Science of the Total Environment 708 (2020) 134594

Contents lists available at ScienceDirect

Science of the Total Environment

journal homepage: www.elsevier.com/locate/scitotenv

Selectively enrichment of antibiotics and ARGs by microplastics in river,

estuary and marine waters
Shanshan Wang a,d, Nana Xue a,d, Wenfeng Li a, Daoyong Zhang a,b, Xiangliang Pan a,b,⇑, Yongming Luo c
a
Xinjiang Key Laboratory of Environmental Pollution and Bioremediation, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China
b
Key Laboratory of Microbial Technology for Industrial Pollution Control of Zhejiang Province, College of Environment, Zhejiang University of Technology, Hangzhou 310014, China
c
Key Laboratory of Soil Environment and Pollution Remediation, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China
d
University of Chinese Academy of Sciences, Beijing 100049, China

h i g h l i g h t s g r a p h i c a l a b s t r a c t

The content of antibiotics and ARGs

on PE was decreased with salinity.

PE MPs can selectively enrich
antibiotics, ARGs and microbe in
various waters.

Bacterial community on PE MPs
differed from surrounding water by
antibiotics.

ARGs and bacterial diversity on PE
MPs increased in river water.

Bacteria on PE MPs were more
susceptible to antibiotics in marine
water.

a r t i c l e i n f o a b s t r a c t

Article history: The partition of antibiotics and antibiotic resistant genes (ARGs) between the microplastics (MPs) and the
Received 27 February 2019 surrounding water with various salinity are still unclear. In this study, we hypothesized that adsorption of
Received in revised form 19 September antibiotics on MPs might cause a significant change of the structure of microbial communities, diversity
2019
and abundance of ARGs on MPs and this might be further affected by change of salinity. In this study,
Accepted 20 September 2019
Available online 3 November 2019
we investigated adsorption of four common antibiotics (sulfamerazine, tetracycline, chloramphenicol
and tylosin) to polyethylene (PE) MPs in river, estuary and marine waters, and the differences of antibiotic
Editor: Daniel CW Tsang resistant genes (ARGs) and bacterial communities on MPs and in the three waters. The results showed that
MPs can enrich antibiotics, ARGs and microbes from the surrounding water. Elevated salinity could reduce
Keywords: adsorption of antibiotics to MPs and the abundance of ARGs. For example, MPs can concentrate more
Antibiotics antibiotics and ARGs in the fresh river water than in the estuary and the marine waters. In addition,
ARGs ARGs and bacterial communities on MPs at various salinity were significantly different under the pressure
Bacterial community of four antibiotics. On MPs, sul1, sulA/folP-01, tetA, tetC, tetX and ermE increased significantly but a few
Microplastics new ARGs such as sulA/folP-01 and tetA appeared. The structure of the bacterial communities on MPs was
Salinity different from the surrounding water since some bacteria species found on MPs were barely detected in
the surrounding water while some genera on MPs vanished after exposure to antibiotics. As the antibiotics
adsorbed and the ARGs on MPs decreased with the water salinity, the structure of the communities on MPs
thus varied with salinity change. These findings are important to understand the effects of MPs on the
transport, fate and ecological risk of antibiotics and ARGs in different aquatic environments.
Ó 2019 Elsevier B.V. All rights reserved.

⇑ Corresponding author at: Xinjiang Key Laboratory of Environmental Pollution and Bioremediation, Xinjiang Institute of Ecology and Geography, Chinese Academy of
Sciences, Urumqi 830011, China.
E-mail address: xiangliangpan@163.com (X. Pan).

