Final Copy - My Dissertation 10-12-2023

Republic of Iraq
Ministry of Higher Education and Scientific

Research
Mustansiriyah University
College of Science
Purification and molecular identification of catechol

1,2- dioxygenase from phenol-degrading
Pseudomonas spp.
A Dissertation
Submitted to the Council of the College of Science/ Mustansiriyah
University as A Partial Fulfillment of the Requirement for the Degree of Doctorate
of Philosophy (Ph.D) in Biology/Microbiology
Submitted by:
Huda Rasheed Tawfeeq Al-Doori
B.Sc. Biology/College of Education/ University of Samarra/2010
M.Sc. Biology/College of Education/ University of Samarra/2018
Supervised by:
Professor Dr. Professor Dr.
Sawsan Sajid Mohammed Ali Amel Hussaein Mussa
2023 A.D 1445 A.H
August Muharram
‫ســـورة البقـــرة‬
‫االيت ‪23‬‬
Dedication
To the memory of my beloved and noble
souls...... My father and my brother
To the loving woman who brightened my life
with her kindness and endless love... My Mother
To the candles that light the way for me......
My Sisters and Brother
To my precious gift from heaven... My daughter
Rama
I dedicate this humble work
Huda
Acknowledgments
I would like to express my gratitude to "Allah" Lord of the universe and

creation who gave me health and strength to accomplish my Dissertation, and
peace be up on his messenger, Prophet Mohammed.
Sincere thanks and appreciation also go to my supervisors, Professor Dr.
Sawsan Sajid Mohammed Ali and Professor Dr. Amel Hussaein Mussa for
their valuable support, guidance and endless encouragement and cooperation
to finish this work.
It is a pleasure to dedicate my genuine thanks to Professor Dr. Khetam

Habeeb Rassol, the Head of Biology Department, College of Science,
Mustansiriyah University and to Professor Dr. Mohammed Faraj Shather, the
Dean of College of Science, University of Mustansiriyah for their kindness and
valuable help throughout my study.
Special thanks and appreciation represented to Professor Dr. Essam

Fadhil Alwan, a Professor in the Genetic Engineering and Biotechnology
Institute for Posgraduate Studies, Baghdad University, for helping me finishing
my enzyme extraction steps perfectly.
My profound respect and gratitude represented to the Directorate of

Environmental and Water Research and Technology, Ministry of Science and
Technology for helping me with my work, especially to the Senior Chief
Biologist Dr. Sahar Ghazi Imran.
Sincere thanks and appreciation to assistant professor Israa M. S. Al-

kadmy in Biology Department, College of Science, University of Mustansiriyah
for helping me in the publication of my paper.
Many thanks represented to my friend Eman Abbas Mohsin and all my
colleagues in the department of Biology for their advice, friendly support and
encouragement. Finally, I owe much to my family for their care, patience and
support during the years of my study.
Huda Rasheed
Summary
Summary
Bioremediation is a technology for removing pollutants from the

environment thus, restoring the original natural surroundings and preventing
further pollution with the aid of microorganisms or their products. Many
bacteria belonging to different genera are well-known for their high abilities
to catabolize phenolic compounds, including, Pseudomonas,
Mycobacterium, Proteobacteria, Actinobacteria, Methylobacillus,
Nocardioides, Achromobacter, Caulobacter, Sphingomonas, and
Sphingobium. The present study aims to isolate and identify the phenol-
degrading Pseudomonas spp. isolates collected from different contaminated
sites at Baghdad city, as well as detecting the dioxygenases responsible for
phenol degradation ability in bacteria to further use them in bioremediation
experiments.
A total of 125 soil samples, were collected from different soils at
Baghdad city. The samples were distributed as 83/125 (66.4%) samples that
were collected from random locations at the Al-Daura refinery and 42/125
(33.6%) samples from private electricity generators of six municipalities
from a depth of (3-10 cm) under the soil surface from the beginning of April
2021 till the end of August 2021.
The microorganisms in soil samples were isolated according to serial
dilution plate technique using mineral salt medium with phenol (as carbon
and energy source). Approximately, 89 different isolates capable of growing
on phenol were obtained, distributed as: 62/89 (69.6%) isolates from the Al-
Daura refinery and 27/89 (30.3%) isolates from the private electricity
generators. In order to isolate Pseudomonas spp. isolates, all 89 phenol-
I
Summary
degrading isolates were cultured on the selective Pseudomonas agar medium
and other differential media. From the total number of isolates, 40/89
(44.9%) of bacterial isolates were obtained, distributed as: 35 (87.5%)
isolates from the Al-Daura refinery and 5 (12.5%) isolates from the private
generators.
The bacterial isolates were identified according to cultural,
morphological, and physiological properties, in addition to the VITEK
system and the molecular methods using 16S rDNA gene. All forty isolates
were identified as members of the genus Pseudomonas. Thirty (75%)
isolates were identified as Pseudomonas aeruginosa and 10 (25%) isolates
were identified as Pseudomonas putida.
Genotypic detection and sequence analysis using Geneious software
for three different catabolic genes were performed. The amplified genes
were; catechol 1, 2-dioxygenase (cat1), catechol 2, 3-dioxygenase (cat2),
and catechol dioxygenase ABC (catABC). Cat1 gene was expressed in all
Pseudomonas spp. isolates (100%), while cat2 gene was found only in 9
(22.5%) isolates, and catABC gene was detected in 11 (27.5%) isolates.
Only six isolates of the total were positive for the three genes of catechol
dioxygenases, so they were used in the next step to check their
biodegradation behavior on phenolic compounds.
Determining the optimum physiological parameters for phenol
biodegradation enhancement showed that the optimum temperature was
30°C and pH was 7 with the addition of phenol as the only source of carbon
and energy using the mineral salt medium. The previous six isolates (P8,
P15, P17, P22, P24, and P33) were subjected to multiple concentrations of
phenol (250, 500, 750, and 1000 ppm) to test their degradation abilities. The
II
Summary
results showed that all the six different Pseudomonas spp. isolates were
resistant to phenol concentrations as high as 1000 ppm, and the isolate P.
putida 15 which was isolated from the Al-Daura refinery was the most
powerful isolate among others. This isolate was able to degrade 78.3% of
1000 ppm of the initial concentration of phenol within five days (120 hours)
of the experiment, while P. aeruginosa 33 had the lowest rate (64.5%)
among the other isolates for degrading phenol at 1000 ppm within six days
(144 hours) of the experiment. Additionally, the isolates 22 and 24 of P.
putida had no ability to degrade phenol at 1000 ppm of initial concentration
of phenol, but they were tolerant to this concentration and continue to grow
till the end of the experiment period.
Using DEAE-cellulose and Sephacryl S-1000 column
chromatography, catechol 1, 2-dioxygenase enzyme was purified with a
yield of 36.12% and a specific activity reaches 38.25 U/mg. Also, the
enzyme was characterized in comparison with four standard proteins and the
molecular weight was 69 kDa. The optimum conditions for enzyme stability
for 30 minutes were 35°C and 6 for temperature and pH, respectively.
The storage stability step was performed also at 4 °C for 30 days. The
stability of catechol 1, 2-dioxygenase was determined by estimating the
specific activity of the soluble enzyme for 28 days. The specific activity of
the purified enzyme was 38.12 U/mg (100%) at zero time of incubation.
Then, it had been decreased to reach 24.03 U/mg (63.03%) at day 7 of
incubation, and to 11.72 U/mg (34.70%) at day 14 of incubation. After 21
days of incubation, the enzyme-specific activity becomes 3.23 U/mg
(8.47%). On day 28, the enzyme was inactive. This means that the enzyme
remains active for 21st day of the incubation period.
III
Summary
Determination of phenolic compounds biodegradation in microcosms
(experimental ecosystem) performing biostimulation (the stimulation of a
microorganisms to degrade chemical contaminants during its cell growth)
and bioaugmentation (the process of increasing the amount of
microorganisms that can remove contaminants from soil or water) studies
which were performed using the free bacterial cells of the local isolate of P.
putida 15. The results of the microcosm experiment were analyzed using gas
chromatography technique which showed that the biodegradative activity of
the free cells increases with time, while after 40 days of incubation, there
was no trace for phenol and its metabolites. Also, the phenol degradation
rate was 97.4% at day 40 of the experiment, while the bacterial growth rate
was (23×105) at the 10th day of the experiment and reaches its highest level
(27×105) after 20 days of the experiment. These results indicate that P.
putida 15 can be used successfully in the biodegradation of phenolic
compounds in different contaminated sites.
IV
List of Contents
Page
Subject
No.
Summary I
List of Contents V
List of Tables XII
List of Figures XIV
List of Abbreviations XIX
Chapter One: Introduction and Literatures Review
Introduction 1
Literature Review 5
1.1 Many Emerging Challenges to the environment 5
1.2 Xenobiotic Compounds 6
1.2.1 Diseases Caused by Xenobiotics 7
1.3 Hydrocarbons 8
1.4 Phenol 9
1.4.1 Uses of Phenol 10
1.4.2 Toxicity of Phenol 11
1.5 The Genus Pseudomonas 12
1.6 Bioremediation 13
1.6.1 Different Types of Bioremediation Methods 15
1.6.1.1 Biostimulation 15
1.6.1.2 Bioaugmentaion 16
1.6.1.3 Natural attenuation 17
1.6.2 Factors Affecting Bioremediation 19
1.6.3 Advantages and Disadvantages of Bioremediation 20
1.6.4 Bioremediation of phenol 21
1.6.5 Mechanisms of Biodegradation of Phenol 24
1.6.5.1 Aerobic Biodegradation 24
V
1.6.5.2 Anaerobic Biodegradation 26
Enzymes Responsible for The Biodegradation of
1.7 28
Phenol
1.7.1 Oxygenases 29
1.7.1.1 Monoxygenases 29
1.7.1.2 Dioxygenases 29
1.7.1.2.1 Nonheme Iron containing Dioxygenases 30
1.7.2 Phenol Hydroxylases 35
Genetic Factors Controlling Phenol Degradation
1.8 36
Ability
Molecular Approach for Identification of Catechol
1.9 Dioxygenases Responsible for Phenol 37

Biodegradation
Biostimulation and Bioaugmentation Experiments
1.10 39
Using pseudomonas spp.
Chapter Two: Materials and Methods

Materials and Methods 42
2.1 Materials 42
2.1.1 Equipment and Apparatus 42
2.1.2 Chemicals and Solutions 43
2.1.3 Kits 44
2.1.4 Culture Media 45
2.1.5 Other materials used in molecular study 45
2.1.6 Primers 46
2.2 Methods 47
Preparation and Sterilization of Reagents and
2.2.1 47
Solutions
2.2.1.1 Reagents 47
VI
Catalase reagent 47
Oxidase reagent 47
2.2.1.2 Solutions 47
Phenol Stock Solution 47
Solutions for 4-Aminoantipyrine Method of Phenol
48
Determination
Solutions Used for Enzyme Purification and
49
Characterization
Solutions Used for protein assay 50
Solutions for gel electrophoresis 51
2.2.2 Preparation of culture media 51
2.2.2.1 Ready to use media 51
2.2.2.2 Laboratory prepared media 52
Mineral Salt Medium 52
Pseudomonas Agar Base with C.F.C (Cephalothin,
52
Fucidin, Cetrimide) Supplement
2.3 Collection of Soil Samples from Different Locations 53

Enumeration of Bacteria Using Serial Dilution Plate
2.4 53
Technique
Isolation of Phenol Degrading Bacteria by
2.5 54
Enrichment Method
Isolation of Pseudomonas spp. Isolates from The
2.6 55
Total Number of Phenol-Degrading Isolates
2.7 Identification of Pseudomonas spp. Isolates 56

2.7.1 Morphological Examination 56
2.7.2 Biochemical Characteristics 56
2.7.2.1 Oxidase test 56
2.7.2.2 Catalase test 56
VII
2.7.2.3 Growth ability at 42ºC and 4ºC 57
Detection of Bacteria Using VITEK2-Compact
2.7.3 57
2.7.4 Molecular Diagnosis of Bacteria 58

2.7.4.1 Extraction of genomic DNA 58
2.7.4.2 DNA concentration and purity 60
2.7.4.3 PCR Amplification 60
2.8 Preservation of Pseudomonas sp. positive isolates 61
2.8.1 Short term preservation 61
2.8.2 Long term preservation 62
Growth and Phenol Degradation Behavior of
2.9 62
Pseudomonas spp. Isolates
Determination of phenol residual and biomass in
2.9.1 63
medium
2.10 Genotypic Detection of Catechol Dioxygenases 65

2.10.1 Primers Stock Solutions Preparation 65
2.10.2 Gradient PCR Amplification Method 65
2.10.3 Agarose Gel Electrophoresis 66
2.10.4 PCR Product Sequensing 67
Optimization of physicochemical parameters to
2.11 68
enhance phenol degradation
Optimum Conditions for Catechol 1,2-Dioxygenase
2.12 68
Production
Optimum Temperature for Catechol 1,2-
2.12.1 69
Dioxygenase Activity
2.12.2 Optimum pH for Catechol 1,2-Dioxygenase Activity 69

2.13 Extraction of Catechol 1,2-Dioxygenase Enzyme 69
2.13.1 Activity Assay of Catechol 1,2-Dioxygenase 69
VIII
2.13.2 Determination of protein concentration 70
Purification of Catechol 1,2-Dioxygenase by
2.14 71
Chromatography Method
2.14.1 Preparation of cell crude extract 71

2.14.2 Precipitation of enzyme by ammonium sulfate 72
2.14.3 Dialysis 72
2.14.4 Purification by ion exchange chromatography 72
2.14.5 Purification by gel filtration chromatography 73
2.15 Characterization of Catechol 1,2-Dioxygenase 74
2.15.1 Molecular weight determination 74
2.15.1.1 Determination of the void volume of the column 74
2.15.1.2 Determining the elution volume for typical proteins 74
2.15.2 75
Dioxygenase Activity
2.15.3 75
Dioxygenase Stability
2.15.4 Optimum pH for Catechol 1,2-Dioxygenase Activity 75

2.15.5 Optimum pH for Catechol 1,2-Dioxygenase Stability 76
Storage Stability of Catechol 1,2-Dioxygenase
2.15.6 76
Activity
Microcosmic Study for Phenol Degradation Using
2.16 76
Phenol-Degrading P. putida Local Isolate
2.17 Statistical analysis 78

Chapter Three: Results and Discussion
Results and Discussion 79
3.1 Isolation of Phenol-degrading bacteria 79

Phenotypic identification of phenol-degrading
3.2 isolates 80
IX
Cultural, morphological examination and
3.2.1 biochemical tests 80
Identification of Pseudomonas spp. isolates using

3.2.2 82
VITEK system
Genotypic identification of Pseudomonas spp.
3.2.3 82
isolates
Genotypic detection of the phe operon genes
3.3 (catechol dioxygenases) in Pseudomonas spp. 86

isolates
3.3.1 Catechol 1,2 dioxygenase (cat1) gene 86

Catechol 2, 3-dioxygenase (cat2) gene
3.3.2 89
Catechol dioxygenase (catABC) genes 91

3.3.3
Growth and phenol degradation behavior of
3.4 95
Pseudomonas spp. local isolates
Optimization of physiological parameters of
3.5 Pseudomonas spp. isolates for phenol 108

biodegradation enhancement
Optimum temperature for phenol biodegradation
3.5.1 108
enhancement
Optimum pH for phenol biodegradation
3.5.2 109
enhancement
Optimum phenol concentration for phenol
3.5.3 109
biodegradation enhancement
Screening of optimum conditions for catechol 1,2-
3.6 110
dioxygenase production by P. putida
Screening of the optimum temperature for enzyme
3.6.1 111
production
3.6.2 Screening of the optimum pH for enzyme 112
X
production
Purification of catechol 1,2-dioxygenase enzyme by
3.7 chromatography method 113
Ammonium sulfate precipitation

3.7.1 113
Ion exchange chromatography
3.7.2 114
Gel Filtration Chromatography
3.7.3 115
Characterization of catechol 1, 2-dioxygenase
3.8 enzyme 117
3.8.1 Molecular weight determination 117

Optimum temperature for catechol 1,2-dioxygenase
3.8.2 activity 120
Optimum temperature for catechol 1,2-dioxygenase

3.8.3 stability 121
3.8.4 Optimum pH for catechol 1,2-dioxygenase activity 122
3.8.5 Optimum pH for catechol 1,2-dioxygenase stability 123
3.8.6 Storage stability of catechol 1,2-dioxygenase 124

Microcosmic study for phenol degradation using
3.9 125
phenol-degrading P. putida local isolate
Conclusions and Recommendations
Conclusions 134
Recommendations 135
References 136
Appendices 192
Summary in Arabic ‫ج‬-‫أ‬
XI
List of Tables
Page
Item No. Table Title
No.
Equipment and apparatus used in this study
(2-1) 42
Chemicals and solutions used in this study
(2-2) 43
Contents of kits packages used in this study
(2-3) 44
Culture media used in this study
(2-4) 45
(2-5) 45
Other materials used in molecular study
Primers used in this study, their sequences and

amplified molecular sizes (Macrogen/ South Korea).
(2-6) IMPORTANT: Except for the housekeeping gene (16S 46
rDNA), all primers used were designed in the present
study.
Gradient PCR program used for the amplification of

catechol dioxygenase genes (cat1, cat2, and catABC) in
(2-7) 66
P. aeruginosa and P. putida isolates.
Standard proteins used in the determination of the

molecular weight of catechol 1, 2-dioxygenase enzyme
(2-8) 75
produced by P. putida.
Detection of Catechol Dioxygenases in Pseudomonas

(3-1) 94
spp. Isolates.
The optical density for the growth of six isolates of
(3-2) 104
Pseudomonas spp. using spectrophotometer at 600 nm.
Purification of catechol 1, 2-dioxygenase enzyme from
(3-3)
P. putida local isolate using DEAE-cellulose and 117
Sephacryl S-1000 column chromatography.
Standard proteins used in the determination of the
(3-4)
molecular weight of catechol 1, 2-dioxygenase enzyme 119
produced by P. putida.
XII
Phenol residual and bacterial growth in soil microcosms
along 40 days of 60 days experiment by UV/Visible
(3-5)
spectrophotometer and viable count technique, 132
respectively; using free cells of P. putida (Isolate No.
15).
XIII
Item Page
Figure Title
No. No.
(1-1) Chemical structure of phenol
9
Strategies for bioremediation of organic contaminants;
(1-2) 18
bioattenuation, biostimulation and bioaugmentation
The two alternative pathways for aerobic biodegradation of
(1-3) phenol: meta and ortho-cleavage pathways 26
(1-4) Anaerobic biodegradation of phenol 27

(1-5) Intradiol ring cleavage mechanism 31
(1-6) Extradiol ring cleavage mechanism 34
(1-7) Genetic organization of phenol degradation gene clusters 37
Calibration curve for the determination of phenol by 4-
(2-1) 63
aminoantipyrine method
Calibration curve of Bovine Serum Albumin for Determination
(2-2) 71
of Protein Concentration
Distribution of phenol-degrading isolates according to source
(3-1) 79
of isolation
A. Isolated colonies of Pseudomonas spp. isolates on nutrient
agar plates. B. Pseudomonas spp. fluorescent pigment
"pyoverdine” under ultra-violet light following growth on
(3-2) 81
MacConkey agar. C. Pseudomonas spp. Isolates growing on
the selective medium of Pseudomonas agar medium
supplemented with CFC supplement
Extracted DNA on agarose gel electrophoresis (1% agarose
(3-3) 83
stained with ethidium bromide, 5 V/cm for 30 minutes) to
XIV
check DNA purity and integrity. Lane 1-7: Genomic DNA of
Pseudomonas spp. isolates
A. Agarose gel electrophoresis (1% percent agarose, 5 V/cm
for 90 minutes) for 16S rDNA gene (amplified size of 956 bp)
vs. DNA ladder. B. A blast hit of a precise size of the gene (918
(3-4) bp) with an interval between 433 –> 1350 from the NCBI 85
standard strain MT454186. C. Pairwise identity between the 16
S rDNA gene DNA sequencing of the local isolate with the
reference strain of Pseudomonas aeruginosa MT454186
A. Cat1 gene (amplified size, 650 bp) on 1% agarose gel
electrophoresis (5 V/cm for 90 minutes) vs DNA ladder lane.
B. A direct hit of a precise size of the gene (578 bp) with an
(3-5) interval between 2,392,757 -> 2,393,334. C. Pairwise 88

identification using standard strain CP016212 of P. putida and
DNA sequencing for cat1 gene which shows few gaps in the
local isolate
A. Agarose gel electrophoresis (1% agarose, 5 V/cm for 90
minutes) for cat2 gene (amplified size of 821 bp) vs. DNA
ladder lane. B. Analysis of a Blast Hit of a precise part of the
(3-6) 90
gene. C. Pairwise identity between the cat2 gene DNA
sequencing of the local isolate with a reference strain
APO15030
A. Agarose gel electrophoresis for catABC gene (amplified
size of 889 bp) compared to DNA ladder lane (1% agarose, 5
(3-7) V/cm for 90 minutes). B. The blast hit of the amplified gene in 92
the current investigation. C. Pairwise identity U12257 and
DNA sequencing for the catABC gene
Detection of Catechol Dioxygenases in Pseudomonas spp.
(3-8) 94
Isolates
XV
A. Growth profile of the isolate P. putida (isolate No. 8) at
various initial concentrations of phenol (30°C, pH 7). B.
(3-9) 96
Degradation profile of the isolate P. putida (isolate No. 8) at
various initial concentrations of phenol (30°C, pH 7.
(3-10) 97
various initial concentrations of phenol (30°C, pH 7).
(3-11) 98
(3-12) 99
(3-13) 101
(3-14) 102
The growth curve of P. putida local isolate at various
(3-15) temperatures (25 °C, 30 °C, 35 °C, and 40 °C) at 250 ppm of 108
initial concentration of phenol.
The growth curve of P. putida local isolate at various pH values
(3-16) 109
(pH 6, pH 7, and pH 8) at 30°C and 250 ppm of initial
XVI
concentration of phenol.
The growth curve of P. putida local isolate at various

concentrations of phenol (250 ppm, 500 ppm, and 750 ppm) at
(3-17) 110
(30°C, pH 7).
The effect of different temperatures on enzyme production by

(3-18) 112
P. putida (isolate No. 15)
The effect of different pH values on enzyme production by P.
(3-19) 113
putida (isolate No. 15)
Ion exchange - charmoatography of catechol 1, 2-dioxygenase
enzyme from P. putida using DEAE-cellulose column (7x 30
(3-20) 115
cm). The column was calibrated with (0.05M) Tris-HCl buffer
(pH 8); flow rate 60 ml/hrs and 5 ml/fraction
Gel-filtration chromatography for purification of catechol 1, 2-
dioxygenase enzyme from P. putida using Sephacryl S-1000
(3-21) 116
column (1.5 x 50) cm. The column was calibrated with (0.05M)
Sodium phosphate pH 8; flow rate 60 ml/hrs and 5 ml/fraction
Standard curve to estimate molecular weight of catechol 1, 2-
(3-22) dioxygenase enzyme from P. putida using gel filtration 119

Sephacryl S-1000
The effect of different temperatures on the activity of the
(3-23) catechol 1,2-dioxygenase enzyme purified from P. putida 120

(isolate No. 15)
The effect of different temperatures on the stability of the
(3-24) Catechol 1,2-dioxygenase enzyme purified from the local 121

isolate of P. putida (isolate No. 15)
The effect of different pH values on the activity of the catechol
(3-25) 1,2-dioxygenase enzyme purified from the local isolate of P. 122

XVII
The effect of different pH values on the stability of the catechol
(3-26) 1,2-dioxygenase enzyme purified from the local isolate of P. 123

Storage stability of free purified catechol 1, 2-dioxygenase
(3-27) from P. putida (isolate No. 15) within 28 days of incubation 125
period
GC Chromatography of phenolic pollutants in soil sample using
(3-28) phenol degrading isolate of P. putida (isolate No. 15) at zero 126
time of incubation period
(3-29) phenol degrading isolate of P. putida (isolate No. 15) at day 10 128
of incubation period
XVIII
List of Abbreviations
Abbreviation Expansion
°C Celsius degree
ANOVA Analysis of Variance
Bp Base Pair
BSA Bovine Serum Albumin
C12O Catechol 1,2 -Dioxygenase gene
C23O Catechol 2,3 -Dioxygenase gene
Cat Catechol Dioxygenase gene
Cat1 Catechol 1,2 -Dioxygenase gene
Cat2 Catechol 2,3 -Dioxygenase gene
CFC Cephalothin, Fucidin, Cetrimide
CFU Colony Forming Unit
Cis Functional groups on same side of plane
Cm Centimeter
CNS Central nervous system
DEAE Diethyl Amino Ethyl
DEAE-cellulose Diethylaminoethyl cellulose
Dmp The multicomponent phenol hydroxylase
DNA Deoxyribonucleic Acid
DW Distilled Water
E. coli Escherichia coli
EDOs Extradiol Dioxygenases
EDTA Ethylene diamine tetra acetic acid
EPA Environmental Protection Agency
Ex-situ Outside the original place
G Gram
µg Microgram
XIX
GC Gas Chromatography
GC content Guanine-cytosine content
GN Gram Negative
HKG Housekeeping Gene
HPLC High performance liquid chromatography
Hrs Hours
In-situ In the original place
IS Insertion Sequence
KDa Kilo Dalton
Kg Kilogram
L Liter
µl Microliter
Lig DNA Ligase
M Molari
Megaplasmid
Group of genes that breakdown organic pollutants
PVI
Mg Milligram
MGEs Mobile Genetic Elements
Min Minute
Ml Milliliter
mM Millimolari
MNA Monitored Natural Attenuation
MSM Mineral Salt Medium
NADP Nicotinamide adenine dinucleotide phosphate
NAH Naphthalene plasmid
NCBI National Center for Biotechnology Information
Nm Nanometer
No. Number
O.D Optical Density
XX
OH Hydroxyl Group
P. Pseudomonas
PAHs Polycyclic Aromatic Hydrocarbons
PCA Protochatechuic acid
PCR Polymerase Chain Reaction Technique
pH Potential of hydrogen
phe Phenylalanine
Pmol Picomol
Ppm Part per million
RNA Ribonucleic acid
Rpm Round per minute
rpoB Beta subunit of RNA polymerase
Reverse Transcription -Polymerase Chain Reaction
RT-PCR
Technique
SAL Salicylate plasmid
Sec Seconds
Sp. Species
Spp. Several Species
SPSS Statistical Package for the Social Sciences
TBE Tris Borate EDTA
TCA Tricarboxylic acid
TOL Toluene plasmid
U Unit
UV Ultra Violet radiation
V Volume
Ve Elution volume
Vitek 2 Vitality index of traditional environmental knowledge
Vo Void volume
WHO World Health Organization
XXI
Chapter One Introduction and Literature Review
Introduction
The world’s growing population led to an increase in soil
contamination, and the growth was correlated with an increase in pollution
levels. Pollutant buildup in soil has significant consequences on ecosystem
functioning, human and animal health, as well as soil production.
Unprecedented economic growth and progress have been fueled by rising
industrialization, sustained population increase, and strong demand and
reliance on petrochemical goods (Schwab, 2017).
The management of wastes produced by the food, health, and
automotive industries has recently garnered significant attention (Abdel-
Shafy and Mansour, 2018). An efficient biotechnological strategy for
eradicating environmental pollution is bioremediation, which uses
microorganisms to eliminate contaminants and prevent toxification (Coelho
et al., 2015). One of the main issues in the industrialization age and
advanced technology is the pollution of the environment with phenolic
compounds and petroleum hydrocarbons (Medić and Karadžić, 2022).
In developed countries including Iraq, the major problem faced by oil
refineries was the disposal of oily sludge generated during the processing of
crude oil. Improper disposal of this sludge leads to environmental pollution,
groundwater pollution, and air pollution due to percolation and evaporation,
respectively (Subber et al., 2011). As a result, contamination is a constant
risk wherever oil is extracted. Furthermore, there is an insufficient
understanding about how to deal with oil contaminated environments,
making them difficult to treat, particularly in extreme or unusual
environments like polar regions, deep sea areas, deserts, and wetlands (Lea-
Smith et al., 2015).
1
Man-made chemicals known as xenobiotics are known to cause severe

harm to living organisms. Their native forms are pervasive in nature and
have not undergone any changes. Because of their peculiar chemical or
physical properties, many xenobiotic substances cannot be broken down by
living organisms (Moniruddin, 2023). A large number of synthetic organics
included phenol as their fundamental structural component (Agarry et al.,
2008). The U.S. Environmental Protection Agency (EPA) and Agency for
Toxic Substances and Disease Registry (ATSDR) have identified phenol as
a priority contaminant (EPA, 1979). Phenolic pollutants are come from a
variety of sources including the use of wood preservatives, the partial
degradation of phenoxy herbicides, waste production by petroleum-related
industries like petroleum refineries, gas and coke oven industries,
pharmaceuticals, explosive manufacturing, phenol-formaldehyde resin
manufacturing, plastic and varnish industries, and associated metallurgical
operations, etc (Arutchelvan et al., 2005; Mohanty and Jena, 2017).
Acute exposure to phenol led to phenol toxicity that have variety of
side effects such as damage to the blood, liver, kidneys, and heart, as well as
causing a weak pulse, cardiac depression, and hypotension (Wismer, 2022).
Phenols have been currently removed by several methods such as
precipitation/ coagulation, floatation, osmosis, ion-exchange, ultrafiltration,
electrochemical degradation, etc (Shah, 2014). These methods are costly,
inefficient and produced toxic end products; so biological phenol removal
techniques are preferable due to eco-friendliness, affordability, and potential
for full substrate mineralization because it’s ability to mimic natural
processes to turn harmful substances into harmless products (Downs and
Wills, 2019; Jabbar et al., 2022).
2
One of the main methods for removing polluting substances from the
environment is done through the bioremediation by colonies of natural
microorganisms. These techniques seem to be among the most effective
ways to deal with a variety of organic pollutants, notably hydrocarbons
including phenol (Koshlaf and Ball, 2017).
Since Pseudomonas species can degrade a wide range of
hydrocarbons and phenolic compounds by using hydrocarbons and phenol as
their carbon sources, they are crucial for the biodegradation of these
xenobiotics and are widespread in almost all hydrocarbon-contaminated
environments (Bala et al., 2022). Studies on the microbial degradation of
phenol have revealed that a wide range of fungi and bacteria, including
Candida tropicalis, Acinetobacter calcoaceticus, Alcaligensm eutrophus,
Pseudomonas Spp. and others may breakdown phenol in an aerobic manner
(Nair et al., 2008).
Catechol dioxygenase and phenol hydroxylase (a two significant
genes that involved in the breakdown of phenolic compounds) were
categorized into the central and peripheral routes for the catabolism of
aromatic compounds, respectively. Along with phenol hydroxylase,
numerous other crucial genes for pollutant degradation, such as those
involved in biphenyl degradation, benzoate catabolism, and naphthalene and
anthracene degradation, were also included in this last group (Silva et al.,
2013).
In order to effectively perform the bioremediation process to soils
contaminated with phenol using microorganisms isolated from different
locations at Baghdad city, the following aims must be achieved
subsequently:
3
1. Isolation, identification, and screening of phenol-degrading

Pseudomonas spp. isolates collected from contaminated soils.
2. Surveying the existence of catechol dioxygenase genes (Cat1, Cat2,
and CatABC) responsible for phenol degradation ability in
Pseudomonas spp. environmental isolates.
3. Determining the most effective isolate in the production of catechol
Dioxygenase enzyme among phenol-degrading Pseudomonas spp.
isolates depending on the optimum conditions for producing this
enzyme.
4. Purification and characterization of 1, 2-catechol dioxygenase enzyme
from the local isolate of Pseudomonas putida.
5. Applying biostimulation and bioaugmentation tests in order to
bioremediate contaminated soils using the most phenol-tolerated
isolates of Pseudomonas spp.
4
Literature Review
1.1 Many emerging challenges to the environment
Ecosystems deal frequently with the natural environmental changes
and disturbances that occur throughout time and place. Numerous economic
and technical advancements were made possible by the massive industrial
boom that took place in the 19th and 20th centuries which fundamentally
altering the trajectory of human history (Schwab, 2017).
Unavoidably, over the last few decades, reliance on fossil fuels has
led to significant environmental problems. Environmental biotechnology-
based approaches to detoxify areas damaged by petrogenic chemicals are
becoming more and more popular due to the ecotoxicity and possible health
effects that petroleum hydrocarbons pose for both environmental and human
health. For remediation petroleum derivative-polluted locations, many
methods have been used (Schmidt, 2010). In order to maximize the
metabolism of organic pollutants and reduce the ecological consequences of
oil spills, bioremediation offers a developing technique that is both
inexpensive and environmentally friendly (Bayat et al., 2015; Koshlaf and
Ball, 2017).
According to scientific research, soil contamination may seriously
impair the crucial ecological functions that soil provides. Because of the
hazardous amounts of toxins present, soil contamination decreases crop
yields and makes foods grown on contaminated soils unfit for both human
and animal use (FAO, 2018). The movement of several pollutants, including
significant nutrients like nitrogen and phosphorus, from the soil to surface
and ground waters results in eutrophication, which harms the ecosystem and
directly affects human health through contaminated drinking water (Rashmi
5
et al., 2022). Additionally, pollutants cause direct injury to bigger soil-

dwelling species and soil microbes, which has an impact on soil biodiversity
and the functions of the impacted organisms (FAO, 2018).
Bioremediation depends on microbial metabolic activities in order to
convert organic pollutants like petrogenic hydrocarbons in the presence of
favorable ecological variables and essential nutrients. Even though
biodegradation sometimes has been taken longer than conventional
treatment techniques, and the pollutant is frequently completely degraded
(Alori et al., 2022). Numerous environmental and biological factors are
influence on the hydrocarbon biodegradation in a soil, which vary from site
to site, including soil pH, temperature, oxygen availability, nutrient content,
the growth and survival of microbes that degrade hydrocarbons, and the
bioavailability of pollutants to microbial (Koshlaf and Ball, 2017).
1.2 Xenobiotic compounds
Xenobiotic compounds are man-made chemicals that are extremely

dangerous. It is unaltered forms and are widely distributed in the
environment (Bhavani et al., 2021). These xenobiotic compounds frequently
have unusual chemical or physical characteristics that render them from
biodegradation. They are hence referred to as "refractory" compounds
(Gupta et al., 2022). Pharmaceuticals, pesticides, carcinogens, and numerous
substances that have been purposely introduced into the environment are the
most typical forms of xenobiotic compounds. Among all the harmful
substances, phenol and phenolic compounds have negative effects on the
environment's health and safety (Singh, 2017; Gupta et al., 2022).
6
Xenobiotic compounds have numerous complex chemical structures

and many non-physiological bonds. Some of xenobiotics have a little
relationship to the natural compounds that have been originate (Goyal and
Basniwal, 2017). The biologically mediated reduction process in the
complexity of chemical compounds is known as biodegradation (Selvaraj et
al., 2021). Xenobiotic biodegradation microorganisms that have through the
full process of evolution and are therefore capable of adapting in various
physicochemical settings are a gift from nature (Das, 2014). Growth and co-
metabolism are the two main mechanisms that make up biodegradation,
where these compounds are used as a source of carbon, nitrogen, and energy
by bacteria for growth. Co-metabolism is the breakdown of an organic
substance when it is present with a growth medium that serves as the main
source of carbon and energy (Faramarzi et al., 2023). Microbes have a wide
variety of enzymes that allow them to utilize various substances as food
sources, carbon and nitrogen sources, or as electron acceptors (Joutey et al.,
2013). In general, when xenobiotics are derived from natural substances that
enzymes have encountered throughout evolution, they are easily targeted by
enzymes, but complex molecules that are entirely synthetic and have
complex chemical structures are not easily targeted by enzymes (Kennedy
and Tierney, 2013).
1.2.1 Diseases caused by xenobiotics
Most of xenobiotics are harmful to humans, and are correlated with

particular disorders, such as psychological, digestive and metabolic
disorders (Fabozzi et al., 2022). For example; nitrosamines (Nabil et al.,
2021), and aflatoxin (Barouki et al., 2023) are associated with both
endocrine system and estrogenic system disruptions. Xenobiotic compounds
7
have been associated also with mutagenic effects, allergies, carcinogenic and
genetic defects (Chaudhary et al., 2023). These consequences are relayed on
the compound itself, period of exposure, and the dose during exposure
(Rengarajan et al., 2015). Some xenobiotics are not harmful but when they
pass by enzymatic modification they become toxic such as tetrachloroethene
and trichloroethene which are carcinogens (Chugh et al., 2022).
1.3 Hydrocarbons
Hydrocarbons are one of the pollutants which are harmful to
ecosystems, if it increased more than the acceptable concentration in the soil
(Odinga et al., 2021). Polycyclic aromatic hydrocarbons (PAHs) are the
major environmental pollutants and could enter into the food chain. Because
PAHs have a tendency to bio-accumulate and can flow from one food chain
to another, the passage of chemicals via the lower members of the food
chain to various tropic levels poses a risk to the environment (Das et al.,
2014). PAHs are most acutely harmful substance, which are linked to several
chronic illnesses and disturb the natural balance between living things and
their environments (Dash et al., 2014; Priyadarshanee et al., 2022).
When hydrocarbons are released into the environment, either
accidently or as a result of human activity, it leads to soil, water, and air
pollution, which poses a number of health risks (Srivastava et al., 2019;
Odinga et al., 2021). A certain amount of expectation may be made for
microorganisms separated from an entirely unrelated environment even
though hydrocarbon degraders may be expected to be easily isolated from a
petroleum-polluted environment. There is a wealth of information on the
mineralization or microbial oxidation of hydrocarbons (Vanishree et al.,
2014; Xu et al., 2018).
8
1.4 Phenol
Phenol is the common term of hydroxybenzene. Phenol is an aromatic
organic compound with one hydroxyl group linked to the benzene ring. The
chemical structure of phenol is C6H6O, figure (1-1) (Elayyat, 2015). The
molecular weight of phenol is 94.11 g/mol with water solubility of 87 g/L at
25°C. Moreover, the melting and boiling temperatures of phenol are 40.5 °C
and 181.7°C, respectively (Elayyat, 2015). At room temperature, phenol is
moderately volatile and highly flammable (it is evaporated slowly when
compared to water) (Ma et al., 2019).
Phenol is the fundamental structural component for a vast variety of

synthetic organic compounds. It is a white, crystalline solid that is soluble in
the majority of organic solvents (Hanafi and Sapawe, 2020). Other names
for phenol include carbolic acid, phenic acid, phenylic acid, phenyl
hydroxide, and oxybenzene (Tiwari et al., 2017; Wachowski and Pietrzak,
2020).
Figure (1-1): Chemical structure of phenol (Elayyat, 2015).
9
Phenol is a weak acid that is very sensitive to electrophilic

substitution reactions and oxidations in its ionized form (Nicas and Neuhaus,
2022). It is produced both naturally and artificially through chemical
processes. Many industries use phenol and its derivatives as products and
raw materials, including leather, paint, pharmaceutical, coking plant
petrochemical, oil refining, plastics, explosives, steel, pesticides, and
disinfectants (Luo et al., 2032).
1.4.1 Uses of phenol
Phenol is used as a pure material in the creation of slimicides,

disinfectants, antiseptics, and pharmaceutical products such ear drops, nose
drops, mouthwash, and sore throat lozenges (Tiwari et al., 2017). Phenol has
many uses including: an extracting solvent in refineries and lubricant
production, a blocking agent for blocked isocyanate monomers, a reagent in
chemical analysis, a primary petrochemical intermediate, and in the
preparation of some cream and shaving soap due to its germicidal and local
anesthetic property (Mohanty and Jena, 2017). It is also used in veterinary
medicine as an internal antiseptic and gastric anesthetic (Sachan et al.,
2019).
In the manufacturing process, phenol is used to create phenolic resins

like bakelite. Moreover, phenol serves as a precursor component for the
manufacture of several epoxy resins. Additionaly, it is used in polyester
polyols (polyester is resistant to corrosion). Polysulphone and polyphenoxy
polymers are made from phenol as well (Tiwari et al., 2017; Ravindran et
al., 2022).
10
Phenol is used also with chloroform for DNA and RNA purification
from proteins as well as its usage for cell lysis (Chacon Cortes and Griffiths,
2014). Furthermore, it has been used also as a building block for the
synthesis of pharmaceuticals such as aspirin (Park et al., 2021). Phenol is
certainly the oldest introduced disinfectant which presented as "carbolic
acid" (Ambrose, 2018). Disinfectants are often used in medical sector, food
and pharmaceutical sectors to stop microorganisms from spread illness.
Wexcide, ProSpray, and Birex are germicidal, fungicidal, virucidal,

and tuberculocidal, all are phenol-based disinfectants that are available at a
reasonable price and are effective against numerous of bacteria, fungi, and
certain viruses (Phenols are effective against gram positive bacteria and
enveloped viruses) (Mohanty, 2012). Although phenolic disinfectants (such
as cresols and pine oil) are typically harmless, but prolonged skin contact
may irritate the skin (Kumar et al., 2023).
1.4.2 Toxicity of phenol
Phenol is registered as a major pollutant in the list of the

