JACC: HEART FAILURE VOL. 2, NO.

6, 2014

ª 2014 BY THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION ISSN 2213-1779/$36.00

PUBLISHED BY ELSEVIER INC. http://dx.doi.org/10.1016/j.jchf.2014.04.016

MINI-FOCUS ISSUE: PHARMACOGENETICS AND PERSONALIZED MEDICINE

CLINICAL RESEARCH

G-Protein Beta-3 Subunit Genotype

Predicts Enhanced Benefit of Fixed-Dose
Isosorbide Dinitrate and Hydralazine
Results of A-HeFT
Dennis M. McNamara, MD, MS,* Anne L. Taylor, MD,y S. William Tam, PHD,z Manuel Worcel, MD,x
Clyde W. Yancy, MD, MSC,k Karen Hanley-Yanez, BS,* Jay N. Cohn, MD,{ Arthur M. Feldman, MD, PHD#

ABSTRACT

OBJECTIVES The purpose of this study was to evaluate the influence of the guanine nucleotide-binding proteins
(G-proteins), beta-3 subunit (GNB3) genotype on the effectiveness of a fixed-dose combination of isosorbide dinitrate
and hydralazine (FDC I/H) in A-HeFT (African American Heart Failure Trial).

BACKGROUND GNB3 plays a role in alpha2-adrenergic signaling. A polymorphism (C825T) exists, and the T allele is
linked to enhanced alpha-adrenergic tone and is more prevalent in African Americans.

METHODS A total of 350 subjects enrolled in the genetic substudy (GRAHF [Genetic Risk Assessment of Heart Failure in
African Americans]) were genotyped for the C825T polymorphism. The impact of FDC I/H on a composite score (CS) that
incorporated death, hospital stay for heart failure, and change in quality of life (QoL) and on event-free survival were
assessed in GNB3 genotype subsets.

RESULTS The GRAHF cohort was 60% male, 25% ischemic, 97% New York Heart Association functional class III, age 57 
13 years, with a mean qualifying left ventricular ejection fraction of 0.24  0.06. For GNB3 genotype, 184 subjects were TT
(53%), 137 (39%) CT, and 29 (8%) were CC. In GNB3 TT subjects, FDC I/H improved the CS (FDC I/H ¼ 0.50  1.6;
placebo ¼ 0.11  1.8, p ¼ 0.02), QoL (FDC I/H ¼ 0.69  1.4; placebo ¼ 0.24  1.5, p ¼ 0.04), and event-free survival
(hazard ratio: 0.51, p ¼ 0.047), but not in subjects with the C allele (for CS, FDC I/H ¼ 0.05  1.7; placebo ¼ 0.09  1.7,
p ¼ 0.87; for QoL, FDC I/H ¼ 0.28  1.5; placebo ¼ 0.14  1.5, p ¼ 0.56; and for event-free survival, p ¼ 0.35).

CONCLUSIONS The GNB3 TT genotype was associated with greater therapeutic effect of FDC I/H in A-HeFT. The role
of the GNB3 genotype for targeting therapy with FDC I/H deserves further study. (J Am Coll Cardiol HF 2014;2:551–7)
© 2014 by the American College of Cardiology Foundation.

A s first

treatment
demonstrated

with isosorbide
hydralazine (I/H) improves survival in subjects
in V-HeFT
erans Affairs Vasodilator-Heart Failure Trial)
dinitrate
(Vet-

and
with heart failure (1). After the development of
angiotensin-converting enzyme (ACE) inhibitors and
the demonstration in V-HeFT II of greater survival
benefit with enalapril compared with I/H (2), I/H was

From the *Heart, Lung, Blood and Vascular Medicine Institute, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania;
yColumbia University College of Physicians and Surgeons, New York, New York; zIndependent consultant, Dover, Massachusetts;
xConsultant, Paris, France; kDivision of Cardiology, Feinberg School of Medicine, Northwestern University, Chicago, Illinois;
{University of Minnesota, Minneapolis, Minnesota; and the #Temple University School of Medicine, Philadelphia, Pennsylvania.
This study was funded in part by a research grant from NitroMed, Inc., of Lexington, Massachusetts, which funded the A-HeFT
investigation. It was also supported in part by grants from the National Heart, Lung, and Blood Institute (contracts K24 HL69912
and RO1 HL75038). Drs. Tam and Worcel are former employees of NitroMed. All other authors have reported that they have no
relationships relevant to the contents of this paper to disclose.

