1

Name: Kent Harold A. Genon Date Submitted: November 28, 2023

Section: B5B12 Score:

LABORATORY EXERCISE 8:
VIRTUAL DNA EXTRACTION and POLYMERASE CHAIN
REACTION WORK SHEET

A. Questions about Virtual DNA extraction:

Your answers should be brief and concise and must not exceed the lines provided.

1. What are the reasons for studying or analyzing human DNA? (3 pts)
- It provides us with valuable insights like body identification, forensic investigation and
also in medicine. It allows us to understand the genetic basis of diseases and so on.
2. In the virtual lab, what was the sample used for extracting DNA? (1 pt)
- The sample used for extracting DNA was Human cheek cells.
3. What are the general steps in extracting DNA from #3? (1 pt each)
- First, collect cheek cells. Second is burst cell open to release the DNA. Third, separates the
DNA from protein and lastly, Isolate concentrated DNA.
4. Give the purpose/function of the following materials in DNA extraction: (1 pt each)
a. warm water bath
- Maintain temperature during DNA extraction and unzip the double helix of DNA
b. centrifuge
- It separate or Isolate DNA from other cellular components, such as proteins and cell debris.
c. buccal swab
- Used to collect cells from the inside of the cheek to obtain the sample
d. sample tubes
- Used to hold and store the samples, and also used to centrifuge the samples
e. Micropipettes
- Used to precisely measure and transfer small volumes of liquids between different containers
f. lysis solution
- It is to break open the cells and release the DNA
g. concentrated salt solution
- It is to precipitate the DNA out of solution
h. resuspension buffer
- It is to dissolve the DNA precipitate, preparing it to down stream application
i. Ethanol
- Used to wash away impurities from the DNA
j. isopropyl alcohol
- It causes the DNA to clump together and precipitate, making it easier to collect and purify.
 2

5. What are the 2 important components found in the lysis solution and their corresponding
function? (3 pts)
- Detergent: It disrupts the cell membrane and nuclear envelope, burst cells open to release
DNA. Proteinase K: It cuts apart the histones to free or to remove the DNA

6. Why is it that another sample tube is added opposite to the tube with DNA sample in the
centrifuge? (1 pt)
- In order to balance, because if it is not balance it can cause the rotor to wobble.
7. Compared to the previous exercise in Lab Activity #5, what similarity and difference have
you learned in this part of the virtual lab activity? Cite 2 examples. (2 pts)
- Both activities used alcohol to clump DNA using cheek cells as the sample; however,
Lab Activity #5 used a mouth-swishing sports drink to acquire the cells, whereas the
virtual activity used an abuccal swab. In contrast to Exercise #5, the virtual lab used a
centrifuge for DNA separation.

8. Attach a screenshot photo of the materials and equipment needed for DNA extraction in the
lab using the box below.. (4 pts)
 3

B. Questions about Polymerase Chain Reaction:

1.Match the following terms with their definitions and

A
label each component of the PCR mixture in the
diagram (use the letters A-D): (4 pts)
B DNA polymerase
D D Primers
C Nucleotides
A Genomic DNA template

B
A. DNA that contains the target sequence that will be
replicated using PCR.

B. An enzyme that copies the DNA sequence.

C. A mixture of 4 nucleotides (A, G, C, and T) that will

C be polymerized into the replicated DNA sequence.

D. A short DNA sequence that allows the enzyme to bind

and initiate polymerization.

2. What equipment do you need for PCR? Explain its purpose.

- PCR machine: It is a programmable device where the temperature cycling takes place
Ice bucket: It is used for Storing everything on ice keeps reaction ingredients fresh.
Primers: It will going to be attach to the DNA sequences at either end of a target
A micropipette and tips: It lets you precisely measure and transfer small amounts of liquid.

3. What are some applications for PCR? What’s the natural process PCR is based on?

- The following are some of the applications for PCR, first detect harmful bacteria, identify
viruses, test for inherited diseases, paternity testing, identify a species, detect species in
water, connect people to crime scenes, learn about human by evolutionary history, and so
many others. The natural process that PCR is based on is the DNA replication.

4. After isolating the genomic DNA, why is it necessary to do PCR? (2 pts)

- After genomic DNA has been isolated, PCR is required because genomic DNA is made up
of a lot of DNA from different parts of the genome, much of which is not relevant to the
topic at hand. By using PCR, scientists can amplify a specific section of DNA with greater
selectivity, which facilitates study and analysis.
 4

5. How did Taq polymerase obtain its name and what is special about this enzyme? (3 pts)

- Taq polymerase is a thermostable DNA polymerase, which means that it won't become
denaturized at high temperatures. In result, it becomes a crucial part of the PCR. Thermus
aquaticus, a thermophilic bacteria from which Taq polymerase was originally isolated in
1968, is the source of its name. Thermus aquaticus is merely shortened to "Taq" in name.

6. Circle the section on the DNA template where the example primer would bind. Use a red
circle to mark your answer.
3’ 5’

ATTGCGCTAACGTCAGTCGATGGCTCGGAACTCGTTCGTCGATCTTCCTGCTATTCAT

Primer: CGATT
5’ 3’
7. Attach a screenshot photo of a conventional PCR machine in the box below.

8. Describe the following steps in DNA synthesis reaction: (3 pts each)

a. Denaturation

- The process of denaturation involves splitting the DNA double helix into its two strands.
The DNA is heated to a high temperature—typically approximately 95°C—in order to
do this. Because the enzyme DNA polymerase, which is in charge of creating new DNA,
can only function on a single-stranded template, denaturation is required.
 5

b. Annealing

- The process of hybridizing a primer to the single-stranded DNA template is known as

annealing. A brief segment of DNA known as a primer complements a particular
nucleotide sequence on the template strand. The primer is crucial because it gives the
DNA polymerase enzyme a place to start when it comes to creating new DNA.

c. Extension

- Extension is the process of synthesizing new DNA complementary to the template

strand. The DNA polymerase enzyme reads the template strand one nucleotide at a time
and adds complementary nucleotides to the growing DNA strand.

REFERENCE:

Genetic Science Learning Center. (2018, October 23) All About PCR - Beta. Retrieved
November 26, 2023, from https://learn.genetics.utah.edu/content/labs/pcr/?
fbclid=IwAR3D68sxBqW9z6hpm9L9w47fvj kkgUf8SwnfPH9SoC6onaNSsf4iurXF4BA
Genetic Science Learning Center. (2018, October 23) DNA Extraction. Retrieved November 26,
2023, from https://learn.genetics.utah.edu/content/labs/extraction/?
fbclid=IwAR3Ws87r7py3L5ItnC1BS UFItrsm_vq_q3cZ_lpLYtcPQPtRzyeEwtbCR4U