Environmental Protection Agency (EPA) in 1979 as reported by Agarry et
al. (2008). It is toxic even at low concentrations and the toxicity of phenols
for microbial cells has been investigated. Phenol is readily absorbed through
multiple routes of exposure (ingestion, dermal, inhalational) and distributes
widely through the body within minutes (Vearrier et al., 2015).
Acute exposure of phenol causes disorders of central nervous system,

damage in blood, liver, kidney, cardiac toxicity and reduced blood pressure
(Olujimi et al., 2010). The lethal dose of phenol is 1 g by Ingestion, and
some effects also reported by several researches such as hypothermia,
11
burning effect on skin, irritation of the eyes, gastrointestinal disturbance,

also cause liver and kidney damage, CNS impairment, diarrhea and dark
urine to human and animals (Khare, 2011; Vearrier et al., 2015).
1.5 The genus Pseudomonas
Pseudomonas is one of the most diverse and adaptable prokaryotic

genera and their metabolic versatility allows their members to survive in
many different environments (Saati-Santamaria et al., 2021). Members of
the genus Pseudomonas have been identified in human and animal related
sources, plants, soil, water environments, psychrophilic environments, and
other environmental niches and hosts encompassing more than 200 species
that have been isolated worldwide (Mahgoub et al., 2023). These gram-
negative gammaproteobacteria are defined by their impressive metabolic
diversity and adaptability which allow them to thrive and colonize all sorts
of environments, from crops, soil, water (Both fresh and salt), cities to even
clouds (Madigan et al., 2017; Batrich et al., 2019).
Pseudomonas is one of the most varied genera of bacteria due to the

wide range of settings in which it may live and evolve. The diversity of
Pseudomonas, together with the fact that these bacteria are incredibly
adaptable and simple to cultivate in a lab, has encouraged the ongoing
identification of new species within this genus (Saati-Santamaria et al.,
2021). Due to their large physiologic diversity, Pseudomonas species are
able to infect a wide variety of plants, invertebrates and animals, including
humans, which leads to many economical and health repercussions. On the
other hand, some species are also known to protect and promote plant
growth (Sah et al., 2021).
12
Pseudomonas genomes exhibit high GC contents, with a genus

average of 61.2% (66.6% on average for P. aeruginosa), which has been
linked to larger genome sizes (approximately 5.63 Mbp) and specific types
of DNA polymerase III α subunits (Wu et al., 2012; Hesse et al., 2018).
Pseudomonas species are genetically highly diverse, with a genus core
genome recently determined as less than 2% of the pan-genome (Freschi et
al., 2019). Among the few genes that are functionally conserved across all
species are those involved in resource consumption with broad substrate
specificity and bacterial motility regulation, both of which are important in
environmental adaptation (Yi and Dalpke, 2020).
The classification of this genus has evolved considerably through

molecular phylogenetics using the rrs gene encoding 16S rRNA which
allowed the reclassification of many species in other bacterial genera
(Lalucat et al., 2022). Other molecular markers were also used to trace the
evolutionary history of Pseudomonas, such as rpoB, rpoD, and gyrB genes
(Garavaglia et al., 2023). In recent times, the use of concatenated
phylogenetic markers or complete genome sequences has enabled a robust
delimitation of the Pseudomonas genus (Girard et al., 2021), which
encompasses several groups of closely-related species, such as the “P.
fluorescens” group, “P. putida” group, “P. aeruginosa” group, “P. stuzeri”
group, and “P. syringae” group (Garavaglia et al., 2023).
1.6 Bioremediation
Bioremediation means the use of diverse biological agents to solve an
environmental problem such as contaminated soil or contaminated water. In
other words it is a technology for removing pollutants from the environment
thus restoring the original natural surroundings and preventing further
13
pollution (Kumar et al., 2018). Bioremediation may be employed in order to

attack specific contaminants, such as chlorinated pesticides that are degraded
by bacteria, or a more general approach may be taken, such as oil
contaminated wastewater that are broken down using multiple techniques
including the addition of bio stimulation to facilitate the decomposition of
oil by bacteria (Maqsood et al., 2023).
More than a century ago, the capacity of naturally existing soil
bacteria to breakdown hydrocarbons was initially discovered as a kind of
microbial biodegradation, bioremediation considered as a new technology to
treat contaminated area by the use of biological agents to decompose
Pollutants (Azubuike et al., 2016).
Bioremediation is a rapidly advancing field which has been applied
successfully to remediate many contaminated sites. It depends on many
factors such as pH, temperature, oxygen targeted pollutants, and the design
of the system in which biodegradation occurs (Agarry et al., 2008). The goal
of every soil remediation method is to enhance the degradation,
transformation, or detoxification of pollutants and to protect, maintain and
sustain environmental quality (Singh et al., 2009).
Although the widespread use of biodegradation methods is still up for
discussion, but bioremediation is usually involves three major processes;
transformation of the molecule, degradation of the molecule to simpler
compounds, and mineralization of complex compounds into simpler ones
such as СО2, Н2, NH3, CH4, H2O and others (Krastanov et al., 2013).
Depending on where the process takes place, bioremediation can be
categorized into two types: in-situ and ex-situ bioremediation (Suthersan et
al., 2016). In-situ and ex-situ bioremediation are the categories of
bioremediation which can be categorized based on where the process takes
14
place. There may be an overlap between the mentioned in-situ and ex-situ
processes, despite the fact that the following classification has been
employed in many classic works (Hussain et al., 2022).
In-situ bioremediation means the use of biological therapy to control
or change environmentally harmful substances such as biosparging,
bioventing, and bioaugmentation (Kumar et al., 2018). By injecting air
through the unsaturated soil in the passive system is known a bioventing,
which encourages in situ aerobic biodegradation by giving oxygen to the
microorganisms. The sluggish airflow rate on sites increases microbial
activity (Riser-Roberts, 2020). The introduction of non-native microbes to
speed up biodegradation is known as bioaugmentation. This strategy is used
by municipal wastewater treatment to restart activated sludge aeration basins
(Azubuike et al., 2016; Ojha and Tiwary, 2021).
For ex-situ bioremediation technologies, they represent applications
involving the physical removal of pollutants from the contaminated soil or
water and transferring them to a controlled environment such as a bioreactor,
possibly within sites, for further treatment. These techniques involve
excavating pollutants from polluted sites (Hussain et al., 2022). The ex-situ
approach usually provides higher efficiencies due to the carefully controlled
conditions in the bioreactor. Examples of ex-situ bioremediation are
biotreatment, bioreactors, and landfarming (Patel et al., 2022).
1.6.1 Different types of bioremediation methods

1.6.1.1 Biostimulation
Biostimulation are changes that applied to the environment to
encourage the bioremediation abilities of already-existing bacteria. It was
15
defined by Margesin and Schinner (2001) as an enhanced process by the

addition of many factors including aeration, fertilizer addition, pH
management, and temperature control, that can accelerate pollutant
breakdown. Biostimulation can be used as a remediation technique to
remove petroleum pollutants from soil, but it first needs to be evaluated for
both the intrinsic degradation potential of the native microflora and the
environmental factors that affect the kinetics of the in-situ process (Udume
et al., 2023).
After altering the environment conditions, existing microorganisms
that can do bioremediation will be stimulated. This accomplished by adding
different types of limiting nutrients and electron acceptors, such as carbon,
oxygen, nitrogen, or phosphorus, which are ordinarily present in levels low
enough to restrict microbial activity (Adams et al., 2015). The addition of
nutrients, oxygen, or electron donors and acceptors to the targeted site to
boost the population or activity of naturally occurring microorganisms
accessible for bioremediation is known as biostimulation (Perfumo et al.,
2007). The main benefit of biostimulation is the occurrence of existing
native microorganisms that are adapted to the subsurface environment and
widely dispersed throughout the subsurface (Adams et al., 2014), figure (1-
2).
1.6.1.2 Bioaugmentaion
Bioaugmentation is the insertion of oil-degrading microbes (e.g.,
bacteria harboring the required catabolic genes) into soil to enhance the rate
of contaminant degradation by the native populations (Garbisu et al., 2017).
This strategy is justified by the possibility that native microbial populations
are stressed as a result of recent exposure to the spill or are unable to
16
degrade the large variety of possible substrates found in complex mixes like
petroleum (Rahmati et al., 2022).
Bioaugmentation can be divided into two different approaches: (i) cell
bioaugmentation, which relies on the survival and growth of the inoculated
strains to perform the degradation of the target contaminants, and (ii) genetic
bioaugmentation, based on the spread of catabolic genes, located in mobile
genetic elements (MGEs), into native microbial population (Garbisu et al.,
2017).
1.6.1.3 Natural attenuation

Natural attenuation or bio attenuation is the reduction of contaminant
concentrations in the environment through biological processes (aerobic and
anaerobic biodegradation, plant and animal uptake), physical phenomena
(advection, dispersion, dilution, diffusion, volatilization,
sorption/desorption), and chemical reactions (ion exchange, complexation,
abiotic transformation) (Ghosh et al., 2021).
Terms such as intrinsic remediation or biotransformation are included
within the more general natural attenuation definition. Although, one of the
most important components of natural attenuation is biodegradation, the
change in the formation of compounds is carried out by the targeted living
creatures such as microorganisms (Joutey et al., 2013). Under the right
conditions, microorganisms can cause or assist chemical reactions that
change the form of the contaminants so that little or no health risk remains
(Ghosh et al., 2021).
Natural attenuation occurs at many polluted sites; however, the right
conditions must exist underground to clean sites properly. If not, cleanup
will not be quick enough or complete enough. Scientists monitor these
17
conditions to make sure that natural attenuation is working and they called it
a monitored natural attenuation or (MNA) (Rosenkranz et al., 2013). So,
monitored natural attenuation is a technique used to monitor or test the
progress of natural attenuation processes that can degrade contaminants in
soil and groundwater. It may be used with other remediation processes as a
finishing option or as the only remediation process if the rate of contaminant
degradation is fast enough to protect human health and the environment
(Lee, 2009; Joutey et al., 2013).
Natural processes can then mitigate the remaining amount of
pollution; regular monitoring of the soil and groundwater can verify those
reductions. The combination of aerobic and anaerobic degradations which
are exceedingly difficult to manage and control in-situ, that is required full
biodegradation of contaminants by microorganisms (El-Saadony et al.,
2023), figure (1-2).
Figure (1-2): Strategies for bioremediation of organic contaminants; bioattenuation,

biostimulation and bioaugmentation (Garbisu et al., 2017).
18
1.6.2 Factors affecting bioremediation

The process of bioremediation is affected by the activities of
heterotrophic microorganisms, both aerobic and anaerobic (Das, 2014). The
activity of microorganisms in the soil is affected by a number of physical
and chemical environmental specifications. Some of these factors include
the following: soil moisture, oxygen, redox potential, nutrients, pH,
temperature, and the presence of heavy metals, along with the type of
microbial culture (Bwapwa, 2022). Suitable monitoring of these factors can
be undertaken to prevent bioremediation failure (Alori et al., 2022).
Increasing the temperature will increase the rate of oil degradation by
bacteria. Increasing the oil concentration in general decreases the rate of
bacterial degradation of oil (Zekri and Chaalal, 2005). Salinity plays a major
role on the acceleration of biodegradation process of crude oil. An optimum
salinity should be determined for every studied system (Iqbal et al., 2007).
Many experiments carried out at different pH values to elucidate the
effects of pH on the biodegradation. A biodegradation at pH 9.0 maintained
better performance of sludge stabilization than acidic and neutral systems
(Liu et al., 2019). An acidic environment, in general, resulted in K+
deficiency, low enzyme activity, and oxidative stress (Dawood et al., 2022).
An alkaline environments facilitated substrate oxidation, accelerated
humification, and prevented the inhibition caused by the accumulation of
acids or ammonia nitrogen. The pH and digestion time may affect the
microbial population and species richness significantly. An alkaline
boidegradation system presented lower bacterial diversity and maintained a
higher richness of functional microbes such as Paenalcaligenes and
Pseudogracilibacillus (Liu et al., 2019). Hence, an alkaline digestion system
19
maintained a relatively high oxidase activity, and mitigated the potential

oxidative stress for thermophili’s (Cao et al., 2022).
1.6.3 Advantages and disadvantages of bioremediation

All bioremediation techniques have its own advantages and
disadvantages because they have their own specific applications. It is a
natural process which takes little time and needs very less efforts (Pham et
al., 2022). When weighed against other remediation strategies,
bioremediation has number of advantages because it does not use any
dangerous chemicals, and supports the complete degradation of pollutant
and many toxic hazardous compounds existed in contaminated sites
(Sharma, 2020). Moreover, it can be finished on-site and there is no need to
transport large numbers of waste off-site. On the other side, bioremediation
is associated with a lower risk of damage to the original sites with no
potential human health risk, and the environment will remain
uncontaminated (Pham et al., 2022). In conclusion, it can be utilized in
conjunction with technology for the purpose of increasing the efficiency of
physical and chemical treatment (Zhang et al., 2023).
The disadvantages of bioremediation are another thing that is readily
obvious including several toxic chemicals that are notably difficult to break
down, such as highly chlorinated compounds and heavy metals (Tabinda et
al., 2023). Some biodegradation processes, such as the biodegradation of
trichloroethenes, have the potential to result in the generation of more
harmful chemicals than the original substance (Zhang et al., 2022). The
creation of dangerous chemicals like 1,1-dichloroethene and vinyl chloride
can result from the biodegradation of trichloroethenes (TCE), which occurs
20
as a byproduct of anaerobic reductive dichlorination (Sayqal and Ahmed,

2021).
In order to know if bioremediation sites are successful, they must be
constantly monitored. Last but not least, bioremediation can be legally
limited due to concerns over the introduction of novel microbial species, the
unpredictability of the process, and the public's acceptance of such a
treatment (Mohee and Mudhoo, 2012; Radhakrishnan et al., 2023).
1.6.4 Bioremediation of phenol
Phenol is the building block for many different types of synthetic

organic molecules (Hanafi and Sapawe, 2020). These organic molecules
including Polycyclic Aromatic Hydrocarbons (PAHs) that are so pervasive
in the environment, which led to an increase in pollution and negative
effects on the health of all animals (Sun et al., 2021). Phenolics are often
found in wastewater discharged from oil refining, coal processing,
petrochemical, pharmaceutical, and other industries (Ahmed and Gogina,
2023).
Up until recently, these toxins were removed via physicochemical

processes such steam distillation, solidification, chemical precipitation, and
cremation. However, rather of actually eradicating contaminating
substances, the aforementioned techniques frequently just shift them from
one place to another. Additionally, they cost more and produce toxic
byproducts that require special handling (Blanco-Enríquez et al., 2018).
Many microorganisms are vulnerable to the antimicrobial properties of

phenol. However, there are certain microorganisms that can breakdown
21
phenol and are resistant to phenol (Miklasińska-Majdanik et al., 2018). In

particular, there are several bacteria belonging to different genera that are
well-known for their powerful abilities to catabolize PAHs, including,
Pseudomonas, Mycobacterium, Proteobacteria, Actinobacteria,
Methylobacillus, Nocardioides, Achromobacter, Caulobacter,
Sphingomonas and Sphingobium (Zhang et al., 2021). These genera may
have the ability to carry ring-hydroxylating-dioxygenase alpha subunit
(RHDα) genes that are significantly correlated to the degradation of PAHs
(Zhang et al., 2022). Some yeasts such as, Candida tropicalis, Fusarium
flocciferium, and Trichosporon cutaneum are also capable of degrading
phenol (El-Naas et al., 2017; Blanco-Enríquez et al., 2018).
Pseudomonas bacteria have been utilized as models for typical
phenol-degrading microorganisms within 144 hours and 162 hours for P.
cepacia and P. putida, respectively (Arutchelvan et al., 2005). As well as
Acinetobacter calcoaceticus that has a very high destruction rate for phenol
reaches to 91.6% within 48 hours. A novel strain of Rhodococcus
aetherivorans degrades phenol at a rate of 35.7 mg/L per hour (Nogina et
al., 2020). By cell immobilization, the mutants M1 of Rhodococcus ruber
SD3 can breakdown 98% of 2 g/L phenol in 72 hours (Xu et al., 2021).
Additionally, several yeasts and fungi have been employed to degrade

phenol such as the model phenol-degrading yeast Candida tropicalis which
was able to breakdown 2.6 g/L of phenol in 70.5 hours (Jiang et al., 2007).
Among the filamentous fungi that degrade phenol are primarily Aspergillus
oryzae and Aspergillus flavus (Ghanem et al., 2009). Numerous techniques,
including selection in an environment with high levels of phenol pollution,
mutagenesis, and immobilization of microbial cells, have been used to
22
increase the efficiency of phenol degradation by microorganisms (Xu et al.,

2021).
The genus Pseudomonas includes a significant group of bacteria with

environmental applications in bioremediation and biological control among
the microorganisms (Agarry et al., 2008). In Pseudomonads, many of its
induced enzymes are nonspecific and its metabolic pathway contains a high
degree of convergence (Mahiudddin and Fakhruddin, 2012). The
convergence of catabolic pathways allow for the efficient utilization of a
wide range of growth substrates while the non-specificity of the induced
enzymes allows for the simultaneous utilization of several similar substrates
without an excess of redundant genetic coding for enzyme
induction (Bruinsma et al., 2023). Microorganisms are able to adapt to the
presence of toxic organic compounds by using a whole cascade of adaptive
mechanisms. Among the adaptive mechanisms, changes in the fatty acid
composition of membrane lipids are the most important reactions of bacteria
to membrane-active substances (Singh, 2017).
Kumar et al. (2005) carried out biodegradation experiments with

phenol and catechol using P. putida and they observed that phenol and
catechol exhibited inhibitory behavior and the culture growth kinetics were
correlated with Haldane’s inhibitory growth kinetic model. They also
observed that the bacterial culture died when the initial concentration of
phenol and catechol were above 1200 mg/L and 600 mg/L, respectively.
Yang and Lee (2007) have isolated two pure phenol-degrading

isolates from enriched mixed cultures and identified them as P. resinovorans
and Brevibacillus sp. They noticed that the phenol-degrading ability of P.
23
resinovorans was much better than that of Brevibacillus sp. The metabolic
pathway for P. resinovorans phenol degradation was assigned to the meta-
cleavage activity of catechol 2, 3 dioxygenase.
Agarry et al. (2008) studied the bioremediation potential of an

indigenous P. fluorescence in batch culture using synthetic phenol in water.
The effect of initial phenol concentration on the degradation process was
investigated. Phenol was completely degraded at different cultivation times
for the different initial phenol concentrations. There was a decrease in the
biodegradation rate while initial phenol concentration has increased.
Bared et al. (2010) used the bacterium P. aeruginosa to eliminate

phenol and benzoic acid. Results obtained showed that the microbe was able
to degrade phenol as well as benzoic acid. However, it was noted that P.
aeruginosa shows better results in phenol than benzoic acid.
1.6.5 Mechanisms of biodegradation of phenol
1.6.5.1 Aerobic biodegradation
Aerobic biodegradation is the breakdown of organic pollutants by

microorganisms when oxygen is present. More specifically, it refers to being
or living only in the presence of oxygen (Bremer, 2022). Numerous organic
pollutants are fleetly degraded under aerobic conditions by aerobic bacteria
called aerobes. Aerobic bacteria (aerobe) have an oxygen grounded
metabolism. Aerobes, in a process known as cellular respiration, oxygen is
used to oxidize substrates (for illustration sugars and fats) in order to gain
energy. Before cellular respiration begins, glucose motes are broken down
24
into two lower motes. This happens in the cytoplasm of the aerobes (Santos
and Bakhshoodeh, 2021).
The lower motes also enter a mitochondrion, where aerobic

respiration takes place. Oxygen is used in the chemical responses that break
down the small motes into water and carbon dioxide. The responses also
release energy. Aerobic, unlike anaerobic digestion, doesn’t produce the
pungent feasts. The aerobic process results in a more complete digestion of
waste solids reducing make up by further than 50 in utmost cases (Santos
and Bakhshoodeh, 2021; Sayqal and Ahmed, 2021).
During the aerobic biodegradation of aromatic compounds, phenol is
converted into catechol, which is subsequently oxidized via an ortho-
cleavage pathway by catechol 1, 2 dioxygenase or via a meta-cleavage
pathway by catechol 2, 3 dioxygenase (Aravind et al., 2020). Both pathways
resulted end products that can enter the tricarboxylic acid cycle, therefore
opening and destroying the ring (Mohd, 2022), figure (1-3).
25
Figure (1-3): The two alternative pathways for aerobic biodegradation of phenol:
meta and ortho-cleavage pathways (Mohd, 2022).
1.6.5.2 Anaerobic biodegradation
Anaerobic degradation occurs when the anaerobic microbes are

dominant over the aerobic microbes. Biodegradable waste in tip degrades in
the absence of oxygen through the process of anaerobic digestion (Lin et al.,
2019). Paper and other accoutrements that typically degrade in a many times
degrade more sluggishly over longer ages of time (Chamas et al., 2020).
Biogas contains methane which has roughly 21 times the global warming
eventuality of carbon dioxide. In a cradle to cradle approach this biogas is
collected and used for eco-friendly power generation. Anaerobic digestion is
a series of processes in which microorganisms break down biodegradable
26
material in the absence of oxygen (Baidhe et al ., 2021; Mohd, 2022), figure

(1-4).
Anaerobic biodegradation is used extensively to treat waste water

sludge and biodegradable waste because it provides volume and mass
reduction of the input material. As part of an intertwined waste operation
system, anaerobic digestion reduces the emigration of tip gas into the
atmosphere (Martens et al., 2016). Anaerobic digestion is a renewable
energy source because the process produces Methane and Carbon dioxide
rich biogas suitable for energy product helping replace Fossil energies. Also,
the nutrient-rich solids left after digestion can be used as toxin (Bremer,
2022).
Figure (1-4): Anaerobic biodegradation of phenol (Mohd, 2022).

27
1.7 Enzymes responsible for the biodegradation of phenol
The aromatic degradation processes involve a number of enzymes that

are typically placed into one of two categories: enzymes that are involved in
the "upper" pathway or enzymes that are involved in the "lower" pathway
(Li et al., 2022). In most cases, the enzymes that are part of the upper
pathway are responsible for the transformation of aromatic chemicals into
aromatic vicinal diols (Reineke and Schlomann, 2023). This first phase of
hydroxylation can be carried out by either a monoxygenase or a
dioxygenase, and it involves the incorporation of oxygen atoms into the
aromatic ring (Brink et al., 2019). Dihydrodiol dehydrogenase is the second
enzyme in the upper route, and it is responsible for catalyzing the conversion
of dihydrodiol to the dihydroxy molecule (Reineke and Schlomann, 2023).
1.7.1 Oxygenases
These enzymes can change the hydrophobic organic compound state

into more water-soluble form thus it can be broken down by a larger number
of other microorganisms. Oxygenases have two major classes;
monooxygenases and dioxygenases (Pandolfo et al., 2023). These enzymes
participate in the oxidative metabolism of a wide variety of chemicals of
pharmaceutical, agricultural and environmental significance. Some of the
most widely recognized substrates for this class of enzymes are the aliphatic
and aromatic hydrocarbons of both endobiotic and xenobiotic sources
(Kumar et al., 2018).
28
1.7.1.1 Monoxygenases
This class of enzymes inserts a single atom of the oxygen molecule

into the substrate, and the other atom of oxygen becomes reduced to water,
i.e. two reluctant (substrates) are needed (Alfieri et al., 2007). They are also
more complex in action, and can catalyze several different types of oxygen
insertion reactions. Since monoxygenases oxidize two substrates, they are
also called mixed function oxidizes (Pazmiño et al., 2010). Also, since one
of the main substrates becomes hydroxylated, they are also called
hydroxylases (Pandolfo et al., 2023).
1.7.1.2 Dioxygenases
Dioxygenases are enzymes that catalyze the incorporation of two

atoms of molecular oxygen into various substrates. These enzymes have
been discovered in all types of living organisms and shown to perform a
variety of functions (Pandolfo et al., 2023). Dioxygenases are very important
in initiating the biodegradation of a variety of chlorinated and nitro-aromatic
compounds as well as non-substituted PAHs which are firstly degraded into
catechol or protocatechuate by oxygenases (dioxygenases and
monooxygenases) (Tiwari et al., 2017).
Among these, the cleavage of the aromatic ring is one function that
appears to depend largely, perhaps entirely, upon this type of enzymes.
Either extradiol dioxygenases (EDOs) or intradiol dioxygenases are
responsible for the transformation of the ensuing dihydroxylated aromatic
compounds into ring-cleavage products when the lower pathway is followed
(Adetunji et al., 2021). The successive steps in a metabolic process are
classified as either meta- or ortho- pathways (Yang et al., 2021). The
29
products of ring cleavage undergo further degradation to produce chemicals

that are candidates for entry into the tricarboxylic acid cycle (Pandolfo et al.,
2023).
There are reports on many microorganisms capable of degrading

phenol through the action of variety of enzymes. These enzymes may
include oxygenases hydroxylases, oxidases, etc ( Narayanan et al., 2023).
Cofactors involved in these enzymes are nonheme iron, heme. The indole
ring-cleaving enzyme, tryptophan 2,3-dioxygenase, is known to contain
heme as a cofactor (Mohapatra and Phale, 2021).
1.7.1.2.1 Nonheme iron containing dioxygenases
Depending on the basis of aromatic ring cleavage mechanisms, two

classes of such enzymes have been identified: Intradiol and extradiol-
dioxygenases (Pandolfo et al., 2023). Intradiol- dioxygenases, which use
nonheme Fe (III) to cleave the aromatic ring at an ortho- position regarding
the hydroxyl substitutes (Krastanov et al., 2013). Catechol 1, 2-Dioxygenase
enzymes [EC 1.13. 11.1] that catalyzes the aromatic ring cleavage of
catechol and its derivatives catalyzes the critical step in the aerobic
degradation of aromatic compounds in microorganisms and also catechol
dioxygenase are first intermediate product of phenol degradation (Traore and
Liu, 2022). Intradiol ring cleavage mechanism of action was shown in figure
(1-5).
30
Figure (1-5): Intradiol ring cleavage mechanism (Abbas et al., 2022).
31
In contrast, extradiol- dioxygenases use nonheme Fe (II) or other two-

valent metal ions to cleave the aromatic ring at meta-position with regard to
hydroxyl groups (Pandolfo et al., 2023). Contemporary genomic, structural,
spectroscopic, and kinetic studies broaden the knowledge of the distribution,
evolution, and action mechanisms of these enzymes (Krastanov et al., 2013).
Extradiol dioxygenases are generally believed to have more activity than
intradiol dioxygenases. This activity is demonstrated by wider substrate
specificity, presence of more structural variations, and participation in more
metabolic pathways, including biosynthetic chains and path ways for the
degradation of non-aromatic compounds (Semana and Powlowski, 2019).
In the meta-mechanisms, the catechol 2,3-dioxygenase enzyme [EC

1.13. 11.2] hydrolyzes the bond at the meta position in the aromatic ring.
The product of this reaction is 2-hydroxymuconic semiadlehyde, which is
later broken down to acetaldehyde and pyruvate (Kita et al., 1999). The
three-dimensional structure of the enzyme was obtained and shown to be a
homotetramer comprised of subunits, each of them containing two similar
domains. This enzyme has a tetramer structure of identical subunits with
molecular mass of 35 kD (Takeo et al., 2007; Eppinger et al., 2023).
Initially, this enzyme was isolated and purified from the bacteria of
Pseudomonas genus. It was established that the enzyme dioxygenase
incorporated molecular oxygen directly in the aromatic ring of catechol,
which resulted in the formation of cis, cis-muconic acid (Pandolfo et al.,
2023). Extradiol ring cleavage mechanism was shown in figure (1-6).
The enzyme catechol 1, 2-dioxygenase was described in

Pseudomonads that highly dependent on ferro- and ferri-ions and has high
substrate specificity. Many enzymes with similar action have been
32
described, some of them being highly specific with regard to their substrates,
synthesis, regulation, and structure (Goveas et al., 2023). Protocatechuic
acid (PCA) is an important ring-cleavage common intermediate formed from
the catabolism of low molecular weight polycyclic aromatic hydrocarbons
(Kamimura and Masai, 2014).
These compounds are derived from the apopolymerization of lignin,

phthalic acid isomers, chlorobenzoic acids, and methylated aromatic
hydrocarbons such as toluene and xylene (Tsagogiannis et al., 2021).
Protocatechuic acid (PCA) is further metabolized and funneled to the
tricarboxylic acid (TCA) cycle under aerobic conditions by the action of
intradiol or extradiol dioxygenases via three distinct catabolic pathways,
differing in the location of the initial ring opening oxidation: 2, 3-
dioxygenation (para-cleavage pathway), 3, 4-dioxygenation (ortho-
cleavage, known as the β-ketoadipate pathway), and 4, 5-dioxygenation of
PCA (meta-cleavage pathway) (Qiu, 2021).
Generally, the ortho-cleavage pathway of PCA is widely distributed

amongst Actinobacteria and Proteobacteria, and PCA 3,4-dioxygenase is
the most commonly characterized enzyme (Sim et al., 2013; Tsagogiannis et
al., 2021). Although numerous biochemical characterizations of the PCA 4,
5-dioxygenases have been established in several bacterial groups such as
Pseudomonas species, Comamonas species, Sphingomonas species, Delftia
sp. strain TBKNP-05, and Rhizobium leguminosarum. Until now, the PCA
4, 5-dioxygenase (ligAB) from Sphingomonas paucimobilis SYK-6 is the
only structurally and fully kinetically characterized enzyme (Tsagogiannis et
al., 2021).
33
Non-heme iron extradiol dioxygenases have been reported to be

catalytically active most commonly with Fe (II) but also with a variety of
metal ions of the same oxidation state (e.g., Mn (II), Co (II), Cu (II), Zn (II)
or Ni (II)) (Fielding et al., 2011; Gerothanassis, 2023).
Figure (1-6): Extradiol ring cleavage mechanism (Abbas et al., 2022).
34
1.7.2 Phenol hydroxylases
Phenol hydroxylase [EC 1.14. 13.7] catalyzes the degradation of

phenol by the addition of OH (hydroxyl) groups to their substrate during
oxidation reactions via two different pathways initiated either by ortho or
meta cleavage (Zharikova et al., 2022). Unlike the previous enzymes, the
genes responsible for the ortho-cleavage pathway are generally situated on
the chromosome. These enzymes from the ortho-mechanisms of the 3-
oxoadipate pathway for phenol degradation is catechol are called 1, 2
dioxygenase. These enzymes are often used with defined or undefined
content for aerobic degradation of aromatic compounds (Soal et al., 2022).
Phenol hydroxylase catalyzes the attachment of a hydroxyl group at

the ortho-position of the aromatic ring, thus hydroxylating phenol to
catechol. This reaction is realized by an enzyme characterized as an NADP-
dependent flavin monooxygenase and is the first step in the degradation of
aromatic compounds in microorganisms (Pandolfo et al., 2023). All
monooxygenases include one atom of molecular oxygen in the
corresponding substrate, while the other oxygen atom is reduced to H2O by a
hydrogen donor which is different for every enzyme (Deng et al., 2022).
Other than phenol, which is the preferred substrate for phenol hydroxylase,
this enzyme can catalyze the hydroxylation of hydroxyl-, amino-, halogen-,
or methyl-substituted phenols (Setlhare et al., 2020).
In the genus Pseudomonas, the structural gene for phenol hydroxylase

was plasmid determined, and the gene was sequenced and cloned. It was
found that this gene had 46% homology with 2, 4-dichlorophenol
hydroxylase from A. eutrophus (Wang et al., 2023).
35
1.8 Genetic factors controlling phenol degradation ability
The genes encoding upper- and lower-pathway enzymes that

mentioned previously are often clustered into operons, and the varied
combinations of upper and lower pathways provide diverse functions. The
ability of degrading phenol has been linked with the presence of plasmids in
Pseudomonas spp (Suenaga et al., 2009). It is known that the pheAB operon
is flanked by two insertion sequence (IS) elements that are involved in the
activation of phenol genes and in horizontal gene transfer. Genes responsible
for the degradation of organic pollutants have usually been allocated to the
megaplasmid pVI 150 (Miyazaki, 2014).
Upper- and lower-pathway enzyme genes are frequently clustered into

operons, and the various combinations of upper and lower pathways give
distinct activities (Sanghvi et al., 2020). Point mutations along with other
gene rearrangements (for example, insertion, deletion, duplication, and
inversion) increase the functional variety of genes and gene clusters. The
presence of foreign chemicals may result in the selection of mutant bacteria
that can metabolize them (Mohapatra and Phale, 2021). Aromatic catabolism
genes are frequently carried by mobile genetic elements (plasmids,
transposons, integrative and conjugative elements, for example), which
successfully disseminate the catabolic properties to phylogenetically distinct
bacteria (Bhatt et al., 2021).
DNAs in bacteria (or considered non mobile when detected in the

chromosome) mostly these genes are organized by the operon (Suenaga et
al., 2009). The (Methyl) phenol dmp operon encoded the dmpN gene,
participates in degrading phenols after dmp operon is expressed. The
36
transcription of the dmp operon from the operon promoter. This operon is
tightly regulated by the divergently transcribed dmpR gene (Mohapatra and
Phale, 2021). Beside dmpR gene, there are fifteen structural genes
responsible for phenol degradation pathway. Over expression of this operon
will accelerate the process (Divyasorubini et al., 2021), figure (1-7(.
Figure (1-7): Genetic organization of phenol degradation gene clusters (Suenaga et

al., 2009).
1.9 Molecular approach for identification of catechol

dioxygenases responsible for phenol biodegradation
Rapid and precise methods for monitoring, finding, and identifying

the new bacteria and their catabolic genes involved in the breakdown of
xenobiotics have been made possible by recent advancements in molecular
biology-based approaches (Rajan et al., 2023). The knowledge of the
makeup, phylogeny, and physiology of the metabolically active members of
37
the microbial community in the environment has also increased as a result of

the use of these approaches in bioremediation (Bala et al., 2022). Recent
advances in metagenomics, complete genome sequencing, and genome
editing technology have opened the way for the discovery of new
contaminants involving degradative genes and associated governing factors
in microbes from the environment (Rajan et al., 2023).
In the past, distinct microorganisms in environmental samples have

been identified utilizing DNA hybridization methods using tagged DNA as a
specific probe (Nelson-Filho et al., 2011; Ansari et al., 2023). In
Pseudomonas, many plasmid-encoded genes, including TOL, NAH, SAL,
and others, have also been discovered to use aromatic chemicals (Bhatt et
al., 2021). Now, reverse transcriptase (RT)/PCR and PCR amplification of
nucleic acids have been effectively used to detect certain genes and their
activity in samples of nucleic acids from a variety of cultures (Srivastava
and Prasad, 2023). When they found in chromosomes, genes for the
breakdown of organic pollutants have typically been assigned to plasmid
DNAs in bacteria or are thought to be nonmobile (Kotoky et al., 2022). One
of the main pathways for the microbial breakdown of aromatic compounds is
the catechol meta-cleavage process (Kumari and Das, 2023).
Different native Pseudomonas species have been shown to have the

acquired PheBA phenol degradation operon, according to Peters et al.
(1997) and Xu et al. (2021). Pseudomonads can utilize phenol as a growth
substrate when the pheA gene, which encodes phenol monooxygenase and is
connected to the pheBA operon, is expressed. In these nine phe operons, the
phe genes were arranged in the same way and coupled to the same promoter
as they were in the original pheBA operon (Elken et al., 2020).
38
1.10 Biostimulation and bioaugmentation experiments using

pseudomonas spp.
Even though some species of Pseudomonas are known to cause severe

environmental damage, the majority of these microorganisms are either
harmless or even helpful to the world around them. Pseudomonas species,
specifically P. fluorescens, P. protegens, P. putida, P. chlororaphis, and P.
stutzeri, have been implicated as playing a role in each of the
aforementioned mechanisms (Trouillon et al., 2021). Some of these species
are even utilized by the agricultural industry as biocontrol agents in order to
boost crop yields (Panpatte et al., 2016). The fact that the bacteria belonging
to the genus Pseudomonas can live in such a diverse range of ecosystems is
evidence of the bacteria's remarkable capacity for adaptation. Because of the
diversity and complexity of these organisms, they make excellent platforms
for the biotechnological development of synthetic biology tools (Ke et al.,
2021).
According to Martinez-Garcia and de Lorenzo (2019), one more

factor that contributed to the scientific community's preference for
Pseudomonas strains was the wide variety of molecular methods that are
available for altering the genetic make-up of Pseudomonas strains. Poly
aromatic hydrocarbons, also known as PAHs, have a high level of
hydrophobicity, which contributes to their persistence and toxicity to both
humans and the environment (Parthipan et al., 2022). There are significant
health risks associated with PAH contamination of soil because of the
persistence, toxicity, mutagenicity, and carcinogenicity effects that have
been demonstrated for PAHs (Sharma, 2022). Extraction of PAHs from
contaminated soils has been attempted using a variety of techniques,
39
including phytoremediation, photocatalytic remediation, electrochemical

remediation, thermal destruction, microbial degradation (bioremediation),
and thermal destruction (Kalantary et al., 2014; Ambaye et al., 2022).
There are three main categories of nutrients for microbial metabolism:

macro nutrients, micro nutrients, and trace elements, all of which were
investigated in order to determine the optimal nutritional composition for the
bioremediation of PAHs in contaminated soils (Curiel-Alegre et al., 2022).
Bacteria and other microorganisms require nutrients in order to survive.
However, carbon is typically required in large quantities, and it is possible
for target pollutants to supply this (Salari et al., 2022). Temperature, pH, and
the accessibility of the substrate to microorganisms, oxygen, and nutrients,
as well as the presence of electron acceptors and the addition of macro and
micro elements, are some of the physical and chemical factors of the
reaction medium that can have an effect on the efficiency of the process (Lin
et al., 2023).
According to many researchs, two processes, namely biostimulation

and bioaugmentation, are typically carried out in order to improve the
bioremediation of soils that have been contaminated with hydrocarbons
(Curiel-Alegre et al., 2022). Biostimulation is the process of adding
nutrients, macro and micro elements, oxygen, or other chemicals to a
polluted site in order to increase the capacity of microorganisms to degrade
pollutants (Ambaye et al., 2022). These chemicals may have an effect on the
bacterial conditions (Sonwani et al., 2021).
Bioaugmentation is the practice of supplementing naturally occurring

microorganisms with an inoculum of pollutant-degrading microorganisms
40
for the purpose of maximizing degradation and, in some cases, boosting the
native microbes' catabolic activities (Kotoky et al., 2022). Despite being a
fast, publically adaptable, widely applicable, and versatile alternative for
PAH degradation, its efficacy and predictability have been shown to be
variable (Kong et al., 2018). Incorporating pure cultures or mixed cultures of
bacteria, archaea, fungi, and algae into a bioaugmentation strategy for PAH
degradation is a viable option (Alao and Adebayo, 2022). There are two
types of PAH degradation that can happen thanks to microorganisms:
aerobic degradation (when oxygen is present) and anaerobic degradation
(when oxygen is absent) (Patel et al., 2020).
Plackett– Burman was chosen as the experimental design to use in

liquid culture medium optimization due to its capability of taking into
consideration a large number of variables. This was done in order to
investigate the effect of a number of macro, micro, and trace nutrients
(Ahmad et al., 2021).
Chauhan et al. (2007) used this design for lactic acid production by
Lactobacillus sp. using date juice. This design is one of many that are
carried out in accordance with the Plackett–Burman experimental design.
Plackett–Burman was the experimental design that Zhou et al. (2011) used
for their research on phenol degradation. According to the findings of
Kalantary et al. (2014), the removal of phenanthrene from contaminated soil
sample was experimented with using the same experimental design
regardless of whether different macro and/or micronutrients and trace
elements were added to mineral salt medium (MSM).
41
Chapter Two Materials and Methods
Materials and Methods

