LWT - Food Science and Technology 149 (2021) 111872

Contents lists available at ScienceDirect

LWT
journal homepage: www.elsevier.com/locate/lwt

Growth and survival characteristics of Salmonella enterica regarding

antibiotic resistance phenotypes
Xiang Wang a, Yani Xie a, Hua Cai b, Shenggang Duan b, Xia Song b, Yufan Wu c, Taisong Fang a,
Qingli Dong a, *, Hong Liu b, **
a
School of Medical Instrument and Food Engineering, University of Shanghai for Science and Technology, Shanghai, China
b
Shanghai Municipal Center for Disease Control and Prevention (SCDC), China
c
Centre of Analysis and Test, School of Chemistry & Molecular Engineering, East China University of Science and Technology, Shanghai, China

A R T I C L E I N F O A B S T R A C T

Keywords: Salmonella enterica is a foodborne pathogen that can cause zoonotic diseases. The aggravation of antibiotic
Salmonella enterica resistant S. enterica has drawn wide attention. Understanding the behavior of antibiotic-resistant pathogens along
Growth characteristics food chain is important to risk assessment. The objective of this study was to describe the growth and survival
Acid stress
characteristics of S. enterica strains and evaluate the correlation with the strains’ antibiotic resistance pheno­
Heat stress
types. Strains isolated from food (n = 16), clinic (n = 8) and standard strain (n = 2) of various antibiotic resistant
Antibiotic resistance
phenotypes were selected, of which half strains were S. Typhimurium and half were S. Enteritidis. The growth
parameters under different temperatures (25, 30, 35 ◦ C) were obtained by time-to-detection (TTD) method, the
survival characteristics were evaluated by the viability after exposed to heat (55, 57.5, 60 ◦ C) and acid (HCl, pH
= 3.0). It was observed that the antibiotic-resistant strains were more heat sensitive than antibiotics-sensitive
ones, although the difference was significant only at 57.5 ◦ C. The multi-antibiotics resistant strains showed
significant higher acid resistance than antibiotics resistant ones. No significant differences were observed on
growth and inactivation characteristics between strains of different origins or serotypes. This study provides
useful information for understanding the correlation of antibiotic resistance phenotypes with growth and sur­
vival characteristics in S. enterica.

1. Introduction
Salmonella infection is a major public health problem in the world.
The cost of detection, prevention and treatment of Salmonella related
diseases has increased the economic burden of industrialized and
developing countries (Crump et al., 2008). Among the over 2600 sero­
types of Salmonella, Salmonella Typhimurium and Salmonella Enteritidis
are the most common serotypes associated with human infection, which
can lead to a variety of diseases (López-Romero et al., 2018). Antibiotics,
such as fluoroquinolones and cephalosporin are commonly used in the
treatment of Salmonella infection. The abuse and misuse of antibiotic in
human and animals increased the antibiotic resistance of Salmonella.
Antibiotic resistant pathogens infection leads to more difficulty of
treatment and higher mortality of patients (Chiu et al., 2002), there have
been reported that patients infected with strains resistant to ampicillin,
chloramphenicol, streptomycin, sulfonamide, and tetracycline were 4.8
times more likely to die, and quinolone resistance was associated with a
mortality rate 10.3 times higher than the general population (Helms,
Vastrup, Gerner-Smidt, & Molbak, 2002).
Antibiotic-resistant foodborne bacteria are prevalent in various
foodstuffs, environments, livestock, associated animals and human be­
ings, they may contact humans indirectly along the food chain through
consumption of contaminated food or directly contact with infected
animals or biological substances such as blood, urine, feces, saliva, and
others (Founou, Founou, & Essack, 2016; H. H. Wang et al., 2020). To
prevent Salmonella infection, many strategies and handicap were
applied in food-processing and circulation process, as a result, microbes
would be exposed to different stress such as acid, heat, food additives
and disinfectants, cells be forced to make metabolic response to cope
with the adverse effects of adverse conditions on bacterial physiology.
The tolerance of pathogens to one or more stresses is called “stress
resistance” (H. H. Wang et al., 2020). Adaptation to external

* Corresponding author.
** Corresponding author.
E-mail addresses: qdong@usst.edu.cn (Q. Dong), liuhong@scdc.sh.cn (H. Liu).