Manuscript received November 11, 2013; revised manuscript received April 10, 2014, accepted April 18, 2014.
552 McNamara et al. JACC: HEART FAILURE VOL. 2, NO. 6, 2014

GNB3 Polymorphism and ISDN-HYD in Heart Failure DECEMBER 2014:551–7

ABBREVIATIONS relegated to less common use in heart failure. institutions. Inclusion criteria for A-HeFT included
AND ACRONYMS Interestingly, the survival benefit for I/H self-designation as African Americans, heart failure
differed markedly in the V-HeFT studies be- resulting from systolic dysfunction, and standard
ACE = angiotensin-converting
enzyme
tween black and white cohorts. Post hoc anal- background therapy for heart failure with neuro-
ysis demonstrated a dramatic benefit of I/H hormonal blockade including ACE inhibitors or an-
CS = composite score
for black subjects in V-HeFT I, with a lesser giotensin receptor antagonists and beta blockers (4).
FDC I/H = fixed-dose
combination of isosorbide impact evident in the larger white cohort Subjects were randomized to FDC I/H or placebo in
dinitrates and hydralazine (3). A similar analysis by race for V-HeFT II addition to standard therapy. Subjects were enrolled
GNB3 = guanine nucleotide- found that the superiority of ACE inhibitors in the GRAHF genetic substudy at the A-HeFT
binding proteins (G-proteins), was driven by the white subset, whereas in 6-month visits after providing informed consent. For
beta-3 subunit
black subjects, the survival with enalapril comparisons of allele frequencies by race, the cohort
I/H = isosorbide dinitrate and
and I/H appeared more equivalent. The from GRACE (Genetic Risk Assessment of Cardiac
hydralazine
observed enhanced impact of I/H in black Events), a single-center investigation based at the
LVEF = left ventricular ejection
fraction subjects with heart failure in these landmark heart failure clinic at the University of Pittsburgh,
LVEDD = left ventricular
studies led to A-HeFT (African American Pennsylvania (11,12), was used (n ¼ 469).
end-diastolic diameter Heart Failure Trial) (4), in which a fixed-
GNB3 GENOTYPING. DNA was isolated from periph-
QoL = quality of life dose combination (FDC) of I/H added to back-
eral blood by leukocyte centrifugation and cell lysis
SNP = single nucleotide ground therapy was demonstrated to improve
using the PureGene DNA purification kit (Gentra Sys-
polymorphism survival in a cohort of self-designated African
tems, Minneapolis, Minnesota). The guanine nucleo-
Americans with a reduced ejection fraction (5).
tide binding protein (G-protein) beta polypeptide-3
Hypertension is far more prevalent among blacks,
(GNB3) position 825 C/T polymorphism was assessed
and investigations of the genomic basis for this dis-
using a TaqMan SNP Genotyping Assay (Applied Bio-
order have demonstrated significant differences be-
systems, Inc., Foster City, California) with tagged
tween black and white cohorts in the prevalence
primers (reporter 1 tagged dye ¼ VIC; reporter 2 tagged
of genetic variants that affect vascular tone. One
dye ¼ FAM). Context sequence for the GNB3 825 C/T
example extensively studied is the G-protein beta-3
polymorphism was as follows: AGAGCATCATCTGC
subunit (GNB3). A common GNB3 polymorphism in
GGCATCACGTC[C/T] GTGGCCTTCTCCCTCAGTGGCCG
the coding region of exon-10, C825T, is associated
CC. Products were read using the Applied Biosystems
with enhanced alpha2-adrenergic receptor intracel-
7000 (ABI).
lular signaling (6). The GNB3 T allele is linked to the
FOLLOW-UP AND CLINICAL OUTCOMES. Subjects in
risk of hypertension (7,8) and low plasma renin (9),
A-HeFT were followed for 18 months with assessment
and it has a much higher prevalence in black cohorts
of deaths, hospital stays for heart failure, and quality
than among whites (10). Whether the T allele linked to
of life (QoL) as endpoints (4). QoL assessment was
low plasma renin is also associated with a diminished
performed by the Minnesota Living with Heart Fail-
impact of ACE inhibitors remains unknown.
ure Questionnaire at baseline and at the 6-month
SEE PAGE 558 visit. All subjects enrolled in A-HeFT had a clinical
assessment of left ventricular ejection fraction (LVEF)
We hypothesized that genomic differences in
before enrollment (qualifying LVEF). In addition, in a
GNB3-mediated alpha 2-adrenergic receptor activation
subset of subjects in a remodeling substudy, LVEF
may underlie the racial differences in the therapeutic
and left ventricular end-diastolic diameter (LVEDD)
efficacy of FDC I/H, and that the GNB3 T allele more
were quantified by echocardiography at a central core
prevalent among African Americans would be asso-
laboratory at baseline (n ¼ 267) and at the 6-month
ciated with a greater impact of I/H. We investigated
follow-up visit (n ¼ 259). The primary endpoint for
the interaction of drug therapy and GNB3 genotype in
A-HeFT was a composite weighted score with 3
the genetic substudy of A-HeFT, GRAHF (Genetic Risk
components: mortality, hospital stay for heart failure,
of Heart Failure in African Americans).
and change in QoL at 6 months (4,5). The change in
QoL score was reported as a component of the com-
METHODS
posite score (CS) ranging from most worsening to
most improvement scores of 2 to 2 (4,5).
STUDY POPULATION. A total of 350 subjects in
A-HeFT were enrolled in GRAHF, a substudy of ge- STATISTICAL ANALYSIS. Event-free survival was
netic risk assessment of heart failure in African compared by genotype class by Kaplan-Meier log rank
Americans. This investigation was approved by the analysis. Continuous variables such as CS were
institutional review boards at the participating compared by genotype class by analysis of variance
JACC: HEART FAILURE VOL. 2, NO. 6, 2014 McNamara et al. 553
DECEMBER 2014:551–7 GNB3 Polymorphism and ISDN-HYD in Heart Failure