https://doi.org/10.1016/j.scitotenv.2019.134594
0048-9697/Ó 2019 Elsevier B.V. All rights reserved.
2 S. Wang et al. / Science of the Total Environment 708 (2020) 134594
1. Introduction
Microplastic fragments (<5 mm) have been an ever-increasing
global threat to aquatic ecosystems (Browne et al., 2013; Lu
et al., 2018a; Pivokonsky et al., 2018; Ryan et al., 2012; Zhao
et al., 2018). Microplastics (MPs) have been found widely in seawa-
ter, fresh water and sediments (Imhof et al., 2012; Law et al., 2014;
Mason et al., 2016; Ryan et al., 2009). MPs are also important
adsorbents for various organic contaminants including antibiotics
because of their hydrophobic surfaces (Bakir et al., 2016; Shimao,
2001; Singh and Sharma, 2008). The adsorption capacity of MPs
for organic pollutants varies from freshwater to seawater
(Velzeboer et al., 2014). The MPs associated with the adsorbed
organic contaminants can be transferred to sea through rivers
(Moore et al., 2002) and may also be transported back to the estu-
ary from the sea by tides (Wan and Zhao, 2017). Evidence showed
that the chemicals generally exist in the sea-surface microlayer,
where MPs (especially for low-density polyethylene) are most
abundant (Rios et al., 2007; Teuten et al., 2009). Polyethylene
(PE) plastics is generally buoyant and can easily float with the flow,
which may cause their long-distance migration from one water
system to another. Adsorption of antibiotics on MPs may be due
to the long-distance transport and may cause complex effects (Li
et al., 2018). Microplastic pollution could influence microbial
diversity and increase gene exchange in aquatic ecosystems. The
bacteria could colonize on the surface of plastics and the microbial
community structure was different from the surrounding water
(De Tender et al., 2015).
Antibiotics have been widely used for treatment of human ani-
mal diseases since last century (Zhang et al., 2015). Antibiotics
have been frequently detected in seawater, rivers and drinking
water (Baquero et al., 2008; Hirsch et al., 1999; Kummerer, 2009;
Zuccato et al., 2010). The omnipresent pressure of antibiotics in
the water environments leads to a persistent increase in antibiotic
resistant genes (ARGs) (Jia et al., 2018; Kataja et al., 2000). For
example, the tetracycline resistance genes were induced by the
residual tetracycline (Wu et al., 2015), and the Sul genes emerged
with the large scale introduction of sulfonamides (Antunes et al.,
2007; Zhang et al., 2009). Some macrolide resistance genes (erm)
encoded resistance can be transferred between different bacterial
species via mobile elements (Liu et al., 2007; Roberts, 2003). In
addition, the metabolites or degradation products of antibiotics
will enter the aquatic environment and the resistant pathogens
or resistant genes may be transferred from environment to human
through horizon gene transfer (Tollefson and Miller, 2000).
Water salinity is an important factor that may significantly
affect the adsorption behavior of organic pollutants onto the MPs
(Barnes et al., 2009; Thompson, 2005). At many sites, water salinity
may drastically change temporarily or spatially. One typical site is
the estuary zone, where seawater from the sea mixes with fresh-
water from rivers. The adsorption capacity of MPs for pollutants
may be increased or decreased in response to the change of water
salinity, which may alter the partition of organic pollutants
between MPs and water and thus affects their bioaccessibility
and ecological risks. However, very limited information is available
on the effects of salinity change on adsorption of antibiotics onto
MPs and their subsequent ecological consequences, such as the
variation of structure of the microbial communities and ARGs on
MPs and in the surrounding water.
In the present study, we hypothesized that MPs could adsorb
antibiotics as well as could be colonized by bacteria, and thus
enrich ARGs. The enrichment of ARGs on MPs might significantly
increase the transport distance of ARGs through the river-
estuary-sea continuum. In addition, because of water salinity chan-
ged drastically from the freshwater river to estuary zone, the sea or
the ocean, adsorption behavior of antibiotics, the microbial com-
munities and the diversity and abundance of ARGs on MPs may
also change significantly during the transport of MPs from the river
to the sea or the repeated transport between the estuary and the
sea. Adsorption behavior of four antibiotics onto PE MPs at differ-
ent salinities and consequences of the abundance of ARGs and the
bacterial diversity in water and on MPs were investigated. Our
study is helpful for evaluation of the potential role of MPs in the
dissemination of antibiotics and ARGs from the freshwater river
to the estuary and the sea.
2. Materials and methods
2.1. Materials
Four commonly used antibiotics (sulfamerazine, tetracycline,
chloramphenicol and tylosin) were purchased from Shanghai Alad-
din Bioscience & Technology Co., Ltd., PR China. Acetonitrile (HPLC
grade) and methanol (HPLC grade) were obtained from Sigma
Aldrich; Deionized water (18 MX cm) was used to prepare aqueous
solutions. PE plastic film (freshness protection package) was pur-
chased from the supermarket and cut into pieces (<5 mm). The
debris was pre-washed with 75% ethanol and sterile ultrapure
water for disinfection and removal of residual contaminants on
the surface. River water was collected from the pristine headwater
zone of the Taihu Lake, China, and the sea water was collected from
the East sea of China, where there are little human activities. The
estuary water was prepared by mixing the fresh river water with
the sea water at a ratio of 1:1. The basic chemical parameters of
the river, estuary water and sea water were listed in Table 1.
2.2. Adsorption of antibiotics to PE MPs
As shown in Fig. 1, the experiments were performed in a 5.0 L
beaker containing 4 L of 5 mg L1 antibiotics solution at a particular
salinity (the river water: 0.2‰, the estuary water: 19.9‰ and the
seawater: 34.3‰). Then 1.0 g PE MPs were added to each beaker.
In order to mimic the persistent pollution of antibiotics, an equal
dose of antibiotics was added to the beaker each week in the fol-
lowing 4 weeks to get a final nomination concentration of 20 mg
L1.
Antibiotics concentration was analyzed by ACQUITY UPLCTM -
MS/MS (Waters) with a ZORBAX SB-C18 column (Agilent,
4.6  150 mm, 5 mm). The mobile phase composed of acetonitrile
(A) and ultrapure water containing 0.1% formic acid (B) was
injected according to the following gradient program: 40% A (0–
8 min), 60% B (8–10 min), and 40% B (10–20 min). The flow rate
of the mobile phase was 0.4 mL min1 and the injection volume
was 10 lL. Analyses were performed in triplicate.
Extraction of antibiotics from water and MPs samples was
referred to Chen et al. (2017) with some modification. 500 mL
water sample was passed through the HLB cartridge (Waters Oasis)
at a flow rate of 5–10 mL min1. Then the HLB cartridges was
rinsed with 20 mL methanol and dried by a flow of nitrogen and
finally diluted with 1 mL methanol. 100 mg MPs was soaked in
10 mL methanol and then treated with ultrasonic for 15 min, and
thereafter the supernatant was transferred to a new clean test
tube. The previous steps for each sample were repeated two more
times and the supernatants were merged and concentrated to 1 mL
by nitrogen gas with high purity.
2.3. DNA extraction and real-time qPCR for ARGs
After 4-week experiment, 500 mL water sample was collected
and filtered through 0.22 lm microporous membranes, and the
 S. Wang et al. / Science of the Total Environment 708 (2020) 134594 3

Table 1
The basic chemical properties of the river, estuary and sea waters.

Water System Salinity pH Cl SO2

4 Ca2+ K+ Mg2+ Na+ HCO–3
(‰) (mgL1) (mgL1) (mgL1) (mgL1) (mgL1) (mgL1) (mgL1)
River 0.20 8.23 8.03 92.36 55.86 1.40 7.89 13.34 127.34
Estuary 19.86 7.92 12147.70 469.50 95.10 32.30 113.20 7871.30 979.12
Marine 34.30 7.25 24555.00 1373.60 274.40 118.80 154.40 16007.90 1174.50

Fig. 1. Experimental diagram for the effect of salinity on the sorption of four antibiotics to PE MPs.
4 S. Wang et al. / Science of the Total Environment 708 (2020) 134594

membranes were cut into pieces for DNA extraction. 100 mg MPs
were collected with sterile forceps. DNA on MPs was extracted
using the PowerSoil DNA Isolation Kit (MO BIO Laboratories, Inc.,
CA, USA) following the manufacturer’s instructions.
ARGs were determined by PCR assays, which were conducted in
a 25 lL volume reactor according to the manufacturer’s instruc-
tions (Sangon Biotech). Target ARGs including sulfonamide resis-
tance genes (sul1 and sulA/folP), tetracycline resistance genes
(tetA, tetC, tetW and tetX), macrolide resistance gene (ermE and
ermF) and chloramphenicol resistance genes (cmlA-02), integrase
gene of class 1 integron (intI1) and bacterial 16S rRNA gene, and
the primer sequences and annealing temperature were listed in
Table 2.
Positive plasmids were extracted and used for standard curves
of real-time quantitative PCR (qPCR) by 7500 Fast Real-Time PCR
System (ABI, USA) with TransStart Top Green qPCR SuperMix
(TransGen Biotech). The specificity was verified by melting curves
and gel electrophoresis. The efficiency of each gene and R2 values
for the standard curves were shown in Supporting Information
(SI Table 1). The standard curves were used to quantify the abun-
dance of ARGs which were normalized to the 16S rRNA gene copies
(ARGs copies/16S rRNA gene copies). Each DNA sample was run in
triplicate.
2.4. Bacterial 16S rRNA gene sequencing
16S rRNA gene sequencing was conducted by GENEWIZ, Inc.
(Suzhou, China). DNA samples were quantified using a Qubit 2.0
Fluorometer (Invitrogen, Carlsbad, CA, USA). 30–50 ng DNA was
used to generate amplicons using a MetaVxTM Library Preparation
kit (GENEWIZ, Inc., South Plainfield, NJ, USA). The v3 and v4
regions were amplified using the forward primer containing the
sequence ‘‘CCTACGGRRBGCASCAGKVRVGAAT” and the reverse pri-
mer containing the sequence ‘‘GGACTACNVGGGTWTCTAATCC”.
The QIIME data analysis package was used for 16S rRNA data anal-
ysis. The operational taxonomic units (OTUs) were defined at the
97% similarity level. Sequences were rarefied prior to calculation
of alpha and beta diversity statistics. The sequencing data can be
referred to the BioProject accession number PRJNA540897 in
Entrez with the temporary Submission ID of SUB5569145.
2.5. Data and statistical analyses
Statistical assessments were performed by SPSS. Bar charts
were generated by Origin. Alpha-diversity, nMDS (Bray–Curtis dis-
tance based) analyses were conducted using R with the vegan
package.
3. Results
3.1. Antibiotics distribution between water and PE
PE MPs could adsorb all the four antibiotics with different
adsorption capacity (Table 3). Sulfamerazine had the highest
adsorption mass toward PE MPs in the river, estuary and sea
waters, ranging from 12.12 to 37.55 mg g1, which may be due to
the relatively high stability of sulfonamides (Chen et al., 2017;
Mitchell et al., 2015). The significant low adsorption amount of
tetracycline and tylosin may be due to their instability (Dolliver
et al., 2008; Nublat et al., 2012). Generally, the freshwater was
more favorable for adsorption of antibiotics to PE MPs than the sal-
ine waters in estuary zone and sea. In addition, the amount of sul-
famerazine, chloramphenicol and tylosin adsorbed on PE MPs was