https://doi.org/10.1016/j.lwt.2021.111872
Received 26 February 2021; Received in revised form 29 May 2021; Accepted 2 June 2021
Available online 5 June 2021
0023-6438/© 2021 Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
X. Wang et al. LWT 149 (2021) 111872

Table 1 (Greenacre & Brocklehurst, 2006). However, for the Salmonella strains
Salmonella enterica strains used in this study. with antibiotic resistance, the resistance to adverse environment is still
Isolate Serotype Source Isolate Serotype Source scarcely reported. The growth characteristics and survival ability under
code code adverse conditions determined the amounts of pathogen bacteria after
1 Enteritidis Pork 14 Typhimurium Pork leg contamination in food. This is crucial information for exposure assess­
tenderloin ment, which is a mandatory step in risk assessment process (Walls &
2 Enteritidis Beef steak 15 Typhimurium Pork leg Scott, 1997).
3 Enteritidis Pork 16 Typhimurium Frozen This objective of study was to detect the antibiotic resistance phe­
tenderloin meatball
4 Enteritidis Chicken 17 Enteritidis Clinic
notypes and genotypes of 26 S. enterica strains (Typhimurium and
wing Enteritidis serotypes) isolated from food and clinical, and to describe the
5 Enteritidis Mutton 18 Enteritidis Clinic growth and survival characteristics. Moreover, the correlation of such
chop characteristics to antibiotic resistance phenotypes was evaluated.
6 Enteritidis Pre- 19 Enteritidis Clinic
packed
milk 2. Material and methods
7 Enteritidis Frozen 20 Enteritidis Clinic
dumpling 2.1. Bacterial strains, growth and storage conditions
8 Enteritidis Pork leg 21 Typhimurium Clinic
9 Typhimurium Ham 22 Typhimurium Clinic
sausage
Twenty-six strains of S. enterica were used in this study, which
10 Typhimurium Pork 23 Typhimurium Clinic include food origin isolates (n = 16), food clinical isolates (n = 8) and
tenderloin two reference strains (Table 1). All bacterial strains were maintained as
11 Typhimurium Pork 24 Typhimurium Clinic frozen (− 80 ◦ C) culture in glycerol stock into Buffered Peptone Water
tenderloin
(BPW, Beijing Land Bridge Technology Co., Ltd, Beijing, China). The
12 Typhimurium Pork 25 Enteritidis ATCC13076
tenderloin working stocks were made by streaking the frozen stocks onto Tryptic
13 Typhimurium Steamed 26 Typhimurium ATCC14028 Soya Agar (TSA) plates and stored at 4 ◦ C for four weeks. Prior to ex­
stuffed periments, each strain was activated by selecting an isolated colony and
bun incubated in BPW at 37 ◦ C overnight. The working cultures were pre­
pared by transferring a loopful of each culture into 10 mL of BPW and
environment may increase or decrease resistance to other stresses, incubated at 37 ◦ C for 24 h to yield late stationary phase cells.
which may lead to cross protection (Doyle et al., 2006). Studies have
shown that cold stress, acid and osmotic stress increased the antibiotic 2.2. Antibiotic resistance test
resistance of Listeria monocytogenes (Al-Nabulsi et al., 2015); acid
adapted could increase the resistance of amoxicillin, ampicillin, chlor­ 2.2.1. Antibiotic resistance phenotypes
amphenicol, ciprofloxacin and other antibiotics for L. monocytogenes The antibiotic susceptibility test for the 26 S. enterica strains was
(Kang & Seo, 2020). In addition, the acetic acid tolerance response in­ performed by the minimal inhibitory concentration (MIC) method using
duces cross-protection to salt stress in Salmonella Typhimurium the Sensititre NARMS Gram Negative Plate (CMV3AGNF, Thermo Fisher
Scientific, USA). The plate consisted of 17 antibiotic agents, including

Table 2
Antibiotic resistance genes of Salmonella enterica.
Antibiotic class Resistance Primer sequences Annealing temp. Fragment size References
genes (◦ C) (bp)