(ANOVA). Statistical analysis was performed using

T A B L E 1 Baseline Clinical Characteristics of Patients in the GRAHF by GNB3 Genotype
SPSS version 20.0 (SPSS Inc., Chicago, Illinois).
Results are presented as mean  SD. Categorical All TT TCþCC
(N ¼ 350) (N ¼ 184) (N ¼ 166) p Value
variables were compared using a nonparametric
Age (yrs) 57  13 57  12 58  13 0.699
chi-square Fisher-exact test.
Female (%) 40 40 40 0.930
NYHA functional class (%/III/IV) 97/3 97/3 97/3 0.894
RESULTS
Ischemic (%) 25 24 26 0.755
LVEF qualifying 0.24  0.06 0.24  0.06 0.23  0.07 0.155
GNB3 GENOTYPE FREQUENCIES. A total of 350 sub-
LVDD (cm) qualifying 6.4  0.9 6.4  0.8 6.4  1.1 0.680
jects from GRAHF were genotyped for the GNB3 BP systolic (mm Hg) 127  17 128  16 126  17 0.290
C825T polymorphism. Of the GRAHF cohort, 184 BP diastolic (mm Hg) 77  10 77  10 76  11 0.520
subjects (53%) were homozygous for the T allele, and Heart rate (beats/min) 73  11 73  12 74  11 0.445
166 (47%) had a least 1 copy of the C allele: 137 (39%) ACE inhibitor (%) 76 76 76 0.743

were heterozygous and 29 (8%) were homozygous for
the C allele. Comparison with the GRACE study
demonstrated that the prevalence of the GNB3 T
allele in GRAHF was similar to that seen in the black
cohort from GRACE, but it was significantly greater
than in the white cohort (% TT/CT/CC GRAHF ¼ 53/
39/8; GRACE (black cohort) ¼ 54/27/19; GRACE (white
cohort) ¼ 14/41/45, p < 0.001) (Figure 1).
PATIENT CHARACTERISTICS. The GRAHF popula-
tion was 60% male, 25% ischemic, and 97% New York
Heart Association (NYHA) class III, with a mean age of
57  13 years (Table 1). Most subjects were taking beta
blockers (85%) and ACE inhibitors (75%) at time of
study entry, and more than one third (36%) were
taking aldosterone receptor antagonists. Compari-
sons of baseline characteristics by GNB3 genotype
class revealed no significant differences. Medical
F I G U R E 1 GNB3 Genotype Frequencies in GRAHF (A-HeFT)
and the Black and White Subsets From GRACE
Frequency of the GNB3 T haplotype is significantly greater in
GRAHF (p < 0.001) compared with the white subset from GRACE.
A-HeFT ¼ African American Heart Failure Trial; GNB3 ¼ guanine
nucleotide-binding proteins (G-proteins) beta-3 subunit;
GRACE ¼ Genetic Risk Assessment of Cardiac Events; GRAHF ¼
Genetic Risk Assessment of Heart Failure in African Americans.
Aldosterone receptor antagonist (%) 36 35 37 0.782
Beta blocker (%) 84 85 83 0.569
Values are mean  SD or %.
ACE ¼ angiotensin-converting enzyme; BP ¼ blood pressure; GRAHF ¼ Genetic Risk Assessment of Heart
Failure in African Americans; LVDD ¼ left ventricular diastolic diameter; LVEF ¼ left ventricular ejection fraction;
NYHA ¼ New York Heart Association.
therapy, blood pressure, and NYHA class were all
similar in subjects homozygous with the T allele
compared with subjects with 1 or 2 copies of the C
allele.
COMPOSITE SCORE, GNB3 GENOTYPE, AND IMPACT
OF THERAPY. Although in A-HeFT, treatment with
FDC I/H significantly improved both CS and QoL (5),
in the smaller GRAHF subset, treatment with FDC I/H
was associated with a trend toward improved CS and
QoL that failed to reach significance (CS:
placebo ¼ 0.10  1.8; FDC I/H ¼ 0.23  1.6, p ¼ 0.07;
and for QoL: placebo ¼ 0.19  1.5; FDC I/H ¼ 0.49 
1.4, p ¼ 0.07). When analyzed by GNB3 genotype, FDC
I/H improved the CS among TT homozygotes
(placebo ¼ 0.11  1.8; FDC I/H ¼ 0.50  1.6, p ¼ 0.02)
(Figure 2), but it had no impact among subjects with
the C allele (placebo ¼ 0.09  1.7; FDC I/H¼ 0.05 
1.7, p ¼ 0.87). Improvement for QoL score with FDC
I/H was also evident for GNB3 TT subjects (QoL
component for GNB3 TT subset: placebo ¼ 0.24  1.5;
FDC I/H ¼ 0.69  1.4, p ¼ 0.04) (Figure 3) but not
among those with the C allele (placebo ¼ 0.14  1.5;
FDC I/H ¼ 0.28  1.5, p ¼ 0.56).
EVENT-FREE SURVIVAL. Over the course of follow-
up, there were 61 (17.3%) hospital stays for heart
failure and 12 deaths (3.4%). When evaluating the
combined endpoint of death or hospital stays for
heart failure, the percentages of event-free survival at
6, 12, and 18 months were 91%, 81%, and 73%,
respectively. Overall in GRAHF, treatment with FDC
I/H did not improve event-free survival (FDC I/H
event-free survival at 6, 12 and 18 months ¼ 91%,
83%, 76%; placebo ¼ 90%, 78%, 69%, p ¼ 0.41)
(Figure 4A). However, when evaluated in the GNB3 TT
554 McNamara et al. JACC: HEART FAILURE VOL. 2, NO. 6, 2014