Table 2
Primers and PCR conditions in this study.

Target genes Primer Sequences Annealing temp (°C) Reference

16S 16S rRNA -F GGGTTGCGCTCGTTGC 60 (Zhu et al. 2017)
16S rRNA -R ATGGYTGTCGTCAGCTCGTG
sul1 sul1-F CACCGGAAACATCGCTGCA 60 (Ji et al. 2012)(Luo et al. 2010)
sul1 -R AAGTTCCGCCGCAAGGCT
sulA/folP sulA/folP -F CAGGCTCGTAAATTGATAGCAGAAG 60 (Zhu et al. 2017)
sulA/folP -R CTTTCCTTGCGAATCGCTTT
ermE ermE -F TGTTCGAGTGGGAGTTCGT 60 (Knapp et al. 2010)
ermE -R GGTACTTGCGCAGAAGCGA
ermF ermF -F CAGCTTTGGTTGAACATTTACGAA 60 (Zhu et al. 2017)
ermF -R AAATTCCTAAAATCACAACCGACAA
tetA tetA -F GCTACATCCTGCTTGCCTTC 60 (Ng et al. 2001)
tetA -R CATAGATCGCCGTGAAGAGG
tetC tetC -F CTTGAGAGCCTTCAACCCAG 60 (Ng et al. 2001)
tetC-R ATGGTCGTCATCTACCTGCC
tetW tetW-F GAGAGCCTGCTATATGCCAGC 60 (Aminov et al. 2001)(Luo et al. 2010)
tetW-R GGGCGTATCCACAATGTTAAC
tetX tetX-F AGCCTTACCAATGGGTGTAAA 60 (Diehl and LaPara 2010)
tetX-R TTCTTACCTTGGACATCCCG
intI1 intI1 -F CCTCCCGCACGATGATC 60 (Zhu et al. 2017)
intI1 -R TCCACGCATCGTCAGGC

Table 3
The concentration of antibiotics in water (mg L1) and PE MPs (mg g1) in different levels of salinity.

Samples Sulfamerazine Tetracycline Chloramphenicol Tylosin

Water River 8.82 ± 0.39 2.51 ± 0.26 6.93 ± 0.70 0.78 ± 0.07
Estuary 8.88 ± 0.65 1.52 ± 0.32 8.64 ± 0.97 0.45 ± 0.05
Marine 6.69 ± 0.48 1.38 ± 0.01 9.92 ± 0.29 0.29 ± 0.09
PE River 37.55 ± 1.73 1.33 ± 0.67 4.69 ± 0.97 0.77 ± 0.02
Estuary 17.17 ± 1.52 1.38 ± 0.15 1.56 ± 0.21 0.616 ± 0.003
Marine 12.13 ± 1.37 1.31 ± 0.91 0.52 ± 0.04 0.56 ± 0.01
 S. Wang et al. / Science of the Total Environment 708 (2020) 134594 5

highest in the river water. Sulfamerazine and chloramphenicol be disseminated between bacterial species because of the mobile
adsorbed on PE MPs in the river water were nearly twice more than elements. Nevertheless, earlier studies showed that many tetracy-
in the estuary and sea water. cline resistance genes were located on non-mobile plasmids
(Roberts, 2005; Zhang et al., 2009). This may be used to explain
why most tetracycline (tetA, tetC and tetW) resistance genes had
3.2. Args analysis
little correlation with intI1.
The relative abundance of four classes of ARGs (gene copies of
ARGs normalized to the gene copies of 16S rRNA) was shown in 3.3. Microbial diversity
Fig. 2. Most ARGs, such as sul1, tetC, tetW, tetX, ermE and ermF,
existed in the original water. The relative abundance of sul1, tetX Microbial diversity based on alpha-diversity (Chao1 estimator)
and ermE significantly increased after the addition of antibiotics, in the river, estuary and marine waters were shown in Fig. 4. In
while sulA/folP-01 and tetA generated under the selective pressure general, PE MPs could exactly act as habitat for microorganisms
of sulfamerazine and tetracycline. Nevertheless, the chlorampheni- in the three aquatic environments. In addition, the microorganisms
col resistance gene was not detected in water samples. Interest- on PE MPs were susceptible to antibiotics especially in the estuary
ingly, PE MPs concentrated most ARGs from the surrounding and marine waters. For example, in the control group, the Chao1
water, and the relative abundance of sul1, tetA, tetC, tetX, ermE estimator on PE MPs in the estuary water was the highest, 490
and ermF on PE MPs were highest in the river water and lowest (E-0), while the figures decreased to below 400 after addition of
in the sea water. antibiotics. In the marine water, the diversity of Chao1 on PE
The correlation between ARGs and class 1 integron integrase MPs also decreased significantly upon exposure to antibiotics. On
gene (intI1) was shown in Fig. 3. Four resistance genes, sul1, tetX, the contrary, the microbial diversity on PE MPs in the river water
ermE and ermF, significantly correlated with intI1, indicating that increased slightly.
intI1 may play an important role in the transmission of ARGs
between water and PE MPs through horizontal gene transfer. 3.4. Bacterial community structure
Sul1, as an origin ARG in natural water (Hu et al., 2008), had a close
relation with intI1 and could be transferred horizontally from one Bray–Curtis-based Non-Metric Multidimensional Scaling
host to another in the river and marine waters (Mukherjee and (nMDS) profile was analyzed to examine the differences in com-
Chakraborty, 2006; Taviani et al., 2008). The erm gene could also munity dissimilarity between samples. The distance between

