
LIZ size standard (Applied Biosystems). Genotypes were
called using GeneMapper v4.0 (Applied Biosystems).
Descriptive statistics, tests for Hardy–Weinberg equilibrium
(HWE) and linkage disequilibrium (LD) were performed on
123
 Conservation Genet Resour

Table 1 Description of 8 polymorphic microsatellites in the Greater Short-horned Lizard (Phrynosoma hernandesi)
Locus/GenBank accession number Primer sequence (50 –30 ) Repeat motif Size rangea TA (°C) NA HO

Phh_Contig6 F: AGCAATTGTTCACATCCTCAGA (AC)19 186–206 54 5 0.552

KF963530 R: GACTTTAGTACAACCCTCCATGT
Phh_C12 F: GAAGGGAAAAGAGGGAAGTGT (CA)15CT(CA)12 184–214 54 10 0.821
KF963531 R: CCAACTGTCACTGTCACCAA
Phh_E01 F: AAGAGATGAGGCTTCCAGTT (GT)12(GA)22 209–237 50 8 0.852
KF963532 R: TGTTCCTCAGCATCATTGTGA
Phh_H02 F: TCCTCTTCAACTCCCTGTCA (AG)13 293–295 54 2 0.379
KF963533 R: TGTTACCCCTCACGTTGGAA
Phh_D04 F: TAGCCAAGCCCCATAAACCA (GT)12 299–321 54 2 0.370
KF963534 R: CCTCCCCTAACCCACATGTT
Phh02 F: GTAATGAGTACTGTTCACTGGT (CT)14 342–376 55 10 0.786
KF963535 R: AATCTAAGCAGCCAGGTCAC
Phh_G08 F: CTGTATGGCGCAGTATAGTGT (AC)15AG(AC)4 193–229 54 11 0.759
KF963536 R: CCCTGTCAGAACTAGGCAGA
Phh_G05 F: AAAGCATTGCAAGCCTTCCT (GT)6GC(GT)13 174–186 55 4 0.464
KF963537 R: ATTCGTTCAGCAATTTGGGC
a
Including M13 (TGTAAAACGACGGCCAGT) attached to 50 end of forward primer

GenePop v4.2 (Rousset 2008). Significant deviations from References

HWE and LD were determined after Bonferroni correction
for multiple comparisons.
Of the 45 loci tested, 8 successfully amplified and yielded
consistent allele calls. The 8 polymorphic loci had an aver-
age of 6.5 alleles, and mean observed and expected hetero-
zygosities of 0.623 and 0.659, respectively (Table 1). After
correcting for multiple comparisons, all loci were found to be
in HWE and no locus pairs were in significant LD.
Acknowledgments This study was conducted as part of BIOL 592
at the University of Alberta. We thank all participants in this course
and the Department of Biological Sciences Molecular Biology
Facility. Special thanks to members of the field team that collected
samples used in this study. Specimens were collected under the
authority of Alberta Fish and Wildlife collection permit #39496, and
Alberta Fish and Wildlife research permit #39552. Sampling of tail
tips for the retrieval of microsatellite markers was conducted under
the auspices of University of Calgary Animal Care permit BI
2009-33.
COSEWIC (2007) COSEWIC assessment and update status report on
the Greater Short-horned Lizard Phrynosoma hernandesi in
Canada. Committee on the Status of Endangered Wildlife in
Canada, Ottawa, pp vi ? 41
Hamilton MB, Pincus EL, DiFiore A, Fleischer RC (1999) Universal
linker and ligation procedures for construction of genomic DNA
libraries enriched for microsatellites. Biotechniques 27:500–507
Rousset F (2008) GENEPOP’007: a complete reimplementation of
the Genepop software for Windows and Linux. Mol Ecol Resour
8:103–110
Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users
and for biologist programmers. In: Krawetz S, Misener S (eds)
Bioinformatics methods and protocols: methods in molecular
biology. Humana Press, Totowa, pp 365–396
Schuelke M (2000) An economic method for the fluorescent labeling
of PCR fragments. Nat Biotechnol 18:233–234

123