2.1 Materials
2.1.1 Equipment and apparatus
Table (2-1): Equipment and apparatus used in this study are listed below:
Manufacturing Company
No. Equipment and Apparatus
(Origin)
1 Autoclave Sukura (Japan)
2 Centrifuge Fisher Scientific (USA)
3 Cooling centrifuge LKB (Sweden)
4 Compound light microscope Olympus (Japan)
5 Dialysis bags and Millipore syringe filters Sigma-Aldrich (USA)
6 Digital camera Sony (Japan)
7 Eppendorf tubes Promega (USA)
8 Gas chromatography instrument DANI (Italy)
9 Gel electrophoresis apparatus with power supply Cleaver scientific (Taiwan)
Gradient thermocycler polymerase chain reaction
10 TECHNE-5000 (USA)
apparatus
11 Hot plate with magnetic stirrer Panasonic (Japan)
12 Incubator Memmert (Germany)
13 Laminar air flow hood Olympus
14 Micropipette (different sizes) Human (Germany)
15 Microwave Shownic (China)
16 MSE Soniprep 150 Ultrasonic processor MSE (UK)
17 Nanodrop spectrophotometer Guangzhou (China)
18 Oven SherWood (USA)
24
19 Portable pH meter Hanna (Romania)

20 Sensitive balance Sartorius (Germany)
21 Shaker incubator Mrc (Germany)
22 Spectrophotometer Shimadzu (Japan)
23 UV-Transilluminator U.V.P (USA)
24 Vitek 2 system Biomerieux (France)
25 Vortex Labco (Germany)
26 Water bath Dragon-med (Spain)
27 Water distillatory Gallenkamp (UK)
2.1.2 Chemicals and solutions

Table (2-2): Chemicals and solutions used in this study are listed below:
Manufacturing
No. Chemicals and Solutions
Company (Origin)
Potassium Phosphate Dibasic (K2HPO4), Potassium
1 Analar (UK)
Phosphate Monobasic (KH2PO4)
2 Bovine Serum Albumin (BSA) AFCO (India)
Ammonium Chloride (NH4Cl), Ammonium Hydroxide
(NH4OH), Calcium Chloride (CaCl2), Glycerol
3 (C3H8O3), N-N-N-N-tetramethyl- paraphenylenediamine BDH (UK)
dihydrochloride, Sodium Chloride (NaCl), Sodium
Hydroxide (NaOH)
EDTA (C10H16N2O8), Hydrogen peroxide (H2O2),
4 Fluka (Switzerland)
Tris-base
5 Absolute ethanol (99%), Gram stain reagents GFS (Canada)
24
GFS-Chemicals
6 Hydrochloric acid (HCl), Phosphoric acid (H3PO4)
(Germany)
7 Arginine Deaminase, Catechol, Tryptone Indiamart (India)
8 DEAE-Cellulose, Sephacryl S-1000 Pharmacia (Sweden)
4- Aminoantipyrine Powder (C11H13N3O), Ammonium
Sulphate [(NH4)2SO4], Calcium, Catalase, Chloride
Dihydrate (CaCl2. 2H2O), Coomassie Brilliant Blue G-
250, Dextran Blue Dye, Magnesium Sulphate Sigma-Aldrich
9
Heptahydrate (MgSO4. 7H2O), Manganese Sulphate (USA)
Heptahydrate (MnSO4. 7H2O), Mercury (II) Chloride
(Hgcl2), Methanol (CH3OH), Pepsin, Phenol, Phosphate
alkaline, Potassium Ferricyanide (K3[Fe(CN)6])
10 Ferric Chloride (FeCl3), yeast Extract Spectrum (USA)
2.1.3 Kits
Table (2-3): Contents of kits packages used in this study are listed below:
Manufacturing Company
No. Kits
(Origin)
ABIO pureTM DNA extraction kit (Cell Lysis
Solution, Nuclei Lysis Solution, Protein
1 Promega (USA)
Precipitation Solution, DNA Rehydration Solution,
RNase A Solution)
2 Vitek 2 GNID (Gram negative identification) Biomerieux (France)
22
2.1.4 Culture media

Table (2-4): Culture media used in this study are listed below:
Manufacturing
No. Culture media
Company (Origin)
1 Agar-agar, Brain heart infusion agar, Brain heart Himedia (India)
infusion broth, MacConkey agar, Nutrient agar,
Pseudomonas agar base with CFC supplement.
2 Nutrient broth. Mast (UK)
2.1.5 Other materials used in molecular study

Table (2-5): Materials used in molecular part of this study are listed below:
Manufacturing
Materials
company (Origin)
 Agarose
 Deionized nuclease –free water.
 100bp DNA ladder (100, 200, 300, 400, 500, 600,
700, 800, 900, 1000, and 1500 bp)
 DNA Loading dye
 Ethidium bromide Promega (USA)
 Nuclease free water
 Polymerase chain reaction mastermix ( GoTaq Green
Master Mix 2x, 3mM MgCl2, 400mM dATP,
400mM dGTP, 400Mm dCTP, 400Mm dTTP)
 10x TBE (Tris-Borate EDTA) Buffer
24
2.1.6 Primers
Table (2-6): Primers used in this study, their sequences and amplified molecular
sizes (Macrogen/ South Korea):
Gene Primer Product Reference

Sequence 5′→3′
name Name size
16S F AGAGTTTGATCCTGGCTCAG Altaai et al.,
956 bp
rDNA R CTTGTGCGGGCCCCCGTCAATTC 2014
F AAACCCGCGCTTCAAGCAGAT Tian et al.,

cat1 650 bp
R AAGTGGATCTGCGTGGTCAGG 2017
F TGATCGAGATGGACCGTGACG Tian et al.,
cat2 821 bp
R TCAGGTCAGCACGGTCATGAA 2017
F GAGTGGACGTGAATCAGTAC designed in the
CatABC 889 bp
R GGCGTACCTCATATTGTTCTT current study
24
2.2 Methods
2.2.1 Preparation and sterilization of reagents and solutions
All reagents and solutions that prepared in this study had their pH
adjusted using HCl (1 M) and NaOH (1 M) according to the needed values
and sterilized (if needed) by autoclaving, filtration with Millipore syringe
filters (different sizes as needed), filter paper, etc.
2.2.1.1 Reagents
 Catalase reagent
The catalase reagent was prepared by mixing 5 ml of 6% hydrogen
peroxide (H2O2) with 5 ml distilled water to get final concentration 3%, then
kept in dark bottle in a refrigerator. This solution was used then to
distinguish the ability of the isolates of bacteria to produce catalase enzyme
(Atlas, 2010).
 Oxidase reagent
This reagent was prepared by dissolving 0.1gm of N-N-N-N-
tetramethyl- paraphenylenediamine dihydrochloride in 10 ml of distilled
water to get final concentration 1%, and stored in dark bottle in the
refrigerator. The solution should be used within a week, and it was used to
detect oxidase production in Pseudomomas sp. isolates (Cappuccino and
Welsh, 2017).
2.2.1.2 Solutions
 Phenol stock solution
Phenol working solutions (100, 250, 500, 750, and 1000 ppm)
were prepared by adding a known amount of phenol crystals to a known
volume of double distilled water (pH 10). Taking in consideration that (1
24
ppm = 1 mg per liter). The solutions were filter sterilized by passing them
through a 0.25µm syringe filter as follows:
1. An amount of 100 mg of phenol were added to 1000 ml of double
distilled water to prepare 100 ppm of initial concentration of phenol.
5. An amount of 1000 mg (1 g) of phenol were added to 1000 ml of
double distilled water to prepare 1000 ppm of initial concentration of
phenol (Mohanty, 2012).
 Solutions for 4-aminoantipyrine method of phenol

determination
The following solutions were prepared according to Amteghy
(2022):
 Ammonium hydroxide- ammonium chloride buffer: It was
prepared by dissolving NH4Cl (16.9 g) in 143 ml of concentrated
NH4OH and diluted to 250 ml with double distilled water.
 Aminoantipyrine solution: This solution was prepared by dissolving
adequate amount of 4-aminoantipyrine (2 g) in distilled water, then
the volume was made up to 100 ml.
24
 Potassium ferricyanide solution: The third solution was prepared by

dissolving potassium ferricyanide (8 g) in distilled water and the
volume was made up to 100 ml.
 Solutions used for enzyme purification and

characterization
The following solutions were prepared according
to Abdullah et al. (2021):
 Arginine deaminase solution: It was prepared by dissolving 1 g of
the powder in 10 ml of distilled water to form a clear and colorless
solution. The pH was adjusted to 6.2.
 Catalase 5% stock solution: It was prepared by mixing 1 ml of

catalase with 15 ml of distilled water, the volume was completed to 20
ml with distilled water.
 Hydrochloric acid HCl (0.5 M): It was prepared by the addition of

40 ml of distilled water in a 1000 ml volumetric flask, and slowly 43
ml of hydrochloric acid were added.
 Hydrochloric acid HCl (1 M): It was prepared by the addition of 82

ml of concentrated solution to 918 ml of distilled water to prepare 1
liter of 1 M hydrochloric acid solution.
 Pepsin 1 % solution: It was prepared by dissolving 0.1 g of

powdered pepsin in 9.9 ml of distilled water.
24
 Sodium chloride NaCl (0.25 M): It was prepared by adding 14.61 g

of sodium chloride to suitable volume of D.W., then the volume was
completed to 1 liter with D.W.
 Sodium hydroxide NaOH (0.25 M): This solution was prepared by

dissolving 4.9 g of sodium hydroxide in suitable amount of D.W, then
the volume was completed to 500 ml with D.W.
 Tris -HCl buffer (50 mM): It was prepared by dissolving 1.211 g of

tris base in 90 ml of D.W, then the pH was adjusted using HCl (1M)
according to the needed values.
 Solutions used for protein assay

For protein determination, the Bradford technique (1976) was
employed to prepare the following solutions:
 Bovine serum albumin stock solution (BSA) (100 mg/ml): It was

prepared by dissolving 1 g of BSA in 10 ml of distilled water.
 Coomassie brilliant blue (G-250) (Bradford reagent): It was

prepared by dissolving 0.1 g of Coomassie brilliant blue G-250 in 50
ml of absolute ethanol. One hundred millimeters of phosphoric acid
85% was added, mixed well, then the volume was completed to 1 L
with D.W, filtered using filter paper (Whatman No. 1) and kept in
dark bottles.
45
 Sodium hydroxide NaOH (1M): It was prepared by dissolving 40 g

of sodium hydroxide in 950 ml of distilled water, and the volume was
completed to 1 liter.
 EDTA solution (0.02 M): It was prepared by dissolving 0.744 g of

EDTA in 100 ml of D.W, then pH was adjusted to 7.5.
 Solutions for gel electrophoresis

 Ethidium bromide dye (10 mg/ml): It was prepared in a
concentration of 10 mg/ml by dissolving 1g of the dye in 100 ml of
sterile D.W and stored at 2-8°C in a dark bottle.
 Tris-borate EDTA (TBE): Working buffer (1X) was prepared by
adding 100 ml of TBE buffer (10 X) to 900 ml of D.W (Sambrook et
al., 1989).
2.2.2 Preparation of culture media

All culture media were sterilized by autoclaving at 121˚C for 15 min
at 15 pound/inch2, thereafter they used as needed. Moreover, pH was
adjusted by adding HCl (1 M) or NaOH (1 M) as needed. The used media
were divided as follows:
2.2.2.1 Ready to use media
Ready to use media were prepared according to the manufacturing
company instructions including brain heart infusion agar, brain heart
infusion broth, macConkey agar, nutrient agar, and nutrient broth. The
ingredients of these media were dissolved in distilled water (D.W.), then
boiled in water bath to dissolve all the ingredients completely. The media
were autoclaved at 121˚C for 15 min at 15 pound/inch 2, cooled, and then
45
poured into sterile Petri dishes. In order to ensure sterility, the petri dishes
were incubated at 37 ºC for 24 hours.
2.2.2.2 Laboratory prepared media
 Mineral salt medium
This medium was prepared according to Mohanty (2012) by melting
the ingredients as follows: K2HPO4 (500 mg), KH2PO4 (250 mg), NaCl (0.5
g), (NH4)2SO4 (230 mg), CaCl2.2H2O (7.5 mg), MgSO4.7H2O (100 mg),
MnSO4.7H2O (100 mg), and FeCl3 (1 mg). All these ingredients were melted
in 100 ml of distilled water and the volume was completed to 1000 ml,
autoclaved at 121˚C for 15 min at 15 pound/inch2, and used (pH was
adjusted to 7). The medium was used for growing and identifying phenol
degrading bacteria after the addition of phenol (according to the needed
values) as a sole source of carbon. If mineral salt medium plates were
needed, they were prepared by the same procedure with the addition of 2%
of agar to solidify the medium).
 Pseudomonas agar base with C.F.C (Cephalothin, Fucidin,

Cetrimide) supplement
This medium was prepared according to the manufacturing company
(Himedia) by suspending 24.2 g in 500 ml of purified/distilled water
containing 5 ml of glycerol, then, heated to boiling to dissolve the medium
completely. Autoclaved at 121˚C for 15 min at 15 pound/inch2, cooled to 45-
50 ºC and the sterile contents of the rehydrated vial of C.F.C (Cephalothin,
Fucidin, Cetrimide) Supplement (FD036) with 2 ml of sterile distilled water
was added aseptically and mixed well with Pseudomonas agar base, and
poured into sterile petri plates. This medium was used for the selective
isolation of Pseudomonas spp samples.
44
2.3 Collection of soil samples from different locations

From the beginning of April 2021 till the end of August 2021, a total
of 125 soil samples were collected from different locations at Baghdad city/
Iraq that have been contaminated with petroleum compounds. The samples
were distributed as 83/125 (66.4%) samples that collected from different
locations at Al-Daura refinery and 42/125 (33.6%) samples from private
electricity generators of six municipalities at Baghdad city including:
Municipality of Karkh, Municipality of Rusafa, Municipality of New
Baghdad, Municipality of Adhamiya, Municipality of Kadhimiya, and
Municipality of Mansour.
A soil profile of 3-10 cm under the surface was sampled after the
removal of the top layer of the soil up to 1-2 cm (Bang-Andreasen et al.,
2017). Using a sterilized spatula, three subsamples of 5 g were collected
from random locations within each plot, and transferred to sterile plastic
bags. Before being transported to the laboratory, samples were kept in a
refrigerator at 4°C. Using a sieve with a mesh size of 3 millimeters, stones
and other undesirable soil particles were removed in the laboratory
(Žvirgždas et al., 2023).
2.4 Enumeration of bacteria using serial dilution plate

technique
A serial dilution is the repeated dilution of a solution to amplify the
dilution factor quickly. It is commonly performed in experiments requiring
highly diluted solutions, such as determining the density of bacteria
depending on the number of colony forming units (CFU/ ml). The
microorganisms in soil samples were isolated and enumerated using the
44
serial dilution plate technique for each sample (Sanders, 2012). Various
dilutions from a suspension of soil samples were prepared as follows:
 Six test tubes with 9 ml of sterilized distilled water were prepared,
labeled from 10-1 to 10-6.
 To get 1:10 dilution number, an amount of 1 g was taken from each
soil sample, suspended in 9 ml of sterilized distilled water and the
mixture was shacked vigorously to ensure homogeneity.
 For the second serial dilution, 1 ml of the suspension in the previous
step was taken by micropipette to get 1:100 dilution number, and so
on reaching to the 6th serial dilution.
The colony forming units (CFU) were estimated by counting the
number of the colonies in each plate as follows:
CFU/ ml = ……………. (Kim et al., 2012)
In order for the results to be statistically reliable, each experiment is

also conducted in triplicate. The advantage of this method is that only viable
bacteria are counted, and the dilutions make it possible to calculate any
number of bacteria, regardless of their initial concentration (Boukouvalas et
al., 2019).
2.5 Isolation of phenol-degrading bacteria by enrichment

method
The bacteria were isolated by cultivating an appropriate volume of
soil suspension in the mineral salt liquid medium (MSM). Ninety milliliters
of this medium were distributed in 250 ml conical flasks and 10 ml of
42
phenol with an initial concentration of 100 ppm were added to the flasks as a
source of carbon and energy (phenol concentration was set in a gradient of
250, 500, 750, and 1000 ppm). Before the addition of phenol, the media was
sterilized by autoclaving and the phenol was previously sterilized by filter
sterilization. The media supplemented with phenol were all inoculated with
10 ml of soil suspensions and incubated at 30°C in an orbital shaking
incubator at 150 rpm for 24-48 hours. The growth was observed as
evidenced by medium turbidity after incubation (Manual and Civil, 2018).
Many dilutions were performed and each dilution gradient was evenly
spread on an mineral salt solid medium (supplemented with phenol) and
incubated in a constant temperature incubator at 30°C for 24 hours. A
number of different colonies were selected and subsequently streaked on
plates from the same solid medium. The process was repeated several times
to ensure the purity of the cultures. Then the isolates were preserved on
nutrient agar slants. The previous steps were performed according to Hassan
(2014).
2.6 Isolation of Pseudomonas spp. isolates from the total

number of phenol-degrading isolates
Phenol-degrading isolates were subjected to some differential and
selective culture media like MacConkey agar and Pseudomonas agar
(prepared as mentioned in section 2.2.2.2). The bacterial cultures obtained
from the previous step were inoculated on the plates of these media with a
sterile loop and incubated at 30ºC for 24-48 hours.
44
2.7 Identification of Pseudomonas spp. isolates

2.7.1 Morphological examination
Initial identification was performed to the targeted isolates based on
morphological characteristic of the colonies including: shape, texture, luster,
color and edges that observed after the bacterial growth on nutrient agar,
macConkey agar, and Pseudomonas agar (Midhat and Abed, 2023). Gram
staining was also performed to determine whether the tested isolates were
gram positive or negative and to test the shape of the resulted colonies under
the microscope (Coico, 2006; Shahnaz et al., 2020).
2.7.2 Biochemical characteristics

2.7.2.1 Oxidase test
This test was employed to detect the bacterial ability to produce oxidase
enzyme. It was done by saturating a filter paper with oxidase reagent
(paragraph 2.2.1.1) and placed in a Petri dish. A tested colony was
transferred to the filter paper and rubbed onto the reagent with a sterile
wooden stick. A violet or purple color should develop within 10 to 30
seconds in the case of the positive reaction. Delayed reactions should be
ignored (Wellinghausen et al., 2005; Aryal, 2022).
2.7.2.2 Catalase test
The slide method was used for the detection of catalase enzyme
activity. An amount of pure growth was transferred by a wooden stick to a
microscope slide, and a drop of 3% hydrogen peroxide was added on the
colony. This test was used to detect the ability of the tested bacteria to
44
produce catalase enzyme. Appearance of bubbles was taken as catalase

positive (Reiner, 2010; Aryal, 2018).
2.7.2.3 Growth ability at 42ºC and 4ºC
All the isolates were cultured on nutrient agar, two plates for each
sample were prepared, first plate was incubated at 42°C, and the other was
incubated at 4°C for 24-48 hours. Bacterial growth at each temperature was
examined .The presence of heavy growth indicates a positive result (Hassan,
2014).
2.7.3 Detection of bacteria using VITEK2-compact
The identification of Pseudomonas sp. was confirmed by using

VITEK2- Compact which represents an advanced colorimetric technology
for bacterial identification. Gram negative (GN) card was used for
Pseudomonas sp. identification. All the following steps were done
according to the manufactures instructions (Bio Merieux, France) as follows:
 Three milliliters of sterile saline (aqueous 0.45% NaCl) was placed

in a clear test tube and inoculated with an isolated colony from the
pure culture.
 The test tube was checked for turbidity by insertion into the Dens
Check device for standardization of the bacterial suspension to
McFarland standard solution (1.5x108 cfu /ml).
 The test tube which contain the standardized inoculum was placed
into the cassette and the identification card was placed in the
neighboring slot, then the identification number of the sample was
entered into the computer software via barcode.
44
 The VITEK-2 card type was then read from barcode placed on the
card by the manufacturer and the card was thus connected to the
sample identification port.
 The filled cassette was placed manually into a vacuum chamber

station; when the card was filled, it was transported to the optical
system for incubation and reading of the reaction.
 All the subsequent steps for identification were carried out by the
instrument which controls the incubation temperature, the optical
reading of the cards and continuously monitors and transfers test
data to the computer for analysis. When the test cycle was
completed, the system automatically ejected the cards into a waste
container.
2.7.4 Molecular diagnosis of bacteria

2.7.4.1 Extraction of genomic DNA
Total genomic DNA was extracted from all Pseudomonas sp. positive
isolates with 105 CFU/ ml using the commercial purification system
(ABIOpureTM Total DNA Extraction Kit). DNA of each isolate was
extracted depending on the bacterial protocol for gram negative bacteria
which summarized as follows:
1. Bacterial cells were prepared by incubating the culture for 12-24
hours at 30°C, with gentle shaking. Bacterial cells were harvested
directly or could be store at -20°C for future use.
44
2. Harvested cells were transferred to 1.5 ml of micro centrifuge tubes,

then centrifuged via cooling centrifugation for 1min at 13,000 rpm.
The supernatant was discarded.
3. The pellet was resuspended in 200 µl of the CL Buffer (lysis buffer).
4. With micropipette, 20 µl of Proteinase K solution (20 mg/ ml) was
added and it was vigorously vortexed to be entirely mixed followed
by incubation at 56˚C for 15minutes. After complete lysis, the lysis
mixture should turn from turbid to clear. If lysate still cloudy or turbid
it should be incubated for further time until the lysate became clear
lacking of any particles.
5. Two hundred microliter of BL buffer was added to the above tubes
followed by vortexing to mix broadly. The tubes were incubated for
10 minutes at 70˚C. The tubes were spun down briefly to remove all
drops from the Eppendorf lids.
6. Two hundred microliter of absolute ethanol was added to each
sample, pulse vortexing to mix the samples well, and tubes were spun
down for a short time to remove all the drops from Eppendorf lids.
7. The mixtures were transferred to mini column sensibly, centrifuged
for one minute at 13,000 rpm, and then the collection tubes were
replaced with new ones.
8. Six hundred microliter of BW Buffer were added, then centrifuged for
one minute at 11,000 rpm, then replace the collection tubes with new
ones.
9. Seven hundred microliter of TW Buffer was applied; then centrifuged
for sixty seconds at 11,000 rpm. Discarded the pass through, and then
a mini-columns were put into collection tubes again.
44
10. The above tubes were centrifuged at the full speed (>13,000 rpm), for
sixty seconds to remove the residual washing buffer. Then the mini
columns were placed into new 1.5 ml tubes.
11. Two hundred microliter of sterilized water or AE Buffer was added,
then incubated at room temperature for 1minute, as well as being
centrifuged for sixty seconds, at >13,000 rpm (The full speed).
12. The purified DNA samples were distributed in mini Eppendorf tubes
and then stored at 2–8°C for next procedures.
2.7.4.2 DNA concentration and purity

Nanodrop was used to measure the concentration and purity of DNA.
DNA sample (1 μl) was used to measure the optical density (O.D) at the
wavelengths of 260 nm and 280 nm. The purity calculated according to the
following equation :-
DNA purity = O.D.260 nm / O.D.280 nm
Pure DNA ranged between 1.8 and 1.9, while ≥ 1.9 referred to RNA
contamination and ≤ 1.9 referred to protein contamination (García-Alegría et
al., 2020).
2.7.4.3 PCR amplification

The housekeeping gene (HKG) 16S rDNA was used for the molecular
identification of Pseudomonas spp. isolates. The product size and primer
sequence were listed in table (2-6). The forward and the reverse primers
have been prepared according to the information of the manufacturing
company to obtain the first stock of 100 pmol/µl, then they were stored in a
deep freezer after dividing them into small tubes for later use. The stock
45
solution was diluted to be used later in PCR mixture by mixing 10 µl from

the original stock solution with 90 µl of nuclease free water to get 10
pmol/µl as a final concentration.
The PCR mixture of the mentioned gene was composed of 12.5 µl of
GoTaq®Green master mix (1x), 2 µl of template DNA; 1 µl from each of
forward and reverse primers (final concentration was 0.6 pmol/µl), and 8.5
µl of nuclease Free water to reach the final volume of 25 µl. Then, the
Eppendorf tubes were mixed shortly with vortex before being placed in PCR
apparatus. For negative control, the same previous mixture of PCR was used
without adding the templates of DNA.
The reaction of PCR was then carried out after optimization using the
following program: 2 minutes of initial denaturation at 95°C, followed by 25
cycles of three stages: denaturation at 94°C for 20 seconds, annealing at
58°C for 20 seconds, and extension at 72°C for 40 seconds. Finally, final
extension temperature was adjusted to 72 °C for one minute. PCR results
were visualized on gel electrophoresis of 1% agarose directly or saved in
deep freezer for another time (Altaai et al., 2014).
2.8 Preservation of Pseudomonas sp. positive isolates

2.8.1 Short term preservation
Pseudomonas sp. positive isolates were preserved after the insurances
of its purification by transferring single pure isolated colony to nutrient agar
slant in screw-capped tube, incubated overnight at 30ºC, then stored in the
refrigerator at 4°C for a short period preservation reaches to few weeks
(Aldoori, 2018).
45
2.8.2 Long term preservation

Pseudomonas sp. positive isolates were preserved after the insurances
of its purification by transferring single pure isolated colony to 20% glycerol
with brain heart infusion broth medium (this preservation medium was
prepared by adding 20 ml of glycerol to 80 ml of brain heart infusion broth
(BHIB). Then 10 ml from this medium was dispensed in each sterile and
well-capped screwed test tube, autoclaved at 121°C and 15 pound/inch 2 for
15 minutes and cooled to 37ºC. It was used for preserving bacterial isolates
for long period (1-8 months or more) at -20°C (Aldoori, 2018).
2.9 Growth and phenol degradation behavior of Pseudomonas

spp. isolates
All phenol-degrading Pseudomonas spp. isolates were inoculated in a
sterilized mineral salt liquid medium (MSM), and supplemented with four
initial concentrations of phenol (250 ppm, 500 ppm, 750 ppm, and 1000
ppm) as mentioned in paragraph (2.2.1.2). Ninety milliliters of MS medium
were distributed in 250 ml conical flasks and 10 ml of phenol with a
concentration of 250 ppm were added to all the flasks as a source of carbon
and energy. Then, the flasks were inoculated with 10 ml (10-5) of bacterial
suspensions and incubated at 30°C in an orbital shaking incubator at 200
rpm for a week (168 hours). The same previous technique was repeated
using the other three concentrations of phenol (500, 750, and 1000 ppm).
The growth was observed as evidenced by medium turbidity after incubation
(Mohanty, 2012; Manual and Civil, 2018).
Every day, one hundred microliters of the growth obtained from the
liquid medium was taken by a micropipette from each flask and plated on
phenol-containing MSM plates, incubated at 30°C for 24 hours to insure the
44
viability of the isolates till the last day of the experiment. The previous steps
were performed according to Mohanty (2012) and Hassan (2014).
2.9.1 Determination of phenol residual and biomass in medium

Residual phenol concentrations in the MSM solutions of the tested
isolates of Pseudomonas spp. was determined by a modified colorimetric
technique 4- aminoantipyrine method as suggested by Mohanty and Jena
(2017). In this method phenolic material reacts with 4-Aminoantipyrine in
the presence of potassium ferricyanide at a pH 10 to produce a purple-red
indoleantipyrine (a colored end product), whose solution has the maximum
absorbance value at 510 nm. Calibration curve for the determination of
phenol by 4-aminoantipyrine method was prepared and showed in figure (2-
1).
0.35
0.3
0.25
0.2
y = 0.0002x + 0.1407
(600nm)
R2 = 0.9907
O.D
0.15
0.1
0.05
0
0 200 400 600 800 1000 1200
Concentration of phenol (in ppm)
Figure (2-1): Calibration curve for the determination of phenol by 4-

aminoantipyrine method.
44
The detailed procedure for determination of phenol will be described

below. Twenty-fold dilutions were made to the reagents ammonium
hydroxide, potassium ferricyanide, and 4-aminoantipyrine to enable the use
of 5-ml phenol samples instead of 100-ml. The equation used for the
determination of residual phenol is as follows:
Phenol degradation rate (%)= ( )
Using the above mentioned solutions, the procedure will be as

follows:
1. The samples (100 ml) were prepared for work, and 10 ml of each
sample was centrifuged at approximately 8000 rpm for 20 minutes.
The supernatant was used for phenol determination. The buffer
solution (2 ml) mentioned in section (2.2.1.2) was added to the
supernatant and mixed properly. The pH of the sample should be 10 ±
0.2 (as 2 ml of the buffer is enough to adjust the pH of the solution at
10).
2. Then, 2 ml of 4-aminoantipyrine solution (section 2.2.1.2) was added
to the above mixture and mixed well.
3. Additionally, 2 ml potassium ferricyanide solution (section 2.2.1.2)
was also added to the above mixture and mixed thoroughly.
4. After that, phenol degradation abilities of the tested isolates were
observed after 15 minutes at 510 nm using spectrophotometer.
For measuring biomass, the samples were centrifuged at

approximately 8000 rpm for 20 minutes. The biomass attached to the walls
of tubes was resuspended in distilled water and optical density of this
42
suspension was measured against distilled water as reference at 600 nm

using UV–vis double beam spectrophotometer. All the transfers were made
in UV chamber, glasswares and medium properly autoclaved (Shaikh et al.,
2023).
2.10 Genotypic detection of catechol dioxygenases
2.10.1 Primers stock solutions preparation
The three primers for catechol dioxygenases (cat1, cat2, and catABC)
mentioned in table (2-6) were designed in the current study. They were
provided by (Macrogen, South Korea) in a lyophilized, dissolved in nuclease
free water to get the final concentration of 100 pmol/µl as recommended by
the provider, and stored in -20°C until use. The stock solution was diluted to
be used later in PCR mixture by mixing 10 µl from the original stock
solution with 90 µl of nuclease free water to get 10 pmol/µl as a final
concentration.
2.10.2 Gradient PCR amplification method
DNA templates of the targeted isolates were used to amplify the

catechol dioxygenase enzymes using specific primers: catechol 1,2-
dioxygenase (Cat1), catechol 2,3-dioxygenase (Cat2), and catechol
dioxygenase (catABC) genes by gradient PCR according to constant
conditions illustrated in table (2-7), but the annealing temperature for the
three genes was determined with a gradient number of temperatures ranging
from (56°C to 62°C). The PCR mixture was performed as mentioned in
(paragraph 2.8.4.3).
44
Table (2-7): Gradient PCR program used for the amplification of catechol
dioxygenase genes (cat1, cat2, and catABC) in P. aeruginosa and P. putida isolates.
Number of
Step Temperature Time
cycles
Initial Denaturation 94ºC 3 min 1
Denaturation 94ºC 30 sec
Cat1 62ºC
Annealing Cat2 60ºC 1 min 35
CatABC 58ºC
Extension 72ºC 1 min
Final extension 72ºC 7 min 1
2.10.3 Agarose gel electrophoresis

PCR products for HKG and catechol dioxygenase genes were
analyzed using agarose gel electrophoresis as illustrated by Sambrook and
Russell (2001) .It was achieved as demonstrated below:
1. Agarose concentration (1%) was equipped by adding one gram of
agarose to 100 ml of the (1X) TBE buffer (pH: 8).
2. The mixture was heated up by microwave until the agarose
completely being dissolved, and the gel was allowed to be cooled
down at 50-45 ºC.
3. Once cooling, 5μl of ethidium bromide was added to the mixture with
slow mixing with the dye to avoid air bubbles formation.
4. The tray with the comb were assembled together and the agarose
mixture was poured carefully in a tray to avoid air bubbles formation
44
and permitted to set for 30- 40 minutes to solidify at room

temperature.
5. The comb was gently removed from the tray and the gel was placed in
the electrophoresis chamber and filled by (1X) TBE buffer till the gel
surface being covered.
6. DNA samples (5µl) were transferred to the agarose wells within the
gel.
7. Finally, five µl of DNA ladder were mixed with 1µl of the loading
dye and placed in one of the wells (The first, last or in the middle
well). Commonly, 100bp of DNA ladder was used to evaluate the size
of PCR products.
8. UV transilluminator had been used to visualize PCR products via UV
light (336nm) and the gel was photographed using a digital camera.
2.10.4 PCR product sequencing

Uniplex PCR products for the amplified genes were stored at -20ºc
(Sequenced by sending 25µl of the product (3 isolates for each gene)
forward or reverse, separately to Macrogen, South Korea). Data were
analyzed through the usage of Geneious software (version 2019 prime) and
the results was read by comparing them with the NCBI control strains.
Query, Pairwise alignment and identity; and also anatomized with the same
software.
44
2.11 Optimization of physicochemical parameters to enhance

phenol degradation
Phenol is metabolized into simple compounds by phenol-degrading
bacteria. Hence, this process can be greatly affected by a number of
physicochemical parameters. The physicochemical parameters that
optimized for C12O enzyme in this study were the optimum incubation
temperature, the optimum pH, and the optimum phenol concentration that
may have an effect on the biodegradation ability of the tested bacteria for 36
hours. The optimization of these parameters was performed by applying one
factor at a time. In this method, one variable of the system is changed at a
time while keeping the others constant (Patil et al., 2023).
The initial parameters used in the present study were (25°C, 30°C,
35°C, and 40°C) for temperature and three pH ranges (6, 7, and 8) with three
initial concentrations of phenol (250, 500, and 750 ppm) for 16 hours. The
increase in optical density represents the increase in growth and biomass
under the optimum conditions of temperature and pH (Mohanty, 2012; Patil
et al., 2023).
2.12 Optimum conditions for catechol 1,2 -dioxygenase

production
Optimum conditions for catechol 1,2 -dioxygenase that produced by

the selected isolate were determined by inoculating 100 ml of the mineral
salt medium (supplemented with 100 ppm of phenol) at pH 7.4 with 1 ml of
fresh bacterial culture (O.D=600), and incubated overnight at 30 ºC. It was
settled in the shaker incubator at 120 rpm, and the enzyme activity as well as
protein concentration in the crude free extract was estimated. If the optimum
44
factor was known it will be used in the next experiment of optimization

(Kou and Li, 1990).
2.12.1 Optimum temperature for catechol 1, 2 -dioxygenase activity
The bacterial isolate was inoculated in mineral salt medium

(supplemented with 100 ppm of phenol) and incubated at different
temperatures (15ºC, 20ºC, 25ºC, 30ºC, 35ºC, and 40ºC) for 24 hours
(Barghoth et al., 2023).
2.12.2 Optimum pH for catechol 1, 2 -dioxygenase activity
The production medium (MSM) was prepared at different pH values

(5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0), then bacterial isolate was
inoculated in each one, incubated at 30Cº for 24 hours (Barghoth et al.,
2023).
2.13 Extraction of catechol 1, 2-dioxygenase enzyme
The bacterial isolate was grown overnight in 250 ml of MS medium

supplemented with 100 ppm of phenol at 30 °C. The bacterial cells were
disrupted by sonication with MSE Soniprep 150 Ultrasonic for 10 minutes
(30 seconds on, 30 seconds off). Sonicated cells were centrifuged at 4°C for
30 minutes at 8000 rpm to remove cell debris. The crude extract was
prepared according to Calero et al. (2022) with slight modification.
2.13.1 Activity assay of catechol 1,2 -dioxygenase
The catechol 1,2 -dioxygenase (intradiol) activity was monitored

spectrophotometrically by the increasing activity of the enzyme which refers
44
to the formation of cis, cis-muconic acid at 260 nm and 25°C. The assay
mixture generally contained in total volume of 1 ml: catechol (20 µl) of 10
mM as substrate, tris-HCl buffer (975 µl) of 50 mM at pH 8.0, EDTA of
0.02 M and enzyme solution (5 µl) (Rodríguez-Salazar et al., 2020).
2.13.2 Determination of protein concentration
The concentration of catechol 1,2 -dioxygenase was determined using

the Bradford method (1976) as follows : 20μl of the sample (crude or
purified) was prepared and mixed with 50 μl of 0.25 M of NaOH with
continuous shaking for (2-3 minutes). Then, 1ml of Coomasie Brilliant Blue
G-250 was added with shaking. Absorbance was measured at 595 nm by a
spectrophotometer. A standard curve of bovine serum albumin was carried
out using different concentrations (10, 20, 30, 40, 50, 60, 70, 80 , 90 and 100
μg/ ml). Each was pipetted in duplicate in sterilized test tubes, then
absorbency was plotted against the corresponding concentration of bovine
serum albumin (BSA), figure (2-2).
45
0.6
y = 0.0056x + 0.0002
R² = 0.9847
Absrob. at 595 nm 0.5
0.4
0.3
0.2
0.1
0
0 20 40 60 80 100
BSA Concentration (μg/ml)
Figure (2-2): Calibration curve of Bovine Serum Albumin for Determination of

Protein Concentration.
2.14 Purification of catechol 1,2-dioxygenase by

chromatography method
2.14.1 Preparation of cell crude extract
The selected isolate was grown overnight in 250 ml of MS medium

30 minutes at 8000 rpm to remove cell debris. The crude extract was
prepared according to Calero et al. (2022) with slight modification.
45
2.14.2 Precipitation of enzyme by ammonium sulfate
Solid ammonium sulfate with the following saturation rates: 0-40%,

40-60%, and 60-80%. A specific concentration of each rate were gradually
added to 100 ml of crude enzyme at 4 Cº. The components were mixed
gently for 45 min. Then it was centrifuged at 10,000 rpm for 20 minutes.
The supernatant was discarded and the precipitate was dissolved in a suitable
volume of 50 mM of tris- HCl buffer ( pH 8.0). The activity of the enzyme
and protein concentration were measured according to Raina et al. (2022)
with slight modification.
2.14.3 Dialysis
The enzyme solution was dialyzed after precipitation with ammonium

sulfate against 50 mM of tris- HCl buffer ( pH 8.0) for 24 hours under
cooling conditions (4Cº) with stirring and the buffer was changed four times.
Then, the enzyme activity, protein concentration, and specific activity were
measured (Hmood and Aziz, 2016).
2.14.4 Purification by ion exchange chromatography

A DEAE-cellulose column (7×30 cm) was prepared according to
Whitaker and Bernard (1972) by dissolving 25 g of resin in 1L of distilled
water. Then beads were left to settle down and washed several times with
D.W until getting clear appearance. The suspension was filtered throughout
Whattman No.1 using buchner funnel under discharging.
The resin was re-suspended in 0.25 M sodium chloride and 0.25 M

sodium hydroxide solution. The suspension was filtered again as mentioned
above and washed several times with 0.5 M hydrochloric acid solution
44
followed by distilled water before it was equilibrated with 50 mM Tris- HCl

buffer (pH 8). The enzyme solution obtained from the previous step was
applied to DEAE-cellulose column that previously equilibrated with 50 mM
tris-HCl buffer (pH 8). The column was washed with an equal volume of the
same buffer, while attached proteins were stepwise eluted with gradual
concentrations of sodium chloride (0.05‒1 M). Flow rate throughout the
column was 5 ml/fraction and the absorbance of each fraction was measured
at 280 nm using UV-VIS spectrophotometer. Catechol 1,2-dioxygenase
activity was determined in each fraction. Fractions presenting catechol 1,2
dioxygenase activity were pooled and kept for further steps of purification
(Al-Halbusi, 2015).
2.14.5 Purification by gel filtration chromatography
The gel filtration chromatography is based on the molecular size and

the hydrodynamic volume of the purified molecules. Sephacryl S-1000 (1.5
× 50 cm) column was prepared as recommended by Pharmacia Fine
Chemicals Company. A quantity of Sephacryl S-1000 was suspended in 50
mM of tris-HCl buffer (pH 8), heated at 90ºC to complete swelling of the
beads, degassed and packed in a glass column, the column was equilibrated
with the same buffer. Partially purified enzyme obtained from the ion
exchange step was applied onto the matrix. Elution was achieved at a flow
rate of 5 ml/fraction using the same buffer for equilibration (Singh and
Singh, 2018; Beschkov et al., 2020).
44
2.15 Characterization of catechol 1,2-dioxygenase

2.15.1 Molecular weight determination
The gel filtration method by Sephacryl S-1000 was performed to
estimate the molecular weight of the catechol 1,2-dioxygenase enzyme using
four standard proteins, table (2-8). This method is done by drawing the
relationship between the logarithm of the standard proteins’ molecular
weights and the size of recovery/ size of Void (Ve/V0). The molecular weight
was calculated as shown in the following steps:
2.15.1.1 Determination of the void volume of the column