3.5E-3
sul1 a 2.0E-6
Norm alized copy num ber

3.0E-3
(copies per bacterial cell)

sul1
2.5E-3
2.0E-3
sulA/folP-01 1.5E-6
sulA/folP-01 b
1.0E-6
1.5E-3 5.0E-7
1.0E-3
5.0E-4

3E-10 1.8E-12

2E-10 1.2E-12

1E-10 6.0E-13

0 0.0
R-0 E-0 M-0 R-Sul E-Sul M-Sul R-0 E-0 M-0 R-Sul E-Sul M-Sul
Water PE MPs
1.0E-6
Norm alized copy number
(copies per bacterial cell)

3.0E-6
2.5E-6
2.0E-6 tetX c tetX
1.5E-6
1.0E-6 tetW tetW d
5.0E-7 tetC 8.0E-7 tetC
tetA tetA
1.5E-11
4.0E-11
1.0E-11
2.0E-11
5.0E-12

0.0 0.0
R-0 E-0 M-0 R-Tet E-Tet M-Tet R-0 E-0 M-0 R-Tet E-Tet M-Tet
Water PE MPs
1.4E-13
e 4E-14
Norm alized copy num ber
(copies per bacterial cell)

1.2E-13 ermF
3E-14 ermF f
1.0E-13 ermE
2E-14 ermE
8.0E-14
1E-14
2.5E-15
2.0E-15
3.0E-18
1.5E-15
1.0E-15 2.0E-18

5.0E-16 1.0E-18
0.0 0.0
R-0 E-0 M-0 R-Tyl E-Tyl M-Tyl R-0 E-0 M-0 R-Tyl E-Tyl M-Tyl
Water PE MPs

Fig. 2. Distribution of four types of ARGs (gene copies per 16S rRNA gene) in water and PE MPs. (Sulfonamides ARGs in water (a) and PE MPs (b); Tetracyclines ARGs in water
(c) and PE MPs (d); Macrolides ARGs in water (e) and PE MPs (f). Chloramphenicols ARGs were not detected in water and PE MPs).
6 S. Wang et al. / Science of the Total Environment 708 (2020) 134594
Fig. 3. Correlations between the relative abundance of ARGs (ARGs copies/16S-
rRNA copies) and class 1 integron-integrase gene (intI1). (a) Sulfonamides ARGs; (b)
Tetracyclines ARGs; (c) Macrolides ARGs.
points represented the degree of variance. The points of water and
MPs were located in different quadrants (Fig. 5), indicating that
bacterial communities between the on the MPs and in the sur-
rounding waters had distinct differences, especially in the river
water and the estuary water. In other words, MPs provides an eco-
logical niche for bacteria different from the surrounding water. In
the marine water, the difference in the structure of communities
between the water and the MPs was relatively samll. For example,
the control group (without antibiotics) of MPs and its surrounding
marine water (M0) were in close proximity, and the distance
between the water and the MPs did not increase much after addi-
tion of antibiotics. In addition, except chloramphenicol, the other
three antibiotics in the sea water had a significant impact on bac-
terial communities, as M0 clearly isolated from MSul (or MTet
and MTyl). This result could be explained by the significant
decrease of diversity in the marine water after exposure to antibi-
otics. Except for the bacterial source from the water, the chemicals
such as heavy metals and antibiotics adsorbed on solid surfaces
such as MPs can also influence the structure of microbial commu-
nities (Liu et al., 2019).
Besides, the microbial community responded differently to dif-
ferent antibiotics. Chloramphenicol decreased the diversity most in
all the waters. Sulfamerazine and tylosin increased biodiversity,
especially in the estuary and the marine water. After exposure to
the four antibiotics, the microbial diversity on MPs decreased in
the estuary and marine waters but increased in the river water.
The taxonomic profiles at phylum and genus levels used to
describe the changes of bacterial patterns under the pressure of
antibiotics in different waters (Figs. 6 and 7). At the phylum level,
the most common bacteria in all samples were Proteobacteria, Bac-
teroidetes and Firmicutes, which account for more than 90%.
Besides, Acidobacteria and Saccharibacteria were typical on MPs
(Fig. 6b and SI Table 3), whereas Chlorobi and Armatimonadetes only
existed in the surrounding waters (Fig. 6a and SI Table 2). The
results explained the nMDS profile that the structure of the bacte-
rial communities on MPs was different from the surrounding
water. As expected, most antibiotics had a significant impact on
the bacterial community. Deferribacteres and Ignavibacteriae disap-
peared in various waters upon exposure to antibiotics. On the con-
trary, PE could be a relatively stable harbor for bacteria because no
phylum vanished and all that changed was the alteration of the
abundance of some bacterial phyla.
At the genus level, most bacteria found on MPs also existed in
the corresponding surrounding water (Fig. 7). This indicates that
MPs can concentrate bacteria from their surrounding water. Except
for the shared genera, Alcanivorax and OM43_clade were unique in
the river and the estuary waters, while Methylophilus, Acidovorax
and Delftia were only detected in the marine water (SI Tables 4
and 5). The results also revealed that antibiotics affected the bacte-
ria on MPs greatly in the marine water. Some fragile genus on MPs
such as Methylophaga, Lutimaribacter, Donghicola, Thalassococcus
and Ruegeria even vanished after exposure to antibiotics (Fig. 7b
and SI Table 5). For the river and the estuary systems, no bacteria
vanished on MPs, which means PE can serve as a stable carrier for
the bacterial community in the low salinity water system.
3.5. Microbiota composition in the water-MPs systems
Bacterial taxa analyzed by LEfSe (linear discriminant analysis
(LDA) effect size) significantly differentiated in water and PE MPs
among the three water systems. In water samples, sixteen bacterial
taxa were identified to be significantly different in control groups,
while the number dropped to 5 except for the uncultured bacteria
under the pressure of MPs and antibiotics (Fig. 8A). The classifica-
tion level was analyzed by the cladogram of LEfSe (Fig. 8C). The key
phylotypes also changed a lot after addition of MPs and antibiotics,
Hyphomonadaceae and Caulobacterales were most abundant in the
control river water and changed to OM43_clade. Lutimaribacter,
Oceanospirillales, Litoricola, Litoricolaceae, Saprospiraceae and Bac-
teroidetes in the estuary water changed to Ruegeria. Rhodocyclaceae,
Rhodocyclales, Rhodospirillales, Methyloversatilis, Novosphingobium,
Sphingomonadales and Sphingomonadaceae in the marine water
changed to Betaproteobacteria, Methylophilales and Aquabacterium.
On MPs, the dominant phylotypes in the three water systems
were significantly different (Fig. 8B and D). Sphingobacteriales,
Saprospiraceae, Sphingobacteriia and Halieaceae were most abun-
dant on MPs in the river water. Under the selection pressure of
antibiotics, the dominant bacteria on MPs in the river water
increased significantly, including Hyphomonadaceae, Caulobac-
terales, Oceanospirillales, Oleiphilus, Oleiphilaceae, Flavobacteriia,
Flavobacteriaceae, bacterium_K2_15, Flavobacteriales, Rhodobacter-
aceae, Alcanivoracaceae and Alcanivorax. The dominant Bacteroide-
tes, Aestuariibacter, Lutimaribacter, Pseudomonas, Pseudomonadales
 S. Wang et al. / Science of the Total Environment 708 (2020) 134594 7