Beta-lactam blaTEM F: CATTTCCGTGTCGCCCTTAT 55 793 Randall, Cooles, Osborn, Piddock, and Woodward
(2004)
R: TCCATAGTTGCCTGACTCCC
blaSHV F: TTCGCCTGTGTATTATCTCC 55 807 Li et al. (2013)
R: TTTGCTGATTTCGCTCGG
blaPER F: ATGAATGTCATCACAAAATG 56 927 Qiao et al. (2017)
R: TCAATCCGGACTCACT
Sulfamethoxazole sul1 F: TCACCGAGGACTCCTTCTTC 60 316 Randall et al. (2004)
R: AATATCGGGATAGAGCGCAG
sul2 F: GGCAGATGTGATCGACCTCG 58 405 Vuthy, Lay, Heng, Kerleguer, and Aidara-Kane
R: ATGCCGGGATCAAGGACAAG
Tetracycline tetA F: GGTTCACTCGAACGACGTCA 56 576 Randall et al. (2004)
R: CTGTCCGACAAGTTGCATGA
tetB F: CAGTGCTGTTGTTGTCATTAA 56 571 Deekshit et al. (2012)
R: GCTTGGAATACTGAGTGTTAA
tetC F: CTTGAGAGCCTTCAACCCAG 56 418 Deekshit et al. (2012)
R: ATGGTCGTCATCTACCTGCC
Fluoroquinolone qnrA F: AGAGGATTTCTCACGCCAGG 55 580 (X. Chen et al., 2012)
R: TGCCAGGCACAGATCTTGAC
qnrB F: GGMATHGAAATTCGCCACTG 57 264 (X. Chen et al., 2012)
R: TTTGCYGYYCGCCAGTCGAA
oqxA F: GACAGCGTCGCACAGAATG 62 339 (X. Chen et al., 2012)
R: GGAGACGAGGTTGGTATGGA
oqxB F: CGAAGAAAGACCTCCCTACCC 62 240 (X. Chen et al., 2012)
R: CGCCGCCAATGAGATACA
carbapenems blaKPC F: CGTCTAGTTCTGCTGTCTTG 52 798 Gan and Li (2020)
R: CTTGTCATCCTTGTTAGGCG
balSME F: AGATAGTAAATTTTATAG 58 1138 Gan and Li (2020)
R: CTCTAACGCTAAATAG