GNB3 Polymorphism and ISDN-HYD in Heart Failure DECEMBER 2014:551–7

poorer event-free survival was evident with the

GNB3 TT genotype for subjects receiving placebo
(p ¼ 0.048) (Figure 5A); this impact was not apparent
in subjects treated with FDC I/H (p ¼ 0.35) (Figure 5B).

F I G U R E 2 Composite Score in GRAHF by Treatment With

FDC I/H Versus Placebo overall and in GNB3 Genotype
Subsets GNB3 C (CTþCC) and GNB3 TT

Treatment is associated with a significantly higher composite

score in GNB3 TT subjects (p ¼ 0.02). FDC I/H ¼ fixed-dose
combination of isosorbide dinitrate and hydralazine; other
abbreviations as in Figure 1.

subset (n ¼ 184), a significant impact of treatment was

evident (FDC I/H event-free survival at 6, 12, and
18 months ¼ 92%, 86%, 79%; placebo ¼ 89%, 74%,
61%, p ¼ 0.047) (Figure 4B) that was not apparent for
subjects with the C allele (FDC I/H event-free survival
at 6, 12 and 18 months ¼ 90%, 80%, 73%; placebo ¼
92%, 82%, 78%, p ¼ 0.35) (Figure 4C). When evalu-
ating the impact of genotype by treatment subset,

F I G U R E 3 Improvement in QoL in GRAHF at 6 Months by F I G U R E 4 Event-Free Survival by Treatment

Treatment With FDC I/H Versus Placebo Overall and in
GNB3 Genotype Subsets GNB3 C (CTþCC) and GNB3 TT
Treatment is associated with a significantly greater improvement
in quality of life (QoL) score in GNB3 TT subjects (p ¼ 0.04). FDC
I/H ¼ fixed-dose combination of isosorbide dinitrate and
hydralazine; other abbreviations as in Figure 1.
With FDC I/H Versus Placebo
(A) Overall GRAHF cohort (n ¼ 350, p ¼ 0.41). (B) GNB3
TT subjects (n ¼ 184, p ¼ 0.047); (C) GNB3 CTþCC subjects
(N ¼ 166, p ¼ 0.35) Impact of therapy is evident only in the GNB3
TT subset. FDC I/H ¼ fixed-dose combination of isosorbide
dinitrate and hydralazine; other abbreviations as in Figure 1.
JACC: HEART FAILURE VOL. 2, NO. 6, 2014 McNamara et al. 555
DECEMBER 2014:551–7 GNB3 Polymorphism and ISDN-HYD in Heart Failure

genotype and the impact of treatment with FDC I/H

on remodeling was apparent (Table 2).