Sephacryl S-1000 column with the dimensions (1.5 × 50 cm) was
prepared and used for enzyme purification. This step was carried out using
Tris-HCl buffer with the concentration of 50 mM. The void volume was
determined using blue dextran (as a marker) to recover parts of the same
buffer. Absorbance was measured in separate parts (5ml) at a wavelength of
600 nm (Al-Halbusi, 2015).
2.15.1.2 Determination of elution volume for standard proteins

Gel filtration was carried out with the comparison of four standard
proteins, table (2-8). Absorption was measured at 280 nm in separated
volumes to determine elution volume (V0) for each standard protein. The
relationship between elution volume percentages was blotted for each
standard protein to the elution volume of blue dextran (Ve/V0) against
molecular weight logarithm. This way is a very helpful way to measure
enzymatic molecular weight (Al-Halbusi, 2015).
42
Table (2-8): Standard proteins used in the determination of the molecular weight of
catechol 1, 2-dioxygenase enzyme produced by P. putida.
No. Standard proteins Molecular weight (kDa)
1 Arginine Deaminase 125.892
2 Bovine Serum Albumin 67

3 Catalase 232
4 Pepsin 34.5
2.15.2 Optimum temperature for catechol 1, 2-dioxygenase activity
Catechol 1,2-dioxygenase (C12O) activity was measured at different

temperatures (15ºC, 20ºC, 25ºC, 30ºC, 35ºC, and 40ºC). Then, the enzyme
activity was plotted against the temperatures (Allos, 2015).
2.15.3 Optimum temperature for catechol 1, 2-dioxygenase stability
For thermal stability, equal volumes of purified C12O enzyme was

incubated in water bath at (15ºC, 20ºC, 25ºC, 30ºC, 35ºC, and 40ºC) for 30
minutes. The enzyme activity was measured and the remaining activity (%)
was plotted against the temperature (Allos, 2015).
2.15.4 Optimum pH for catechol 1, 2-dioxygenase activity
Tris-HCl Buffer solutions described in (2.2.1.2) had been distributed

evenly into clean tubes, and pH was adjusted from (4-9). A volume of 20μl
of purified enzyme was added to 20μl of the buffer. The activity of C12O
44
was assayed and enzyme activity was plotted against the pH values to
determine the optimal pH for C12O activity (Allos, 2015).
2.15.5 Optimum pH for catechol 1, 2-dioxygenase stability
Equal volumes of purified enzyme and buffer solutions (2.2.1.2) with

pH ranging from (4-9) were incubated at 25℃ for 30 minutes. The
enzymatic activity for each tube was measured. The remaining activity (%)
for C12O was plotted against the pH values of solutions (Allos, 2015).
2.15.6 Storage stability of catechol 1, 2-dioxygenase

To test the storage stability of the purified enzyme, a number of glass
test tubes were prepared, and an amount of 20 μl of tris-HCl buffer (50 mM)
was taken by micropipette and distributed in each tube. Then, 20 μl of the
purified enzyme were added for all tubes and incubated at 4ºC. After that,
the enzyme activity of each sample was evaluated at standard weekly
intervals (7-days intervals) for a total of 30 days by considering the activity
of the first day to be 100% (Rodríguez-Salazar et al., 2020; Asimakoula et
al., 2022).
2.16 Microcosmic study for phenol degradation using phenol-

degrading of Pseudomonas spp. local isolate
This experiment was designed according to Kumari et al. (2016) with
some modifications to study the effect of bioaugmentation in the presence of
biostimulants on phenol biodegradation in soil microcosms. The experiment
was performed for 60 days by choosing the most effective phenol-degrading
Pseudomonas spp. isolate identified in the current study with a dilution
44
number of 10-5. The soil used in this step which was taken from an ordinary
house garden at Baghdad city, Iraq. The soil was sieved (2-mm mesh), and
autoclaved two times at 121˚C for 15 min at 15 pound/inch2.
An amount of 2 kg of sterilized soil was settled in plastic containers
with a 5 kg capacity to prepare soil microcosms. One treatment was carried
out in triplicates: the treatment included the addition of the free bacterial
cells of the local isolate of Pseudomonas spp. to the soil. Each microcosm
was contaminated with 500 ppm of phenol as a single source of carbon and
energy. All the containers was inoculated with bacterial cells suspension
which was already cultivated in the liquid medium of mineral salt medium
(MSM) and supplemented with trace salts solution (CaCl2.2H2O,
FeSO4.7H2O, CoCl2.6H2O, MnCl2, and NaMoO4), incubated at 30°C with a
rotary shaking incubator at 150 rpm for 24-48 hours (pH was adjusted to
7.0).
After adding all the previous components, every container was
incubated at 25 ± 2 C for 60 days, and the components were mixed daily
with a sterilized spatula to provide aeration. The moisture content of all the
containers was maintained at 60-70 % with distilled water throughout
experimentation period (Ueno et al., 2006; Kumari et al., 2016).
 Soil mixture analysis

From each container, 10 g of soil mixture was collected at intervals of
55 days and preserved at 4 °C till all the parameters such as soil pH, residual
phenol, and bacterial growth were analyzed. The soil pH was measured by
pH meter. Phenol residual was monitored using 4-aminoantipyrine
colorimetric assay using UV/Visible spectrophotometer at 510 nm. Growth
of soil bacteria was measured in terms of CFU/Kg of soil using serial
44
dilution technique by counting the colonies developed on nutrient agar plates

(viable count) after 24-48 hours (Subramaniam et al., 2020).
For soil analysis by GC, 5/10 g of soil sample mentioned previously
was taken to the Ministry of Sciences and Technology to be analyzed by gas
chromatography technique which was used to separate the chemical
components of the soil sample and then detect these chemicals to determine
the presence or absence of phenol and its derivatives and/ or how much is
present. The chromatogram that shows the standard conditions for the
degradation of phenol and its metabolites by GC analysis is presented in
appendix (13).
2.17 Statistical analysis

The Statistical Analysis System- SAS (2018) program was used to
detect the effect of difference factors in study parameters. Least significant
difference –LSD test (Analysis of Variation-ANOVA) was used to calculate
the significant differences among the tested means. Chi-square test was used
to significant compare between percentages (0.05 and 0.01 probability) in
this study. P values of p>0.05 were considered statically non-significant
while p≤0.05 and p≤0.01 were significantly different and high significantly
different, respectively.
44
Chapter Three Results and Discussion
Results and Discussion
3.1 Isolation of phenol-degrading bacteria

A total of 125 soil samples were collected from different soils at
Baghdad city for the primary screening with regard to phenol degradation.
They were distributed as 83/125 (66.4%) samples collected from different
locations at Al-Daura refinery and 42/125 (33.6%) samples from private
electricity generators of six municipalities within four months. Results of
primary screening tests on mineral salt medium agar plates (supplemented
with phenol) indicated that 89/125 (71.2%) different isolates were capable of
growing with the presence of phenol in the culture medium. Those 89
isolates were considered as phenol-degrading isolates. The above isolates
were distributed as 62/89 (69.6%) isolates from Al-Daura refinery and 27/89
(30.3%) isolates from the private electricity generators of six municipalities
as shown in figure (3-1) and appendix (1).
30.3 %
Al-Daura refinery phenol-degraders
Private generators phenol-degraders

69.6 %
Figure (3-1): Distribution of phenol-degrading isolates according to source of

isolation.
9;
3.2 Phenotypic identification of phenol-degrading isolates

3.2.1 Cultural, morphological examination and biochemical tests
All phenol-degrading isolates were subjected to cultural,
morphological identification and biochemical tests. Cultural characterization
on nutrient agar (figure 3-2 A) showed that some isolates were able to
produce large, opaque, flat colonies with irregular margins beside producing
pigments and grape-like odor. Such characteristics may indicate that the
isolates are related to Pseudomonas spp. as mentioned by Al-Saffar and
Jarallah (2019) who showed that the colonies of P. aeruginosa were
characterized by producing diffusible pigments and sweet-grape odor on
nutrient agar and Muller-Hinton agar.
These isolates showed different manners on MacConkey agar plates
as appeared small, pale, round, convex, rough, and lactose non fermenting
colonies with irregular edges as aforesaid by Chen and Sun (2023) for P.
fluorescens. Some isolates were able to produce pigments as pyocyanin
(blue) or fluorescent pigment "pyoverdine” which can be monitored under
ultra-violet light following growth on MacConkey agar as a rapid orientation
test (figure 3-2 B) (Ahmadian-Fard-Fini et al., 2019). The same isolates
were also able to grow on Pseudomonas agar as a selective medium for
Pseudomonas spp. isolates (figure 3-2 C), with producing pigments after 48
hours of incubation. This result was very close to the results presented by
Alsarraf et al. (2023) who found that Pseudomonas species isolated from
soil were able to produce pyoverdine pigment.
The Gram stain examination of Pseudomonas spp. for the isolates
revealed very small rods, single or paired, and non-spore forming bacteria
(Azegami et al., 1987). The findings were also consistent with those
reported by Al-Daraghi and Al-Badrwi (2020) and Midhat and Abed (2023).
:8
A B
Figure (3-2): A. Isolated colonies of Pseudomonas spp. isolates on nutrient agar

plates. B. Pseudomonas spp. fluorescent pigment "pyoverdine” under ultra-violet
light following growth on MacConkey agar. C. Pseudomonas spp. Isolates growing
on the selective medium of Pseudomonas agar medium supplemented with CFC
supplement.
For the biochemical characterization different tests were performed.

The results emphasized that some bacterial isolates (that were able to grow
:8
on the above media) were positive for oxidase, catalase and they were able
to grow at 42ºC and 4ºC. These results were close to the results reported by
Midhat and Abed (2023) who illustrated that all Pseudomonas four species
(P. aeruginosa, P. putida, P. stutzeri, and P. fluorescens) were grown on the
solid nutrient medium at 42ºC and 4ºC and most of them were positive for
this test.
The current study results emphasized that 40/89 (44.9%) isolates were
primary identified as Pseudomonas spp. isolates according to the previous
characteristics.
3.2.2 Identification of Pseudomonas spp. isolates using VITEK system

The findings of the VITEK system confirmed that out of the positive
isolates for phenol degradation, forty isolates 40/89 (44.94%) were identified
as Pseudomonas spp., (appendices 2-11). These isolates were distributed as
P. aeruginosa 30/40 (75 %) as follows (26 isolates from Al-Daura refinery
and 4 isolates from the private generators) and P. putida 10/40 (25 %) as
follows (5 isolates from Al-Daura refinery and 5 isolates from the private
generators), appendix (1).
It is well known that Pseudomonas is a highly versatile organism that
is armed with the ability to metabolize even the most complex polymers. It
represents the most effective genus of bacteria used in the biodegradation of
xenobiotics in contaminated environments, that is why it was chosen for the
current study (Miglani et al., 2022).
3.2.3 Genotypic identification of Pseudomonas spp. isolates

Genomic DNA was successfully extracted from all forty isolates ,
then was confirmed and analyzed by gel electrophoresis as shown in figure
:8
(3-3). All the isolates had DNA concentrations between (50-100ng/μl) and
the DNA purity was ranging between 1.8 and 1.9.
Figure (3-3): Extracted DNA on agarose gel electrophoresis (1% agarose stained
with ethidium bromide, 5 V/cm for 30 minutes) to check DNA purity and integrity.
Lane 1-7: Genomic DNA of Pseudomonas spp. isolates.
The genotypic identification with 16s rDNA for the forty isolates
showed that all Pseudomonas spp. identified isolates 40/40 (100%) gave
positive results for this housekeeping gene, in which 30/40 (75%) were
identified as P. aeruginosa and 10/40 (25%) were identified as P. putida.
The expected amplicon size reached 956 bp as matched with 100 bp DNA
ladder. In figure (3-4 A), the sharp bands demonstrated the positive isolates
for this HKG. This result agreed with the study that performed by Altaai et
al. (2014). The 16s rDNA gene is used for phylogenetic studies because it is
highly conserved between different species of bacteria and archaea (Yang et
al., 2022).
The DNA sequencing for the amplified 16s rDNA segment was
analyzed using Geneious software. Figure (3-4 B) clarifies the precise
amplified size from the original gene represented by the Blast hit interval
which was 128- > 1495 from the NCBI strain gene. The pairwise identity
(3-4C) was 99.89%, which represents exemplify residues percentage that
was identical in alignment with gaps versus non-gap residue. The nucleotide
:8
sequence of this local isolates was compared with NCBI stain Accession no.
MH114980.
Some of the differences appeared between the local isolate and
recorded standard NCBI strain as cleared in figure (3-4 C). The results
showed that the locally isolated bacteria was very similar to NCBI standard
strain, as confirmed by blast hit analysis beside pairwise identity. The
molecular identification methods have considerably enriched laboratory
detection and identifying bacterial isolates within clinical samples.
In the past, bacterial cultures were considered the gold standard
method for microbial identification as the results will be consumed between
24-48 hours. Such routine method might be delay in proving the result for
some species especially for slow growing organisms such as Mycobacteria
spp. (Ferone et al., 2020). Thus, the molecular method will be superior for
rapid identification (Franco-Duarte et al., 2019). Additionally, the false
negative cultures results might arise from fastidious organisms; non-viable
bacterial species, or the prior use of antimicrobial substances, potentially
affecting patient management (Chen et al., 2021).
:8
Figure (3-4): A. Agarose gel electrophoresis (1% percent agarose, 5 V/cm for 90
minutes) for 16S rDNA gene (amplified size of 956 bp) vs. DNA ladder. B. A blast
hit of a precise size of the gene (918 bp) with an interval between 433 –> 1350 from
the NCBI standard strain MT454186. C. Pairwise identity between the 16 S rDNA
gene DNA sequencing of the local isolate with the reference strain of Pseudomonas
aeruginosa MT454186.
:8
3.3 Genotypic detection of the phe operon genes (catechol

dioxygenases) in Pseudomonas spp. isolates
Catechol dioxygenase enzyme-encoding cat1, cat2, and catABC
genes were amplified from DNA templates of the target isolates using
conventional polymerase chain reaction (PCR) with specified primers.
3.3.1 Catechol 1,2 dioxygenase (cat1) gene
The results of detecting catechol 1, 2-dioxygenase (cat1) gene showed
that all the forty isolates 40/40 (100%) of Pseudomonas spp. were positive
for this gene (Table 3-1). Clear bands appeared on agarose gel with an
expected size of 650 bp as in figure (3-5 A).
The Blast hit of P. putida local isolate which presented in figure (3-5 B)
clarifies the amplified size (578 bp) and was the part of the gene size
Interval: 2,392,757 -> 2,393,334. The sequence of cat1 gene for the same
local isolate was displayed in figure (3- 5C). DNA from this investigation
was compared to that of the reference strain accession no. CP016212 of P.
putida. The results showed that 98% of the residues in the alignments were
identical to those in the NCBI strain as the local isolate was nearly identical
to this reference strain with only few minor variations. These data are crucial
for assessing the bioremediation capacity of these bacteria and
understanding their development properties.
The recent result is similar to a study conducted by Tian et al. (2017)
who used PCR to verify the existence of the catabolic genes catechol 1, 2-
dioxygenase, catechol 2, 3-dioxygenase, and protochatecuate 3, 4-
dioxygenase that sequenced from three distinct bacteria: Pseudomonas sp.
PH11, Pseudomonas sp. PH7, and Ralstonia sp. PH19. They found that
:8
these genes were amplified successfully in many strains of bacteria and

these strains were capable of degrading multiple monoaromatic compounds.
The catechol 1,2-dioxygenase gene is found in all the gram-negative
bacteria and the majority of studies on the detection of catabolic genes in
contaminated environments have focused on gram-negative bacteria, such
as Pseudomonas, Burkholderia, Acinetobacter and Sphingomonas (Cabral et
al., 2022). Catechol dioxygenases catalyze the initial stage in the breakdown
of aromatic molecules like catechol, which is a ubiquitous intermediate in
the breakdown of a wide range of monoaromatic chemicals (Reineke and
Schlomann, 2023). Degradation of monoaromatic compounds by these
bacteria is ecologically significant since these pollutants are prevalent in soil
and water systems and can endanger human health and ecosystems
(Pandolfo et al., 2023).
The best proof that Pseudomonas spp. isolates can play an important
role in the biodegradation of monoaromatic chemicals in polluted
environments is the presence of cat1 gene in all 40 isolates tested in the
current investigation. Moreover, the importance of gram-negative bacteria in
the biodegradation of hydrocarbons is underscored also by the finding of the
present study. Traditional polymerase chain reaction (PCR) that used for
gene detection is an effective and trustworthy method for determining
whether the bacterial strains have the potential to breakdown particular
contaminants or not. In order to create efficient bioremediation solutions for
polluted areas, more study of the biodegradation mechanisms of these
bacteria is required (Ansari et al., 2023).
:9
Figure (3-5): A. Cat1 gene (amplified size, 650 bp) on 1% agarose gel electrophoresis
(5 V/cm for 90 minutes) vs DNA ladder lane. B. A direct hit of a precise size of the
gene (578 bp) with an interval between 2,392,757 -> 2,393,334. C. Pairwise
identification using standard strain CP016212 of P. putida and DNA sequencing for
cat1 gene which shows few gaps in the local isolate.
::
3.3.2 Catechol 2, 3-dioxygenase (cat2) gene
For catechol 2, 3-dioxygenase (cat2) gene amplification, the results

demonstrated that 9/40 (22.5%) isolates of Pseudomonas spp. isolates were
positive for this gene. From those nine isolates; 5/40 (12.5%) were P.
aeruginosa and 4/40 (10%) were P. putida (Table 3-1). Sharp, single bands
of the predicted size (821bp) were seen in figure (3-6 A) demonstrating the
presence of positive bands.
The exact area (778bp) from the entire gene that was amplified by the
blast hit is shown in figure (3-6 B) with interval: started from 43,222 -> to
43,999 in the original chromosomal gene. Pairwise identity between the cat2
gene DNA sequencing of the local isolate with a reference strain Accession
no. APO15030 is shown in figure (3-6 C) and it was 90% and as clear many
gaps appeared between the local isolates and NCBI strain. This gene can be
located on both chromosomes and plasmids of varying sizes (Song et al.,
2022; Hirose, 2023).
It is thought to be essential for the breakdown of a wide variety of
aromatic chemicals in polluted environments (Thacharodi et al., 2023). Most
strains that capable of decomposing aromatic compounds have one or two
dioxygenase genes, one of which codes for a catechol 2,3-dioxygenase (Tian
et al., 2017). Another screening study was performed by Foleake (2020)
illustrated that catechol 2, 3-dioxygenase (C23O) was existed in oil-
degrading bacteria. The previous study results showed that C23O gene was
obtained from best strains with oil degrading activity which confirmed the
catabolic ability of the bacteria. When they compared to the database, the
percent identities (72-94) % of the oil-degrading bacteria have revealed
novel bacteria.
:;
As a result of the fact that this gene is in charge of oil breakdown in

bacteria, and it is reasonable to assume that in the process of
bioremediation, indigenous microorganisms from polluted settings will be
analyzed to determine whether or not they possess this specific gene
sequence (Rafeeq et al., 2023).
C
Figure (3-6): A. Agarose gel electrophoresis (1% agarose, 5 V/cm for 90
minutes) for cat2 gene (amplified size of 821 bp) vs. DNA ladder lane. B.
Analysis of a Blast Hit of a precise part of the gene. C. Pairwise identity
between the cat2 gene DNA sequencing of the local isolate with a reference
strain APO15030.
;8
3.3.3 Catechol dioxygenase (catABC) genes

For amplification catechol dioxygenase (catABC) by PCR, the results
showed that 11/40 isolates (27.5%) of Pseudomonas spp. isolates were
having these genes (as a part of operon related to phenol degradation) in
their genetic materials. From this number, 4/40 (10%) isolates were P.
aeruginosa and 7/40 (17.5%) isolates were P. putida (Table 3-1). The figure
(3-7 A) showed sharp and single bands with an expected size of (889bp).
The blast hit for this gene is shown in Figure (3-7 B), as compared with the
genome of the standard strain accession no. U12257, Interval: 1,795 ->
2,606. Figure (3-7 C) displays that there were many gaps between the
sequences of the locally isolated strain and the NCBI-recorded strain as the
pairwise identity 90%. That might related to the potential for genetic
diversity among Pseudomonas spp. isolates which may be attributable to
differences between the regionally isolated strains and the reference strain
(Yasmin et al., 2022).
Ridl et al. (2018) demonstrated that in total, five regions harboring
genes for aromatic compounds degradation pathways were identified in
Pseudomonas alcaliphila JAB1 genome, and catABC genes, which encode
the enzymes of the catechol branch of the β-ketoadipate pathway, yielding
succinyl-CoA and acetyl-CoA was found in the fifth region. Another study
performed by Sadauskas et al. (2020) illustrated that the end-product of Iac-
mediated degradation in Caballeronia glathei DSM50014 is catechol which
is further oxidized by a catechol dioxygenase, the genes of which (catABC)
are located in close proximity to the iac cluster.
;8
Figure (3-7): A. Agarose gel electrophoresis for catABC gene (amplified size of 889
bp) compared to DNA ladder lane (1% agarose, 5 V/cm for 90 minutes). B. The
blast hit of the amplified gene in the current investigation. C. Pairwise identity
U12257 and DNA sequencing for the catABC gene. Interval: 1,795 -> 2,606.
A study was conducted using Arthrobacter sp. bacteria revealed that

catechol catabolic genes, catABC, were detected within the gene cluster and
are shown as ORF6-8. Also, a recent study done by Regar et al. (2023) listed
;8
that genome sequencing of Alcaligenes faecalis IITR89 revealed the

presence of gene cluster dmpKLMNOP, encoding multicomponent phenol
hydroxylase; and Abcd gene cluster, encoding many subunits including
catA, catechol 1, 2-dioxygenase; catB, cis, cis-muconate cycloisomerase;
and catC, muconolactone D-isomerase which play an active role in indole
degradation.
The results of detecting the three catechol dioxygenase genes in
Pseudomonas spp. isolates showed that cat1 gene was positive for all the
forty isolates (100%), distributed as 30/40 (75%) in P. aeruginosa isolates
and 10/40 (25%) in P. putida isolates. Statistically, there were high
significant differences (P≤0.01) between P. aeruginosa and P. putida
isolates for cat1 gene.
Moreover, the gene cat2 was distributed as 5/40 (12.5%) in P.
aeruginosa isolates and 4/40 (10%) in P. putida isolates. Statistically, there
were no significant differences between P. aeruginosa and P. putida isolates
for cat2 gene. Also, the gene catABC was distributed as 4/40 (10%) in P.
aeruginosa isolates and 7/40 (17.5%) in P. putida isolates, figure (3-8).
Statistically, there were significant differences (P≤0.05) between P.
aeruginosa and P. putida isolates for catABC gene.
P. aeruginosa isolates were highly significant (P≤0.01) for the three
genes of catechol dioxygenases while P. putida isolates had no significant
differences among the three previous genes. The previous findings were
illustrated in table (3-1) and appendix (12).
;8
Pseudomonas aeruginosa isolates

80 75 Pseudomonas putida isolates
70
60
Percentage (%)
50
40
30 25
17.5
20
12.5
10 10
10
0
cat1 cat2 catABC
Catechol Dioxygenase Genes
Figure (3-8): Detection of Catechol Dioxygenases in Pseudomonas spp. Isolates.
Table (3-1): Detection of Catechol Dioxygenases in Pseudomonas spp. Isolates.
Pseudomonas spp. Catechol Dioxygenase Genes

P-value
Isolates
cat1 cat2 catABC
Pseudomonas 0.0001 **
30 (75%) 5 (12.5%) 4 (10%)
aeruginosa isolates
Pseudomonas putida
10 (25%) 4 (10%) 7 (17.5%) 0.091 NS
isolates
Total 40 (100%) 9 (22.5%) 11 (27.5%) 0.0001 **
P-value 0.0017 ** 0.082 NS 0.049 * ---
* (P≤0.05), ** (P≤0.01).
;8
3.4 Growth and phenol degradation behavior of Pseudomonas

spp. local isolates
From the total number 40/40 (100%) of Pseudomonas spp. isolates,

only six (15%) of them (P 8, P 15, P 17, P 22, P 24 and P 33) were able to
achieve more than 70% phenol degradation at the initial concentration of
phenol at 250 ppm within two days (48 hours) or less, so they were
subjected to higher initial phenol concentrations like 500, 750, and 1000
ppm. Additionally, these isolates were positive for all amplified genes of
catechol dioxygenase (cat1, cat2, and catABC). These isolates were tested
for their capacity in growth and phenol degradation at the previous four
concentrations of phenol (250, 500, 750, and 1000 ppm) at 30°C and pH 7.
Figure (3-9 A) shows the growth curve of the local isolate of P.
aeruginosa (isolate No. 8) at various initial concentrations of phenol. This
isolate was collected from the contaminated soil of Al-Daura refinery, it was
able to grow reaching to more than 750 ppm of initial concentration of
phenol with lag phase till 24 hours of incubation period. Then, the biomass
concentration began to increase to reach its maximum level at the fourth day
of incubation time and then the biomass was going down after 96 hours.
With an initial concentration of phenol at 1000 ppm there was a gradual
increase in lag phase till the third day reaching to the highest peak in 144
hours of incubation period.
The results manifested in figure (3-9 B) clarified the degradation
behavior of the local isolate of P. aeruginosa (isolate No. 8) with varying
phenol starting concentrations. The microbe was able to breakdown 72.8%
of 250 ppm of initial phenol completely after 48 hours of incubation period,
while 500 ppm of phenol was completely degraded after 72 hours of the
;8
incubation. Phenol was degraded after just 96 hours of incubation at 750

ppm of phenol, and 1000 ppm of initial concentration of phenol was
completely degraded in 144 hours of incubation period with more than 24-
hour lag phase.
0.3
250 ppm 250 ppm
0.25 500 ppm

500 ppm 1000
750 ppm
750 ppm
Concentration (in ppm)

0.2 1000 ppm
OD (600 nm)
1000 ppm 750
Residual Phenol
0.15
500
0.1
250
0.05
0 0
0 24 48 72 96 120 144 0 24 48 72 96 120 144
A Time (in hours) B Time (in hours)
Figure (3- 9): A. Growth profile of the isolate P. putida (isolate No. 8) at various
initial concentrations of phenol (30°C, pH 7). B. Degradation profile of the isolate P.
putida (isolate No. 8) at various initial concentrations of phenol (30°C, pH 7).
Figure (3-10 A) represents the growth curve of the local isolate of P.

putida (isolate No. 15) at various initial concentrations of phenol. As clear ,it
can easily grow up to 1000 ppm of initial concentration of phenol. The
isolate had a constant increase in the growth curve for all the four
concentrations of phenol (250, 500, 750, and 1000 ppm) till the last day of
this experiment.
The results showed in figure (3-10 B) depicts the degradation
behavior of the local isolate of P. putida (isolate No. 15) with varying
phenol starting concentrations. The microbe can degrade 77.6% of 250 ppm
of initial phenol concentration within 48 hours of incubation period in the
medium, whereas 40% of 500 ppm of phenol was degraded after 72 hours
of incubation. The third concentration, 750 ppm of phenol was degraded in
96 hours of incubation time with a slight delay (lag phase) for 24 hours, and
;8
1000 ppm of initial concentration of phenol reached to its minimum peak

and degraded completely in 120 hours with no lag phase.
0.3
250 ppm 250 ppm
0.25 500 ppm

500 ppm 1000
750 ppm
750 ppm

0.2 1000 ppm
OD (600 nm)
1000 ppm 750
Residual Phenol
0.15
500
0.1
250
0.05
0 0
0 24 48 72 96 120 144 0 24 48 72 96 120 144
Figure (3-10): A. Growth profile of the isolate P. putida (isolate No. 15) at various
Figure (3-11 A) features the growth curve of the local isolate of P.

isolated was able to grow rapidly at 250 ppm and 500 ppm of phenol
reaching to the last day of experiment (after 144 hours), but it had a lag
phase extended for 48 hours and 72 hours of incubation period at 750 ppm
and 1000 ppm, respectively.
Figure (3-11 B) reveals the degradation behavior of the local isolate of
P. aeruginosa (isolate No. 17) at various initial concentrations of phenol. It
was observed that the microbe was able to degrade 72% of 250 ppm of
phenol within 48 hours while it takes 84 hours for the complete degradation
of 500 ppm of initial concentration of phenol. The microbe was able to
degrade 750 ppm of phenol in just 120 hours of incubation period while it
took 144 hours to degrade 1000 ppm of initial phenol concentration entirely.
;9
0.3
250 ppm 250 ppm
0.25 500 ppm 1000 500 ppm
750 ppm
750 ppm

0.2 1000 ppm
1000 ppm
OD (600 nm)
750
Residual Phenol
0.15
500
0.1
250
0.05
0 0
0 24 48 72 96 120 144 0 24 48 72 96 120 144
Figure (3-12 A) shows the growth curve of the local isolate of P.

putida (isolate No. 22) at various initial concentrations of phenol. This
isolate was collected from the contaminated soil of a private electricity
generator at the municipality of Rusafa. It showed a high rate of growth at
250 ppm of initial concentration of phenol with an increased biomass
concentration that lasted constantly till the sixth day of incubation time.
With an initial concentration of phenol at 500 ppm there was an increase in
bacterial growth and biomass till the fifth day of experiment, then the growth
curve had a slight decrease after the fifth day (120 hours) of this experiment.
Both initial concentrations of phenol at 750 ppm and 1000 ppm, there were a
gradual increase in their lag phase from the first day of the experiment till
the third day (72 hours) reaching to their highest biomass peaks at 144 hours
of incubation period (day 6).
Figure (3-12 B) represents the biodegradation behavior of the local
isolate of P. putida (isolate No. 22) at various initial concentrations of
phenol. This isolate had the ability of degrading 68.4% of 250 ppm of
;:
phenol within two days (48 hours). Up to 500 ppm of phenol, the microbe
shows an efficient degradation potential where it completely degraded the
substrate in 120 hours. The microbe had the capacity to tolerate up to 750
ppm of phenol efficiently in 144 hours with an extended lag phase but a
linear degradation curve, but with an increase in the concentration of phenol
above 750 ppm the degradation of the substrate decreases and increase in the
lag phase was depicted by the microorganism till the last day of the
experiment and beyond (more than 144 hours). This proves that the high
levels of phenol poses a high toxicity to the medium which obviously
inhibits and prevents the growth of this isolate.
0.3
250 ppm 250 ppm
0.25 500 ppm 1000 500 ppm
750 ppm
750 ppm
0.2 1000 ppm

OD (600 nm)
1000 ppm 750

Residual Phenol
0.15
500
0.1
250
0.05
0 0
0 24 48 72 96 120 144 0 24 48 72 96 120 144
Figure (3-13 A) shows up the growth curve of the local isolate of P.

putida (isolate No. 24) at various initial concentrations of phenol. This
isolate was collected from a private electricity generator at the municipality
of Karkh. The isolate was able to grow reaching 500 ppm of initial
concentration of phenol.
;;
It can grow with no lag phase at 250 ppm of phenol concentration and
with slight lag phase till the 48 hours of incubation period at 500 ppm of
phenol. At 750 ppm and 1000 ppm of initial phenol concentrations, the
isolate had a clear lag phase- retardation reaching to the second day (48
hours) of the experiment period. Subsequently, the growth rate began to
lessen and inhibited at the fifth day (120 hours) of the incubation period for
750 ppm of phenol concentration, and at the third day (72 hours) of the
incubation period for 1000 ppm. As a result, this isolate was not able to
grow at phenol concentrations higher than 500 ppm of initial phenol
concentration.
Figure (3-13 B) shows the degradation behavior of the local isolate of
P. putida (isolate No. 24) at various initial concentrations of phenol. It was
notable that the microbe was unable to degrade the substrate completely up
to 250 ppm of phenol but has the potential to withstand such high
concentration of phenol as 1000 ppm. The microbe degrades only 66% of
250 ppm of phenol and on increasing the concentration of the phenol its
capacity to degrade the substrate decreased but the microbe was still able to
grow. From the figure (3-13) it can be seen that the microbe exhibit a lag
phase at higher concentration of phenol more than 500 ppm of phenol thus
implicating that the substrate at higher concentration is lethal to the microbe.
888
0.3
250 ppm 250 ppm
0.25 500 ppm 1000 500 ppm
750 ppm
750 ppm

0.2 1000 ppm
OD (600 nm)
1000 ppm 750
Residual Phenol
0.15
500
0.1
0.05 250
0
0
0 24 48 72 96 120 144 0 24 48 72 96 120 144
Figure (3-14 A) represents the growth curve of the local isolate of P.

isolate was collected from the contaminated soil of Al-Daura refinery. The
isolate grew fast with no lag phase for the first two concentrations of phenol
within 48 hours for 250 ppm of phenol and 72 hours for 500 ppm of phenol,
respectively. It also had the capacity to grow reaching beyond 750 ppm of
initial concentration of phenol with lag phase till 48 hours of incubation
period. After that, the biomass level started to increase to reach its highest
rate in just 96 hours of incubation period and then going down after the
fourth day of the experiment. With an initial concentration of phenol at 1000
ppm, the isolate tolerated this high concentration and continue to grow with
a lag phase till 72 hours of incubation reaching to its maximum peak in 120
hours of incubation period and the growth curve tend to go down after the
fifth day of the experiment.
The results shown in figure (3-14 B) illustrated the degradation
behavior of the local isolate of P. aeruginosa (isolate No. 33) with varying
phenol starting concentrations. The microbe was able to breakdown 70.8%
888
of 250 ppm of initial phenol completely after 60 hours of incubation period,

while 500 ppm of phenol was completely degraded after 84 hours of the
incubation. At 750 ppm of phenol, the substrate was degraded after just 96
hours of incubation with lag phase lasted for 24 hours, while 1000 ppm of
initial concentration of phenol was completely degraded in 144 hours of
incubation period with 84-hour lag phase. The toxicity of phenol at higher
concentrations forces the bacteria to take more time (extended lag phase) in
order to be able of degrading phenol efficiently.
0.3
250 ppm 250 ppm
0.25 500 ppm
500 ppm 1000
750 ppm
750 ppm
0.2 1000 ppm
OD (600 nm)
1000 ppm 750

Residual Phenol
0.15
500
0.1
250
0.05
0 0
0 24 48 72 96 120 144 0 24 48 72 96 120 144
The current study findings revealed that each of the six evaluated
isolates of Pseudomonas spp. were extremely efficient phenol degraders.
The isolate No. 15 of P. putida which were isolated from the contaminated
soils of Al-Daura refinery was the most powerful isolate among the others
where it was able to degrade 78.3% of 1000 ppm of the initial concentration
of phenol within five days (120 hours) of the experiment, followed by the
isolates P8, P17, and P33 of P. aeruginosa which were isolated also from the
contaminated soils of Al-Daura refinery. The isolate No. 8 was able to
888
degrade 67.7% of 1000 ppm of phenol within five days (120 hours) of the
experiment. Followed by the isolate No. 17 which was capable of degrading
75.3% of 1000 ppm of phenol within six days (144 hours) of the experiment,
while the isolate No. 33 had the ability to degrade 64.5% of 1000 ppm of
phenol also within six days (144 hours) of the experiment.
Additionally, the isolates No. 22 and 24 of P. putida which were
isolated from the private electricity generators had no capacity to degrade
phenol up to 1000 ppm of initial concentration of phenol, but they were
tolerant to it and continue to grow till the end of the experiment.
Statistically, the six isolates were significantly different (P≤0.05) in their
growth rates along the six days. The differences may due to the type of
isolate whether it was P. aeruginosa or P. putida or to inherent variations in
their genetic makeup or environmental conditions. Moreover, the six isolates
of Pseudomonas spp. were significant for all the used concentrations of
phenol except for the zero time data and the first day data of incubation
which were non-sigificant for 750 ppm of phenol, respectively.
The results of this experiment concluded that the isolates collected
from Al- Daura refinery were very efficient in degrading pollutants
especially phenol, and they were much better than the isolates collected from
the private electricity generators regardless to the isolate type whether it was
P. aeruginosa or P. putida. This ability could be correlated with the fact that
the refinery isolates were more adaptable to accomplish the degradation
function because they were exposed frequently to multiple pollutants so they
acquired the ability of using these pollutants as their carbon and energy
source with the aid of their catalytic enzymes like the catechol dioxygenases
and other enzymes (Bala et al., 2022).
888
Moreover, the current study results demonstrated that Pseudomonas

spp. isolates can withstand high phenol concentrations and they can
breakdown phenol efficiently as a substrate. The results also showed that the
six isolates of Pseudomonas spp. were resistant to phenol concentrations as
high as 1000 ppm. The exponential growth of these microbes corresponding
to the rate of degradation indicates clearly that these microbes are able to
tolerate such high concentration of phenol and utilize it as their source of
carbon and energy. Statistically, there were significant differences (P≤0.05)
between the bacterial growth for all isolates, table (3-2).
Table (3-2): The optical density for the growth of six isolates of Pseudomonas spp.
using spectrophotometer at 600 nm.
Phenol LSD
Isolate Isolate Isolate Isolate Isolate Isolate
Days Concentration value
No. 8 No. 15 No. 17 No. 22 No. 24 No. 33
(ppm)
250 ppm 0.05 0.06 0.03 0.03 0.03 0.05 0.025 *
0.021
500 ppm 0.04 0.04 0.02 0.02 0.02 0.04
NS
Zero day 0.022
of 750 ppm 0.04 0.03 0.02 0.02 0.02 0.03
NS
incubation
0.021
1000 ppm 0.02 0.03 0.01 0.02 0.01 0.02
NS
250 ppm 0.11 0.12 0.05 0.09 0.11 0.11 0.047 *
500 ppm 0.033 *
0.08 0.08 0.04 0.05 0.03 0.1
Day 1 750 ppm 0.026
(After 0.03 0.04 0.02 0.03 0.03 0.03
NS
incubation) 0.028 *
1000 ppm
0.02 0.04 0.02 0.02 0.01 0.02
250 ppm 0.20 0.17 0.08 0.16 0.15 0.21 0.056 *

500 ppm 0.048 *
0.15 0.15 0.08 0.08 0.04 0.15
888
Day 2 750 ppm 0.044 *

0.04 0.08 0.03 0.03 0.03 0.04
(After
incubation) 1000 ppm 0.038 *
0.03 0.06 0.02 0.03 0.02 0.03
250 ppm 0.21 0.19 0.11 0.17 0.16 0.21 0.051 *

500 ppm 0.055 *
0.19 0.19 0.10 0.12 0.06 0.19
Day 3 750 ppm 0.048 *
(After 0.12 0.13 0.1 0.04 0.05 0.12
0.04 0.08 0.03 0.03 0.005 0.04
250 ppm 0.19 0.22 0.13 0.19 0.17 0.19 0.062 *
Day 4 500 ppm 0.057 *

0.16 0.21 0.12 0.17 0.1 0.16
(After
0.16 0.14 0.13 0.11 0.03 0.16
0.052 *
1000 ppm 0.1 0.10 0.09 0.09 0.003 0.1
250 ppm 0.18 0.27 0.17 0.21 0.18 0.18 0.059 *
500 ppm 0.13 0.22 0.15 0.19 0.11 0.13 0.044 *

Day 5
(After 750 ppm 0.11 0.17 0.16 0.15 0.002 0.11 0.063 *
incubation)
1000 ppm 0.17 0.17 0.12 0.12 0.001 0.17 0.062 *
0.077 *
250 ppm 0.17 0.28 0.22 0.23 0.18 0.17
500 ppm 0.11 0.24 0.17 0.17 0.12 0.11 0.061 *
Day 6
(After 750 ppm 0.08 0.18 0.17 0.16 0.001 0.08 0.069 *
incubation)
0.067 *
1000 ppm 0.13 0.14 0.13 0.13 0.001 0.13
---
LSD value --- 0.069 * 0.074 * 0.068 * 0.077 * 0.062 * 0.067 *
* (P≤0.05).
888
These results were in agreement with the results of Mahgoub et al.