2
X. Wang et al. LWT 149 (2021) 111872

Table 3 at 12,000 g for 5 min. The supernatants were used for further gene
Antibiotic resistance phenotypes and genotypes of Salmonella enterica strains. amplification. Fourteen antibiotics-resistance genes (ARGs) include
Strain Antibiotic Antibiotic resistance Antibiotic resistance beta-lactam (blaTEM; blaSHV, blaPER), sulfamethoxazole (sul1, sul2),
code resistancea profileb genotypec tetracycline (tetA, tetB, tetC), fluoroquinolone (qnrA, qnrB, oqxA, oqxB)
1 AS – – and carbapenems (blaKPC, blaSME) were detected by PCR, the primers
3 AS – – and annealing temperature are described in Table 2. The 25 μL PCR
4 AS – – mixture contained 1 μL DNA sample, 1.5 μL primer (Sangon Biotech,
8 AS – – Shanghai, China), 12.5 μL Taq DNA polymerase (Generary Biotech Co.,
10 AS
Ltd, Shanghai, China) and 10 μL ddH2O. The amplification was carried
– –
17 AS – –
25 AS – – out using a gene amplification system (Analytik Jena AG, Germany): (i)
26 AS – – initial denaturation at 95 ◦ C for 5 min; (ii) 30 cycles of 95 ◦ C for 30 s,
2 AR SXT – 55–62 ◦ C for 30 s and 72 ◦ C for 1 min; (iii) final extension at 72 ◦ C for 5
5 AR FAZ; SXT blaTEM; sul1; sul2;
min. Amplified products were analyzed using 1.5% agarose gel elec­
oqxA; oqxB
11 AR SXT – trophoresis in 1 × TBE buffer and run at 110 V for 20 min.
18 AR FAZ; SXT blaTEM; sul2
19 AR AZT; FAZ; TAZ; AXO – 2.3. Growth characteristics
20 AR AZT; FAZ; TAZ; AXO qnrA
6 MAR FAZ; NIT; SXT blaTEM; sul1
7 MAR A/S2; FAZ; CIP; LEV; blaTEM; sul1; sul2; tetB;
Assessment of growth was performed by turbidimetric measure­
MIN; TET; TIM2; SXT oqxA; oqxB ments in an automatic Bioscreen C (Labsystems, Finland) at 600 nm. The
9 MAR CIP; LEVO TET; SXT – growth parameters (maximum specific growth rate μmax and lag phase
12 MAR FAZ; MIN; SXT – duration λ) were estimated by determining the time to detection (TTD)
13 MAR A/S2; AXO; MIN; TET; blaTEM; sul1; sul2; tetB;
and using the serial dilution method as previously described (Biesta-­
SXT qnrA; oqxA; oqxB
14 MAR A/S2; FAZ; CIP; LEVO; blaTEM; sul1; sul2; tetB; Peters, Reij, Joosten, ; Cuppers & Smelt, 1993). Five Salmonella solutions
MIN; TET; SXT oqxA; oqxB containing 102 CFU/mL-106 CFU/mL diluted by BPW were prepared and
15 MAR A/S2; FAZ; CIP; LEVO; blaTEM; sul1; sul2; tetB; was separately loaded in a 100-well honeycomb (Helsinki, Finland).
MIN; TET; TIM; SXT oqxA; oqxB Three replicates for each condition were performed. Working volume in
16 MAR LEVO; MIN; TET; SXT blaTEM; sul1; sul2; tetB;
the Bioscreen plate was 200 μL. Temperature was controlled at 25, 30
oqxA; oqxB
21 MAR MIN; TET; STX blaTEM; sul2; tetB; and 35 ◦ C respectively and the optical density of cell suspensions was set
oqxA; oqxB at 600 nm. Absorbance values of the cell suspensions were automatically
22 MAR AZT; FAZ; TAZ; AXO; – read at regular intervals of 10 min for 24 h. At the same time, initial
MIN; TET; ETP
concentration was calculated by plating appropriate dilutions on TSA
23 MAR A/S2; AZT; FAZ; FEP; blaTEM; sul1; sul2
TAZ; AXO; TET plates and incubating at 37 ◦ C for 24 h. The relation between the TTD
24 MAR A/S2; FAZ; MIN; TET; blaSHV; sul1; sul2; tetB; and μmax can be geometrically described by Eq. (1):
SXT qnrB
a
μmax = -1/slope (1)
AS, antibiotic sensitive; AR, antibiotic resistance; MAR, multi-antibiotics
resistance. The relation between the TTD and λ can be geometrically proposed
by Baranyi and Pin (1999), Which described by Eq. (2):
b
-sensitive to all antibiotics tested; A/S2, ampicillin/sulbactam; AZT,
aztreonam; FAZ, cefazolin; FEP, cefepime; TAZ, ceftazidime; AXO, ceftriaxone; ln(xx0
det
)
Tdet (x0 ) = λ(x0 ) + (2)
CIP, ciprofloxacin; LEVO, levofloxacin; MIN, minocycline; TET, tetracycline; μmax
TIM2, ticarcillin/clavulanic acid; SXT, trimethoprim/sulfamethoxazole.
Where x0 is the initial cell count (CFU/mL); xdet is the cell population at
c
absence of genes. detection time; Tdet is the detection time (h); μmax is maximum specific
growth rate (log CFU/h); λ is lag phase duration (h).