DISCUSSION

In GRAHF, subjects with the GNB3 TT genotype

F I G U R E 5 Event-Free Survival by GNB3 Genotype
GNB3 (guanine nucleotide-binding proteins [G proteins], beta
3 subunit) TT subset versus subjects with GNB3 C (CTþCC). (A)
Subjects receiving placebo (n ¼ 186, p ¼ 0.047). (B) Subjects
receiving a fixed-dose combination of isosorbide dinitrate and
hydralazine (FDC I/H) (n ¼ 164, p ¼ 0.38).
received therapeutic benefit from FDC I/H, as
demonstrated by an improved event-free survival
and QoL and a higher CS. In contrast, no therapeutic
impact was evident in subjects with 1 or 2 copies of
the C allele. The prevalence of the T allele differs
markedly by race; more than 50% of black cohorts
have the homozygous GNB3 TT genotype associated
with enhanced benefit of FDC I/H, compared with less
than 15% of whites. These findings suggest that racial
differences in the prevalence of the GNB3 T allele may
underlie the apparent racial differences in the impact
of therapy.
The GNB3 C825T polymorphism is a functionally
silent single nucleotide polymorphism (SNP) in exon
10 that does not change the amino acid sequence (14).
Common SNPs are also evident in the GNB3 promoter
region (G-350A), intron 9 (A3882C and G5249A), the 3 0
untranslated region (C1429T), in addition to an
insertion/deletion polymorphism of 4 base pairs
(6496 CACA) in intron 10. These polymorphisms are in
near complete linkage disequilibrium with the 350A,
3882C, 5249A, 1429T and 6496 CACA insertion alleles
co-inherited with the 825T allele as the “T haplotype”
(15). This haplotype is strongly associated with a
splicing variant of GNB3, GNB3s, which is evident only
in cell lines with the 825T allele (7). When compared
with the wild-type protein, GNB3s is missing 41 amino
acids, a complete repeated loop domain, but it re-
mains functionally active. Enhanced activation of G

T A B L E 2 Core Lab Assessment LVEF and LVDD at Baseline

LEFT VENTRICULAR REMODELING, TREATMENT
and 6 Months by GNB3 Genotype Overall and by Treatment
AND GNB3 GENOTYPE. Overall in A-HeFT, treatment (FDC I/H or Placebo)
with FDC I/H was associated with significant reverse
All TT TCþCC p Value
remodeling, as assessed by the change in LVEF by
LVEF baseline all (%) 35  8 36  8 34  9 0.052
echocardiography at 6 months (13). In the GRAHF
LVEF baseline placebo 35  9 36  8 34  9 0.165
substudy, improvements in LVEF at 6 months were LVEF baseline FDC I/H 35  8 36  8 34  9 0.180
not significantly different by treatment group (LVEF LVDD baseline all (cm) 6.4  1.2 6.3  1.3 6.5  1.2 0.134
at 6 months: placebo ¼ 0.36  0.10; FDC I/H ¼ 0.38  LVDD baseline placebo 6.4  1.2 6.4  1.2 6.5  1.2 0.523
0.09, p ¼ 0.16; change from baseline at 6 months: LVDD baseline FDC I/H 6.4  1.3 6.2  1.3 6.6  1.2 0.141