(2023) who illustrated that P. aeruginosa can thrive in a liquid medium with
varying amounts of phenol as the only carbon and energy source (0, 250,
500, 750, 1000, 1250, 1500, and 2000 mg/L) and digest 75.66% of phenol
(1000 mg/L while these strains were resistant and tolerant in the presence of
phenol up to 2000 mg/L). Many microorganisms are capable of consuming
petroleum hydrocarbons as a source of carbon and energy and are
widespread in nature. Consumption of these substances depends largely on
the genetic system and on the chemical nature of the compounds, as well as
environmental factors (Ossai et al., 2020). The addition of nutrients with
providing phenol as a source of carbon and energy has accelerated the
growth and high efficiency of these isolates on phenol degradation
(Gouthami et al., 2023).
The genus Pseudomonas includes a significant group of bacteria with
environmental applications in bioremediation and biological control among
the microorganisms (Agarry et al., 2008). In Pseudomonads, many of its
induced enzymes are nonspecific and its metabolic pathway contains a high
degree of convergence (Mahiudddin and Fakhruddin, 2012).
Microorganisms are able to adapt to the presence of toxic organic
compounds by using a whole cascade of adaptive mechanisms. Among the
adaptive mechanisms, changes in the fatty acid composition of membrane
lipids are the most important reactions of bacteria to membrane-active
substances (Singh, 2017).
The convergence of catabolic pathways allow for the efficient
utilization of a wide range of growth substrates while the non-specificity of
the induced enzymes allows for the simultaneous utilization of several
888
similar substrates without an excess of redundant genetic coding for enzyme

induction (Bruinsma et al., 2023).
Another reason for bacterial resistance to high concentrations of
phenol is their ability to partition into membranes, alter membrane functions,
and result in cell death, phenolic compounds are the main subject of research
into toxicity, microbial breakdown, and adaptive mechanisms. Bacterial
cells' primary response to the presence of phenols is to increase the level of
membrane lipid saturation (Kachur and Suntres, 2020). It is important to
understand that bacteria can produce fatty acids through an anaerobic
process and that the only way they may alter the fluidity of their membranes
during growth is through de novo synthesis of membrane lipids with a
changing ratio of saturated to unsaturated fatty acids.
These membrane alterations were discovered to be associated with an
improvement in cell tolerance to harmful substances in E. coli (Ecevit et al.,
2022). Several microorganisms were discovered to have an outstanding
ability of phenol degradation. Identification of these bacteria showed that the
genus Pseudomonas was the most dominant genus, especially P. putida
because of its high distribution in soils which have been studied the most for
its phenol biodegradation potential (Mahgoub et al., 2023).
Other studies mentioned that these bacteria are known for their ability
to tolerate up to an initial concentration of 1000 ppm of phenol and they are
able to degrade this substrate efficiently (Mohanty and Jena, 2017;
Sreenivasulu et al., 2019; Khraisheh et al., 2020; Salem et al., 2021; and
Putmai et al., 2023). Depending on the results obtained from the current
study, it can be concluded that the toxicity of phenol at higher concentrations
increases the time needed by the bacteria to be capable of degrading phenol.
889
Also, these bacteria could be used effectively for bioremediation

experiments using the enrichment method.
3.5 Optimization of physiological parameters of Pseudomonas

spp. isolates for phenol biodegradation enhancement
3.5.1 Optimum temperature for phenol biodegradation enhancement

The growth of the target isolate of P. putida 15 was studied at
different incubation temperatures (25°C, 30°C, 35°C, and 40°C). Figure (3-
15) represents the growth curve of this isolate at various temperatures. The
degree 30°C was the optimum temperature for phenol biodegradation
followed by the degree of 35°C. This result agreed with Mohanty (2012)
who illustrates that the degradation of phenol was associated with growth of
Pseudomonas sp. NBM11 and high degradation rate was related to high
growth rate obtained in cultivation at temperature ranging from 30°C to
35°C.
0.3
25 °C
0.25
30 °C
0.2 35 °C
OD (600 nm)
40 °C
0.15
0.1
0.05
0
0 6 12 18 24 30 36
Time (in hours)
Figure (3-15): The growth curve of P. putida local isolate at various temperatures
(25 °C, 30 °C, 35 °C, and 40 °C) at 250 ppm of initial concentration of phenol.
88:
3.5.2 Optimum pH for phenol biodegradation enhancement
The effect of pH on the growth of the target isolate of P. putida

(isolate No. 15) was studied in the range between 6 and 8. The growth curve
of these microbes at different pH conditions at 30°C was obtained.
Maximum growth of the microorganism was observed at pH 7, figure (3-16).
From the obtained result, it was observed that the pH of the medium has a
significant effect on the growth of these bacteria and ultimately the
degradation of the xenobiote. This result was in agreement with Belal and
El-Nady (2013) and Nguyen et al. (2023) who both illustrated that the
survival of P. putida was the highest at pH of 7.
0.3
pH 6
0.25
pH 7
0.2 pH 8
OD (600 nm)
0.15
0.1
0.05
0
0 6 12 18 24 30 36
Time (in hours)
Figure (3-16): The growth curve of P. putida local isolate at various pH values (pH 6,
pH 7, and pH 8) at 30°C and 250 ppm of initial concentration of phenol.
3.5.3 Optimum phenol concentration for phenol biodegradation

enhancement
The effect of substrate concentration on the growth of the

microorganism was studied at various initial concentrations of phenol
ranging from 250 ppm to 750 ppm at pH 7 and incubation temperature of
88;
30o C. It was observed that the optimum phenol concentration for bacterial
growth was at 250 ppm of initial phenol. The increase in the concentration
of phenol made the growth of the microorganism slows down because of the
toxicity of phenol, figure (3-17). This result is in consistency with Patil et al.
(2023) who suggested that R. biphenylivorans RARA1707 strain is naturally
adapted to metabolize phenolic compounds and hence may prove to be a
potential candidate for its bioremediation and an initial high concentration of
phenol can cause significant stress on the isolate and hence lead to
ineffective phenol removal.
0.3
250 ppm
0.25
500 ppm
0.2
750 ppm
OD (600 nm)
0.15
0.1
0.05
0
0 6 12 18 24 30 36
Time (in hours)
Figure (3-17): The growth curve of P. putida local isolate at various concentrations
of phenol (250 ppm, 500 ppm, and 750 ppm) at (30°C, pH 7).
3.6 Screening of optimum conditions for catechol 1,2-

dioxygenase production by P. putida
P. putida isolate 15 was the best isolate in degrading phenol up to the
concentration of 1000 ppm of initial concentration of phenol, so it was
subjected to various tests to assure its capacity to produce C12O enzyme.
The isolate was grown overnight in 250 ml of MS medium supplemented
888
with 100 ppm of phenol at 30 °C. The bacterial cells were disrupted by
sonication with MSE Soniprep 150 Ultrasonic for 10 minutes (30 seconds
on, 30 seconds off). Sonicated cells were centrifuged at 4°C for 30 minutes
at 8000 rpm to remove cell debris. The isolate showed a specific activity
reaches to 2.39 U/mg.
Most studies on catechol 1, 2-dioxygenase (C12O) enzyme have been
conducted on Gram-negative bacteria; however, much less information is
available about this group of bacteria (Setlhare, et al., 2018). Aerobic
biodegradation of these chemicals involves the conversion of phenol to
catechol, which is then oxidized by catechol 1, 2-dioxygenase via an ortho-
cleavage pathway (Al-Defiery and Reddy, 2019). Byproducts of this route
include molecules that can proceed to the tricarboxylic acid cycle, where the
ring is opened and eventually degraded (Mulla et al., 2019; Arvind et al.,
2020).
3.6.1 Optimum temperature for enzyme production

The production of the Catechol 1,2-Dioxygenase enzyme from the
isolate No. 15 was the highest at 30°C, but it was decreased dramatically to
low levels at temperatures below and above 30°C. The enzyme activity at
30°C was 1.32 U/ml. The amount of enzyme synthesis by this isolate at
various temperatures are depicted in figure (3-18). The results showed that
the enzyme activity had increased significantly at 30°C. These results
indicate that under specific temperature conditions, the isolate No. 15 can
produce abundant enzymes that may be useful in bioremediation processes.
As demonstrated in the following figure (3-18), the highest level of
C12O activity was observed at 30°C. Significant activity is also detected at
35°C even if it is less than at 30°C. Both temperatures lower and higher than
888
30°C can lower the enzyme's activity. These findings were in agreement
with Patil (2014) for Burkholderia sp., Mohanty and Jena (2017) for
Pseudomonas sp. NBM11, and Setlhare et al. (2018) for P. chlororaphis
strain UFB2).
1.4 1.32
1.2
1
Enzyme activity U/ml
0.84
0.8
0.66
0.57
0.6
0.4
0.26
0.2 0.09
0
15 20 25 30 35 40
Temperatures °C
Figure (3-18): The effect of different temperatures on enzyme production by P.

putida (isolate No. 15).
3.6.2 Optimum pH for enzyme production

Based on the data presented in figure (3-19), enzyme production from
the P15 isolate was relatively low at a pH of 5.5, but it increased to its
highest level to reach (0.92 U/ml) at pH 8. So, the best pH value for the
production of the enzyme was at pH 8. Both acidic and alkaline pH inhibited
the enzyme’s activity significantly. Even the changes in pH result in the
denaturation of proteins, which may have a deleterious effect on the
microorganism. The pH values in figure (3-19) were the same as those of
Karigar et al. (2006) for Arthrobacter citreus, in addition to Mohanty and
Jena (2017) for Pseudomonas Spp., and Ghaima et al . (2017) for
Pseudomonas aeruginosa.
888
1 0.92
0.9 0.84
0.77 0.77
Enzyme activity U/ml
0.8
0.68
0.7 0.62
0.6 0.55
0.5
0.4
0.28
0.3
0.2
0.07
0.1
0
5 5.5 6 6.5 7 7.5 8 8.5 9
pH values
Figure (3-19): The effect of different pH values on enzyme production by P. putida

(isolate No. 15).
3.7 Purification of catechol 1,2-dioxygenase enzyme by

chromatography method
3.7.1 Ammonium sulfate precipitation
The enzyme was recovered from the isolate 15 of P. putida. The

bacterial isolate was grown overnight in 250 ml of MS medium
30 minutes at 8000 rpm to remove cell debris. It was purified by
precipitating the crude extract with ammonium sulfate with a saturation rate
of 80%. The initial activity of the crude extract was 0.72 U/ml, whereas the
specific activity was 2.48 U/mg. After being concentrated by 80%
ammonium sulfate, the enzyme's activity level increased to 0.78 U/ ml,
while its specific activity increased to 4.58 U/ mg, Table (3-5). After that,
888
the solution of ammonium sulfate precipitate was transferred to a plastic bag

designed for this purpose (Hasan et al., 2023). Dialysis was performed
overnight using the same buffer and then, the bag was settled on sucrose
crystals until the volume reached 10 ml, and stored in the fridge at 4 oC for
further purification as described by Hassan and Al-Jobory (2016). The final
step of gel-filtration enhanced the enzyme's specific activity and yielded the
most.
These findings have major effects on bioremediation and biocatalysis

applications of the enzyme. The precipitation of the crude extract by
Ammonium Sulfate is a very helpful and excellent step in the initial
purification of enzymes (Si et al., 2021). The suitably high molarity of
ammonium sulphate allows the precipitation of a vast majority of proteins.
Because of its low cost, wide availability, and ability to stabilize enzyme
activity while being nontoxic to most enzymes, ammonium sulfate is a
practical and powerful tool (Arbita et al., 2023).
3.7.2 Ion exchange chromatography
The concentrated precipitate with ammonium sulphate obtained from

the previous step was carried out using DEAE-cellulose by ion exchange
chromatography. For the enzyme activity, two peaks were shown (figure 3-
20); the first at washing step with no activity and the other at elution step
with an activity reached to 0.86 U/ml, and a specific activity of 10.75 U/mg
(Table 3-3).
These outcomes were similar to the findings of Beschcov et al.
(2020) for P. putida, and comparable to those illustrated by Nadaf and
Ghosh (2011) for Rhodococcus Sp. Ion exchange chromatography is one of
888
the best options for purifying proteins. Ultimately, the enzyme will have a
positive or negative charge depending on the surface residues, the enzyme,
and the buffer conditions (Segel,1976; Liang et al., 2021).
0.8 0.12
Wash Absorbance at 280nm
0.7
Enzyme activity
0.1
0.6
Absorbance at 280nm
Enzyme activity (unit/ml)

0.08
0.5
1M
0.4 0.06
0.3
0.04
0.2
0.02
0.1
0 0 0.0M
1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58
Fraction no.
Figure (3-20): Ion exchange - charmoatography of catechol 1, 2 dioxygenase

enzyme from P. putida using DEAE-cellulose column (7x 30 cm). The column was
calibrated with (0.05M) Tris-HCl buffer (pH 8); flow rate 60 ml/ hrs and 5
ml/fraction.
3.7.3 Gel Filtration Chromatography
On Sephacryl S-1000 gel filtration column, the partially purified

enzyme was added. When absorbance at 280 nm and enzyme activity at 260
888
nm were measured, a single peak was detected (figure 3-21). The specific
activity obtained (38.25 U/mg) with a number of folds of (15.42) and a yield
of (36.12%), as demonstrated in table (3-3). The present findings were the
same as those of Singh and Singh (2018) and Beschcov et al. (2020) for P.
putida.
1.6 0.14
Absorance at 280nm
1.4 Absorane at 260nm 0.12
Absorbance at 280 nm
1.2
Enzyme activity (unit/ml)

0.1
1
0.08
0.8
0.06
0.6
0.04
0.4
0.2 0.02
0 0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49
Tube no.
Figure (3-21): Gel-filtration chromatography for purification of catechol 1, 2

dioxygenase enzyme from P. putida using Sephacryl S-1000 column (1.5 x 50) cm.
The column was calibrated with (0.05M) Sodium phosphate pH 8; flow rate 60 ml/
hrs and 5 ml/fraction.
888
Table (3-3): Purification of catechol 1, 2-dioxygenase enzyme from P. putida local

isolate using DEAE-cellulose and Sephacryl S-1000 column chromatography.
Enzyme Total Protein Specific Fold Yield

Volume
Step activity activity conc. activity (%)
(ml)
(U/ml) (Units) (mg/ml) (U/mg)
Crude Extract 100 0.72 72.0 0.29 2.48 1.0 100
Ammonium
40 0.78 31.2 0.17 4.58 1.84 43.33
Sulfate 80%
DEAE-cellulose
32 0.86 27.52 0.08 10.75 4.33 38.22
Ionic- exchange
Gel-filtration
Sephacryl S- 17 1.53 26.01 0.04 38.25 15.42 36.12
1000
3.8 Characterization of catechol 1, 2-dioxygenase enzyme
3.8.1 Molecular weight determination
Using a gel filtration on Sephacryl S-1000 column in comparison with

four reference proteins (Table 3-4), the molecular weight of catechol 1, 2-
dioxygenase was calculated to be 69 kDa. This method was developed by
establishing a link between the logarithm of the molecular weight of
standard proteins and the ratio of the volume of recovery to the volume of
void (Ve/V0), figure (3-22).
The previous results were consistent with the results of a research
performed by Nakai et al. (1990) on Pseudomonas arvilla. The study results
were also in agreement with the results concluded by Saxena and Thakur
(2005) who found that the cell free extract fractionated by DEAE-cellulse
ion-exchange and gel filtration chromatography showed two different
889
fractions of catechol 1,2-dioxygenase with an expected molecular weight of

62 and 48 kDa, respectively which indicating dimeric nature of the enzyme.
A study performed by Lin and Milase (2015) had purified and
characterized catechol 1,2-dioxygenase (C12O) from Acinetobacter sp. Y64
and E. coli transformant with a molecular weight of 36 kDa. Another study
performed by Setlhare et al, (2018) showed that the template-based three-
dimensional structure of catechol 1,2-dioxygenase (C12O) from indigenous
P. chlororaphis strain UFB2 (PcUFB2) was purified and characterized with
a molecular weight of 35 kDa. Moreover, a study conducted by Aravind et
al. (2021) concluded that the molecular mass of the purified C12O under
denatured conditions on SDS-PAGE was estimated to be 38.6 kDa, while the
molecular mass of C12O under non-denatured conditions was determined to
be 121.4 kDa by size exclusion chromatography.
88:
5.5 Pepsin (34.5 kDa)
5
Bovine Serum albumin (67 kDa)
4.5
Catechol1,2Dioxygenase (69 kDa)
4
3.5
Ve/ Vo
3 Arginine Deaminase ( 125.892 kDa)
2.5
1.5 Catalase (232 kDa)
1
4.4 4.6 4.8 5 5.2 5.4 5.6
Log Molecular weight
Figure (3-22): Standard curve to estimate molecular weight of catechol 1, 2-

dioxygenase enzyme from P. putida using gel filtration Sephacryl S-1000.
Table (3-4): Standard proteins used in the determination of the molecular weight of
catechol 1, 2-dioxygenase enzyme produced by P. putida.
M. wt
No. Standard proteins Ve/Vo Log MW
(KDa)
1 Pepsin 34.5 5.488 4.538
Bovine Serum
2 67.0 4.560 4.826
Albumin
Arginine
3 125.89 3.463 5.099
Deaminase
4 Catalase 232.0 1.439 5.365
88;
3.8.2 Optimum temperature for catechol 1, 2-dioxygenase activity
An accelerated increase in the enzyme activity was observed when the

temperature was increased from 15°C until 30°C, figure (3-23). When the
activity of the enzyme reached its maximum value at 30°C (100%), the
activity of the enzyme started to decrease gradually above this degree and
the enzyme lost 25% of its activity at 35°C. The current results are
compatible to those illustrated by Nadaf and Ghosh, (2011) who found that
the optimal temperature of catechol 1, 2-dioxygenase from Rhodococcus sp.
NCIM 2891 was 30°C.
The present results also relative to many studies like that performed
by Aravind et al. (2021) who applied different temperatures in the range of
15°C- 65°C using catechol as substrate, and the enzyme C12O exhibited
maximum catalytic activity at 35°C and began to decrease with increasing
temperature. In addition to the observations of temperature optima of C12O
from P. putida N6 which performed by Guzik et al. (2011). Any increase in
the temperature leads generally to an increase in the activity rates of the
enzyme (Bhatt, 2011; Nasser and Abdulrazaq, 2022).
100
Enzyme Activity (Unit/ml)
80
60
40
20
0
15°C 20°C 25°C 30°C 35°C
40°C
Temperatures °C
Figure (3-23): The effect of different temperatures on the activity of the catechol 1,2-
dioxygenase enzyme purified from P. putida (isolate No. 15).
888
3.8.3 Optimum temperature for catechol 1, 2-dioxygenase stability

The findings indicated that the enzyme was stable at 35°C, as the
enzyme retains 100% of its activity for 60 minutes. The enzyme's stability
was slightly increased at the temperatures less than 35°C, but it was affected
by the increase in temperature above 35°C and started to decline to lose
more than 20% of its stability, figure (3-24).
This may be due to the denaturation of the protein resulting from the
breakdown of the weak ionic and hydrogen bonding that stabilizes the three
dimensional structure of the enzyme (Bhatt, 2011). This also may cause a
distortion in the active site of the protein and these enzymes stay more stable
at low temperatures, so in order to maintain the activity of these enzymes, it
is preferable to preserve them at low temperatures (Tincu et al., 2023).
Aravind et al. (2021) demonstrated that the recombinant C12O
enzyme which was stored at 10°C for 3 h poses greater stability by
exhibiting maximum activity. A similar effect had been previously observed
for C12O from Arthrobacter sp. BA-5-17 (Muakami et al., 1998), P.
aeruginosa (Wang et al., 2006), and S. maltophilia (Guzik et al., 2013).
100
80
60
40
20
0
15°C 20°C 25°C 30°C 35°C
40°C
Temperatures °C
Figure (3-24): The effect of different temperatures on the stability of the catechol
1,2-dioxygenase enzyme purified from the local isolate of P. putida (isolate No. 15).
888
3.8.4 Optimum pH for catechol 1, 2-dioxygenase activity

The activity of C12O was measured and the optimal pH for enzyme
activity was 8 where it reaches its maximum activity (100%). For pH values
less than 8, the enzyme activity was affected by pH buffer differences
having an accelerating activity, but above pH value of 8, the enzyme activity
started to decline losing 7% of its activity, figure (3-25).
The effect of pH on enzyme activity of the purified C12O was

investigated since pH is the crucial factor that influences spatial
configuration in enzymes, which directly affects enzyme-catalyzed reactions
(Weng et al., 2022). A research performed by Saxena and Thakur (2005)
concluded that the pH optima for catechol 1,2-dioxygenase activity was 6.5.
Aravind et al. (2021) found out that the purified C12O of Paracoccus sp.
MKU1, which was cloned and expressed in E. coli was highly active at pH
7.5 and tolerated different pH values efficiently. Another study performed
by Meier et al. (2022) illustrated that catechol 1, 2-dioxygenase (Acdo1p)
from Blastobotrys raffinosifermentans was also active at pH 7.5.
100
80
60
40
20
0
4 5 6 7 8
9
pH Values
Figure (3-25): The effect of different pH values on the activity of the catechol 1,2-
dioxygenase enzyme purified from the local isolate of P. putida (isolate No. 15).
888
3.8.5 Optimum pH for catechol 1, 2-dioxygenase stability
The findings manifested that the optimal pH value for the enzyme's
stability was at pH 6, as the enzyme retains 100% of its activity for 60
minutes. This indicates that the enzyme remains in its optimal and stable
state near to acidic values of pH. Above a pH value of 6, the pH stability
began to gradually decline losing more than 46% of its stability at pH 7, 8,
and 9 because of the effect of alkalinity of pH on the nature of the protein.
Enzyme stability was maximized at 25°C and a pH 6, figure (3-26). This
decline is due to the effect of hydrogen number on the enzymatic structure or
irreversible denaturation that may occur in the extremely high acidic or basic
solutions which leads to change in the active site of the enzyme making it
deactivated (Huang et al., 2021). Results from the current investigation for
the pH stability of C12O were consistent with the results obtained from
Pseudomonas sp. AW-2 (Muakami et al., 1998) and P. aeruginosa (Wang et
al., 2006). In addition to the above, the present results were consistent with
those found by Setlhare et al. (2018).
100
80
60
40
20
0
4 5 6 7 8
9
pH Values
Figure (3-26): The effect of different pH values on the stability of the catechol 1,2-
dioxygenase enzyme purified from the local isolate of P. putida (isolate No. 15).
888
3.8.6 Storage stability of catechol 1, 2-dioxygenase

The stability of catechol 1, 2-dioxygenase was determined by
estimating the specific activity of the soluble enzyme for 28 days. The
specific activity of the purified enzyme was 38.12 U/mg (100%) at zero
time. It had been decreased to reach 24.03 U/mg (63.03%) at day 7 of
incubation, and 11.72 U/mg (34.70%) at day 14 of incubation. After 21 days
of incubation, the enzyme specific activity become 3.23 U/mg (8.47%). At
day 28, the enzyme was not active. So, the enzyme remains active for 21st
days of incubation period, figure (3-27).
The current results were close to the results of Guzik et al. (2014) who
found out that the free enzyme of catechol 1, 2-dioxygenase from
Stenotrophomonas maltophilia KB2 was not active at the day 21 of
incubation period. Another study performed by Karami et al. (2020) who
purified β-glucosidase from Aspergillus niger illustrated that the storage
stability of β-glucosidase activity was enhanced with the incubation time and
reached to maximum (0.497 U/ml) after 144 hours. Then, it was decreased
after 192 hours of incubation time. This decline can result due to a shortage
of nutrient materials in the medium by enhancing cells count during storage
time. Moreover, the accumulation of toxic wastes may result in fermentation
process inhibition and decrease bacterial growth (Li et al., 2023).
888
100
Relative Activity
80
60
100%
40
20
0
0 7 14 21 28
Days
Figure (3-27): Storage stability of free purified catechol 1, 2-dioxygenase from the
local isolate of P. putida (isolate No. 15) within 28 days of incubation period.
3.9 Microcosmic study for phenol degradation using phenol-

degrading P. putida local isolate
Gas Chromatography in the current study was used to monitor and
confirm phenol biodegradation in the soil samples contaminated with
phenolic compounds over two months by using the free bacterial cells of the
local isolate of P. putida. One treatment with three replicates was performed
along sixty days as follows:
Phenol was added as the sole source of carbon and energy to stimulate
phenol degradation by P. putida local isolate. The results of the current
study showed that there was no phenol compounds manifested in GC
analysis at zero time. The compound’s areas, and retention times were listed
in appendix (14) and showed in (figure 3-28). Haq et al. (2021) added that
the addition of pregrown microbial cultures to enhance the degradation of
undesirable compounds (bioaugmentation) and/or the addition of nutrients
and other supplementary constituents to the natural microbial population that
888
encourage propagation at an accelerated rate (biostimulation) are the most

common methodologies for bioremediation of oil spills and heavy metal
degraded sites. Phenolic compounds are highly toxic, along with being one
of the most persistent substances in petroleum refinery effluents (Shebl et
al., 2022).
The finding of using the phenol-degrading local isolate of P. putida
for cleaning up contaminated sites containing phenol were very efficient
because of their long-term and eco-friendly effects depending on
biostimulation and bioaugmentation properties of biocontrol treatment
methods.
Figure (3-28): GC Chromatography of phenolic pollutants in soil sample using

phenol degrading isolate of P. putida (isolate No. 15) at zero time of incubation
period.
The findings of GC analysis at the 10th days of incubation period

showed that there were many peaks for a number of compounds that resulted
as metabolites for phenol degradation pathway. These compounds are
phenol (41.581), 4-methylphenol (10.670), 2,4,5-tri chloro phenol (474.630),
888
2-methyl -4,6-di nitrophenol (806.313), and penta chloro phenol (2682.732).

These findings were illustrated in appendix (15) and figure (3-29).
The results showed that the biodegradative activity increases with
time. The consumption of phenol was observed after different retention
times. So, it is obvious that the area of phenol began to increase at the 10th
day of incubation to reach (41.581) which means that after this period of
time, the bacteria tolerated the toxicity of phenol and started to enter it in
their biodegradation pathway as a sole source of carbon and energy and they
can convert phenol biologically into a number of metabolites. The yield
biomass for bioremediation purpose is very convenient with a little biomass
production and a high utilization of the carbon source in order to not altering
the ecosystem. This result was compatible with a study conducted by Al-
Hamando (2015) who found that biodegradation of oil has increased with
time after the tenth day of the experiment. Moreover, another study
performed by Mahgoub et al. (2023) demonstrated that a complete removal
of 1000 mg phenol/L was observed at 192 hours (8 days).
A research performed by Abuhamed et al. (2004) concluded that
phenol (50 mg/l) was degraded by P. putida F1 ATCC 700007 (Pp F1)
within 18 hours. A study conducted by Fulekar and Geetha (2008) showed
that P. aeruginosa (NCIM 2074) has been potentially used in bioremediation
of chlorpyrifos at concentrations up to 50 mg/l, but the organism is inhibited
by higher concentrations.
An investigation performed by Liu et al. (2009) showed that the
removal efficiency of phenol by free cells was investigated. The
experimental values indicated that free suspended cells showed high phenol
degradation efficiency higher than 95% within 35 hours with an initial
concentration of 800 mg/l phenol. Another study conducted by Jiang et al.
889
(2013) illustrated that the phenol degradation efficiency was as high as 96%
within 30 hours, with an initial concentration of 800 mg/l phenol.
Another study done by Gu et al. (2016) indicates that an acclimated
bacterial community that can degrade over 80% of 300 mg/L of phenol
within 3 days. Varjani and Upasani (2019) illustrated that the degradation of
hydrocarbons reported in their study was both qualitatively and
quantitatively better if compared to that reported by other researchers. From
the results of microcosm study, it was concluded that P. aeruginosa NCIM
5514 can be employed as a potential biodegrader to remediate soils that
contaminated with petroleum hydrocarbons.
Yang et al. (2023) had isolated cold-tolerant phenol-degrading strain,
Pseudomonas veronii Ju-A1 (Ju-A1) which can produce cis, cis-muconic
acid by ortho-cleavage pathway of catechol at 12 °C. The rate of phenol
degradation by the previously mentioned strain was about 33% and phenol
could be completely degraded within 36 hours.

phenol degrading isolate of P. putida (isolate No. 15) at day 10 of incubation period.
88:
Based on GC analysis, it was found that after 20 days of incubation

period, three peaks were shown for a number of compounds that resulted as
metabolites in phenol degradation pathway. These compounds were phenol
(4.998), 4-methylphenol (6.472), and 2,4,6-tri chlorophenol (51.932), as
illustrated in appendix (16) and figure (3-30). At the day 20 of incubation,
the area of phenol began to decrease to reach (4.998) which means that
phenol had been degraded and consumed by bacteria so its quantity appeared
lower than the previous time.
The current results were in agreement with the results of Djokic et al.
(2013) who performed an experiment for removing phenol using Bacillus sp.
PS11using four natural different types of soils in the time period ranging
from 6 to 21 days. The same study demonstrated that the fastest phenol
removal occurred in the loamy soil taken from wooded region which it was
330 (mg day-1 kg-1).

88;
At the day 30 of incubation, phenol degradation almost ended and its

area reached to (0.122). After 30 days of the incubation period, it was shown
that there was only one peak for phenol which it had an area of 0.122 that
illustrated in appendix (17) and figure (3-31).
Nandy et al. (2021) observed that the encapsulated Pseudomonas
oleovorans ICTN13 cells stored at 4 °C for 30 days could reduce phenol
concentration by 53% in 24 hours, retaining half of their catalytic activity,
whereas longer storage time (beyond 30 days) reduced phenol removal
activity significantly.

The findings of GC analysis after 40 days of incubation period

showed that there were no formed peaks for any compound which means
that phenol and other metabolites had been decreased or even degraded
completely after this period of time. These results were illustrated in
appendix (18) and figure (3-32).
888
At the day 40 of incubation period, it was noted that there were no

peaks and compounds shown in the GC analysis results. These results
indicate that there was no trace for phenol and its metabolites and that the
bacteria destroyed these compounds completely within forty days of the
experiment revealing that using pure culture application is quite promising
detoxification technique through bioaugmentation. This result is very close
to the study of Liang et al. (2018) who found that Pseudomonas sp. ZS1
reaches as high as 97.6% in 36 days in comparison with Alcaligenes sp.
CT10, the degradation rate reduces by 4.3-fold (degradation rate of 22.5%
vs. 97.6%).

Phenol degradation rates were quantified using UV/Visible

spectrophotometer at 510 and bacterial growth rates were quantified by
viable counting technique (Subramaniam et al., 2020). Bacterial growth
reaches its highest level (27×105) after 20 days and began to decrease after
this period, and phenol degradation ratio was 97.4% at the day 40 of the
experiment. Statistically, there were high significant differences between
888
bacterial growth and phenol degradation rate after using the tested bacterial
isolate along the experiment period, table (3-5).
Table (3-5): Phenol residual and bacterial growth in soil microcosms along 40 days
of 60 days experiment by UV/Visible spectrophotometer and viable count technique,
respectively; using free cells of P. putida (Isolate No. 15).
Days
Day Day Day Day Day X2
Parameter Zero 10 20 30 40 P value
Bacterial Growth 5×105 23×105 27×105 15×104 1×104 0.01

(CFU/Kg) SIG
Phenol Residual 500 325 120 75 13 0.001

(ppm) SIG
However, the free cells of P. putida in the current study took about 10
days to adapt to phenol toxicity and began to utilize phenol as a carbon
source after that period which resulted in many peaks of phenol metabolites.
It was observed that temperature, pH and initial concentration of phenol play
key roles in determining the rate of phenol degradation. In addition to that,
moisture, nutrients, physical support to the growing microbial population,
and aeration are necessary for faster biodegradation of petroleum
contaminants and for prolonged shelf life of the microbes (Kumari et al.,
2016; Mohanty and Jena, 2017). The reason for the decline in bacterial
growth after one month (30 days) of the experiment is attributed to the
888
consumption of essential nutrients from the medium and the accumulation of

toxic metabolites of phenol, which significantly inhibit the growth of
bacteria, which in turn leads to a decrease in the number of living cells
(Huang et al., 2023).
Many researchers have proved that the use of a single strain or
consortia of indigenous bacteria in the laboratory is effective for the
biodegradation of hydrocarbons (Hamidi et al., 2021; Baltaci et al., 2023). A
number of factors may affect the efficiency and rate of biodegradation
including characteristics of microorganisms, the physicochemical properties
of contaminants, and environmental factors (Kebede et al., 2021). The
previous factors may alter microbial activities, degradative enzyme
activities, and hydrocarbon degradation in general. Bacterial bioremediation
could be effective and enhanced if these factors are manipulated, optimized
and regulated (Koh and Khor, 2022).
The current study results indicates that the local isolate of P. putida 15
can be used successfully in biodegradation of petroleum compounds in
different contaminated sites.
888
Conclusions
The following are the most remarkable conclusions that this study had
come up with:
1. The bacterial species P. aeruginosa showed more frequency than P.
putida isolates with a ratio of 3:1.
2. It was easy to obtain phenol-degrading bacteria from the Iraqi soils
contaminated with petroleum compounds which functioning in
bioremediation.
3. Six isolates of the total number of Pseudomonas spp. isolates
harbored the three set of catabolic genes related to catechol
dioxygenases (cat1, cat2, and catABC). Few differences in nucleotide
sequences were noticed between the amplified segment of the local
isolates and the NCBI strains.
4. Optimization of physiological parameters for phenol biodegradation
using the local isolate of P. putida showed that the optimum
temperature was 30°C and pH was 7 using MSM medium
supplemented with phenol as the only source of carbon and energy.
5. Biostimulation and bioaugmentation experiment using microcosms
was conducted with the application of bacterial free cells of P. putida
15 which was able to degrade 97.4% of phenol at 1000 ppm within 40
days of the experiment.
6. Bioaugmentation experiments in microcosms using the local isolate of
P. putida 15 can be applied effectively in phenol degradation studies.
431
Recommendations
1. Conducting more studies on pollution sources in many contaminated sites
(soil and water) to overcome this global environmental problem.
2. Using some fungi, plants, algae and other species of bacteria in biological
treatment to decompose hydrocarbons in contaminated sites.
3. Constructing phenol-degrading microbial consortia with high potential
for soil bioremediation.
4. Isolating and extracting other catabolic enzymes of dioxygenases which
didn’t extracted in the present study like the catechol 2, 3-dioxygenase.
5. Identifying genes responsible for catabolic ability of xenobiotics that
found in phenol- tolerant microorganisms.
6. Cloning experiments to identify plasmids responsible for the degradation
of PAHs from phenol- degrading bacterial isolates to other bacteria to use
them in biocontrol treatment experiments.
7. Performing extra studies in biostimulation and bioaugmentation
experiments using the phenol- degrading isolates identified in the current
study to remediate contaminated sites.
8. Using immobilized nanoparticles of different oxides to achieve
photocatalytic degradation of dissolved phenol in water streams and other
contaminated sites.
9. Doing more molecular experiments including conjugation and
transformation to determine the mobile genetic elements responsible for
catechol enzymes’ ability to degrade phenol like plasmids and
transposons.
431
References
Abbas N. H., Elsayed A., Hassan H. A., El-Sabbagh S., Elbaz A. F., and
Khalil H. 2022. ―Characterization and expression analysis of
extradiol and intradiol dioxygenase of phenol-degrading
haloalkaliphilic bacterial isolates‖, Current Microbiology, 79(10),
294.‫‏‬
Abdel-Shafy H. I., and Mansour M. S. M. 2016. ―A review on polycyclic

aromatic hydrocarbons: source, environmental impact, effect on
human health and remediation‖, Egyptian Journal of Petroleum,
25(1), 107–123.
Abdel-Shafy H. I.,‫ ‏‬and Mansour M. S. M. 2018. ―Solid waste issue:

Sources, composition, disposal, recycling, and valorization‖,
Egyptian Journal of Petroleum, 27(4), 1275–1290.
Abdullah N. A. H., Mohtar J. A., Ismail K. S., and Khoo B. Y. 2021. ―A

comparison of protein extraction methods suitable for gel-based
proteomic studies of spider silk proteins‖, In AIP Conference
Proceedings (Vol. 2339, No. 1). AIP Publishing.‫‏‬
Abuhamed T., Bayraktar‫ ‏‬E., Mehmetoğlu T., and Mehmetoğlu‫ ‏‬Ü.

2004. ―Kinetics model for growth of Pseudomonas putida F1
during benzene, toluene and phenol biodegradation‖, Process
Biochemistry, 39(8), 983-988.‫‏‬
Adams G.O., Fufeyin, P. T., Okoro, S. E., and Ehinomen, I. 2015.

―Bioremediation, biostimulation and bioaugmention: a review‖.
International Journal of Environmental Bioremediation and
Biodegradation, 3(1), 28–39.
636
References
Adams G.O., Tawari-Fufeyin P., and Igelenyah E.2014. ―Bioremediation

of spent oil contaminated soils using poultry litter‖, Research
Journal in Engineering and Applied Sciences, 3(2), 124–130.
Adetunji C. O., Olaniyan O. T., Igere B. E., Ekundayo T. C., Anani O.

A., Bodunrinde R. E., et al. 2021. ―Microbial degradation of
chlorophenolic compounds‖, Recent Advances in Microbial
Degradation, 313-349.‫‏‬
Agarry S. E., Durojaiye A. O., and Solomon B. O. 2008. ―Microbial

degradation of phenols: a review‖, International Journal of
Environment and Pollution, 32(1), 12–28.
Ahmad M., Wang P., Li J. L., Wang R., Duan L., Luo, X., et al. 2021.
―Impacts of bio-stimulants on pyrene degradation, prokaryotic
community compositions, and functions‖, Environmental
Pollution, 289, 117863.‫‏‬
Ahmadian-Fard-Fini S., Ghanbari D., and Salavati-Niasari M. 2019.
―Photoluminescence carbon dot as a sensor for detecting of
Pseudomonas aeruginosa bacteria: Hydrothermal synthesis of
magnetic hollow NiFe2O4-carbon dots nanocomposite material‖,
Composites Part B: Engineering, 161, 564-577.
Ahmed S. A., and Gogina E. S. 2023. ―Phenol degradation by

electropersulfate process: Statistical modeling using CCD-RSM
optimization‖, In AIP Conference Proceedings (Vol. 2560, No.
1). AIP Publishing.‫‏‬
Alao M. B., and Adebayo E. A. 2022. ―Fungi as veritable tool in
bioremediation of polycyclic aromatic hydrocarbons‐polluted
wastewater‖, Journal of Basic Microbiology, 62(3-4), 223-244.
Al-Daraghi W. A. H., and Al-Badrwi M. S. A. 2020. ―Molecular
637
References
detection for nosocomial Pseudomonas aeruginosa and its

relationship with multidrug resistance, isolated from hospitals
environment‖, Medico-Legal Update, 20(1), 631-636.
Al-Defiery M. E. J., and Reddy G. 2019. ―Aerobic biodegradation of

phenol‖, Mesopotamia Environmental Journal (mesop.
environ.j) ISSN: 2410-2598, 5(2), 20-41.‫‏‬
Aldoori H. R. T. 2018. ―Detection of some resistance and virulence
genes in Acinetobacter baumannii isolated from patients with
various infections at Baghdad hospitals‖, A master's thesis.
Biology Department, College of Education, University of
Samarra, Iraq .
Alfieri A., Fersini F., Ruangchan N., Prongjit M., Chaiyen P., and
Mattevi A. 2007. ―Structure of the monooxygenase component of
a two-component flavoprotein monooxygenase‖, Proceedings of
the National Academy of Sciences, 104(4), 1177–1182.
Al-Halbusi R. I. A. 2015. ―Production, purification and characterization

of alginase from Bacillus circulans local isolate‖, a master's
thesis. University of Baghdad, Iraq.
Alhamando M. M. 2015. ―Anti bacterial activity of Cinnamomum

zeylanicum and Capsicum annunm extracts against Escherichia
coli and Salmonella typhi‖, Al-Qadisiyah Journal of Pure
Science, 20(1), 50-57.‫‏‬
Al-Hawash A. B., Dragh M. A., Li S., Alhujaily A., Abbood H. A.,

Zhang X., et al. 2018. ―Principles of microbial degradation of
petroleum hydrocarbons in the environment‖, The Egyptian
Journal of Aquatic Research, 44(2), 71-76.‫‏‬
Allan D. R., Clark S. J., Dawson A., McGregor P. A., and Parsons S.
638
References
2002. ―Pressure-induced polymorphism in phenol‖, Acta

Crystallographica Section B: Structural Science, 58(6), 1018–
1024.
Allos M. M. 2015. ―Production, characterization and immobilization of

laccase enzyme from Bacillus cereus local isolate‖, (Doctoral
dissertation). Ministry of Higher Education.‫‏‬
Alori E. T., Gabasawa A. I., Elenwo C. E., and Agbeyegbe O. O. 2022.