600 600

a b
500 500

400 400
Chao1 estimator

Chao1 estimator
300 300

200 200

100 100

0 0
R- - 0

E- 0

M -0
R- u l
R - et

E- h l
Ml
R- l

E- ul
E- t

M hl
yl
M ul
M et
Ty

Ty
Te
Ch

E-

R- 0

E- 0

M -0
l

l
R- ul

E- l
E - et
E- l

yl
R - et
R- l

M ul
M et
M hl
T

-T

-T
S

C
S

-S

-C
R

Ty

Ty
Su

Ch
Ch
R-

E-
T

-T

-T
S

-C
-S
M
Water PE MPs

Fig. 4. Alpha-diversity (Chao1 estimator) of bacterial communities for water (a) and PE MPs (b).

Fig. 5. Non-Metric Multidimensional Scaling (nMDS) profile based on Bray-Curtis distance showed the community dissimilarity among water and PE MPs samples.

and Pseudomonadaceae on MPs in the estuary water were changed 4. Discussion

to Rhodocyclales, Rhodocyclaceae and Methyloversatilis upon expo-
sure to antibiotics. In the marine water, Betaproteobacteria, Coma-
monadaceae, Burkholderiales, Methylophilus and Delftia were most
abundant on MPs and Proteobacteria and Methylophilales became
the dominant bacteria after exposure to antibiotics.
Microplastics can concentrate contaminants from the surround-
ing water, which may alter the ecological toxicity to aquatic organ-
isms (Lu et al., 2018a,b). Our study showed that PE MPs could
adsorb the four antibiotics in the three different waters, and these
8 S. Wang et al. / Science of the Total Environment 708 (2020) 134594

100
a
Armatimonadetes
TM6_(Dependentiae)
80 Chlorobi
Fusobacteria
Planctomycetes
Deferribacteres
Relative abundance

Deinococcus-Thermus
60 Chlamydiae
Hydrogenedentes
Ignavibacteriae
Gemmatimonadetes
Woesearchaeota_(DHVEG-6)
40 Chloroflexi
Peregrinibacteria
Actinobacteria
Unclassified
Cyanobacteria
20 Verrucomicrobia
Tenericutes
Firmicutes
Bacteroidetes
Proteobacteria
0
l

t
0

-0

ul

et

hl

yl
0

Ty

Ty
Su

Te

Su

Te
Ch

Ch
R-

E-

-T

-T
-S

-C
M

R-

R-

E-

E-
R-

E-
R-

E-

M
M
100
b
TM6_(Dependentiae)
Fusobacteria
80 Planctomycetes
Deferribacteres
Deinococcus-Thermus
Saccharibacteria
Relative abundance

Chlamydiae
60 Hydrogenedentes
Ignavibacteriae
Gemmatimonadetes
Woesearchaeota_(DHVEG-6)
Acidobacteria
40 Chloroflexi
Peregrinibacteria
Actinobacteria
Unclassified
Cyanobacteria
20 Verrucomicrobia
Tenericutes
Firmicutes
Bacteroidetes
Proteobacteria
0
l

t
-0

ul

et

hl

yl
0

Ty

Ty
Su

Te

Su

Te
Ch

Ch
R-

E-

-T

-T
-S

-C
M

R-

R-

E-

E-
R-

E-
R-

E-

M
M

Fig. 6. Change in the microbiota composition at the phylum level. (Relative abundance of the bacteria based on 16S sequencing data for water (a) and PE MPs (b) samples).

antibiotics could be much more easily adsorbed by MPs in the fresh
river water than in the marine water. The different adsorption
capacity of MPs for the four antibiotics in the waters with various
salinity may be owing to the differences in total salt content and
chemical composition between the river, estuary and marine
waters, which could compete for the adsorption sites against the
antibiotics (Pimol et al., 2008).
PE MPs can also be the carrier for ARGs as most ARGs were
detected on PE MPs. The ARGs results were in accordance with
the adsorption ability of MPs toward antibiotics. Apart from the
selection pressure of antibiotics, water salinity appeared to be a
critical factor that governs the emergence and development of
ARGs. The good correlation between intI1 and ARGs suggests that
intI1 may play an important role in the transmission of sul1, tetX,
ermE and ermF between water and MPs through horizontal gene
transfer (Zhu et al., 2017).
Microbial diversity in the waters and on MPs changed signifi-
cantly in response to the selection pressure of the four antibiotics.
The results may be caused by the relatively low levels of antibiotics
in the waters that would not prevent microbe growth (Gullberg
et al., 2011). Selvam et al. (2012) demonstrated that there was a
slightly higher abundance of 16S rDNA upon exposure to low levels
of chlortetracycline, sulfadiazine and ciprofloxacin. In addition,
ions may also influence the adsorption of antibiotics to MPs surface
(Chen et al., 2011; Pimol et al., 2008; Sun et al., 2006). Boatman and
Murray (1982) found that sea salts in estuarine waters would neu-
tralize the polarity of ions and reduce cation exchange sites, thus
leading to the weak adsorption of antibiotics on PE MPs in the sal-
ine water. Furthermore, in the river water, most ARGs showed the
highest abundance and the microbial diversity increased slightly.
This implies that bacterial communities were stable under the
selective pressure of antibiotics in the river water by acquiring
ARGs but were susceptible in marine water. This may be one
important reason for the differences in the structure of the micro-
bial communities among the river, the estuary and the marine sys-
tems under the pressure of antibiotics.
PE MPs showed a different ecological niche of bacterial commu-
nity from the surrounding water. The results were in accordance
with McCormick et al. (2014) and De Tender, et al. (2015), who
demonstrated that the floating plastic debris had a different com-
 S. Wang et al. / Science of the Total Environment 708 (2020) 134594 9