placebo ¼ 0.02  0.09; FDC I/H ¼ 0.03  0.08, LVEF 6 months all (%) 37  9 37  10 37  9 0.644
LVEF 6 months placebo 36  10 37  11 35  9 0.160
p ¼ 0.18). No clear interaction of GNB3 genotype
LVEF 6 months FDC I/H 38  9 37  9 39  10 0.337
with remodeling was evident. For subjects with the
LVDD 6 months all (cm) 6.2  1.3 6.0  1.4 6.3  1.3 0.105
GNB3 TT genotype the mean LVEF was slightly
LVDD 6 months placebo 6.2  1.3 6.0  1.3 6.4  1.2 0.072
higher at baseline (LVEF GNB3 TT: 0.36  0.08 LVDD 6 months FDC I/H 6.2  1.4 6.1  1.4 6.2  1.4 0.608
versus C allele: 0.34  0.09, p ¼ 0.052); however,
this difference at baseline was not evident at Values are mean  SD.
FDC I/H ¼ fixed-dose combination of isosorbide dinitrate and hydralazine;
6 months (GNB3 TT: LVEF ¼ 0.37  0.10; C allele: ¼ LVDD ¼ left ventricular diastolic diameter; LVEF ¼ left ventricular ejection fraction.
0.37  0.09, p ¼ 0.64). No clear interaction of GNB3
556 McNamara et al.
GNB3 Polymorphism and ISDN-HYD in Heart Failure
proteins is evident in immortalized cell lines from
hypertensive compared with normotensive subjects
(16), and in these same cell lines it is tightly linked to
the presence of the 825T allele and GNB3s (7).
The role of the GNB3 polymorphism in the risk of
hypertension has been studied extensively (17–19),
and pharmacogenetic investigations have suggested
increased alpha2-adrenergic activation with the T
allele as a potential mechanism. In subjects with hy-
pertension, the GNB3 T allele has been associated with
an increased response to clonidine, a centrally acting
alpha2-adrenergic receptor antagonist (20). In inves-
tigation of coronary vasomotor response, subjects
with the T allele also demonstrate enhanced vaso-
constriction (8,21), and this enhanced impact can be
eliminated by selective blockade of the alpha 2 , but not
the alpha1 , adrenergic receptor (22). Although in-
vestigations of the role of GNB3 in cardiovascular dis-
ease have focused on vascular reactivity, duplication
of the GNB3 locus has been implicated as a cause of
obesity both in murine models and in human syn-
dromes of chromosomal translocation (23). In contrast,
genome-wide association studies (GWAS) evaluating
the genomic basis of obesity (24) and hypertension (25)
have not identified GNB3 as a disease-associated locus.
Pharmacogenetic investigations suggest that the
GNB3 C825T polymorphism influences therapeutics
directed at the nitric oxide (NO) pathway. The en-
hanced vasoconstriction in subjects with the GNB3 T
allele can be eliminated by pretreatment with the NO
synthase (NOS) inhibitor L-NMMA (26). Carriers of the
T allele also have an enhanced vasodilator response to
nitroglycerin (27), as well as an enhanced therapeutic
response to the phosphodiesterase type 5 inhibitor
(PDE5) sildenafil in subjects with erectile dysfunction
(28) and in those with pulmonary arterial hypertension
(29). Insulin-induced venodilation, a response medi-
ated by the NO pathway, is diminished in healthy car-
riers of the GNB3 T allele (30). Together with GRAHF,
these studies suggest that the GNB3 TT genotype may
identify subjects who would obtain maximal benefit
from therapeutic strategies that enhance NO.
Recent reports from 2 separate longitudinal popu-
lation studies suggest a higher risk of cardiovascular
or cerebrovascular events in subjects with the GNB3
TT genotype. In the Fungata study of a rural Japanese
cohort of 1,524 subjects, those with the GNB3 TT
genotype had a higher incidence of cardiovascular
disease (hazard ratio [HR]: 1.82, 95% confidence in-
terval [CI]: 1.14 to 2.89) and stroke (HR: 1.76, 95% CI:
1.01 to 3.07) despite no differences in blood pressure
or hypertension (31). In the Italian LEOGRA study,
Last Evidence of Genetic Risk in the Aged, a cohort of
subjects from 2 small towns was followed for 10 years.
JACC: HEART FAILURE VOL. 2, NO. 6, 2014
DECEMBER 2014:551–7
Subjects with the GNB3 TT genotype had a signifi-
cantly higher risk of cerebral vascular events (HR:
2.22, 95% CI: 1.31 to 3.79) which remained significant
when adjusting for blood pressure and other cardio-
vascular risk factors (32).
In a small Brazilian cohort with systolic heart fail-
ure, the GNB3 825T and the Arg389 b1 alleles were
associated with increased cardioverter-defibrillator
therapies (33). In these previous studies, the GNB3
TT genotype subset represented only 10% to 20% of
the entire cohort, whereas in the GRAHF study in
African Americans, this high-risk genotype was pre-
sent in more than 50% of subjects. Consistent with
these previous reports, GRAHF subjects with the GNB3
TT genotype who received standard heart failure
therapy plus placebo demonstrated the lowest CS and