―Bioremediation techniques as affected by limiting factors in soil
environment‖, Frontiers in Soil Science, 47.
Al-Saffar M. F., and Jarallah E. M. 2019. ―Isolation and characterization

of Pseudomonas aeruginosa from Babylon province‖,
Biochemical and Cellular Archives, 19(1).‫‏‬
Alsarraf Z., Ahmed M., Zainab H. A., Mohammad M. F., Saadon H.

B., and Al-Jassani M. J. 2023. ―Inhibition of catheter biofilm-
acquired urinary tract infections by purified pyoverdine from
Pseudomonas aeruginosa isolated from agricultural soils‖,
Revista Electronica de Veterinaria, 24(1), 69-76.‫‏‬
Altaai M.‫ ‏‬E., Aziz I.‫ ‏‬H. and Marhoon A.‫ ‏‬A. 2014. ―Identification of
Pseudomonas aeruginosa by 16s rRNA gene for differentiation
from other Pseudomonas species that isolated from patients and
environment‖, Baghdad Science Journal, 11(2), pp.1028-1034.
Ambaye T. G., Chebbi A., Formicola F., Prasad S., Gomez F. H.,
Franzetti A., and Vaccari M. 2022. ―Remediation of soil polluted
with petroleum hydrocarbons, and their reuse for agriculture:
Recent progress, challenges, and perspectives‖, Chemosphere,
133572.
639
References
Ambrose C. T. 2018. ―The conquest of pus- a history of bitumen,

creosote and carbolic acid‖.
Amteghy A. H. 2022. ―4-amino antipyrine spectrophotometric and

chromatographic gas determination of phenols in the water of
southern Iraq along with the density functional theory study‖,
Technology, 12(2), 539-545.‫‏‬
Ansari F., Ahmad A., and Rafatullah M. 2023. ―Review on

bioremediation technologies of polycyclic aromatic hydrocarbons
(PAHs) from soil: Mechanisms and future perspective‖,
International Biodeterioration and Biodegradation, 179, 105582.
Aravind M. K., Kappen J., Varalakshmi P., John S. A., and

Ashokkumar B. 2020. ―Bioengineered graphene oxide
microcomposites containing metabolically versatile Paracoccus
sp. MKU1 for enhanced catechol degradation‖, ACS omega,
5(27), 16752-16761.‫‏‬
Aravind M. K., Varalakshmi P., John S. A., and Ashokkumar B. 2021.
―Catechol 1, 2-dioxygenase from Paracoccus sp. MKU1—A
greener and cleaner bio-machinery for cis, cis-muconic acid
production by recombinant E. coli‖, Frontiers in bioengineering
and biotechnology, (9), 703399.‫‏‬
Arbita A. A., Paul N. A., Cox J., and Zhao J. 2023. ―Screening and
isolation of milk-clotting enzymes from seaweed‖, Journal of
Applied Phycology, 1-10.‫‏‬
Arora N. K. 2018. ―Bioremediation: a green approach for restoration of

polluted ecosystems‖ , Environmental Sustainability, 1, 305-307.
Arutchelvan V., Kanakasabai V., Nagarajan S., and Muralikrishnan V.
641
References
2005. ―Isolation and identification of novel high strength phenol

degrading bacterial strains from phenol-formaldehyde resin
manufacturing industrial wastewater‖, Journal of Hazardous
Materials, 127(1-3), 238-243.
Arvind M., Bhatt S., and Nichith K. R. 2020. ―Biodegradation of

aromatics such as benzene, toluene and phenol by Pseudomonas
Strain‖, European Journal of Environment and Earth Sciences,
1(3).
Aryal S. 2022. ―Oxidase test-principle, uses, procedure, types, result
interpretation, examples and limitations‖.‫‏‬
Aryal S. 2018. ―Catalase test-principle, uses, procedure, result

interpretation with precautions‖, Microbiology Info. com.‫‏‬
Asimakoula S., Giannakopoulou A., Lappa E., Tsagogiannis E.,

Primikyri A., Stamatis H., et al. 2022. ―Characterization of
gentisate 1, 2-dioxygenase from Pseudarthrobacter
phenanthrenivorans Sphe3 and its stabilization by immobilization
on nickel-functionalized magnetic nanoparticles‖, Applied
Microbiology, 2(1), 113-132.‫‏‬
Atlas R. M. 2010. ―Handbook of microbiological media‖, CRC press.
ATSDR. 2008. ―Toxicological profile for 1,1-dichloroethylene. Atlanta,

GA: Agency for Toxic Substances and Disease Registry, U.S‖,
Department of Health and Human Services, Public Health
Service.
Azegami K., Nishiyama K., Watanabe Y., Kadota I., Ohuchi A., and
Fukazawa C. 1987. ―Pseudomonas plantarii sp. nov., the causal
agent of rice seedling blight‖. International Journal of Systematic
646
References
and Evolutionary Microbiology, 37(2), 144-152.‫‏‬
Azubuike C. C., Chikere C. B., and Okpokwasili G. C. 2016.

―Bioremediation techniques-classification based on site of
application: principles, advantages, limitations and prospects‖,
World Journal of Microbiology and Biotechnology, 32(11), 1-18.
Baidhe E., Kigozi J., Mukisa I., Muyanja C., Namubiru L., and
Kitarikawe B. 2021. ―Unearthing the potential of solid waste
generated along the pineapple drying process line in Uganda: A
review‖, Environmental Challenges, 2, 100012.‫‏‬
Bala S., Garg D., Thirumalesh B. V., Sharma M., Sridhar K., Inbaraj
B. S., and Tripathi M. 2022. ―Recent strategies for
bioremediation of emerging pollutants: A Review for a Green and
Sustainable Environment‖, Toxics, 10(8), 484.
Baltaci M. O., Omeroglu M. A., Ozkan H., Taskin M., and Adıguzel
A. 2023. ―Enhanced biodegradation of crude oil contamination by
indigenous bacterial consortium under real conditions‖,
Biocatalysis and Biotransformation, 1-12.‫‏‬
Bandyopadhyay K., Das D., and Maiti B. R. 1998. ―Kinetics of phenol

degradation using Pseudomonas putida MTCC 1194‖, Bioprocess
Engineering, 18, 373-377.‫‏‬
Bang-Andreasen T., Schostag M., Priemé A., Elberling B., and Jacobsen
C. S. 2017. ―Potential microbial contamination during sampling
of permafrost soil assessed by tracers‖, Scientific reports, 7(1), 1-
11.‫‏‬
641
References
Bared R., Boucheta A., Chaib M., and Kacimi S. 2010. ―Phenol and
benzoic acid degradation by Pseudomonas aeruginosa‖, Journal
of Water Resource and Protection.
Barghoth M. G., Desouky S. E., Radwan A. A., Shah M. P., and Salem
S. S. 2023. ―Characterizations of highly efficient moderately
halophilic toluene degrading exiguobacterium mexicanum M7
strain isolated from Egyptian saline sediments‖, Biotechnology
and Genetic Engineering Reviews, 1-19.‫‏‬
Barouki R., Samson M., Blanc E. B., Colombo M., Zucman-Rossi J.,
Lazaridis K. N., et al. 2023. ―The exposome and liver disease-
how environmental factors affect liver health‖, Journal of
Hepatology.‫‏‬
Barry K. P., and Taylor E. A. 2013. ―Characterizing the promiscuity of

LigAB, a lignin catabolite degrading extradiol dioxygenase from
Sphingomonas paucimobilis SYK-6‖, Biochemistry, 52(38),
6724–6736.
Basha K. M., Rajendran A., and Thangavelu V. 2010. ―Recent advances

in the biodegradation of phenol: a review‖, Asian J Exp Biol Sci,
1(2), 219–234.
Batrich M., Maskeri L., Schubert R., Ho B., Kohout M., Abdeljaber .,
et al. 2019. ―Pseudomonas diversity within urban freshwaters‖,
Frontiers in Microbiology, (10), 195.
Bayat Z., Hassanshahian M., and Cappello S. 2015. ―Immobilization of

microbes for bioremediation of crude oil polluted environments: a
mini review‖, The Open Microbiology Journal, (9), 48.
643
References
Belal B E., and El-Nady, M F. 2013. ―Bioremediation of pendimethalin-

contaminated soil‖. Afr J Microbiol Res, 7(21), 2574-2588.‫‏‬
Beschkov V., Alexieva Z., Parvanova-Mancheva T., Vasileva E.,

Gerginova M., Peneva N., et al. 2020. ―Phenol biodegradation
by the strain Pseudomonas putida affected by constant electric
field‖, International Journal of Environmental Science and
Technology, 17(4), 1929-1936.
Bhatt P., Bhandari G., Bhatt K., Maithani D., Mishra S., Gangola S.,
et al. 2021. ―Plasmid-mediated catabolism for the removal of
xenobiotics from the environment‖, Journal of Hazardous
Materials, 420, 126618.‫‏‬
Bhatt S.M. 2011. ―Enzymology and enzymatic technology. S. Chand

higher acadamic‖, Chapter 4, 92.
Bhavani P., Parameswari E., and Maheswari M. 2021. ―Impacts of

xenobiotic compounds on the environment‖, Biotica Research
Today, 3(11), 1011–1013.
Blanco-Enríquez E. G., Zavala-Díaz de la Serna F. J., Peralta-Pérez M.

D. R., Ballinas-Casarrubias L., Salmerón I., Rubio-Arias H., et
al. 2018. ―Characterization of a microbial consortium for the
bioremoval of polycyclic aromatic hydrocarbons (PAHs) in
water‖, International Journal of Environmental Research and
Public Health, 15(5), 975.
Boukouvalas D. T., Prates R. A., Leal C. R. L., and de Araújo S. A.

2019. ―Automatic segmentation method for CFU counting in
single plate-serial dilution‖, Chemometrics and Intelligent
Laboratory Systems, 195, 103889.‫‏‬
644
References
Bradford M. M. 1976. ―A rapid and sensitive method for the quantitation

of microgram quantities of protein utilizing the principle of
protein-dye binding‖, Analytical biochemistry, 72(1-2), 248-254.
Bremer J. R. A. 2022. ―Aerobic and anaerobic biodegradation‖, Journal

of Ecosystem and Ecography, 12(4), 1–1.
Brink D. P., Ravi K., Lidén G., and Gorwa-Grauslund M. F. 2019.

―Mapping the diversity of microbial lignin catabolism:
experiences from the eLignin database‖, Applied microbiology
and biotechnology, 103(10), 3979-4002.‫‏‬
Bruinsma L., Martin-Pascual M., Kurnia K., Tack M., Hendriks S.,
van Kranenburg R., et al. 2023. ―Increasing cellular fitness and
product yields in Pseudomonas putida through an engineered
phosphoketolase shunt‖, Microbial Cell Factories, 22(1), 1-9.‫‏‬
Bwapwa J. K. 2022. ―Factors affecting the bioremediation of industrial

and domestic wastewaters‖, In Microbial Biodegradation and
Bioremediation ,461–472. Elsevier.
Cabral L., Giovanella P., Pellizzer E. P., Teramoto E. H., Kiang C. H.,
and Sette, L. D. 2022. ―Microbial communities in petroleum-
contaminated sites: Structure and metabolisms‖, Chemosphere,
286, 131752.
Calero P., Gurdo N., and Nikel P. I. 2022. ―Role of the CrcB transporter
of Pseudomonas putida in the multi‐level stress response elicited
by mineral fluoride‖, Environmental Microbiology, 24(11), 5082-
5104.
645
References
Cao X., Zhao L., Dong W., Mo H., Ba T., Li T., et al. 2022.
―Revealing the mechanisms of alkali-based magnetic nanosheets
enhanced hydrogen production from dark fermentation:
Comparison between mesophilic and thermophilic conditions‖,
Bioresource Technology, 343, 126141.‫‏‬
Cappuccino J. G., and Welsh C. T. 2017. ―Microbiology: a laboratory

manual‖, Pearson Education.‫‏‏‬
Cases I., and Lorenzo V. de. 2005. ―Genetically modified organisms for
the environment: stories of success and failure and what we have
learned from them‖.
Chacon Cortes D. F., and Griffiths L. 2014. ―Methods for extracting

genomic DNA from whole blood samples: current perspectives‖,
Journal of Biorepository Science for Applied Medicine, 2014(2),
1–9.
Chakraborty J., Suzuki-Minakuchi C., Tomita T., Okada K., and

Nojiri H. 2021. ―A novel gene cluster is involved in the
degradation of lignin-derived monoaromatics in Thermus oshimai
JL-2‖, Applied and Environmental Microbiology, 87(11), e01589-
20.‫‏‬
Chamas A., Moon H., Zheng J., Qiu Y., Tabassum T., Jang J. H., and
Suh S. 2020 . ―Degradation rates of plastics in the environment‖,
ACS Sustainable Chemistry and Engineering, 8(9), 3494-3511.‫‏‬
‫‏‬Chapelle F. H. (1999). ―Bioremediation of petroleum hydrocarbon‐

contaminated ground water: the perspectives of history and
hydrology‖. Groundwater, 37(1), 122–132.
646
References
Chaudhary P., Ahamad L., Chaudhary A., Kumar G., Chen W. J.,
and Chen S. 2023. ―Nanoparticle-mediated bioremediation as a
powerful weapon in the removal of environmental pollutants‖,
Journal of Environmental Chemical Engineering, 109591.‫‏‬
Chauhan K., Trivedi U., and Patel K. C. 2007. ―Statistical screening of

medium components by Plackett–Burman design for lactic acid
production by Lactobacillus sp. KCP01 using date juice‖,
Bioresource Technology, 98(1), 98-103.‫‏‬
Chen S., and Sun L. 2023. ―Screening of efficient phenol-degrading

bacteria and analysis of their degradation characteristics‖,
Sustainability, 15(8), 6788.‫‏‬
Chen Y., Feng W., Ye K., Guo L., Xia H., Guan Y., and Li M. 2021.
―Application of metagenomic next-generation sequencing in the
diagnosis of pulmonary infectious pathogens from
bronchoalveolar lavage samples‖, Frontiers in cellular and
infection microbiology, 11, 541092.‫‏‬
Chugh M., Kumar L., and Bharadvaja N. 2022. ― Fungal diversity in

the bioremediation of toxic effluents‖, In Development in
Wastewater Treatment Research and Processes, 61-88. Elsevier.
Coelho L. M., Rezende H. C., Coelho L. M., De Sousa P. A., Melo D.

F., and Coelho N. M. 2015. ―Bioremediation of polluted waters
using microorganisms‖. Advances in Bioremediation of
Wastewater and Polluted Soil, 10, 60770.
Coico R. 2006. ―Gram staining‖. Current protocols in microbiology, (1),

A-3C.‫‏‬
647
References
Curiel-Alegre S., Velasco-Arroyo B., Rumbo C., Khan A. H. A.,

Tamayo-Ramos J. A., Rad C., and Barros, R. 2022.― Evaluation
of biostimulation, bioaugmentation, and organic amendments
application on the bioremediation of recalcitrant hydrocarbons of
soil‖. Chemosphere, 307, 135638.
Das S. 2014. ―Microbial biodegradation and bioremediation‖. Elsevier.
Das S., Raj R., Mangwani N., Dash H. R., and Chakraborty J. 2014.
―Heavy metals and hydrocarbons: adverse effects and mechanism
of toxicity‖,Microbial Biodegradation and Bioremediation,23–54.
Dash H. R., Mangwani N., and Das S. 2014.―Characterization and

potential application in mercury bioremediation of highly
mercury-resistant marine bacterium Bacillus thuringiensis PW-
05‖, Environmental Science and Pollution Research, 21(4), 2642–
2653.
Dawood M. F., Sofy M. R., Mohamed H. I., Sofy A. R., and Abdel-
kader H. A. 2022. ―Hydrogen sulfide modulates salinity stress in
common bean plants by maintaining osmolytes and regulating
nitric oxide levels and antioxidant enzyme expression‖, Journal of
Soil Science and Plant Nutrition, 22(3), 3708-3726.‫‏‬
Deng Y., Zhou Q., Wu Y., Chen X., and Zhong F. 2022. ―Properties
and mechanisms of flavin-dependent monooxygenases and their
applications in natural product synthesis‖, International Journal
of Molecular Sciences, 23(5), 2622.‫‏‬
Dhari S. F., and Hetite W. A. 2019. ―Expression of dmpn in
648
References
Pseudomonas Putida for degradation of phenol in soil‖, The

Iraqi Journal of Agricultural Science, 50, 54–63.
Divyasorubini S., Kandage S. M., Liyanage S., Rajapakse C., and

Silva G. N. 2022. ―Microbial biosensors for real-time monitoring
of the bioremediation processes‖. Bioremediation of
Environmental Pollutants: Emerging Trends and Strategies, 111-
144.‫‏‬
Djokic L., Narancic T., Biocanin M., Saljnikov E., Casey E., Vasiljevic
B., and Nikodinovic-Runic J. 2013. ―Phenol removal from four
different natural soil types by Bacillus sp. PS11‖, Applied soil
ecology, 70, 1-8.‫‏‬
Dougan S. J., and Sadler P. J. 2007. ―The design of organometallic

ruthenium arene anticancer agents‖, CHIMIA International
Journal for Chemistry, 61(11), 704–715.
Downs J. W., and Wills B. K. 2019. ―Phenol toxicity‖.
Ecevit K., Barros A. A., Silva J. M., and Reis R. L. 2022. ―Preventing
microbial infections with natural phenolic compounds‖, Future
Pharmacology, 2(4), 460-498.‫‏‬
Elayyat S. M. 2015. ―Concentration and temperature dependence of

viscosity in mode-coupling theory of binary mixture of water and
phenol‖.‫‏‬
Eljounaidi K., Lee S. K., and Bae H. 2016. ―Bacterial endophytes as

potential biocontrol agents of vascular wilt diseases–review and
future prospects‖, Biological Control, 103, 62–68.
649
References
Elken E., Heinaru E., Jõesaar M., and Heinaru A. 2020 . ―Formation of
new PHE plasmids in pseudomonads in a phenol-polluted
environment‖, Plasmid, 110, 102504.‫‏‬
El-Naas M. H., Mousa H. A., and Gamal M. El. 2017. ―Microbial

degradation of chlorophenols‖. In Microbe-induced degradation
of pesticides, 23–58. Springer.
El-Saadony M. T., Saad A. M., El-Wafai N. A., Abou-Aly H. E., Salem

H. M., Soliman S. M., and AbuQamar S. F. 2023. ―Hazardous
wastes and management strategies of landfill leachates: A
comprehensive review‖, Environmental Technology and
Innovation, 103150.‫‏‬
Environmental Protection Agency (EPA). 1979. ―Phenol ambient water

quality criteria‖, Office of the planning and standards, EPA,
Washington, DC.
Eppinger E., Stolz A., and Ferraroni M. 2023. ―Crystal structure of the
monocupin ring-cleaving dioxygenase 5-nitrosalicylate 1, 2-
dioxygenase from Bradyrhizobium sp‖, Acta Crystallographica
Section D: Structural Biology, 79(7).‫‏‬
Erdogan E., and Karaca A. 2011. ―Bioremediation of crude oil polluted

soils‖, Asian Journal of Biotechnology, 3(3), 206–213.
Fabozzi G., Rebuzzini P., Cimadomo D., Allori M., Franzago M.,
Stuppia L., and Rienzi L. 2022.―Endocrine-disrupting chemicals,
gut microbiota, and human (in) fertility—it is time to consider the
triad‖, Cells, 11(21), 3335.‫‏‬
651
References
FAO F. 2018. ―Food and agriculture organization of the United Nations‖,

Rome, URL: Http://Faostat. Fao. Org.
Faramarzi M., Avarseji Z., Gholamalipuor Alamdari E., and Taliei, F.

2023. ―Biodegradation of the trifluralin herbicide by
Pseudomonas fluorescens‖, International Journal of
Environmental Science and Technology, 20(4), 3591-3598.‫‏‬
Ferone M., Gowen A., Fanning S., and Scannell A. G. 2020. ―Microbial
detection and identification methods: Bench top assays to omics
approaches‖. Comprehensive Reviews in Food Science and Food
Safety, 19(6), 3106-3129.
Fielding A. J., Kovaleva E. G., Farquhar E. R., Lipscomb J. D., and

Que L. 2011. ―A hyperactive cobalt-substituted extradiol-cleaving
catechol dioxygenase‖, JBIC Journal of Biological Inorganic
Chemistry, 16(2), 341–355.
Folake O. 2020. ―Molecular identification of crude oil-degrading bacteria

and screening for catechol 2, 3 dioxygenase (C23O) gene‖,
Biotechnology Journal International, 23(4), 1-14.‫‏‬
Franco-Duarte R., Černáková L., Kadam S., S. Kaushik K., Salehi B.,
Bevilacqua A., and Rodrigues C. F. 2019. ―Advances in chemical
and biological methods to identify microorganisms—from past to
present‖, Microorganisms, 7(5), 130.‫‏‬
Freschi L., Vincent A. T., Jeukens J., Emond-Rheault J. G., Kukavica-

Ibrulj I., Dupont M. J., and Levesque R. C. 2019. ―The
Pseudomonas aeruginosa pan-genome provides new insights on
its population structure, horizontal gene transfer, and
pathogenicity‖, Genome biology and evolution, 11(1), 109-120.
656
References
Fulekar M. H., and Geetha M. 2008. ―Bioremediation of chlorpyrifos by

Pseudomonas aeruginosa using scale up technique‖, Journal of
Applied Biosciences, 12, 657-60.‫‏‬
Garavaglia M., Muzlera A., and Valverde C. 2023. ―Comparative

genomics and informational content analysis uncovered internal
regions of the core genes rpoD, pepN and gltX for an MLSA with
genome-level resolving power within the genus Pseudomonas‖.
Molecular Phylogenetics and Evolution, 179, 107663.‫‏‬
Garbisu C., Garaiyurrebaso O., Epelde L., Grohmann E., and Alkorta
I.2017. ―Plasmid-mediated bioaugmentation for the
bioremediation of contaminated soils‖, Frontiers in microbiology,
8, 1966.
García-Alegría A. M., Anduro-Corona I., Pérez-Martínez C. J.,

Guadalupe Corella-Madueño M. A., Rascón-Durán M. L., and
Astiazaran-Garcia H. 2020. ―Quantification of DNA through the
nanoDrop spectrophotometer: methodological validation using
standard reference material and Sprague Dawley rat and human
DNA‖, International journal of analytical chemistry.‫‏‬
Gerothanassis I. P. 2023. ―Ligand-observed in-tube NMR in natural

products research: A review on enzymatic biotransformations,
protein-ligand interactions, and in-cell NMR spectroscopy‖.
Arabian Journal of Chemistry, 104536.
Ghaima K. K., Rahal B. S., and Mohamed, M. M. 2017.

―Biodegradation of phenol by Pseudomonas aeruginosa isolated
651
References
from soil contaminated with diesel fuel‖, Bioscience Research,

14(4), 713-720.‫‏‬
Ghanem K. M., Al-Garni S. M., and Al-Shehri A. N. 2009. ―Statistical
optimization of cultural conditions by response surface
methodology for phenol degradation by a novel Aspergillus flavus
isolate‖, African Journal of Biotechnology, 8(15).
Ghangrekar M.M., Kumar S. and Chakraborty I. 2022. ―Environmental

impacts and necessity of removal of emerging contaminants to
facilitate safe reuse of treated municipal wastewaters‖,
Environmental Degradation: Challenges and Strategies for
Mitigation. 95.
Ghosh S., Sharma I., Nath S., and Webster, T. J. 2021.
―Bioremediation—the natural solution‖, In Microbial Ecology of
Wastewater Treatment Plants, 11-40. Elsevier.‫‏‬
Gibson D.T, Parales R,E. 2000. ―Aromatic hydrocarbon dioxygenases in

environmental biotechnology‖, Current Opinion in
Biotechnology. 11: 236–243.
Girard L., Lood C., Höfte M., Vandamme P., Rokni-Zadeh H., van
Noort V., and De Mot R. 2021. ―The ever-expanding
Pseudomonas genus: description of 43 new species and partition
of the Pseudomonas putida group‖, Microorganisms, 9(8), 1766.‫‏‬
Glick B. R. 2012. ―Plant growth-promoting bacteria: mechanisms and

applications‖, Scientifica.
Gouthami K., Lakshminarayana L., Faniband B., Veeraraghavan V.,

Bilal M., Bhargava R. N., and Mulla, S. I. 2023. ―Introduction to
polymeric nanomaterials‖, In Smart polymer nanocomposites. 3-
653
References
25. Elsevier.‫‏‬
Goveas L. C., Selvaraj R., Vinayagam R., Sajankila S. P., and

Pugazhendhi A. 2023. ―Biodegradation of benzo (a) pyrene by
Pseudomonas strains, isolated from petroleum refinery effluent:
Degradation, inhibition kinetics and metabolic pathway‖,
Chemosphere, 321, 138066.‫‏‬
Goyal P., and Basniwal R. K. 2017. ―Environmental bioremediation:

biodegradation of xenobiotic compounds‖, In Xenobiotics in the
soil environment . 347–371. Springer.
Grekova-Vasileva M., and Topalova Y. 2009. ―Enzyme activities and

shifts in microbial populations associated with activated sludge
treatment of textile effluents‖, Biotechnology and
Biotechnological Equipment, 23(1), 1136–1142.
Gu Q., Wu Q., Zhang J., Guo W., Wu H., and Sun M. 2016.
―Community analysis and recovery of phenol-degrading bacteria
from drinking water biofilters‖, Frontiers in microbiology, 7, 495.
Gupta S. K., Singh B., Mungray A. K., Bharti R., Nema A. K., Pant
K. K., and Mulla, S. I. 2022. ―Bioelectrochemical technologies for
removal of xenobiotics from wastewater‖, Sustainable Energy
Technologies and Assessments, 49, 101652.
Guzik U., Hupert-Kocurek K., Marchlewicz A., and Wojcieszynska D.

2014. ―Enhancement of biodegradation potential of catechol 1, 2-
dioxygenase through its immobilization in calcium alginate gel‖,
Electronic Journal of Biotechnology, 17(2), 83-88.‫‏‬
654
References
Guzik U., Hupert-Kocurek K., Sitnik M., and Wojcieszyńska D. 2013.

―High activity catechol 1, 2-dioxygenase from Stenotrophomonas
maltophilia strain KB2 as a useful tool in cis, cis-muconic acid
production‖, Antonie Van Leeuwenhoek, 103, 1297-1307.
Haas D., and Défago G. 2005. ―Biological control of soil-borne

pathogens by fluorescent pseudomonads‖, Nature Reviews
Microbiology, 3(4), 307–319.
Hamidi Y., Ataei S. A., and Sarrafi A. 2021. ―Biodegradation of total

petroleum hydrocarbons in oily sludge: a comparative study of
biostimulation, bioaugmentation, and combination of methods‖,
Journal of Chemical Technology and Biotechnology, 96(5), 1302-
1307.‫‏‬
Hanafi M. F., and Sapawe N. 2020. ―A review on the water problem

associate with organic pollutants derived from phenol, methyl
orange, and remazol brilliant blue dyes‖, Materials Today:
Proceedings, 31, A141–A150.
Haq S., Bhatti A. A., Bhat S. A., Mir S. A., and ul Haq A. 2021. ―In‐
situ bioremediation: An eco‐sustainable approach for the
decontamination of polluted sites‖, Soil Bioremediation: An
Approach Towards Sustainable Technology, 1-14.‫‏‬
Hasan S., Anwar Z., Khalid W., Afzal F., Zafar M., Ali U., and Aljobair
M. O. 2023. ―Laccase production from local biomass using solid
state fermentation‖. Fermentation, 9(2), 179.‫‏‬
Hassan A. A., and Al-Jobory H. 2016. ―Purification and characterization
655
References
of phytase from fruit bodies of local mushroom Pleorotus

ostreatus grown by solid state fermentation‖, Tikrit Journal of
Pure Science, 21(1), 1-10.‫‏‬
Hassan S. K. 2014. ―Isolation and identification of phenol degradable

bacteria from water and the environmental factors affecting them
and studying some mineral elements in industrial wastewater‖, A
doctorate dissertation, College of Agriculture, University of
Baghdad.
He Z., Parales R. E., Spain J. C., and Johnson G. R. 2007. ―Novel

organization of catechol meta pathway genes in the nitrobenzene
degrader Comamonas sp‖, JS765 and its evolutionary implication.
Journal of Industrial Microbiology and Biotechnology, 34(2), 99–
104.
Hesse C., Schulz F., Bull C. T., Shaffer B. T., Yan Q., Shapiro N.,
Hassan K. A., Varghese N., Elbourne L. D. H., and Paulsen I. T.
2018. ―Genome‐based evolutionary history of Pseudomonas spp‖,
Environmental Microbiology, 20(6), 2142–2159.
Hirose J. 2023. ―Diversity and evolution of integrative and conjugative

elements involved in bacterial aromatic compound degradation
and their utility in environmental remediation‖, Microorganisms,
11(2), 438.‫‏‬
Hmood S. A., and Aziz G. M. 2016. ―Purification and characterization

of nattokinase produced by local isolate of Bacillus sp‖, B24.
Iraqi journal of Biotechnology, 15(2).‫‏‬
Huang J., Tan X., Ali I., Duan Z., Naz I., Cao J., and Wang Y. 2023.
―More effective application of biochar-based immobilization
656
References
technology in the environment: Understanding the role of

biochar‖, Science of The Total Environment, 872, 162021.‫‏‬
Huang J., Zheng Y., Groom J. D., Yu Z., and Chistoserdova L. 2021.
―Expression, purification and properties of the enzymes involved
in lanthanide-dependent alcohol oxidation: XoxF4, XoxF5,
ExaF/PedH, and XoxG4‖, In Methods in Enzymology (Vol. 650,
81-96). Academic Press.‫‏‬
Hussain A., Rehman F., Rafeeq H., Waqas M., Asghar A., Afsheen
N., and Iqbal H. M. 2022. ―In-situ, ex-situ, and nano-remediation
strategies to treat polluted soil, water, and air–A review‖,
Chemosphere, 289, 133252.‫‏‬
Iqbal J., Metosh-Dickey C., and Portier R. J. 2007. ―Temperature effects

on bioremediation of PAHs and PCP contaminated south
Louisiana soils: a laboratory mesocosm study‖, Journal of Soils
and Sediments, 7(3), 153–158.
Jabbar N. M., Alardhi S. M., Mohammed A. K., Salih I. K., and

Albayati T. M. 2022. ―Challenges in the implementation of
bioremediation processes in petroleum-contaminated soils: A
review‖, Environmental Nanotechnology, Monitoring and
Management, 18, 100694.
Jiang L., Ruan Q., Li R., and Li T. 2013. ―Biodegradation of phenol

by using free and immobilized cells of Acinetobacter sp. BS8Y‖.
Journal of basic microbiology, 53(3), 224-230.‫‏‬
657
References
Jiang Y., Wen J., Jia X., Caiyin Q., and Hu Z. 2007. ―Mutation of
Candida tropicalis by irradiation with a He-Ne laser to increase
its ability to degrade phenol‖, Applied and Environmental
Joutey N. T., Bahafid W., Sayel H., and El Ghachtouli N. 2013.

―Biodegradation: involved microorganisms and genetically
engineered microorganisms‖, Biodegradation-Life of Science, 1,
289–320.
Kachur K., and Suntres Z. 2020. ―The antibacterial properties of

phenolic isomers, carvacrol and thymol‖, Critical reviews in food
science and nutrition, 60(18), 3042-3053.
Kahru A., Maloverjan A., Sillak H., and Põllumaa L. 2002. ―The
toxicity and fate of phenolic pollutants in the contaminated soils
associated with the oil-shale industry‖, Environmental Science
and Pollution Research, 9(1), 27–33.
Kalantary R. R., Mohseni-Bandpi A., Esrafili A., Nasseri S., Ashmagh

F. R., Jorfi S., and Ja’fari M. 2014. ―Effectiveness of
biostimulation through nutrient content on the bioremediation of
phenanthrene contaminated soil‖, Journal of Environmental
Health Science and Engineering, 12(1), 1-9.
Kamimura N., and Masai E. 2014. ―The protocatechuate 4, 5-cleavage

pathway: overview and new findings‖, Biodegradative Bacteria,
207–226.
Karami F., Ghorbani M., Mahoonak A. S., and Khodarahmi R. 2020.

―Fast, inexpensive purification of β-glucosidase from Aspergillus
658
References
niger and improved catalytic/physicochemical properties upon the

enzyme immobilization: Possible broad prospects for industrial
applications‖. LWT Journal, 118, 108770.
Karigar C., Mahesh A., Nagenahalli M., and Yun D. J. 2006. ― Phenol
degradation by immobilized cells of Arthrobacter citreus‖,
Biodegradation. 17(1), 47.
Kasai D., Fujinami T., Abe T., Mase K., Katayama Y., Fukuda M.,
and Masai E. 2009. ―Uncovering the protocatechuate 2, 3-
cleavage pathway genes‖, Journal of Bacteriology, 191(21),
6758–6768.
Ke J., Wang B., and Yoshikuni Y. 2021. ―Microbiome engineering:

synthetic biology of plant-associated microbiomes in sustainable
agriculture‖, Trends in Biotechnology, 39(3), 244–261.
Kebede G., Tafese T., Abda E. M., Kamaraj M., and Assefa F. 2021.
―Factors influencing the bacterial bioremediation of hydrocarbon
contaminants in the soil: mechanisms and impacts‖, Journal of
Chemistry, 1-17.‫‏‬
Kennedy C. J., and Tierney K. B. 2013. ―Xenobiotic

protection/resistance mechanisms in organisms‖, In
Environmental Toxicology (689–721). Springer.
Khare P. K. 2011. ―Treatment of phenolic water using adsorption‖.
Khraisheh M., Al-Ghouti M. A., and AlMomani F. 2020. ―P. putida as

biosorbent for the remediation of cobalt and phenol from
industrial waste wastewaters‖, Environmental Technology and
Innovation, 20, 101148.‫‏‬
659
References
Kim D. J., Chung S. G., Lee S. H., and Choi J. W. 2012. ―Relation of
microbial biomass to counting units for Pseudomonas
aeruginosa‖, African Journal of Microbiology Research, 6(21),
4620-4622.‫‏‬
Kita A., Kita S., Fujisawa I., Inaka K., Ishida T., Horiike K., Nozaki
M., and Miki K. 1999. ―An archetypical extradiol-cleaving
catecholic dioxygenase: the crystal structure of catechol 2, 3-
dioxygenase (metapyrocatechase) from Pseudomonas putida mt-
2. Structure‖, 7(1), 25–34.
Koh L. M., and Khor S. M. 2022. ―Biodegradation process: Basics,

factors affecting, and industrial applications‖, In Handbook of
Biodegradable Materials (pp. 1-39). Cham: Springer International
Publishing.‫‏‬
Kong F. X., Sun G. D., and Liu Z. P. 2018. ―Degradation of polycyclic

aromatic hydrocarbons in soil mesocosms by microbial/plant
bioaugmentation: performance and mechanism‖, Chemosphere,
198, 83-91.‫‏‬
Koshlaf E., and Ball A. S. 2017. ―Soil bioremediation approaches for

petroleum hydrocarbon polluted environments‖, AIMS
Microbiology, 3(1), 25.
Kotoky R., Ogawa N., and Pandey P. 2022. ―The structure-function

relationship of bacterial transcriptional regulators as a target for
enhanced biodegradation of aromatic hydrocarbons‖,
Microbiological Research, 127087.
661
References
Kou X., and Li Q. 1990 . ―The preparation and properties of catechol-1,

2-dioxygenase from Pseudomonas putida‖, Wei Sheng wu xue
bao= Acta Microbiologica Sinica, 30(5), 397-399.‫‏‬
Krastanov A., Alexieva Z., and Yemendzhiev H. 2013. ―Microbial

degradation of phenol and phenolic derivatives‖, Engineering in
Life Sciences, 13(1), 76–87.
Kumar A., Kumar S., and Kumar S. 2005 . ―Biodegradation kinetics of

phenol and catechol using Pseudomonas putida MTCC 1194‖,
Biochemical Engineering Journal, 22(2), 151–159.
Kumar V., Shahi S. K., and Singh S. 2018. ―Bioremediation: an eco-

sustainable approach for restoration of contaminated sites‖, In
Microbial bioprospecting for sustainable development (115–136).
Springer.
Kumar V., Sharma N., Umesh M., Chakraborty P., Kaur K., Duhan
L., and Maitra S. S. 2023. ―Micropollutants characteristics, fate,
and sustainable removal technologies for landfill leachate: A
technical perspective‖, Journal of Water Process Engineering, 53,
103649.‫‏‬
Kumari B., Singh S. N., and Singh D. P. 2016. ―Induced degradation

of crude oil mediated by microbial augmentation and bulking
agents‖, International journal of environmental science and
technology, 13, 1029-1042.‫‏‬
Kumari S., and Das S. 2023.―Bacterial enzymatic degradation of

recalcitrant organic pollutants: catabolic pathways and genetic
regulations‖, Environmental Science and Pollution Research, 1-
30.‫‏‬
666
References
Kyte R. 2014. ―Climate change is a challenge for sustainable

development‖. Gaidar Forum Moscow, Russian Federation.
Lalucat J., Gomila M., Mulet M., Zaruma A., and García-Valdés E.
2022. ―Past, present and future of the boundaries of the
Pseudomonas genus: Proposal of Stutzerimonas gen‖, Nov.
Systematic and Applied Microbiology, 45(1), 126289.‫‏‬
Lea-Smith D. J., Biller S. J., Davey M. P., Cotton C. A. R., Perez

Sepulveda B. M., Turchyn A. V, Scanlan D. J., Smith A. G.,
Chisholm S. W., and Howe C. J. 2015. ―Contribution of
cyanobacterial alkane production to the ocean hydrocarbon
cycle‖, Proceedings of the National Academy of Sciences,
112(44), 13591–13596.
Lee M. 2009. ―EU regulation of GMOs: law and decision making for a
new technology‖, Edward Elgar Publishing.
Li F., Zhao Y., Xue L., Ma F., Dai S. Y., and Xie S. 2022. ―Microbial
lignin valorization through depolymerization to aromatics
conversion‖, Trends in Biotechnology.‫‏‬
Li G., Xu F., Yang T., Wang X., Lyu T., and Huang Z. 2023.
―Microbial behavior and influencing factors in the anaerobic
digestion of distiller: A comprehensive review‖, Fermentation,
9(3), 199.‫‏‬
Li Y., Li J., Wang C., and Wang P. 2010. ―Growth kinetics and phenol
biodegradation of psychrotrophic Pseudomonas putida LY1‖,
Bioresource Technology, 101(17), 6740-6744.‫‏‬
661
References
Liang J., Cheng T., Huang Y., and Liu J. 2018. ―Petroleum degradation
by Pseudomonas sp. ZS1 is impeded in the presence of antagonist
Alcaligenes sp. CT10‖. Amb express, 8(1), 1-13.‫‏‬
Liang W., Wied P., Carraro F., Sumby C. J., Nidetzky B., Tsung C. K.,
and Doonan C. J. 2021. ―Metal–organic framework-based enzyme
biocomposites‖. Chemical Reviews, 121(3), 1077-1129.‫‏‬
Lin L., Xu F., Ge X., and Li Y. 2019 . ―Biological treatment of

organic materials for energy and nutrients production—Anaerobic
digestion and composting‖, In Advances in Bioenergy (Vol. 4.
121-181). Elsevier.‫‏‬
Lin M., Li F., Li X., Rong X., and Oh K. 2023. ―Biochar-clay,

biochar-microorganism and biochar-enzyme composites for
environmental remediation: a review‖, Environmental Chemistry
Letters, 1-26.‫‏‬
Lin J., and Milase R. N. 2015. ―Purification and characterization of

catechol 1, 2-dioxygenase from Acinetobacter sp. Y64 strain and
Escherichia coli transformants‖. The protein journal, 34, 421-
433.‫‏‬
Liu S., Yang X., and Yao X. 2019. ―Effects of pH on the biodegradation
characteristics of thermophilic micro-aerobic digestion for sludge
stabilization‖, RSC Advances, 9(15), 8379–8388.
Liu Y. J., Zhang A. N., and Wang X. C. 2009. ―Biodegradation of phenol

by using free and immobilized cells of Acinetobacter sp. XA05
and Sphingomonas sp. FG03‖. Biochemical Engineering Journal,
44(2-3), 187-192.‫‏‏‬
Luo T., He J., Shi Z., Shi Y., Zhang S., Liu Y., and Luo G. 2023.
663
References
―Metagenomic binning revealed microbial shifts in anaerobic

degradation of phenol with hydrochar and pyrochar‖,
Fermentation, 9(4), 387.‫‏‏‬
Ma X., Li Y., Liang Y., Liu Y., Yu L., Li C., and Chen L. 2020.
―Development of a DNA microarray assay for rapid detection of
fifteen bacterial pathogens in pneumonia‖, BMC microbiology,
20, 1-13.‫‏‬
Ma Z., Zhang Y., Shen Y., Wang J., Yang Y., Zhang W., and Wang S.
2019. ―Oxygen migration characteristics during bamboo
torrefaction process based on the properties of torrefied solid,
gaseous, and liquid products‖, Biomass and Bioenergy, 128,
105300.
Mahesh S. and Rama B.M., 1999. ―Adsorption kinetics of dihydriphenol

hydroquinone on activated carbon‖, Indian Journal of
Environmental Health, 41, p. 317.
Mahgoub S. A., Qattan S. Y., Salem S. S., Abdelbasit H. M., Raafat

M., Ashkan M. F., and Abd El-Fattah H. I .2023.
―Characterization and biodegradation of phenol by Pseudomonas
aeruginosa and Klebsiella variicola strains isolated from sewage
sludge and their effect on soybean seeds germination‖, Molecules,
28(3), 1203.‫‏‬
Mahiudddin M., and Fakhruddin A. N. M. 2012. ―Degradation of
phenol via meta cleavage pathway by Pseudomonas fluorescens
PU1‖, International Scholarly Research Notices, 2012.
664
References
Maqsood Q., Sumrin A., Waseem R., Hussain M., Imtiaz M., and
Hussain N. 2023. ―Bioengineered microbial strains for
detoxification of toxic environmental pollutants‖, Environmental
Research, 115665.‫‏‬
Marami H., Tsapekos P., Khoshnevisan B., Madsen J. A., Andersen J.