100
a
Others
Delftia
80 OM43_clade
Bacillus
Novosphingobium
Methyloversatilis
Relative abundance

Aestuariibacter
60
Ruegeria
Comamonas
Aquabacterium
Thalassococcus
40 Donghicola
Alcanivorax
Lutimaribacter
Acidovorax
Alteromonas
20 Pseudomonas
Methylophilus
Methylophaga
Marinobacter
Unclassified
0
0

-0

ul

et

hl

yl
Ty

Ty
Te
Su

Ch

Su
Te

Ch
E-
R-

-T

-T
-S

-C
M

E-

E-
R-

R-

R-

E-
R-

E-

M
M
100
b
Others
Delftia
80
OM43_clade
Bacillus
Novosphingobium
Methyloversatilis
Relative abundance

60 Aestuariibacter
Ruegeria
Comamonas
Aquabacterium
Thalassococcus
40 Donghicola
Alcanivorax
Lutimaribacter
Acidovorax
Alteromonas
20 Pseudomonas
Methylophilus
Methylophaga
Marinobacter
Unclassified
0
l

t
0

-0

ul

et

hl

yl
Ty

Ty
Su

Te
Su

Ch

Ch
Te
E-
R-

-T

-T
-S

-C
M

E-

E-
R-

R-

R-

E-
R-

E-

M
M

Fig. 7. Change in the microbiota composition at the genus level. (Relative abundance of 20 most abundant bacteria based on 16S sequencing data for water (a) and PE MPs (b)
samples).