poorest event-free survival. Importantly, treatment
with FDC I/H appeared to eliminate this genetic risk.
STUDY LIMITATIONS. The current study is limited by
study number, which diminishes the power to
address pharmacogenetic interactions. In particular,
the small number of subjects homozygous for the C
allele limits the ability to evaluate the impact of gene
dose on the outcomes observed. In addition, although
the T allele has been previously linked to low plasma
renin, renin and neurohormones were not measured
as part of the GRAHF analysis. Finally, whereas the
current analysis is focused on GNB3, the influence of
genomics on the effectiveness of heart failure therapy
is almost certainly polygenic. Previous analysis in
GRAHF suggests that genetic heterogeneity of NOS3
(34) influences the benefit of FDC I/H, and variation of
the aldosterone synthase promoter affects event-free
survival (35); however, the limited study number in
GRAHF prevents analysis of gene-gene interactions.
An individual’s response to pharmacological inter-
vention almost certainly involves multiple genomic
loci, and as a result many previous attempts to
replicate other pharmacogenetic reports of single SNP
interactions have not succeeded.
CONCLUSIONS
A-HeFT demonstrated that treatment with FDC I/H
improved survival for a cohort of self-designated Af-
rican Americans with heart failure, and it remains a
pivotal study that for the first time resulted in the
approval by the Food and Drug Administration of a
heart failure therapy in a specific racial or ethnic
group (36,37). The ability of race to predict the ther-
apeutic impact of I/H likely reflects its role as a
marker of functional genomic differences. Pharma-
cogenomic analysis should be more effective than
race in predicting efficacy and targeting heart failure
JACC: HEART FAILURE VOL. 2, NO. 6, 2014
DECEMBER 2014:551–7
therapeutics. Although the current investigation
suggests that the GNB3 genotype predicts the thera-
peutic impact of FDC I/H for an individual, these
findings should be considered hypothesis generating
and will require prospective validation. Further
investigation is warranted to explore its potential
utility for targeting heart failure therapeutics.
REFERENCES
1. Cohn JN, Archibald DG, Ziesche S, et al. Effect of
vasodilator therapy on mortality in chronic
congestive heart failure: results of a Veterans
Administration Cooperative Study. N Engl J Med
1986;314:1547–52.
2. Cohn JN, Johnson G, Ziesche S, et al.
A comparison of enalapril with hydralazine-
isosorbide dinitrate in the treatment of chronic
congestive heart failure. N Engl J Med 1991;325:
303–10.
3. Carson P, Ziesche S, Johnson G, Cohn JN. Racial
differences in response to therapy for heart fail-
ure: analysis of the vasodilator-heart failure trials:
Vasodilator-Heart Failure Trial Study Group. J Card
Fail 1999;5:178–87.
4. Taylor AL. The African-American Heart Failure
Trial (A-HeFT): rationale and methodology. J Card
Fail 2003;9 Suppl Nitric Oxide:S216–9.
5. Taylor AL, Ziesche S, Yancy C, et al. Combina-
tion of isosorbide dinitrate and hydralazine in
blacks with heart failure. N Engl J Med 2004;351:
2049–57.
6. Meirhaeghe A, Bauters C, Helbecque N, et al.
The human G-protein beta3 subunit C825T poly-
morphism is associated with coronary artery
vasoconstriction. Eur Heart J 2001;22:845–8.
7. Siffert W, Rosskopf D, Siffert G, et al. Associa-
tion of a human G-protein b3 subunit variant with
hypertension. Nat Genet 1998;18:45–8.
8. Siffert W. G-protein b3 subunit 825T allele and
hypertension. Curr Hypertens Rep 2003;5:47–53.
9. Schunkert H, Hense HW, Doring A, et al. Asso-
ciation between a polymorphism in the G-protein
b3 subunit gene and lower renin and elevated
diastolic blood pressure levels. Hypertension
1998;32:510–3.
10. Siffert W, Forster P, Jockel KH, et al. World-
wide ethnic distribution of the G-protein b3 sub-
unit 825T allele and its association with obesity in
Caucasian, Chinese and black African individuals.
J Am Soc Nephrol 1999;10:1921–30.
11. McNamara DM, Holubkov R, Janosko K, et al.
Pharmacogenetic interactions between b-blocker
therapy and the angiotensin converting enzyme
deletion polymorphism in patients with congestive
heart failure. Circulation 2001;103:1644–8.
12. McNamara DM, Holubkov R, Postava L, et al.
Effect of the Asp298 variant of endothelial nitric
oxide synthase on survival for patients with
congestive heart failure. Circulation 2003;107:
1598–602.
13. Cohn JN, Tam SW, Anand IS, et al. Isosorbide
dinitrate and hydralazine in a fixed-dose
REPRINT REQUESTS AND CORRESPONDENCE: Dr.
Dennis M. McNamara, Center for Heart Failure Research,
Heart, Lung, Blood and Vascular Medicine Institute,
University of Pittsburgh Medical Center, 566 Scaife Hall,