K., Rafiee S., and Angelidaki I. 2022. ―Going beyond
conventional wastewater treatment plants within circular
bioeconomy concept–a sustainability assessment study‖, Water
Science and Technology, 85(6), 1878–1903.
Margesin R., and Schinner F. 2001. ―Bioremediation (natural

attenuation and biostimulation) of diesel-oil-contaminated soil in
an alpine glacier skiing area‖, Applied and Environmental
Microbiology, 67(7), 3127–3133.
Martens P., McEvoy D., and Chang C. T. 2016. ―Climate change:

responding to a major challenge for sustainable development‖, In
Sustainability science (303–310). Springer.
Martínez-García E., and de Lorenzo V. 2019. ―Pseudomonas putida in

the quest of programmable chemistry‖, Current Opinion in
Biotechnology, 59, 111–121.
Medić A. B., and Karadžić I. M. 2022. ―Pseudomonas in environmental

bioremediation of hydrocarbons and phenolic compounds-key
catabolic degradation enzymes and new analytical platforms for
comprehensive investigation‖, World Journal of Microbiology
and Biotechnology, 38(10), 1–28.
Meier A., Worch S., Hartmann A., Marzec M., Mock H. P., Bode R.,
and Matthes F. 2022. ―Characterization of catechol-1, 2-
665
References
dioxygenase (Acdo1p) from Blastobotrys raffinosifermentans and

investigation of its role in the catabolism of aromatic
compounds‖, Frontiers in Microbiology, 13, 872298.‫‏‬
Midhat M. S., and Abed S. M. 2023. ―Isolation and identification of

pathogenic species of the genus Pseudomonas and study of
antibiotic resistance‖, GSC Biological and Pharmaceutical
Sciences, 23(1), 087-098.‫‏‬
Miglani R., Parveen N., Kumar A., Ansari M. A., Khanna S., Rawat
G., and Ansari M. N. 2022. ―Degradation of xenobiotic
pollutants: an environmentally sustainable approach‖,
Metabolites, 12(9), 818.
Miklasińska-Majdanik M., Kępa M., Wojtyczka R. D., Idzik D., and

Wąsik T. J. 2018. ―Phenolic compounds diminish antibiotic
resistance of Staphylococcus aureus clinical strains‖,
International Journal of Environmental Research and Public
Health, 15(10), 2321.
Mishra J., and Arora N. K. 2018. ―Secondary metabolites of fluorescent

pseudomonads in biocontrol of phytopathogens for sustainable
agriculture‖, Applied Soil Ecology, 125, 35–45.
Miyazaki K. 2014. ―Diversity and evolution of aromatic degradation

pathway enzymes in an activated sludge‖, Biodegradative
Bacteria: How Bacteria Degrade, Survive, Adapt, and Evolve,
249-264.‫‏‬
Mohanty S. S. 2012. ―Microbial degradation of phenol: A comparitive

study‖, doctoral dissertation.
666
References
Mohanty S. S., and Jena H. M. 2017. ―Biodegradation of phenol by free

and immobilized cells of a novel Pseudomonas sp. NBM11‖.
Brazilian Journal of Chemical Engineering, 34, 75–84.
Mohapatra B., and Phale P. S. 2021. ―Microbial degradation of

naphthalene and substituted naphthalenes: Metabolic diversity
and genomic insight for bioremediation‖, Frontiers in
Bioengineering and Biotechnology, 9, 602445.
Mohd A. 2022. ―Presence of phenol in wastewater effluent and its

removal: an overview‖, International Journal of Environmental
Analytical Chemistry, 102(6), 1362-1384.‫‏‬
Mohee R., and Mudhoo A. 2012. ―Bioremediation and sustainability‖,

Environmental Engineering and Management Journal, 11(12),
2335–2336.
Moniruddin A. B. M. 2023. ―Dangers of xenobiotics to health and

ecosystem: Xenobiotics‖, KYAMC Journal, 13(4), 189-191.‫‏‬
Movahedyan H., Khorsandi H., Salehi R., and Nikaeen M. 2009.

―Detection of phenol degrading bacteria and Pseudomonas putida
in activated sludge by polymerase chain reaction‖, Journal of
Environmental Health Science and Engineering, 6(2), 115-120.‫‏‬
Muakami S., Wang C. L., Naito A., Shinke R., and Aoki K. 1998.
―Purification and characterization of four catechol 1, 2-
dioxygenase isozymes from the benzamide-assimilating
bacterium Arthrobacter species BA-5-17‖, Microbiological
research, 153(2), 163-171.‫‏‬
667
References
Mulla S. I., Bharagava R. N., Belhaj D., Saratale G. D., Kumar A.,
Rajasekar A., and Yu C. P. 2019. ―Microbial degradation of
phenolic compounds‖, In Microbes and Enzymes in Soil Health
and Bioremediation (305-320). Springer, Singapore.‫‏‬
Munteanu I. G., and Apetrei C. 2021. ―Analytical methods used in
determining antioxidant activity: A review‖, International
Journal of Molecular Sciences, 22(7), 3380.
Nabil S. K., Mustari N., and Khan M. S. 2021. ―Sources and health
impacts of chemical contaminants in foods‖, In Techniques to
Measure Food Safety and Quality (31–68). Springer.
Nadaf N. H., and Ghosh J. S. 2011. ―Purification and characterization of

catechol 1, 2-dioxygenase from Rhodococcus sp. NCIM 2891‖.
Research Journal of Environmental and Earth Sciences, 3(5),
608-613.‫‏‬
Nair C. I., Jayachandran K., and Shashidhar S. 2008 . ―Biodegradation
of phenol‖, African Journal of Biotechnology, 7(25).
Nakai C., Horiike K., Kuramitsu S., Kagamiyama H., and Nozaki M.
1990. ―Three isozymes of catechol 1, 2-dioxygenase
(pyrocatechase), alpha alpha, alpha beta, and beta beta, from
Pseudomonas arvilla C-1‖, Journal of Biological Chemistry,
265(2), 660-665.‫‏‬
Nandy S., Arora U., Tarar P., Viggor S., Jõesaar M., Kivisaar M., and
Kapley A. 2021. ―Monitoring the growth, survival and phenol
utilization of the fluorescent-tagged Pseudomonas oleovorans
668
References
immobilized and free cells‖, Bioresource Technology, 338,

125568.‫‏‬
Narayanan M., Ali S. S., and El-Sheekh M. 2023. ―A comprehensive
review on the potential of microbial enzymes in multipollutant
bioremediation: Mechanisms, challenges, and future prospects‖,
Journal of Environmental Management, 334, 117532.‫‏‬
Nasser S. J., and Abdulrazaq R. A. 2022. ―Effect of purified bacteriocin

from Acinetobacter baumannii on some pathogenic and
environmental isolates and its inhibitory effect on hemolysin
production from S. aureus‖, Journal of Chemical Health Risks,
12(4), 649-658.‫‏‬
Nelson-Filho P., Olmedo L. Y. G., Andrucioli M. C. D., Saraiva M. da
C. P., Matsumoto M. A. N., De Queiroz A. M., Da Silva R. A.
B., and Da Silva L. A. B. 2011. ―Use of the checkerboard DNA–
DNA hybridisation technique for in vivo detection of cariogenic
microorganisms on metallic brackets, with or without use of an
antimicrobial agent‖, Journal of Dentistry, 39(7), 513–517.
Nguyen C. T., Nguyen T. H. H., Tungtakanpoung D., Tran C. S., Vo

T. K. Q., and Kaewlom P. 2023. ―Paraquat removal by free and
immobilized cells of Pseudomonas putida on corn cob biochar‖,
Case Studies in Chemical and Environmental Engineering, 8,
100376.‫‏‬
Nicas M. and Neuhaus J. 2022. ―Estimating exposure intensity based on

odor‖, Annals of Work Exposures and Health, 66(6), 808-814.
Nogina T., Fomina M., Dumanskaya T., Zelena L., Khomenko L.,
Mikhalovsky S., Podgorskyi V., and Gadd G. M. 2020. ―A new
Rhodococcus aetherivorans strain isolated from lubricant-
669
References
contaminated soil as a prospective phenol-biodegrading agent‖,

Applied Microbiology and Biotechnology, 104(8), 3611–3625.
Odinga E. S., Gudda F. O., Waigi M. G., Wang J., and Gao Y. 2021.
―Occurrence, formation and environmental fate of polycyclic
aromatic hydrocarbons in biochars‖, Fundamental Research, 1(3),
296-305.‫‏‬
Ojha A., and Tiwary D. 2021. ―Various remediation measures for

groundwater contamination‖, Groundwater Geochemistry:
Pollution and Remediation Methods, 326-351.‫‏‬
Olujimi O., Fatoki O., and Odendaal J. 2010. ―Analysis of phthalate

and priority phenols from a wastewater treatment plant in Cape
town, South Africa‖, Linnaeus Eco-Tech, 106–116.
Ossai I. C., Ahmed A., Hassan A., and Hamid F. S. 2020. ―Remediation
of soil and water contaminated with petroleum hydrocarbon: A
review‖, Environmental Technology and Innovation, 17, 100526.‫‏‬
Ostovan A., Arabi M., Wang Y., Li J., Li B., Wang X., and Chen L.
2022. ―Greenificated molecularly imprinted materials for
advanced applications‖, Advanced Materials, 34(42), 2203154.
Pandolfo E., Barra Caracciolo A., and Rolando L. 2023. ―Recent

advances in bacterial degradation of hydrocarbons‖, Water, 15(2),
375.
Panpatte D. G., Jhala Y. K., Shelat H. N., and Vyas R. V. 2016.
671
References
―Pseudomonas fluorescens: a promising biocontrol agent and

PGPR for sustainable agriculture‖, In Microbial inoculants in
sustainable agricultural productivity (257–270). Springer.
Park J., Kelly M. A., Kang J. X., Seemakurti S. S., Ramirez J. L., Hatzell
M. C., Sievers C., and Bommarius A. S. 2021. ―Production of
active pharmaceutical ingredients (APIs) from lignin-derived
phenol and catechol‖, Green Chemistry, 23(19), 7488–7498.
Parthipan P., Cheng L., Dhandapani P., Elumalai P., Huang M., and
Rajasekar A. 2022. ―Impact of biosurfactant and iron
nanoparticles on biodegradation of polyaromatic hydrocarbons
(PAHs) ‖, Environmental Pollution, 306, 119384.‫‏‬
Patel A. B., Shaikh S., Jain K. R., Desai C., and Madamwar D. 2020.
―Polycyclic aromatic hydrocarbons: sources, toxicity, and
remediation approaches‖, Frontiers in Microbiology, 11, 562813.
Patel A. K., Singhania R. R., Albarico F. P. J. B., Pandey A., Chen C.

W., and Dong C. D. 2022. ―Organic wastes bioremediation and
its changing prospects‖, Science of the Total Environment,
153889.‫‏‬
Patil A. H., Mishra R. M., Kundar R. R., and Pendse A. S. 2023.

―Study of phenol degradIing bacterium isolated from a
petrochemical contaminated site‖, Journal of Applied Biological
Sciences, 17(2), 306-319.
Patil S. S. 2014. ―Biodegradation study of phenol by Burkholderia sp‖,

PS3 and Bacillus pumilus OS1 isolated from contaminated soil
(Doctoral dissertation).‫‏‬
Pazmiño D. E. T., Winkler M., Glieder A., and Fraaije M. W. 2010.
676
References
―Monooxygenases as biocatalysts: classification, mechanistic

aspects and biotechnological applications‖, Journal of
Biotechnology, 146(1–2), 9–24.
Perfumo A., Banat I. M., Marchant R., and Vezzulli L. 2007.

―Thermally enhanced approaches for bioremediation of
hydrocarbon-contaminated soils‖, Chemosphere, 66(1), 179–184.
Perkins E. J., Gordon M. P., Caceres O., and Lurquin P. F. 1990.

―Organization and sequence analysis of the 2, 4-dichlorophenol
hydroxylase and dichlorocatechol oxidative operons of plasmid
pJP4‖, Journal of Bacteriology, 172(5), 2351–2359.
Peters M., Heinaru E., Talpsep E., Wand H., Stottmeister U., Heinaru
A., and Nurk A. 1997. ―Acquisition of a deliberately introduced
phenol degradation operon, pheBA, by different indigenous
Pseudomonas species‖, Applied and Environmental
Microbiology, 63(12), 4899–4906.
Pham V. H. T., Kim J., Chang S., and Chung W. 2022. ―Bacterial
biosorbents, an efficient heavy metals green clean-up strategy:
Prospects, challenges, and opportunities‖, Microorganisms, 10(3),
610.
Powlowski J., and Shingler V. 1994. ―Genetics and biochemistry of

phenol degradation by Pseudomonas sp‖, CF600. Biodegradation,
5(3), 219–236.
Priyadarshanee M., Mahto U., and Das S. 2022. ―Mechanism of

toxicity and adverse health effects of environmental pollutants‖,
In Microbial biodegradation and bioremediation (33-53).
Elsevier.
671
References
Prpich G. P., and Daugulis A. J. 2005. ―Enhanced biodegradation of

phenol by a microbial consortium in a solid–liquid two phase
partitioning bioreactor‖, Biodegradation, 16(4), 329–339.
Qiu W. 2021. ―The route of lignin biodegradation for its valorization‖, In

Emerging Technologies for Biorefineries, Biofuels, and Value-
Added Commodities (289-325). Cham: Springer International
Publishing.
Radhakrishnan A., Balaganesh P., Vasudevan M., Natarajan N.,

Chauhan A., Arora J., and Srivastav R. 2023. ―Bioremediation
of hydrocarbon pollutants: Recent promising sustainable
approaches, scope, and challenges‖, Sustainability, 15(7), 5847.‫‏‬
Rafeeq H., Afsheen N., Rafique S., Arshad A., Intisar M., Hussain
A., and Iqbal H. M. 2023. ―Genetically engineered
microorganisms for environmental remediation‖, Chemosphere,
310, 136751.‫‏‏‬
Rahman K. S. M., Thahira-Rahman J., Lakshmanaperumalsamy P., and

Banat I. M. 2002. ―Towards efficient crude oil degradation by a
mixed bacterial consortium‖, Bioresource technology, 85(3), 257-
261.‫‏‬
Rahmati F., Asgari Lajayer B., Shadfar N., van Bodegom P. M., and
van Hullebusch E. D. 2022. ―A review on biotechnological
approaches applied for marine hydrocarbon spills remediation‖,
Microorganisms, 10(7), 1289.‫‏‬
673
References
Raina D., Kumar V., and Saran S. 2022. ―A critical review on

exploitation of agro-industrial biomass as substrates for the
therapeutic microbial enzymes production and implemented
protein purification techniques‖, Chemosphere, 294, 133712.‫‏‬
Rajan R., Wani A. W., Mirza A., Sultana S., and Singh J. 2023.
―Genome editing of microbes for degradation of pesticides‖, In
Current Developments in Biotechnology and Bioengineering.
(167-200). Elsevier.‫‏‬
Rashmi I., Karthika K. S., Roy T., Shinoji K. C., Kumawat A., Kala
S., and Pal R. 2022. ―Soil erosion and sediments: A source of
contamination and impact on agriculture productivity‖, In
Agrochemicals in Soil and Environment: Impacts and
Remediation (313-345). Singapore: Springer Nature Singapore.‫‏‬
Ravindran L., MS S., Kumar S, A., and Thomas S. 2022. ―A

comprehensive review on phenol‐formaldehyde resin‐based
composites and foams‖, Polymer Composites, 43(12), 8602-8621.‫‏‬
Ray S., and Banerjee A. 2015. ―Molecular level biodegradation of phenol

and its derivatives through dmp operon of Pseudomonas putida: a
bio-molecular modeling and docking analysis‖, Journal of
Environmental Sciences, 36, 144–151.
Regar R. K., Singh D., Gaur V. K., Thakur R. S., and Manickam N. 2023.
―Functional genomic analysis of an efficient indole degrading
bacteria strain Alcaligenes faecalis IITR89 and its biodegradation
characteristics‖, Environmental Science and Pollution Research,
30(18), 51770-51781.‫‏‬
674
References
Reineke W., and Schlömann M. 2023. ―Microbial degradation of

pollutants‖, In Environmental Microbiology (161-290). Berlin,
Heidelberg: Springer Berlin Heidelberg.
Reiner K. 2010. ―Catalase test protocol‖. American society for

microbiology, 1-6.‫‏‬
Rengarajan T., Rajendran P., Nandakumar N., Lokeshkumar B.,

Rajendran P., and Nishigaki I. 2015. ―Exposure to polycyclic
aromatic hydrocarbons with special focus on cancer‖, Asian
Pacific Journal of Tropical Biomedicine, 5(3), 182–189.
Ridl J., Suman J., Fraraccio S., Hradilova M., Strejcek M., Cajthaml
T., and Uhlik O .2018. ―Complete genome sequence of
Pseudomonas alcaliphila JAB1 (= DSM 26533), a versatile
degrader of organic pollutants‖. Standards in genomic sciences,
13, 1-10.‫‏‬
Riser-Roberts E. 2020. ―Remediation of petroleum contaminated soils:

biological, physical, and chemical processes‖. CRC press.
Rodríguez-Salazar J., Almeida-Juarez A. G., Ornelas-Ocampo K.,

Millán-López S., Raga-Carbajal E., Rodríguez-Mejía J. L., and
Pardo-López L. 2020. ―Characterization of a novel functional
trimeric catechol 1, 2-dioxygenase from a Pseudomonas stutzeri
isolated from the Gulf of Mexico‖, Frontiers in Microbiology, 11,
1100.‫‏‬
Rojo F. 2010. ―Carbon catabolite repression in Pseudomonas: optimizing

metabolic versatility and interactions with the environment‖,
FEMS Microbiology Reviews, 34(5), 658–684.
675
References
Rosenkranz F., Cabrol L., Carballa M., Donoso-Bravo A., Cruz L.,
Ruiz-Filippi G., and Lema J. M. 2013. ―Relationship between
phenol degradation efficiency and microbial community structure
in an anaerobic SBR‖, Water Research, 47(17), 6739-6749.
Saa L., Jaureguibeitia A., Largo E., Llama M. J., and Serra J. L. 2010.
―Cloning, purification and characterization of two components of
phenol hydroxylase from Rhodococcus erythropolis UPV-1‖,
Applied Microbiology and Biotechnology, 86(1), 201–211.
Saati-Santamaría Z., Peral-Aranega E., Velázquez E., Rivas R., and

García-Fraile P. 2021. ―Phylogenomic analyses of the genus
Pseudomonas lead to the rearrangement of several species and the
definition of new genera‖, Biology, 10(8), 782.‫‏‬
Sadauskas M., Statkevičiūtė R., Vaitekūnas J., and Meškys R. 2020.

―Bioconversion of biologically active indole derivatives with
indole-3-acetic acid-degrading enzymes from Caballeronia
glathei DSM50014‖, Biomolecules, 10(4), 663.‫‏‬
Sah S., Krishnani S., and Singh R. 2021. ―Pseudomonas mediated

nutritional and growth promotional activities for sustainable food
security‖, Current Research in Microbial Sciences, 2, 100084.
Salari M., Rahmanian V., Hashemi S. A., Chiang W. H., Lai C. W.,
Mousavi S. M., and Gholami A. 2022. ―Bioremediation treatment
of polyaromatic hydrocarbons for environmental sustainability‖,
Water, 14(23), 3980.
Salem S. S., El-Fattah A., Abdelbasit H. M., and Mahgoub S. A. 2021.
676
References
―Isolation and characterization of phenol degrading bacteria from

industrial wastewater and sewage water‖, Zagazig Journal of
Agricultural Research, 48(2), 443-457.‫‏‬
Sanders E. R. 2012. ―Aseptic laboratory techniques: plating methods‖.

JoVE (Journal of Visualized Experiments), (63), e3064.‫‏‬
Sanghvi G., Thanki A., Pandey S., and Singh N. K. 2020.

―Engineered bacteria for bioremediation‖, In Bioremediation of
Pollutants (359-374). Elsevier.‫‏‬
Santos R. M., and Bakhshoodeh R. 2021. ―Climate change/global

warming/climate emergency versus general climate research:
comparative bibliometric trends of publications‖, Heliyon, 7(11),
e08219.
SAS. 2018. ―Statistical analysis system, user's guide‖, Statistical. Version

9.6th ed. SAS. Inst. Inc. Cary. N.C. USA.
Saxena P., and Thakur I. S. 2005. ―Purification and characterization of

catechol 1, 2-dioxygenase of Pseudomonas fluorescens for
degradation of 4-chlorobenzoic acid‖.
Sayers E. W., Beck J., Bolton E. E., Bourexis D., Brister J. R., Canese
K., and Sherry S. T. 2021. ―Database resources of the national
center for biotechnology information‖, Nucleic acids research,
49(D1), D10
Sayqal A., and Ahmed O. B. 2021. ―Advances in heavy metal

bioremediation: an overview‖, Applied Bionics and
Biomechanics, 2021.
Schmidt C. W. 2010. ―Synthetic biology: environmental health
677
References
implications of a new field‖, National Institute of Environmental

Health Sciences.
Schwab K. 2017. ―The fourth industrial revolution‖, Currency.
Scott T., Zhao H., Deng W., Feng X. and Li Y., 2019. ―Photocatalytic
degradation of phenol in water under simulated sunlight by an
ultrathin MgO coated Ag/TiO2 nanocomposite‖, Chemosphere,
216, 1-8.
Segel I. H. 1976. ―Biochemical Calculations, 2nd edition‖, John and Sons,

Inc. New York.
Selvaraj V., Karthika T. S., Mansiya C., and Alagar M. 2021. ―An
over review on recently developed techniques, mechanisms and
intermediate involved in the advanced azo dye degradation for
industrial applications‖, Journal of molecular structure, 1224,
129195.‫‏‬
Semana P., and Powlowski J. 2019. ―Four aromatic intradiol ring

cleavage dioxygenases from Aspergillus niger‖, Applied and
environmental microbiology, 85(23), e01786-19.
Setlhare B., Kumar A., Mokoena M. P., and Olaniran A. O. 2018.

―Catechol 1, 2-dioxygenase is an analogue of homogentisate 1, 2-
dioxygenase in pseudomonas chlororaphis strain UFB2‖,
International Journal of Molecular Sciences, 20(1), 61.‫‏‬
Setlhare B., Kumar A., Mokoena M. P., Pillay B., and Olaniran A. O.
(2020). ―Phenol hydroxylase from Pseudomonas sp. KZNSA:
Purification, characterization and prediction of three-dimensional
678
References
structure‖. International journal of biological macromolecules,

146, 1000-1008.‫‏‬
Shah M. P. 2014. ―Microbiological removal of phenol by an application

of Pseudomonas spp. ETL: An innovative biotechnological
approach providing answers to the problems of FETP‖. Journal of
Applied & Environmental Microbiology, 1(6).
Shahnaz M., Sharma S., Dev D., and Prasad D. N. 2020. ―Cultivation
technology and antibacterial activity of Agaricus bisporus (U-
03)‖, International Journal of Pharmaceutical Chemistry and
Analysis, 7, 135-144.
Shaikh S., Rashid N., McKay G., Liberski A. R., and Mackey H. R. 2023.
―Nitrogen influence on suspended vs biofilm growth and resource
recovery potential of purple non-sulfur bacteria treating fuel
synthesis wastewater‖, Biochemical Engineering Journal, 190,
108754.‫‏‬
Sharma I. 2020. ―Bioremediation techniques for polluted environment:

concept, advantages, limitations, and prospects‖, In Trace Metals
in the Environment-New Approaches and Recent Advances.
IntechOpen.
Sharma P. 2022. ―Microbial communication during bioremediation of

polyaromatic hydrocarbons‖, Systems Microbiology and
Biomanufacturing, 2(3), 430-444.
Shebl S., Hussien N. N., Elsabrouty M. H., Osman S. M., Elwakil B.

H., Ghareeb D. A., and Olama, Z. A. 2022. ―Phenol
biodegradation and bioelectricity generation by a native bacterial
consortium isolated from petroleum refinery wastewater‖,
679
References
Sustainability, 14(19), 12912.‫‏‬
Shingler V. 2011. ―Signal sensory systems that impact σ54-dependent

transcription‖, FEMS Microbiology Reviews, 35(3), 425–440.
Shivalkar S., Singh V., Sahoo A. K., Samanta S. K., and Gautam P. K.
2021. ―Bioremediation: a potential ecological tool for waste
management‖, In Bioremediation for Environmental
Sustainability, (1-21). Elsevier.
Shwetaa N., Samathab S. and Keshavkanta S. 2021. ―An innovative

approach to degrade xenobiotics through microbial system‖,
Microbial Ecology of Wastewater Treatment Plants, p.73.
Si J., Wu Y., Ma H. F., Cao Y. J., Sun Y. F., and Cui B. K. 2021.
―Selection of a pH-and temperature-stable laccase from
Ganoderma australe and its application for bioremediation of
textile dyes‖, Journal of Environmental Management, 299,
113619.‫‏‬
Sihag S., Pathak H., and Jaroli D. P. 2014. ―International journal of pure
and applied bioscience‖, International Journal Pure and Applied
Bioscience, 2(3), 185–202.
Silva C. C., Hayden H., Sawbridge T., Mele P., De Paula S. O., Silva L.
C. F., Vidigal P. M. P., Vicentini R., Sousa M. P., and Torres
A. P. R. 2013. ―Identification of genes and pathways related to
phenol degradation in metagenomic libraries from petroleum
refinery wastewater‖, PloS One, 8(4), e61811.
Sim H. W., Jung M., and Cho Y. K. 2013. ―Purification and

characterization of protocatechuate 3, 4-dioxygenase from
Pseudomonas pseudoalcaligenes KF707‖, Journal of the Korean
681
References
Society for Applied Biological Chemistry, 56(4), 401–408.
Singh A. K. 2018. ―Purification and characterization of catechol 1, 2-

dioxygenase from Pseudomonas putida Strain PS-I‖, Indian
Journal of Scientific Research, 8(2), 137-140.
Singh A., Kuhad R. C., and Ward O. P. 2009. ―Advances in applied

bioremediation‖, Springer.
Singh R. 2017. ―Biodegradation of xenobiotics-a way for environmental

detoxification‖, International Journal of Development Research,
7(1), 14082–14087.
Singh R. L. 2017. ―Principles and applications of environmental

biotechnology for a sustainable future‖, Springer.
Soal N. C., Coetzee M. P., van der Nest M. A., Hammerbacher A., and
Wingfield B. D. 2022. ―Phenolic degradation by catechol
dioxygenases is associated with pathogenic fungi with a
necrotrophic lifestyle in the Ceratocystidaceae‖, G3, 12(3),
jkac008.‫‏‬
Song D., Chen X., and Xu M. 2022. ―Characteristics and functional

analysis of the secondary chromosome and plasmids in
sphingomonad‖, International Biodeterioration and
Biodegradation, 171, 105402.‫‏‬
Sonwani R. K., Kim K. H., Zhang M., Tsang Y. F., Lee S. S., Giri B.
S., and Rai B. N. 2021. ―Construction of biotreatment platforms
for aromatic hydrocarbons and their future perspectives‖, Journal
of Hazardous Materials, 416, 125968.‫‏‬
Spain J. C. 1995. ―Biodegradation of nitroaromatic compounds‖, Annual
686
References
Review of Microbiology, 49(1), 523–555.
Sreenivasulu K., Basha P. O., Reddy E. S., and Devi K. L. 2019.

―Isolation, purification and characterization of catechol 1, 2-
dioxygenase from Pseudomonas sp‖.‫‏‬
Sridevi V., Lakshmi M. C., Swamy A. V. N., and Rao M. N. 2011.

―Implementation of response surface methodology for phenol
degradation using Pseudomonas putida (NCIM 2102) ‖, Journal
of Bioremediation and Biodegradation, 2(2).‫‏‬
Srivastava M., Srivastava A., Yadav A., and Rawat V. 2019. ―Source and
control of hydrocarbon pollution‖, In Hydrocarbon Pollution and
its Effect on the Environment (p. 9). IntechOpen London, UK.
Srivastava P., and Prasad D. 2023. ―Isothermal nucleic acid

amplification and its uses in modern diagnostic technologies‖, 3
Biotechnology, 13(6), 200.‫‏‬
Subber A. R. H., Ali M. A., and Salman T. M. 2011. ―Radon

concentration in oily sludge produced from oil refineries in the
southern oil plant at Basra Governorate-Iraq‖, Archives of Applied
Science Research, 3, 263–271.
Subramaniam K., Shaharuddin N. A., Tengku-Mazuki T. A.,

Zulkharnain A., Khalil K. A., Convey P., and Ahmad S. A. 2020.
―Statistical optimisation for enhancement of phenol
biodegradation by the Antarctic soil bacterium Arthrobacter sp.
strain AQ5-15 using response surface methodology‖. Journal of
Environmental Biology, 41(6), 1560-1569.‫‏‬
Suenaga H., Koyama Y., Miyakoshi M., Miyazaki R., Yano H., Sota
681
References
M., and Miyazaki K. 2009. ―Novel organization of aromatic

degradation pathway genes in a microbial community as revealed
by metagenomic analysis‖, The ISME journal, 3(12), 1335-1348.‫‏‬
Sun K., Song Y., He F., Jing M., Tang J., and Liu R. 2021. ―A review
of human and animals exposure to polycyclic aromatic
hydrocarbons: Health risk and adverse effects, photo-induced
toxicity and regulating effect of microplastics‖, Science of the
Total Environment, 773, 145403.‫‏‬
Suthersan S. S., Horst J., Schnobrich M., Welty N., and McDonough
J. 2016. ―Remediation engineering: design concepts‖, CRC press.
Tabinda A. B., Javed R., Yasar A., Mahmood A., and Rasheed R.
2023. ―Remediation of persistent organic pollutants using
advanced techniques‖, In Emerging Contaminants and Plants:
Interactions, Adaptations and Remediation Technologies (287-
307). Cham: Springer International Publishing.‫‏‬
Takenaka S., Okugawa S., Kadowaki M., Murakami S., and Aoki K.
2003. ―The metabolic pathway of 4-aminophenol in Burkholderia
sp. strain AK-5 differs from that of aniline and aniline with C-4
substituents‖. Applied and Environmental Microbiology, 69(9),
5410–5413.
Takeo M., Nishimura M., Shirai M., Takahashi H., and Negoro S. 2007.
―Purification and characterization of catechol 2, 3-dioxygenase
from the aniline degradation pathway of Acinetobacter sp. YAA
and its mutant enzyme, which resists substrate inhibition‖,
Bioscience, Biotechnology, and Biochemistry, 706060442.
683
References
Thacharodi A., Hassan S., Singh T., Mandal R., Khan H. A., Hussain
M. A., and Pugazhendhi A. 2023. ―Bioremediation of polycyclic
aromatic hydrocarbons: An updated microbiological review‖,
Chemosphere, 138498.‫‏‬
Tian M., Du D., Zhou W., Zeng X., and Cheng G. 2017. ―Phenol
degradation and genotypic analysis of dioxygenase genes in
bacteria isolated from sediments‖, Brazilian Journal of
Microbiology, 48, 305-313.
Tincu C. E., Bouhadiba B., Atanase L. I., Stan C. S., Popa M., and
Ochiuz L. 2023. ―An accessible method to improve the stability
and reusability of porcine pancreatic α-amylase via
immobilization in gellan-based hydrogel particles obtained by
ionic cross-linking with Mg2+ ions‖, Molecules, 28(12), 4695.‫‏‬
Tiwari B., Sellamuthu B., Ouarda Y., Drogui P., Tyagi R. D., and
Buelna G. 2017. ―Review on fate and mechanism of removal of
pharmaceutical pollutants from wastewater using biological
approach‖, Bioresource Technology, 224, 1–12.
Tiwari S., Tripathi A., and Gaur R. 2017. ―Bioremediation of plant

refuges and xenobiotics‖, In Principles and applications of
environmental biotechnology for a sustainable future (85–142).
Springer.
Traore E. S., and Liu A. 2022. ―Charge maintenance during catalysis in

nonheme iron oxygenases‖, ACS catalysis, 12(10), 6191-6208.‫‏‬
Trouillon J., Imbert L., Villard A.-M., Vernet T., Attrée I., and Elsen,
S. 2021. ―Determination of the two-component systems
regulatory network reveals core and accessory regulations across
684
References
Pseudomonas aeruginosa lineages‖, Nucleic Acids Research,

49(20), 11476–11490.
Tsagogiannis E., Vandera E., Primikyri A., Asimakoula S., Tzakos A.

G., Gerothanassis I. P., and Koukkou A. I. 2021.
―Characterization of protocatechuate 4, 5-dioxygenase from
Pseudarthrobacter phenanthrenivorans Sphe3 and in Situ
reaction monitoring in the NMR tube‖, International Journal of
Molecular Sciences, 22(17), 9647.
Tyagi M., da Fonseca M. M. R., and de Carvalho C. C. C. R. 2011.

―Bioaugmentation and biostimulation strategies to improve the
effectiveness of bioremediation processes‖, Biodegradation,
22(2), 231–241.
Udume O. A., Abu G. O., Stanley H. O., Vincent-Akpu I. F., Momoh Y.,
and Eze M. O. 2023. ―Biostimulation of petroleum-contaminated
soil using organic and inorganic amendments‖. Plants, 12(3), 431.‫‏‬
Vanishree M., Thatheyus A. J., and Ramya D. 2014. ―Biodegradation of

petrol using Aspergillus sp‖, Annual Research and Review in
Biology, 914–923.
Varjani S., and Upasani V. N. 2019. ―Comparing bioremediation

approaches for agricultural soil affected with petroleum crude: a
case study‖, Indian journal of microbiology, 59(3), 356-364.‫‏‬
Vearrier D., Jacobs D., and Greenberg M. I. 2015. ―Phenol toxicity
685
References
following cutaneous exposure to Creolin®: A case report‖.

Journal of Medical Toxicology, 11(2), 227–231.
Wachowski L., and Pietrzak R. 2020. ―Phenols. In managing global

resources and universal processes‖, (275–301). CRC Press.
Wang C. Y., Jerng J. S., Cheng K. Y., Lee L. N., Yu C. J., Hsueh P.
R., and Yang P. C. 2006. ―Pandrug-resistant Pseudomonas
aeruginosa among hospitalised patients: clinical features, risk-
factors and outcomes‖, Clinical Microbiology and Infection,
12(1), 63-68.‫‏‏‬
Wang Q., Li Y., Li J., Wang Y., Wang C., and Wang P. 2015.
―Experimental and kinetic study on the cometabolic
biodegradation of phenol and 4-chlorophenol by psychrotrophic
Pseudomonas putida LY1‖, Environmental Science and Pollution
Research, 22, 565-573.‫‏‬
Wang Y., Meng F., Li H., Zhao S., Liu Q., Lin Y., Wang G. and Wu
J. 2019. ―Biodegradation of phenol by Isochrysis galbana
screened from eight species of marine microalgae: growth kinetic
models, enzyme analysis and biodegradation pathway‖, Journal
of Applied Phycology, 31(1), 445-455.
Wang Y., Tian Y. S., Gao J. J., Xu J., Li Z. J., Fu X. Y., and Yao Q.
H. 2023.―Complete biodegradation of the oldest organic herbicide
2, 4-Dichlorophenoxyacetic acid by engineering Escherichia
coli‖, Journal of Hazardous Materials, 451, 131099.
Wellinghausen N., Köthe J., Wirths B., Sigge A., and Poppert S. 2005.
686
References
―Superiority of molecular techniques for identification of gram-

negative, oxidase-positive rods, including morphologically
nontypical Pseudomonas aeruginosa, from patients with cystic
fibrosis‖. Journal of clinical microbiology, 43(8), 4070-4075.‫‏‬
Weng Z. H., Nargotra P., Kuo C. H., and Liu Y. C. 2022.