munity composition from the surrounding water. The different taxa and this can further influence the microbial community structure on
between water and PE samples in the three waters by LEfSe can PE MPs and in the surrounding water.
explain this. Except for the shared bacteria, the major different
phylotypes between the control group and experimental group
5. Conclusions
(with the addition of PE-antibiotics) changed remarkably. Undoubt-
edly, antibiotics can induce the shift of the microbiome (Theriot
This study shows that microplastics can selectively enrich
et al., 2014; Vaz-Moreira et al., 2014). Our study showed that the
antibiotics, ARGs and microbe in the river, the estuary and the mar-
combination of PE and antibiotics could induce significant differ-
ine waters. Distribution pattern of ARGs and structure of bacterial
ences in bacterial taxa compared with the control group (Fig. 8).
community showed significant differences between on PE MPs and
The dominant bacteria species in the surrounding waters decreased
the three waters with different salinity under the pressure of the
under the pressure of antibiotics adsorbed on MPs. For MPs, despite
four antibiotics. On PE MPs, sul1, tetC, tetX and ermE increased sig-
the river water, the key bacterial species in the estuary and marine
nificantly and a few ARGs as sulA/folP-01 and tetA appeared. PE
waters also showed significant decreases upon exposure to antibi-
MPs can concentrate more ARGs in the river water than in the estu-
otics. MPs, as a niche for the microorganisms, can selectively enrich
ary and the marine water, which was in accordance with the con-
the bacteria from the surrounding water and form biofilm with dif-
tent of antibiotics on PE MPs. Bacterial alpha-diversity on PE MPs
ferent community structure (Eckert et al., 2018). This study also
was decreased upon exposure to antibiotics in the estuary and
shows that PE MPs is a vehicle for antibiotics and bacteria with ARGs
the marine waters but increased slightly in the river system as a
10 S. Wang et al. / Science of the Total Environment 708 (2020) 134594
Fig. 8. Linear discriminative analysis (LDA) effect size (LEfSe) of bacterial taxa with a significant difference of water (a) and PE (b). The cladogram of water (c) and PE MPs (d)
for the three water systems.
whole whereas bacterial alpha-diversity in the surrounding waters
showed an opposite trend. The relative abundance of bacteria at
the phylum and the genus levels further demonstrated that bacte-
rial community structure on PE MPs was different from the sur-
rounding water since some bacteria species found on PE MPs
were barely detected in the surrounding water and some genera
on PE MPs vanished after exposure to antibiotics. LEfSe also
showed PE MPs can enrich the dominant bacteria in the river
water. As the adsorption capacity for antibiotics and ARGs of PE
MPs decreased with increasing water salinity, the microbiota com-
position on PE MPs was differently influenced in the three waters.
These findings are important to understand the roles of microplas-
tics in the partition, transport and ecological risk of antibiotics and
ARGs in various water environments.
Declaration of Competing Interest
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared
to influence the work reported in this paper.
Acknowledgments
This work was supported by the National Natural Science Foun-
dation of China (41907140, U1503281 and U1703243).
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.scitotenv.2019.134594.
References
Aminov, R.I., Garrigues-Jeanjean, N., Mackie,, R.I., 2001. Molecular ecology of
tetracycline resistance: development and validation of primers for detection of
tetracycline resistance genes encoding ribosomal protection proteins. Appl
Environ Microbiol 67 (1), 22–32.
Antunes, P., Machado, J., Peixe, L., 2007. P513 Dissemination of a new gene cluster
comprising sul3 (tnp-sul3-tnp) linked to class 1 integrons with an unusual 30 CS
region (qacH) among Salmonella isolates. Int. J. Antimicrobial Agents 29, S112–
S113.
Bakir, A., O’Connor, I.A., Rowland, S.J., Hendriks, A.J., Thompson, R.C., 2016. Relative
importance of microplastics as a pathway for the transfer of hydrophobic
organic chemicals to marine life. Environ. Pollut. 219, 56–65.
 S. Wang et al. / Science of the Total Environment 708 (2020) 134594
Baquero, F., Martinez, J.L., Canton, R., 2008. Antibiotics and antibiotic resistance in
water environments. Curr. Opin. Biotechnol. 19, 260–265.
Barnes, D.K., Galgani, F., Thompson, R.C., Barlaz, M., 2009. Accumulation and
fragmentation of plastic debris in global environments. Philos. Trans. R. Soc.
Lond. B. Biol. Sci. 364, 1985–1998.
Boatman, C.D., Murray, J.W., 1982. Modeling exchangeable NH4+ adsorption in
marine sediments: process and controls of adsorption1, 2. Limnol. Oceanogr. 27,
99–110.
Browne, M.A., Niven, S.J., Galloway, T.S., Rowland, S.J., Thompson, R.C., 2013.
Microplastic moves pollutants and additives to worms, reducing functions
linked to health and biodiversity. Curr. Biol. 23, 2388–2392.
Chen, R., Zhang, Z., Yang, Y., Lei, Z., Chen, N., Guo, X., Zhao, C., Sugiura, N., 2011. Use
of ferric-impregnated volcanic ash for arsenate (V) adsorption from
contaminated water with various mineralization degrees. J. Colloid. Interface.
Sci. 353, 542–548.
Chen, Y., Zhou, J.L., Cheng, L., Zheng, Y.Y., Xu, J., 2017. Sediment and salinity effects
on the bioaccumulation of sulfamethoxazole in zebrafish (Danio rerio).
Chemosphere 180, 467–475.
De Tender, C.A., Devriese, L.I., Haegeman, A., Maes, S., Ruttink, T., Dawyndt, P., 2015.
Bacterial community profiling of plastic litter in the Belgian part of the North
Sea. Environ. Sci. Technol. 49, 9629–9638.
Diehl, D.L., LaPara, T.M., 2010. Effect of temperature on the fate of genes encoding
tetracycline resistance and the integrase of class 1 integrons within anaerobic
and aerobic digesters treating municipal wastewater solids. Environmental
Science & Technology 23 (44), 9128–9133.
Dolliver, H., Gupta, S., Noll, S., 2008. Antibiotic degradation during manure
composting. J. Environ. Qual. 37, 1245–1253.
Eckert, E.M., Di Cesare, A., Kettner, M.T., Arias-Andres, M., Fontaneto, D., Grossart, H.
P., Corno, G., 2018. Microplastics increase impact of treated wastewater on
freshwater microbial community. Environ. Pollut. 234, 495–502.
Gullberg, E., Cao, S., Berg, O.G., Ilback, C., Sandegren, L., Hughes, D., Andersson, D.I.,
2011. Selection of resistant bacteria at very low antibiotic concentrations. PLoS
Pathog. 7, e1002158.
Hirsch, R., Ternes, T., Haberer, K., Kratz, K.-L., 1999. Occurrence of antibiotics in the
aquatic environment. Sci. Total Environ. 225, 109–118.
Hu, J., Shi, J., Chang, H., Li, D., Yang, M., Kamagata, Y., 2008. Phenotyping and
genotyping of antibiotic-resistant Escherichia coli Isolated from a Natural River
Basin. Environ. Sci. Technol. 42, 3415–3420.
Imhof, H.K., Schmid, J., Niessner, R., Ivleva, N.P., Laforsch, C., 2012. A novel, highly
efficient method for the separation and quantification of plastic particles in
sediments of aquatic environments. Limnol. Oceanogr. Methods 10, 524–537.
Ji, X., Liu, Q., Ma, J., Xu, G., Wang, Y., Wu, M., 2012. Antibiotic resistance gene
abundances associated with antibiotics and heavy metals in animal manures
and agricultural soils adjacent to feedlots in Shanghai, China. J Hazard Mater
235–236, 178–185.
Jia, J., Guan, Y., Cheng, M., Chen, H., He, J., Wang, S., Wang, Z., 2018. Occurrence and
distribution of antibiotics and antibiotic resistance genes in Ba River, China. Sci.
Total Environ. 642, 1136–1144.
Kataja, J., Huovinen, P., Seppälä, H., Group, M.R.S., 2000. Erythromycin resistance
genes in group A streptococci of different geographical origins. J. Antimicrob.
Chemother. 46, 789–792.
Knapp, C.W., Dolfing, J., Ehlert, P.A.I., Graham, D.W., 2010. Evidence of Increasing
Antibiotic Resistance Gene Abundances in Archived Soils since 1940.