200 Lothrop Street, Pittsburgh, Pennsylvania 15213.
E-mail: mcnamaradm@upmc.edu.
combination produces further regression of left
ventricular remodeling in a well-treated black
population with heart failure: results from A-HeFT.
J Card Fail 2007;13:331–9.
14. Rosskopf D, Busch S, Manthey I, Siffert W. G-
protein gene: structure, promoter and additional
polymorphisms. Hypertension 2000;36:33–41.
15. Rosskopf D, Manthey, Siffert W. Identification
and ethnic distribution of major haplotypes in the
gene GNB3 encoding the G-protein b3 subunit.
Pharmacogenetics 2002;12:209–20.
16. Siffert W, Rosskopf D, Moritz A, et al.
Enhanced G protein activation in immortalized
lymphoblasts from patients with essential hyper-
tension. J Clin Invest 1995;96:759–66.
17. Siffert W. G protein b3 subunit 825T allele,
hypertension, obesity, and diabetic nephropathy.
Nephrol Dial Transplant 2000;15:1298–306.
18. Poch E, Gonzalez D, Gomez-Angelats E, et al.
G-protein b3 subunit gene variant and left ven-
tricular hypertrophy in essential hypertension.
Hypertension 2000;35:214–8.
19. Young JH, Chang YP, Kim JD, et al. Differential
susceptibility to hypertension is due to selection
during the out-of-Africa expansion. PLoS Genet
2005;1:e82.
20. Nurnberger J, Dammer S, Mitchell A, et al.
Effect of the C825T polymorphism of the G pro-
tein b3 subunit on the systolic blood pressure-
lowering effect of clonidine in young, healthy
male subjects. Clin Pharmacol Ther 2003;74:
53–60.
21. Naber C, Baumgart D, Heusch G, et al. Role of
eNOS Glu289Asp variant on the GNB3825T allele
dependent determination of a-adrenergic coro-
nary constriction. Pharmacogenetics 2003;13:
279–84.
22. Baumgart D, Naber C, Haude M, et al. G protein
beta3 subunit 825T allele and enhanced coronary
vasoconstriction on alpha(2)-adrenoceptor activa-
tion. Circ Res 1999;85:965–9.
23. Goldlust IS, Hermetz KE, Catalano LM, et al.
Mouse model implicates GNB3 duplication in a
childhood obesity syndrome. Proc Natl Acad Sci
U S A 2013;110:14990–4.
24. Xia Q, Grant SF. The genetics of human
obesity. Ann N Y Acad Sci 2013;1281:178–90.
25. Levy D, Ehret GB, Rice K, et al. Genome-wide
association study of blood pressure and hyper-
tension. Nat Genet 2009;41:677–87.
26. Wenzel R, Siffert W, Bruck H, et al. Enhanced
vasoconstriction to endothelin-1, angiotensin II
and noradrenaline in carriers of the GNB3 825T
McNamara et al. 557
GNB3 Polymorphism and ISDN-HYD in Heart Failure
allele in the skin microcirculation. Pharmacoge-
netics 2002;12:489–95.
27. Mitchell A, Bührmann S, Seifert A, et al.
Venous response to nitroglycerin is enhanced in
young, healthy carriers of the 825T allele of the G
protein beta3 subunit gene (GNB3). Clin Pharma-
col Ther 2003;74:499–504.
28. Sperling H, Eisenhardt A, Virchow S, et al.
Sildenafil response is influenced by the G protein
beta 3 subunit GNB3 C825T polymorphism: a pilot
study. J Urol 2003;169:1048–51.
29. Sekine A, Tanabe N, Sugiura T, et al. Poly-
morphism of the G protein b3 subunit gene
influences the efficacy of sildenafil in patients with
pulmonary hypertension. Intern Med 2014;53:291–7.
30. Mitchell A, Pace M, Nürnberger J, et al.
Insulin-mediated venodilation is impaired in
young, healthy carriers of the 825T allele of
the G-protein beta3 subunit gene (GNB3). Clin
Pharmacol Ther 2005;77:495–502.
31. Daimon M, Sato H, Kaino W, et al. Association
of the G-protein b3 subunit gene polymorphism
with the incidence of cardiovascular disease in-
dependent of hypertension: the Funagata study.
J Hum Hypertens 2013;27:612–6.
32. Casiglia E, Tikhonoff V, Boschetti G, et al. The
C825T GNB3 polymorphism, independent of blood
pressure, predicts cerebrovascular risk at a popu-
lation level. Am J Hypertens 2012;25:451–7.
33. Chemello D, Rohde LE, Santos KG, et al.
Genetic polymorphisms of the adrenergic system
and implantable cardioverter-defibrillator thera-
pies in patients with heart failure. Europace 2010;
12:686–91.
34. McNamara DM, Tam SW, Sabolinski ML, et al.
Endothelial nitric oxide synthase (NOS3) poly-
morphisms in African Americans with heart failure:
results from the A-HeFT trial. J Card Fail 2009;15:
191–8.
35. McNamara DM, Tam SW, Sabolinski ML, et al.
Aldosterone synthase promoter polymorphism
predicts outcome in African Americans with heart
failure: results from the A-HeFT Trial. J Am Coll
Cardiol 2006;48:1277–82.
36. Bloche MG. Race-based therapeutics. N Engl J
Med 2004;351:2035–7.
37. Cole RT, Kalogeropoulos AP, Georgiopoulou VV,
et al. Hydralazine and isosorbide dinitrate in
heart failure: historical perspective, mechanisms,
and future directions. Circulation 2011;123:2414–22.
KEY WORDS heart failure, outcomes,
pharmacogenetics, race