―Immobilization of recombinant endoglucanase (CelA) from
Clostridium thermocellum on modified regenerated cellulose
membrane‖, Catalysts, 12(11), 1356.‫‏‬
Whitaker J. R., and Bernhard R. A. 1972. ―Experiments for: an

introduction to enzymology‖.‫‏‬
Widada J., Nojiri H., and Omori T. 2002. ―Recent developments in

molecular techniques for identification and monitoring of
xenobiotic-degrading bacteria and their catabolic genes in
bioremediation‖, Applied Microbiology and Biotechnology, 60(1),
45–59.
Williams P.A and Sayers J.R. 1994. ―The evolution of pathways for
aromatic hydrocarbon oxidation in Pseudomonas‖,
Biodegradation 5: 195–217.
Wilson M. G., and Pandey S. 2022. ―Pseudomonas aeruginosa‖, In

StatPearls. StatPearls Publishing.
Wismer T. 2022. ―Toxicological emergencies‖, Feline Emergency and

Critical Care Medicine, 479-507.‫‏‬
World Health Organization. 2011. ―Establishment of PCR laboratory in
developing countries‖, WHO Regional Office for South-East Asia.
687
References
Xu N., Qiu C., Yang Q., Zhang Y., Wang M., Ye C., and Guo M. 2021.
―Analysis of phenol biodegradation in antibiotic and heavy metal
resistant Acinetobacter lwoffii NL1‖, Frontiers in Microbiology,
2670.
Xu X., Liu W., Tian S., Wang W., Qi Q., Jiang P., Gao X., Li F., Li
H., and Yu H. 2018. ―Petroleum hydrocarbon-degrading bacteria
for the remediation of oil pollution under aerobic conditions: a
perspective analysis‖, Frontiers in Microbiology, 9, 2885.
Yang N., Tian C., Lv Y., Hou J., Yang Z., Xiao X., and Zhang Y. 2022.
―Novel primers for 16S rRNA gene-based archaeal and bacterial
community analysis in oceanic trench sediments‖, Applied
Microbiology and Biotechnology, 106(7), 2795-2809.‫‏‬
Yang Y., Zhang Z. W., Liu R. X., Ju H. Y., Bian X. K., Zhang W. Z.,
and Lu W. Y. 2021. ―Research progress in bioremediation of
petroleum pollution‖, Environmental Science and Pollution
Research, 28(34), 46877-46893.‫‏‬
Yang Y., Zhang Y., Liu C., Su Z., Zhao R., and Zhou J. 2023. ―Low
temperature phenol-degrading microbial agent: construction and
mechanism‖, Research Square.
Yang C. F., and Lee C. M. 2007. ―Enrichment, isolation, and

characterization of phenol-degrading Pseudomonas resinovorans
strain P-1 and Brevibacillus sp. strain P-6‖. International
Biodeterioration and Biodegradation, 59(3), 206-210.‫‏‬
Yasmin H., Bano A., Wilson N. L., Nosheen A., Naz R., Hassan M. N.,
688
References
et al. 2022. ―Drought‐tolerant Pseudomonas sp. showed

differential expression of stress‐responsive genes and induced
drought tolerance in Arabidopsis thaliana‖. Physiologia
Plantarum, 174(1), e13497.‫‏‬
Yi B., and Dalpke A. H. 2020. ―Revisiting the genomic structure of the

genus Pseudomonas with whole genome data: Insights into
diversity and host-related genetic determinants‖, The preprint
Server for Biology (bioRxiv).
ZEKRI A. Y., and Chaalal O. 2005. ―Effect of temperature on

biodegradation of crude oil‖, Energy Sources, 27(1–2), 233–244.
Zhan Y., Yu H., Yan Y., Ping S., Lu W., Zhang W., Chen M., and
Lin M.2009.―Benzoate catabolite repression of the phenol
degradation in Acinetobacter calcoaceticus PHEA-2‖, Current
Zhang Y. H., Dong J. D., Wang Y. S., Gu J. D., Yin J. P., Ahmad M.,
and Ling J. 2022. ―Comparative genomics reveals the evidence of
aromatic hydrocarbons degradation potential in genus
Roseovarius in marine environment‖, International
Biodeterioration and Biodegradation, 171, 105408.
Zhang Y., Hu X., Wang Y., and Jiang N. 2023. ―A critical review of
biomineralization in environmental geotechnics: Applications,
trends, and perspectives‖, Biogeotechnics, 100003.‫‏‬
689
References
Zhang Z., Sarkar D., Biswas J. K., and Datta R. 2022. ―Biodegradation
of per-and polyfluoroalkyl substances (PFAS): A review‖.
Bioresource technology, 344, 126223.
Zhang L., Qiu X., Huang L., Xu J., Wang W., Li Z., and Tang H. 2021.
―Microbial degradation of multiple PAHs by a microbial
consortium and its application on contaminated wastewater‖,
Journal of Hazardous Materials, 419, 126524.‫‏‬
Zhang T., Lang Q., Zeng L., Li T., Wei M., and Liu A. 2014.
―Substituent effect on the oxidation peak potentials of phenol
derivatives at ordered mesoporous carbons modified electrode and
its application in determination of acidity coefficients (pKa) ‖,
Electrochimica Acta, 115, 283–289.
Zharikova N. V., Korobov V. V., and Zhurenko E. I. 2022. ―Flavin-

dependent monooxygenases involved in bacterial degradation of
chlorophenols‖, Applied Biochemistry and Microbiology, 58(6),
677-691.‫‏‬
Zhou C., Zhu L., Huang J., and Lu X. 2022. ―Development of plant
systemic resistance by beneficial rhizobacteria: Recognition,
initiation, elicitation and regulation‖, Frontiers in Plant Science,
2853.
Zhou J., Yu X., Ding C., Wang Z., Zhou Q., Pao H., and Cai W. 2011.
―Optimization of phenol degradation by Candida tropicalis Z-04
using Plackett-Burman design and response surface
methodology‖, Journal of Environmental Sciences, 23(1), 22-30.‫‏‬
Žvirgždas J., Paškevičius A., Petrovas S., Galginienė I., and Iljasevičius
K. 2023. ―Isolation, selection, and use of oil-degrading
691
References
microorganisms for biological treatment of contaminated soil‖,

Polish journal of environmental studies, 32(3), 1-10.‫‏‬
696
Appendices
Appendix (1): Distribution of Pseudomonas spp. isolates collected from different
sources at Baghdad city.
Isolate
Pseudomonas species Source of Isolation
No.
Pseudomonas aeruginosa 1 Daura refinery
Pseudomonas putida 9 Daura refinery
Pseudomonas putida 20 Generator/ Rusafa
Pseudomonas putida 21 Generator/ Mansour
291
Appendices
Pseudomonas putida 22 Generator/ Rusafa
Pseudomonas putida 23 Generator/ Karkh
Pseudomonas putida 24 Generator/ Karkh
Pseudomonas aeruginosa 37 Generator/ New Baghdad
Pseudomonas aeruginosa 38 Generator/ Mansour
Pseudomonas aeruginosa 39 Generator/ Kadhimiya
Pseudomonas aeruginosa 40 Generator/ Adhamiya
Daura Refinery = 31 (77.5%) Pseudomonas aeruginosa = 30 (75%)
Generators = 9 (22.5%) Pseudomonas putida = 10 (25%)
291
Appendices
Appendix (2): Biochemical test results of Pseudomonas aeruginosa by VITEK
system.
291
Appendices
system.
291
Appendices
system.
291
Appendices
system.
291
Appendices
system.
291
Appendices
Appendix (7): Biochemical test results of Pseudomonas putida by VITEK system.
299
Appendices
122
Appendices
122
Appendices
121
Appendices
121
Appendices
Appendix (12): Distribution of Catechol Dioxygenase Genes Among Pseudomonas
spp. Isolates.
Isolate Catechol Dioxygenase Genes

Pseudomonas species
No. cat1 cat2 catABC
1 Pseudomonas aeruginosa Positive Positive
2 Pseudomonas aeruginosa Positive
8 Pseudomonas aeruginosa Positive Positive Positive
9 Pseudomonas putida Positive Positive
14 Pseudomonas putida Positive
15 Pseudomonas putida Positive Positive Positive
121
Appendices
23 Pseudomonas putida Positive
• The six isolates that have been highlighted (P8, P15, P17, P22, P24, and P33) were
all positive for the three genes of Catechol Dioxygenases (cat1, cat2, and catABC).
121
Appendices
Appendix (13): Standard GC chromatography analysis of phenol biodegradation
and its metabolites.
121
Appendices
121
Appendices
Appendix (14): GC Chromatography of phenolic pollutants in soil
samples using P. putida local isolate after zero time.
Retention
Area Height Area Height W 05 Compound
No. Time
(mV.s) (mV) (%) (%) (min) Name
(min)
1 1.983 33087.655 4.810 80.2 3.6 1.22
2 3.547 7502.010 5.275 18.2 4.0 0.39
3 4.817 253.745 50.168 0.6 38.0 0.12
4 6.753 49.264 11.840 0.1 9.0 0.07
5 7.770 13.101 1.518 0.0 1.1 0.12
6 8.120 44.442 7.831 0.1 5.9 0.10
7 10.587 16.567 2.679 0.0 2.0 0.10
8 11.437 50.232 7.314 0.1 5.5 0.11
9 12.690 18.256 3.243 0.0 2.5 0.10
10 13.790 52.636 10.284 0.1 7.8 0.09
11 15.430 33.901 5.062 0.1 3.8 0.09
12 18.230 62.424 9.288 0.2 7.0 0.10
13 23.163 44.767 3.389 0.1 2.6 0.24
14 24.927 45.134 9.470 0.1 7.2 0.08
Total 41274.132 132.171 100.0 100.0
121
Appendices
Appendix (15): GC Chromatography of phenolic pollutants in soil samples using P.
putida local isolate after 10 days of incubation.
Retention
No. Time
(mV .s) (mV) (%) (%) (min) Name
(min)
1 1.353 104698.712 989.854 55.7 10.9 1.66
2 4.567 452.876 14.927 0.2 0.2 0.53
3 5.680 367.229 18.588 0.2 0.2 0.32
4 6.830 41.581 7.620 0.0 0.1 0.11 Phenol
5 7.443 302.365 30.907 0.2 0.3 0.15
6 7.967 302.156 40.874 0.2 0.4 0.12
7 9.160 65.214 10.597 0.0 0.1 0.09
4-
8 9.630 10.670 2.129 0.0 0.0 0.09
methylphenol
9 10.430 415.405 98.735 0.2 1.1 0.07
10 12.667 508.817 41.843 0.3 0.5 0.07
11 13.077 774.542 201.097 0.4 2.2 0.07
12 13.203 4945.495 931.748 2.6 10.2 0.08
13 13.683 3740.201 194.259 2.0 2.1 0.27
2,4,5-tri
14 14.180 474.630 102.243 0.3 1.1 0.08 chloro
phenol
15 14.327 988.298 127.622 0.5 1.4 0.08
16 14.780 1303.061 232.089 0.7 2.6 0.07
17 15.350 443.961 29.804 0.2 0.3 0.23
129
Appendices
18 15.877 350.885 72.657 0.2 0.8 0.08
19 16.253 2928.841 480.015 1.6 5.3 0.09
20 16.550 12092.961 899.427 6.4 9.9 0.21 .
21 16.947 722.351 64.672 0.4 0.7 0.20
22 17.387 7671.030 731.732 4.1 8.0 0.16
23 17.753 755.442 124.848 0.4 1.4 0.09 ..
2-methyl -
24 17.943 806.313 177.553 0.4 2.0 0.08 4,6-di
nitrophenol
25 18.097 1037.523 160.880 0.6 1.8 0.08 …
26 18.477 1549.099 303.458 0.8 3.3 0.08
27 18.713 111.882 17.255 0.1 0.2 0.10
28 19.283 310.120 46.757 0.2 0.5 0.10
Penta chloro
29 19.777 2682.732 175.458 1.4 1.9 0.25
phenol
30 20.100 16758.147 862.653 8.9 9.5 0.30
31 20.587 9600.283 855.043 5.1 9.4 0.18
32 21.060 7047.341 589.544 3.7 6.5 0.17
33 21.453 2893.436 332.411 1.5 3.7 0.12
34 21.933 805.948 122.575 0.4 1.3 0.10
Total 187959.544 9091.873 100.0 100.0
122
Appendices
Retention
Area Height Area Height W 05
No. Time Compound
(mV .s) (mV) (%) (%) (min) Name
(min)
1 2.150 0.032 0.016 0.0 0.0 0.02
2 3.477 66347.273 989.133 99.4 98.8 1.14
3 6.237 4.998 0.745 0.0 0.1 0.12 Phenol
4 7.773 0.280 0.012 0.0 0.0 0.02
4-
5 9.840 6.472 0.968 0.0 0.1 0.10
methylphenol
2,4,6-tri
6 14.033 51.932 0.634 0.1 0.1 0.02
chlorophenol
7 15.637 304.526 9.400 0.5 0.9 0.57
Total 66715.513 1000.907 100.0 100.0
122
Appendices
Retention Area Height Area Height W 05 Compound

No.
Time (min) (mV .s) (mV) (%) (%) (min) Name
1 3.050 836.772 227.128 3.4 14.5 0.04
2 3.653 60.413 9.744 0.2 0.6 0.05
3 3.780 21853.322 992.811 90.0 63.2 0.33
4 4.780 87.216 8.683 0.4 0.6 0.19
5 4.960 244.018 30.594 1.0 1.9 0.06
6 6.173 0.122 0.006 0.0 0.0 0.01 Phenol
7 7.547 119.178 11.800 0.5 0.8 0.16
8 9.140 72.670 10.255 0.3 0.7 0.09
9 10.140 88.745 8.849 0.4 0.6 0.15
10 10.733 138.295 33.886 0.6 2.2 0.06
11 12.907 62.533 12.628 0.3 0.8 0.06
12 13.110 263.820 73.091 1.1 4.7 0.05
13 13.583 43.694 8.962 0.2 0.6 0.08
14 13.927 67.295 22.493 0.3 1.4 0.05
15 14.310 58.846 15.500 0.2 1.0 0.06
16 14.510 290.478 105.316 1.2 6.7 0.05
Total 24287.417 1571.745 100.0 100.0
121
Appendices
Retention
No. Time
(mV .s) (mV) (%) (%) (min) Name
(min)
1 0.300 21.463 1.437 0.2 8.1 0.28
2 3.710 9785.444 11.812 96.5 66.6 0.41
3 14.237 331.540 4.239 3.3 23.9 1.17
4 25.803 1.130 0.248 0.0 1.4 0.08
Total 10139.578 17.736 100.0 100.0
121
‫الخالصة‬
‫اٌّعاٌجةةح اٌث‪ٌٛٛ١‬ة‪١‬ةةح ٘ةة‪ ٟ‬ذمٕ‪١‬ةةح ذسةةرم َ إلزاٌةةح اٌٍّ‪ٛ‬تةةاخ ِةةٓ اٌث‪١‬لةةح ‪ٚ‬تاٌرةةاٌ‪ ٟ‬ايةةرعا ج اٌث‪١‬لةةح‬
‫اٌطث‪١‬ع‪١‬ةةح اليةةٍ‪١‬ح ‪ِٕٚ‬ةةي اٌّ ‪٠‬ة ِةةٓ اٌرٍةة‪ٛ‬ز تّسةةاة ج الد‪١‬ةةاد اٌ ل‪١‬مةةح ت‪ٛٔ ٚ‬اذج‪ٙ‬ةةا‪ .‬ذشةةر‪ٙ‬ا اٌع ‪٠‬ة ِةةٓ‬
‫اٌثىر‪١‬ا‪٠‬ا اٌر‪ ٟ‬ذٕرّ‪ ٟ‬إٌ‪ ٝ‬تةٕاس ِمرٍفح تم راذ‪ٙ‬ا اٌعاٌ‪١‬ح ةٍ‪ ٝ‬ذم‪٠ٛ‬ض اٌّاوثاخ اٌف‪١ٌٕٛ١‬ح ‪ ،‬تّا ف‪ ٟ‬ذٌةه‬
‫‪ٚ Actinobacteria ٚ Proteobacteria ٚ Mycobacterium ٚ Pseudomonas ،‬‬
‫‪ٚ Caulobacter ٚ Achromobacter ٚ Nocardioides ٚ Methylobacillus‬‬
‫تٔة‪ٛ‬اب تىر‪١‬ا‪٠‬ةا‬ ‫‪ ٘ .Sphingobium ٚ Sphingomonas‬فد اٌ رايةح اٌذاٌ‪١‬ةح إٌة‪ ٝ‬ةة ي ‪ٚ‬ذشةم‪١‬‬
‫اٌ ائفح ‪ Pseudomonas spp‬اٌّذطّح ٌٍف‪ٕٛ١‬ي ‪ ٚ‬اٌر‪ ٟ‬ةّعةد ِةٓ ِ‪ٛ‬الةي ٍِ‪ٛ‬تةح ِمرٍفةح فة‪ٕ٠ ِ ٟ‬ةح‬
‫تغ ة ا ‪ ،‬إضةةافح إٌةة‪ ٝ‬اٌرذةةا‪ ٞ‬ةةةٓ أ ‪ّ٠‬ةةاخ اٌ ‪ٛ٠‬وسةة‪١‬ج‪ ١ٕ١‬اٌّسةةل‪ٌٚ‬ح ةةةٓ يةةفح ذذٍ‪ ١‬ةً اٌف‪ٕ١‬ةة‪ٛ‬ي فةة‪ٟ‬‬
‫اٌثىر‪١‬ا‪٠‬ا اليرم اِ‪ٙ‬ا تشىً توثا ف‪ ٟ‬ذجارب اٌّعاٌجح اٌذ‪٠ٛ١‬ح‪.‬‬
‫ةّعد ‪ 125‬ة‪ٕ١‬ةح ذاتةح ِةٓ ذةاب ِمرٍفةح فة‪ٕ٠ ِ ٟ‬ةح تغة ا ‪ ٚ .‬لسةّد اٌع‪ٕ١‬ةاخ إٌة‪125/83 ٝ‬‬
‫(‪ )٪66.4‬ة‪ٕ١‬ح ةّعد ِٓ ِ‪ٛ‬الي ةش‪ٛ‬ائ‪١‬ح ف‪ِ ٟ‬صف‪ ٝ‬اٌ ‪ٚ‬رج ‪ )٪33.6( 125/42 ٚ‬ة‪ٕ١‬ح ِٓ ِ‪ ٌٛ‬اخ‬
‫و‪ٙ‬اتائ‪١‬ح ةائ ج ٌسد تٍ ‪٠‬اخ تعّك (‪ 10-3‬يُ) ذذد يطخ اٌراتح ِٓ ت ا‪٠‬ةح تتا‪٠‬ةً ‪ 2021‬درة‪ٙٔ ٝ‬ا‪٠‬ةح‬
‫تغسطس ‪.2021‬‬
‫ة ٌد الد‪١‬اد اٌ ل‪١‬مح ِٓ ة‪ٕ١‬اخ اٌراتح ‪ٚ‬فمًا ٌرمٕ‪١‬ح اٌرمف‪١‬ف اٌرسٍسٍ‪ ٟ‬تايرم اَ تطثاق اٌ‪ٛ‬يظ‬
‫اٌٍّذ‪ ٟ‬اٌّع ٔ‪ِ ٟ‬ي اٌف‪ٕٛ١‬ي (وّص ر ٌٍىارت‪ ٚ ْٛ‬اٌطالح)‪ .‬ذُ اٌذص‪ٛ‬ي ةٍة‪ 89 ٝ‬ة ٌةح ِمرٍفةح لةا رج‬
‫ةٍ‪ ٝ‬إٌّ‪ ٛ‬ت‪ٛ‬ة‪ ٛ‬اٌف‪ٕٛ١‬ي ِ‪ٛ‬زةح ةٍ‪ 89/62 ٝ‬ة ٌةح (‪ِ )٪69.6‬ةٓ ِصةف‪ ٝ‬اٌة ‪ٚ‬رج ‪ 89/27 ٚ‬ة ٌةح‬
‫(‪ ٌِٛ ِٓ )٪30.3‬اخ اٌى‪ٙ‬اتاد اٌمايح‪ .‬زرةد ةّ‪١‬ي اٌع الخ اٌّذطّح ٌٍف‪ٕٛ١‬ي ‪ ٚ‬اٌثاٌغ ة ٘ا ‪89‬‬
‫ة ٌح ةٍ‪ٚ ٝ‬يظ الةار االٔرمائ‪ٚ ٌٍ ٟ‬ائف ‪ٚ Pseudomonas agar medium‬غ‪١‬ا٘ا ِٓ ال‪ٚ‬ياط‬
‫اٌ رة‪١‬ةةح اٌرفا‪٠‬م‪١‬ةةح ِةةٓ تةةةً ةة ي اٌعة الخ اٌمايةةح تثىر‪١‬ا‪٠‬ةةا ‪ .Pseudomonas‬ذةةُ اٌذصةة‪ٛ‬ي ةٍةة‪ٝ‬‬
‫‪ 89/40‬ة ٌةةح (‪ِ )٪44.9‬ةةٓ إةّةةاٌ‪ ٟ‬ة ة اٌع ة الخ ِ‪ٛ‬زةةةح ةٍةة‪ )٪87.5( 35 ٝ‬ة ٌةةح ِةةٓ ِصةةف‪ٝ‬‬
‫اٌ ‪ٚ‬رج ‪ )٪12.5( 5 ٚ‬ة ٌح ِةٓ اٌّ‪ٌٛ‬ة اخ اٌمايةح‪ .‬شمصةد اٌعة الخ اٌثىر‪١‬ا‪٠‬ةح دسةة اٌمصةائ‬
‫اٌ رة‪١‬ةةح ‪ٚ‬اٌّظ‪ٙ‬ا‪٠‬ةةح ‪ٚ‬اٌفسةة‪ٌٛٛ١‬ة‪١‬ح ‪ ،‬إضةةافح إٌةة‪ٔ ٝ‬ظةةاَ ‪ٚ VITEK‬اٌطةةاق اٌج ‪٠‬ل‪١‬ةةح تايةةرم اَ ةةة‪ٓ١‬‬
‫‪ .16S rDNA‬شمصد اٌع الخ الرتع‪ ْٛ‬ةّ‪١‬عا ةٍ‪ ٝ‬تٔ‪ٙ‬ةا تٔة‪ٛ‬اب ِةٓ ةةٕس ‪ .Pseudomonas‬ذةُ‬
‫‌أ‬
‫ذذ ‪ )٪75( 30 ٠‬ة ٌح ةٍ‪ ٝ‬تٔ‪ٙ‬ا ‪ )٪25( 10 ٚ Pseudomonas aeruginosa‬ة الخ ةٍ‪ ٝ‬تٔ‪ٙ‬ةا‬
‫‪.Pseudomonas putida‬‬
‫تةا‪ ٞ‬اٌرذا‪ ٞ‬ةٓ إٌّظ اٌج‪ٚ ٟٕ١‬ذذٍ‪ ً١‬اٌرسٍسً تايرم اَ تأاِج ‪Geneious software‬‬
‫ٌثالز ة‪ٕ١‬اخ ذم‪٠ٛ‬ض‪١‬ح ِمرٍفح‪ .‬اٌج‪ٕ١‬اخ اٌر‪ ٟ‬ذُ ذىث‪١‬ا٘ا وأةد وةاذ‪١‬ى‪ٛ‬ي ‪ٛ٠ -2 ،1‬وسةج‪، )cat1) ١ٕ١‬‬
‫واذ‪١‬ى‪ٛ‬ي ‪ٛ٠ -3 ، 2‬وسج‪ٚ ، )cat2) ١ٕ١‬واذ‪١‬ى‪ٛ‬ي ‪ٛ٠‬وسج‪ .)catABC( ABC ١ٕ١‬اٌج‪ cat1 ٓ١‬واْ‬
‫ِعثةةاا ةٕةةٗ فةة‪ ٟ‬ةّ‪١‬ةةي ة ة الخ (‪ ، Pseudomonas sp. )٪100‬ت‪ّٕ١‬ةةا ‪ٚ‬ة ة اٌجةة‪ cat2 ٓ١‬فةة‪9 ٟ‬‬
‫(‪ )٪22.5‬ة الخ فمظ ‪ٚ‬ذُ اٌىشف ةٓ ةة‪ catABC ٓ١‬فة‪ )٪27.5( 11 ٟ‬ة ٌةح‪ .‬يةد ةة الخ فمةظ‬
‫ِةةةٓ اٌّجّةةة‪ٛ‬ب اٌىٍةةة‪ ٟ‬وأةةةد ِ‪ٛ‬ةثةةةح ٌٍج‪ٕ١‬ةةةاخ اٌثالتةةةح ِةةةٓ ‪ٌ ،catechol dioxygenases‬ةةة ٌه ذةةةُ‬
‫ايرم اِ‪ٙ‬ا ف‪ ٟ‬اٌمط‪ٛ‬ج اٌراٌ‪١‬ح ٌٍرذمك ِٓ يٍ‪ٛ‬و‪ٙ‬ا ف‪ ٟ‬اٌرذًٍ اٌث‪ٌٛٛ١‬ة‪ٌٍّ ٟ‬اوثاخ اٌف‪١ٌٕٛ١‬ح‪.‬‬
‫تظ‪ٙ‬ا ذذ ‪ ٠‬اٌّعا‪١٠‬ا اٌفس‪ٌٛٛ١‬ة‪١‬ح اٌّثٍة‪ٌ ٝ‬رع ‪٠‬ة اٌرذٍةً اٌذ‪١‬ة‪ٌٍ ٞٛ‬ف‪ٕ١‬ة‪ٛ‬ي تْ رةةح اٌذةاارج‬
‫اٌّثٍ‪ ٝ‬وأد ‪ 30‬رةح ِل‪٠ٛ‬ح ‪ ٚ‬رةح اٌذّ‪ٛ‬ضح وأد ‪ِ 7‬ةي إضةافح اٌف‪ٕ١‬ة‪ٛ‬ي وّصة ر ‪ٚ‬د‪١‬ة ٌٍىاتة‪ْٛ‬‬
‫‪ٚ‬اٌطالح تايرم اَ ‪ٚ‬يظ اٌٍّخ اٌّع ٔ‪ .ٟ‬خضعد اٌع الخ اٌسد اٌساتمح ( ‪،P22 ،P17 ،P15 ،P8‬‬
‫‪ٌ )P33 ،P24‬رااو‪١‬ة ِرعة ج ِةٓ اٌف‪ٕ١‬ة‪ٛ‬ي ٘ة‪ 1000 ٚ ، 750 ، 500 ، 250( ٟ‬ةة د فة‪ ٟ‬اٌٍّ‪١‬ة‪)ْٛ‬‬
‫الخرثار ل رذ‪ٙ‬ا ةٍ‪ ٝ‬اٌرذًٍ‪ .‬تظ‪ٙ‬اخ إٌرائج تْ ةّ‪١‬ي ة الخ ‪ Pseudomonas spp‬اٌسد اٌّمرٍفح‬
‫وأةةد ِما‪ِٚ‬ةةح ٌرااو‪١‬ة اٌف‪ٕ١‬ةة‪ٛ‬ي اٌرةة‪ ٟ‬ذصةةً إٌةة‪ 1000 ٝ‬ةة د فةة‪ ٟ‬اٌٍّ‪١‬ةة‪ٚ ، ْٛ‬تْ اٌع ٌةةح ‪ِ 15‬ةةٓ ‪P.‬‬
‫‪ ٚ putida‬اٌر‪ ٟ‬ذُ ة ٌ‪ٙ‬ا ِٓ ِصف‪ ٝ‬اٌ ‪ٚ‬رج وأد تل‪ ٜٛ‬ة ٌح ِٓ ت‪ ٓ١‬اٌعة الخ الخةا‪ .ٜ‬وأةد ٘ة ٖ‬
‫اٌع ٌح لا رج ةٍ‪ ٝ‬ذذٍ‪ 1000 ِٓ ٪78.3 ً١‬ة د ف‪ ٟ‬اٌٍّ‪ ِٓ ْٛ١‬اٌراو‪ ١‬ال‪ٌٍ ٌٟٚ‬ف‪ٕٛ١‬ي خالي خّسح‬
‫ت‪٠‬ةةاَ (‪ 120‬يةةاةح) ِةةٓ اٌرجاتةةح ‪ ،‬ت‪ّٕ١‬ةةا وأةةد اٌع ٌةةح ‪ 33‬ذاخ اٌّعة ي اللةةً (‪ِ )٪64.5‬ةةٓ تةة‪ ٓ١‬تم‪١‬ةةح‬
‫ذذًٍ اٌف‪ٕٛ١‬ي ةٕة ‪ 1000‬ةة د فة‪ ٟ‬اٌٍّ‪١‬ة‪ ٚ ْٛ‬خةالي يةرح ت‪٠‬ةاَ (‪ 144‬يةاةح) ِةٓ‬ ‫اٌع الخ تّا ‪٠‬م‬
‫اٌرجاتح‪ .‬ةال‪ٚ‬ج ةٍ‪ ٝ‬ذٌه ‪٠ ٌُ ،‬ىٓ ٌٍع ٌر‪ P. putida ِٓ 24 ٚ 22 ٓ١‬اٌم رج ةٍ‪ ٝ‬ذذٍ‪ ً١‬اٌف‪ٕٛ١‬ي ةٕ‬
‫‪ 1000‬ة د ف‪ ٟ‬اٌٍّ‪ ِٓ ْٛ١‬اٌراو‪ ١‬ال‪ٌٍ ٌٟٚ‬ف‪ٕ١‬ة‪ٛ‬ي ‪ٌ ،‬ىٕ‪ّٙ‬ةا وأرةا ِرذٍّرة‪ٌٙ ٓ١‬ة ا اٌراو‪١‬ة ‪ٚ‬ايةرّاذا‬
‫ف‪ ٟ‬إٌّ‪ ٛ‬در‪ٙٔ ٝ‬ا‪٠‬ح فراج اٌرجاتح‪.‬‬
‫تايرم اَ وا‪ِٚ‬اذ‪ٛ‬ةااف‪١‬ا اٌعّة‪ٌ ٛ‬ةً ‪ ، Sephacryl S-1000 ٚ DEAE-cellulose‬ذّةد‬
‫ذٕم‪١‬ح إٔ ‪ ُ٠‬اٌىاذ‪١‬ى‪ٛ‬ي ‪ٛ٠ -2 ، 1‬وسج‪ِ ١ٕ١‬ي ةائ ‪٠‬ح تٍغد ‪ٚ ٪36.12‬فعاٌ‪١‬ح ٔ‪ٛ‬ة‪١‬ح ذصً إٌة‪38.25 ٝ‬‬
‫‪ٚ‬د ج ‪ِ /‬جُ‪ .‬وّا ذُ ذ‪ٛ‬ي‪١‬ف اإلٔ ‪ ُ٠‬تاٌّمارٔح ِي ترتعح تا‪ٚ‬ذ‪ٕ١‬اخ ل‪١‬اي‪١‬ح ‪ٚ‬وةاْ اٌة‪ٛ‬زْ اٌج ‪٠‬لة‪69 ٟ‬‬
‫‌ب‬
‫و‪ ٍٛ١‬اٌر‪ .ْٛ‬وأد اٌظا‪ٚ‬ف اٌّثٍ‪ٌ ٝ‬ثثاخ اإلٔة ‪ٌّ ُ٠‬ة ج ‪ 30‬ل‪١‬مةح ٘ة‪ 35 ٟ‬رةةح ِل‪٠ٛ‬ةح ‪ٌ 6 ٚ‬ىةً ِةٓ‬
‫رةح اٌذاارج ‪ ٚ‬رةح اٌذّ‪ٛ‬ضح ةٍ‪ ٝ‬اٌر‪ٛ‬اٌ‪.ٟ‬‬
‫ضةا ةٕة ‪ 4‬رةةاخ ِل‪٠ٛ‬ةح ٌّة ج ‪ًِ ٛ٠ 30‬ةا‪ .‬دة تثةاخ إٔة ‪ُ٠‬‬
‫ذُ إةااد خط‪ٛ‬ج تثاخ اٌرم ‪ ٓ٠‬ت‪ً ٠‬‬
‫اٌىاذ‪١‬ى‪ٛ‬ي ‪ٛ٠ -2 ، 1‬وسج‪ ِٓ ١ٕ١‬خالي ذم ‪٠‬ا اٌفعاٌ‪١‬ح إٌ‪ٛ‬ة‪١‬ح ٌّذٍ‪ٛ‬ي اإلٔ ‪ ٌّ ٚ ُ٠‬ج ‪ًِ ٛ٠ 28‬ا‪ .‬وأةد‬
‫اٌفعاٌ‪١‬ح إٌ‪ٛ‬ة‪١‬ح ٌإلٔ ‪ ُ٠‬إٌّم‪ٚ 38.12 ٝ‬د ج ‪ِ /‬جُ (‪ٚ )٪100‬لد اٌصفا ِٓ اٌذضأح‪ .‬تُ أمفضةد‬
‫ٌرصً إٌة‪ٚ 24.03 ٝ‬دة ج ‪ِ /‬جةُ (‪ )٪63.03‬فة‪ ٟ‬اٌ‪١‬ة‪ َٛ‬اٌسةاتي ِةٓ اٌذضةأح ‪ ٚ ،‬إٌة‪ٚ 11.72 ٝ‬دة ج ‪/‬‬
‫ِجُ (‪ )٪34.70‬ف‪ ٟ‬اٌ‪ َٛ١‬اٌااتي ةشا ِةٓ اٌذضةأح ‪ .‬تةُ تعة ِةا‪ٚ‬ر ‪ًِ ٛ٠ 21‬ةا ِةٓ اٌذضةأح ‪ ،‬تٍغةد‬
‫اٌفعاٌ‪١‬ح إٌ‪ٛ‬ة‪١‬ح ٌإلٔ ‪ٚ 3.23 ُ٠‬د ج ‪ِ /‬جُ (‪ .)٪8.47‬تِا ف‪ ٟ‬اٌ‪٠ ٌُ ، 28 َٛ١‬ىٓ اإلٔ ‪ٔ ُ٠‬ش ً‬
‫طا‪ .‬إْ ٘ ا‬
‫‪ ٠‬ي ةٍ‪ ٝ‬تْ اإلٔ ‪ ُ٠‬تم‪ٔ ٟ‬ش ً‬
‫طا ٌّ ج ‪ًِ ٛ٠ 21‬ا ِٓ فراج اٌذضأح‪.‬‬
‫ذُ ذذ ‪ ٠‬اٌرذًٍ اٌذ‪ٌٍّ ٞٛ١‬اوثاخ اٌف‪١ٌٕٛ١‬ح ف‪ ٟ‬ة‪ٛ‬اٌُ ِصغاج (ٔظةاَ ت‪١‬لة‪ ٟ‬ذجا‪٠‬ثة‪ )ٟ‬إلةةااد‬
‫راياخ اٌرذف‪ ١‬اٌذ‪١‬ة‪( ٞٛ‬ذذف‪١‬ة اٌىائٕةاخ اٌ ل‪١‬مةح ٌرذٍ‪١‬ةً اٌٍّ‪ٛ‬تةاخ اٌى‪١ّ١‬ائ‪١‬ةح خةالي ّٔ‪٘ٛ‬ةا اٌمٍة‪)ٞٛ‬‬
‫‪ٚ‬اإلتااد اٌذ‪( ٞٛ١‬ةٍّ‪١‬ح ز‪٠‬ا ج وّ‪١‬ح الد‪١‬اد اٌ ل‪١‬مح اٌر‪ٌٙ ٟ‬ا اٌم رج ةٍة‪ ٝ‬إزاٌةح اٌٍّ‪ٛ‬تةاخ ِةٓ اٌراتةح ‪ٚ‬‬
‫اٌّاد) تايرم اَ اٌمال‪٠‬ا اٌثىر‪١‬ا‪٠‬ح إٌم‪١‬ح ٌٍع ٌح اٌّذٍ‪١‬ح ِٓ ‪( P. putida‬اٌع ٌةح ‪ .)15‬ذةُ ذذٍ‪١‬ةً ٔرةائج‬
‫اٌرجاتح اٌّصغاج تايرم اَ ذمٕ‪١‬ح وا‪ِٚ‬اذ‪ٛ‬ةااف‪١‬ا اٌغاز اٌر‪ ٟ‬تظ‪ٙ‬اخ تْ فعاٌ‪١‬ح اٌرذًٍ اٌذ‪١‬ة‪ٌٍ ٞٛ‬مال‪٠‬ةا‬
‫ل از ا خ ِي اٌ‪ٛ‬لد ‪ ،‬ت‪ّٕ١‬ا تع ‪ِٛ٠ 40‬ا ِٓ اٌذضأح ٌُ ‪٠‬ىٓ ٕ٘ان تتةا ٌٍف‪ٕ١‬ة‪ٛ‬ي ت‪ٛٔ ٚ‬اذجةٗ ال‪٠‬ضة‪١‬ح‪.‬‬
‫وّا تٍةغ ِعة ي ذذٍةً اٌف‪ٕ١‬ة‪ٛ‬ي ‪ ٪97.4‬فة‪ ٟ‬اٌ‪١‬ة‪ِ 40 َٛ‬ةٓ اٌرجاتةح ت‪ّٕ١‬ةا وةاْ ِعة ي ّٔة‪ ٛ‬اٌثىر‪١‬ا‪٠‬ةا (‪23‬‬
‫×‪ )105‬ف‪ ٟ‬اٌ‪ َٛ١‬اٌعاشةا ِةٓ اٌرجاتةح ‪ٚ‬تٍةغ تةٍة‪ِ ٝ‬سةر‪ٌ ٜٛ‬ةٗ (‪ )105×27‬تعة ‪٠ 20‬ة‪ِ َٛ‬ةٓ اٌرجاتةح‪.‬‬
‫ذش‪١‬ا ٘ ٖ إٌرائج إٌ‪ ٝ‬تٔٗ ‪ّ٠‬ىٓ ايرم اَ اٌع ٌح ‪ 15‬تٕجاح ف‪ ٟ‬اٌرذًٍ اٌذ‪ٌٍّ ٞٛ١‬اوثاخ اٌف‪١ٌٕٛ١‬ح ‪ ٚ‬فة‪ٟ‬‬
‫ِ‪ٛ‬الي ٍِ‪ٛ‬تح ِمرٍفح‪.‬‬
‫‌ج‬
‫جًهىرَت انعراق‬
‫وزارة انخعهُى انعبنٍ وانبحث انعهًٍ‬
‫انجبيعت انًطخنصرَت‬
‫كهُت انعهىو‬
‫لطى عهىو انحُبة‬
‫حنمُت و حىصُف جسَئٍ إلنسَى ‪ Catechol 1,2- dioxygenase‬ين‬

‫أنىاع انطُدويىنبش انًحههت نهفُنىل‬
‫أطروحت‬
‫يمديت إنً يجهص كهُت انعهىو ‪ /‬انجبيعت انًطخنصرَت كجسء ين يخطهببث نُم درجت‬
‫اندكخىراه فٍ انفهطفت فٍ عهىو انحُبة ‪ /‬األحُبء انًجهرَت‬
‫حمديج بهب انطبنبت‪:‬‬

‫هدي رشُد حىفُك اندورٌ‬
‫بكبنىرَىش عهىو حُبة ‪ /‬كهُت انخربُت ‪ /‬جبيعت ضبيراء ‪2010 /‬‬
‫يبجطخُر عهىو حُبة ‪ /‬كهُت انخربُت ‪ /‬جبيعت ضبيراء ‪2012 /‬‬
‫بإشراف‪:‬‬
‫األضخبذ‬ ‫األضخبذ‬
‫د‪ .‬أيم حطُن يىضً‬ ‫د‪ .‬ضىضن ضبجد دمحم عهٍ‬
‫‪ 1445‬هـ‬ ‫‪ 2023‬و‬
‫يحرو‬ ‫أغططص‬

Final Copy - My Dissertation 10-12-2023

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Final Copy - My Dissertation 10-12-2023

Uploaded by

Copyright:

Available Formats

Republic of Iraq

Ministry of Higher Education and Scientific

Purification and molecular identification of catechol

I dedicate this humble work

I would like to express my gratitude to "Allah" Lord of the universe and

It is a pleasure to dedicate my genuine thanks to Professor Dr. Khetam

Special thanks and appreciation represented to Professor Dr. Essam

My profound respect and gratitude represented to the Directorate of

Sincere thanks and appreciation to assistant professor Israa M. S. Al-

Bioremediation is a technology for removing pollutants from the

1.9 Dioxygenases Responsible for Phenol 37

Chapter Two: Materials and Methods

2.3 Collection of Soil Samples from Different Locations 53

2.7 Identification of Pseudomonas spp. Isolates 56

2.7.4 Molecular Diagnosis of Bacteria 58

2.10 Genotypic Detection of Catechol Dioxygenases 65

2.12.2 Optimum pH for Catechol 1,2-Dioxygenase Activity 69

2.14.1 Preparation of cell crude extract 71

2.15.4 Optimum pH for Catechol 1,2-Dioxygenase Activity 75

2.17 Statistical analysis 78

3.1 Isolation of Phenol-degrading bacteria 79

Identification of Pseudomonas spp. isolates using

3.3 (catechol dioxygenases) in Pseudomonas spp. 86

3.3.1 Catechol 1,2 dioxygenase (cat1) gene 86

Catechol dioxygenase (catABC) genes 91

3.5 Pseudomonas spp. isolates for phenol 108

3.6.2 Screening of the optimum pH for enzyme 112

Ammonium sulfate precipitation

3.8.1 Molecular weight determination 117

Optimum temperature for catechol 1,2-dioxygenase

3.8.4 Optimum pH for catechol 1,2-dioxygenase activity 122

3.8.5 Optimum pH for catechol 1,2-dioxygenase stability 123

3.8.6 Storage stability of catechol 1,2-dioxygenase 124

Primers used in this study, their sequences and

Gradient PCR program used for the amplification of

Standard proteins used in the determination of the

Detection of Catechol Dioxygenases in Pseudomonas

(1-4) Anaerobic biodegradation of phenol 27

(3-5) interval between 2,392,757 -> 2,393,334. C. Pairwise 88

The growth curve of P. putida local isolate at various

The effect of different temperatures on enzyme production by

(3-22) dioxygenase enzyme from P. putida using gel filtration 119

(3-23) catechol 1,2-dioxygenase enzyme purified from P. putida 120

(3-24) Catechol 1,2-dioxygenase enzyme purified from the local 121

(3-25) 1,2-dioxygenase enzyme purified from the local isolate of P. 122

(3-26) 1,2-dioxygenase enzyme purified from the local isolate of P. 123

Man-made chemicals known as xenobiotics are known to cause severe

1. Isolation, identification, and screening of phenol-degrading

et al., 2022). Additionally, pollutants cause direct injury to bigger soil-

1.2 Xenobiotic compounds

Xenobiotic compounds are man-made chemicals that are extremely

Xenobiotic compounds have numerous complex chemical structures

1.2.1 Diseases caused by xenobiotics

Most of xenobiotics are harmful to humans, and are correlated with

Phenol is the fundamental structural component for a vast variety of

Figure (1-1): Chemical structure of phenol (Elayyat, 2015).

Phenol is a weak acid that is very sensitive to electrophilic

1.4.1 Uses of phenol

Phenol is used as a pure material in the creation of slimicides,

In the manufacturing process, phenol is used to create phenolic resins

Wexcide, ProSpray, and Birex are germicidal, fungicidal, virucidal,

1.4.2 Toxicity of phenol

Phenol is registered as a major pollutant in the list of the