Environmental Science & Technology 2, 580–587.
Kummerer, K., 2009. Antibiotics in the aquatic environment–a review–part I.
Chemosphere 75, 417–434.
Law, K.L., Moret-Ferguson, S.E., Goodwin, D.S., Zettler, E.R., Deforce, E., Kukulka, T.,
Proskurowski, G., 2014. Distribution of surface plastic debris in the eastern
Pacific Ocean from an 11-year data set. Environ. Sci. Technol. 48, 4732–4738.
Li, J., Zhang, K., Zhang, H., 2018. Adsorption of antibiotics on microplastics. Environ.
Pollut. 237, 460–467.
Liu, Y.F., Wang, C.H., Janapatla, R.P., Fu, H.M., Wu, H.M., Wu, J.J., 2007. Presence of
plasmid pA15 correlates with prevalence of constitutive MLS(B) resistance in
group A streptococcal isolates at a university hospital in southern Taiwan. J.
Antimicrob. Chemother. 59, 1167–1170.
Liu, J., Yin, M., Zhang, W., Tsang, D., Wei, X., Zhou, Y., Xiao, T., Wang, J., Dong, X., Sun,
Y., Chen, Y., Li, H., Hou, L., 2019. Response of microbial communities and
interactions to thallium in contaminated sediments near a pyrite mining area.
Environ. Pollut. 248, 916–928.
Lu, K., Qiao, R., An, H., Zhang, Y., 2018a. Influence of microplastics on the
accumulation and chronic toxic effects of cadmium in zebrafish (Danio rerio).
Chemosphere 202, 514–520.
Lu, L., Wan, Z., Luo, T., Fu, Z., Jin, Y., 2018b. Polystyrene microplastics induce gut
microbiota dysbiosis and hepatic lipid metabolism disorder in mice. Sci. Total
Environ. 631–632, 449–458.
Luo, Y., Mao, D., Rysz, M., Zhou, Q., Zhang, H., Xu, L., Alvarez, J.J.P., 2010. Trends in
Antibiotic Resistance Genes Occurrence in the Haihe River, China.
Environmental Science & Technology 44 (19), 7220–7225.
Mason, S.A., Kammin, L., Eriksen, M., Aleid, G., Wilson, S., Box, C., Williamson, N.,
Riley, A., 2016. Pelagic plastic pollution within the surface waters of Lake
Michigan, USA. J. Great Lakes Res. 42, 753–759.
McCormick, A., Hoellein, T.J., Mason, S.A., Schluep, J., Kelly, J.J., 2014. Microplastic is
an abundant and distinct microbial habitat in an urban river. Environ. Sci.
Technol. 48, 11863–11871.
11
Mitchell, S.M., Ullman, J.L., Bary, A., Cogger, C.G., Teel, A.L., Watts, R.J., 2015. Antibiotic
degradation during thermophilic composting. Water Air Soil Pollut. 226.
Moore, C.J., Moore, S.L., Weisberg, S.B., Lattin, G.L., Zellers, A.F., 2002. A comparison
of neustonic plastic and zooplankton abundance in southern California’s coastal
waters. Mar. Pollut. Bull. 44, 1035–1038.
Mukherjee, S., Chakraborty, R., 2006. Incidence of class 1 integrons in multiple
antibiotic-resistant Gram-negative copiotrophic bacteria from the River Torsa
in India. Res. Microbiol. 157, 220–226.
Ng, L.K., Martin, I., Alfa, M., Mulvey, M., 2001. Multiplex PCR for the detection of
tetracycline resistant genes. Mol Cell Probes 4 (15), 209–215.
Nublat, C., Braud, C., Garreau, H., Vert, M., 2012. Ammonium bicarbonate as porogen
to make tetracycline-loaded porous bioresorbable membranes for dental guided
tissue regeneration: failure due to tetracycline instability. J. Biomater. Sci.
Polym. Ed. 17, 1333–1346.
Pimol, P., Khanidtha, M., Prasert, P., 2008. Influence of particle size and salinity on
adsorption of basic dyes by agricultural waste: dried Seagrape (Caulerpa
lentillifera). J. Environ. Sci. 20, 760–768.
Pivokonsky, M., Cermakova, L., Novotna, K., Peer, P., Cajthaml, T., Janda, V., 2018.
Occurrence of microplastics in raw and treated drinking water. Sci. Total
Environ. 643, 1644–1651.
Rios, L.M., Moore, C., Jones, P.R., 2007. Persistent organic pollutants carried by
synthetic polymers in the ocean environment. Mar. Pollut. Bull. 54, 1230–1237.
Roberts, M., 2003. Acquired tetracycline and/or macrolide–lincosamides–
streptogramin resistance in anaerobes. Anaerobe 9, 63–69.
Roberts, M.C., 2005. Update on acquired tetracycline resistance genes. FEMS
Microbiol. Lett. 245, 195–203.
Ryan, P.G., Moore, C.J., van Franeker, J.A., Moloney, C.L., 2009. Monitoring the
abundance of plastic debris in the marine environment. Philos. Trans. R. Soc.
Lond. B. Biol. Sci. 364, 1999–2012.
Ryan, P.G., Bouwman, H., Moloney, C.L., Yuyama, M., Takada, H., 2012. Long-term
decreases in persistent organic pollutants in South African coastal waters
detected from beached polyethylene pellets. Mar. Pollut. Bull. 64, 2756–2760.
Selvam, A., Xu, D., Zhao, Z., Wong, J.W., 2012. Fate of tetracycline, sulfonamide and
fluoroquinolone resistance genes and the changes in bacterial diversity during
composting of swine manure. Bioresour. Technol 126, 383–390.
Shimao, M., 2001. Biodegradation of plastics. Curr. Opin. Biotechnol. 12, 242–247.
Singh, B., Sharma, N., 2008. Mechanistic implications of plastic degradation. Polym.
Degrad. Stab. 93, 561–584.
Sun, H., Wang, L., Zhang, R., Sui, J., Xu, G., 2006. Treatment of groundwater polluted
by arsenic compounds by zero valent iron. J. Hazard. Mater. 129, 297–303.
Taviani, E., Ceccarelli, D., Lazaro, N., Bani, S., Cappuccinelli, P., Colwell, R.R., Colombo,
M.M., 2008. Environmental Vibrio spp., isolated in Mozambique, contain a
polymorphic group of integrative conjugative elements and class 1 integrons.
FEMS Microbiol. Ecol. 64, 45–54.
Teuten, E.L., Saquing, J.M., Knappe, D.R., Barlaz, M.A., Jonsson, S., Bjorn, A., Rowland,
S.J., Thompson, R.C., Galloway, T.S., Yamashita, R., Ochi, D., Watanuki, Y., Moore,
C., Viet, P.H., Tana, T.S., Prudente, M., Boonyatumanond, R., Zakaria, M.P.,
Akkhavong, K., Ogata, Y., Hirai, H., Iwasa, S., Mizukawa, K., Hagino, Y., Imamura,
A., Saha, M., Takada, H., 2009. Transport and release of chemicals from plastics
to the environment and to wildlife. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 364,
2027–2045.
Theriot, C.M., Koenigsknecht, M.J., Carlson, P.E., Jr., Hatton, G.E., Nelson, A.M., Li, B.,
Huffnagle, G.B., J, Z.L., Young, V.B., 2014. Antibiotic-induced shifts in the mouse
gut microbiome and metabolome increase susceptibility to Clostridium difficile
infection. Nat Commun 5, 3114.
Thompson, M.C.A.A., 2005. New Directions in Plastic Debris. Science 5751.
Tollefson, L., Miller, M.A., 2000. Antibiotic use in food animals: controlling the
human health. J. AOAC Int. 83, 245–254.
Vaz-Moreira, I., Nunes, O.C., Manaia, C.M., 2014. Bacterial diversity and antibiotic
resistance in water habitats: searching the links with the human microbiome.
FEMS Microbiol. Rev. 38, 761–778.
Velzeboer, I., Kwadijk, C.J., Koelmans, A.A., 2014. Strong sorption of PCBs to
nanoplastics, microplastics, carbon nanotubes, and fullerenes. Environ. Sci.
Technol. 48, 4869–4876.
Wan, Y., Zhao, D., 2017. Observation of saltwater intrusion and ETM dynamics in a
stably stratified estuary: the Yangtze Estuary. China. Environ. Monit. Assess 189, 89.
Wu, D., Huang, Z., Yang, K., Graham, D., Xie, B., 2015. Relationships between
antibiotics and antibiotic resistance gene levels in municipal solid waste
leachates in Shanghai, China. Environ. Sci. Technol. 49, 4122–4128.
Zhang, Q.Q., Ying, G.G., Pan, C.G., Liu, Y.S., Zhao, J.L., 2015. Comprehensive evaluation
of antibiotics emission and fate in the river basins of China: source analysis,
multimedia modeling, and linkage to bacterial resistance. Environ. Sci. Technol.
49, 6772–6782.
Zhang, X.X., Zhang, T., Fang, H.H., 2009. Antibiotic resistance genes in water
environment. Appl. Microbiol. Biotechnol. 82, 397–414.
Zhao, J., Ran, W., Teng, J., Liu, Y., Liu, H., Yin, X., Cao, R., Wang, Q., 2018. Microplastic
pollution in sediments from the Bohai Sea and the Yellow Sea, China. Sci. Total.
Environ. 640–641, 637–645.
Zhu, Y.G., Zhao, Y., Li, B., Huang, C.L., Zhang, S.Y., Yu, S., Chen, Y.S., Zhang, T., Gillings,
M.R., Su, J.Q., 2017. Continental-scale pollution of estuaries with antibiotic
resistance genes. Nat. Microbiol. 2, 16270.
Zuccato, E., Castiglioni, S., Bagnati, R., Melis, M., Fanelli, R., 2010. Source, occurrence
and fate of antibiotics in the Italian aquatic environment. J. Hazard. Mater. 179,
1042–1048.