ampicillin/sulbactam (A/S2), aztreonam (AZT), cefazolin (FAZ), cefe­
pime (FEP), ceftazidime (TAZ), ceftriaxone (AXO), ciprofloxacin (CIP),
ertapenem (ETP), imipenem (IMI), levofloxacin (LEVO), meropenem
(MERO), minocycline (MIN), nitrofurantoin (NIT), piperacillin/tazo­
bactam (P/T4), tetracycline (TET), ticarcillin/clavulanic acid (TIM2)
and trimethoprim/sulfamethoxazole (SXT). The test was performed
following the manufacturer’s instructions. The results were read by
measuring the absorbance at 630 nm using a microplate reader (Shanpu,
Shanghai, China). The interpretation of the categories of susceptible,
intermediate or resistant was based on the Clinical and Laboratory
Standards Institute (CLSI) guidelines (Humphries, Abbott, & Hindler,
2019). Escherichia coli ATCC 25922 was used as the quality control
strain.
2.2.2. Antibiotic resistance genotypes
Genomic DNA extraction was carried out by boiling method as
described previously, with modifications (López-Romero et al., 2018)
with modifications. 1.5 mL of the stationary phase S. enterica culture
were harvested by centrifugation at 12,000 g for 2 min (Thermo Fisher
Scientific, Shanghai, China). The cells were resuspended in 1 mL sterile
water and boiled in a metal bath for 10 min, followed by centrifugation
2.4. Heat tolerance
To assess the heat tolerance of the S. enterica strains, 30 μL of the
initial bacterial suspensions (ca. 109 CFU/mL) were transferred to sterile
flat-top thin wall PCR cap tubes (KIRGEN, USA). Based on experimental
methods and procedures brought out previously (Wang, Devlieghere,
Geeraerd, & Uyttendaele, 2017), the tubes were warmed-up in the
micro-well of the thermal cycler through direct contact with a hot metal
plate. Setting the thermal cycler initially at 37 ◦ C for 30 s and then
maintained at the target temperatures. Heat treatment was performed at
60 ◦ C for 40 s, 57.5 ◦ C for 3 min and 55 ◦ C for 12 min, respectively,
which was established on preliminary test as to obtain appropriate
cytopenia. After treatment, the tubes were placed in ice-water imme­
diately for 1 min to refrigeration and prevent further inactivation. Viable
cell counts were determined by serial decimal dilutions with sterile
physiological saline solution that were subsequently plated on TSA by
the drop count technique (C. Y. Chen, Nace, & Irwin, 2003). Apparent D
value was used to evaluate the heat resistance, and can be calculated by
Eq. (3):

3
X. Wang et al. LWT 149 (2021) 111872

Fig. 1. Lag phase duration (λ) of 26 Salmonella isolates at 25 (A), 30 (B) and 35 ◦ C (C). AS, antibiotics sensitive; AR, antibiotics resistant; MAR, multi-antibiotics
resistant. Columns represent the mean values of three repetitions; error bars represent standard errors.

t initial bacterial solution was serial decimal diluted with sterile physio­
Dapparent = (3)
log(N0 ) − log(Nt ) logical saline solution and plated on TSA plates which were incubated at
37 ◦ C for 24 h before enumeration. The population reduction can be
Where t is the time be treated by heat (min); N0 is the initial concen­ calculated by Eq. (4):
tration of cells (CFU/mL); Nt is the concentration of cells after heat
treatment (CFU/mL). Log(ND) = Log(Ni)-Log(Nacid) (4)

Where the ND is the amount of cytopenia (CFU/mL); Ni is the initial

2.5. Acid tolerance
Acid tolerance of S. enterica strains was assessed by the reduction of
cell population in the acidification broth as described previously
(Arvizu-Medrano & Escartin, 2005) with the following alterations. Acid
medium was prepared by adjusting BPW to pH 3.0 with HCl. Aliquots of
1 mL of cell culture were harvested by centrifugation (3,600 g, 10 min,
4 ◦ C), pellets were washed twice with acidification-BPW and then
incubated at 37 ◦ C for 18 h. Survival of cells was monitored before and
after incubation. The viable cell counts were determined by plating: the
concentration of cells (CFU/mL); Nacid is the concentration of cells after
acid treatment (CFU/mL).
2.6. Statistical analysis
Growth and inactivation characteristics of each strain were per­
formed for three independent replicates. Statistically significant differ­
ences among strains were determined using One-way analysis of
variance (ANOVA) followed by a post hoc (Tukey) test (Heckler, Silva,

4
X. Wang et al.
Fig. 2. Lag phase duration λ (A) and maximum specific growth rate μmax (B) of Salmonella as a function of the antibiotic resistance phenotypes: AS, antibiotics-
sensitive; AR, antibiotics resistant; MAR, multi antibiotics resistant at 25, 30 and 35 ◦ C respectively. Data are the mean of three independent experiments; each
box encloses the central 50th percentile of the data, with the median value displayed as a horizontal line. Vertical lines protruding from each box represent the
maximum and minimum values; the symbol (▴) indicates moderated outliers; error bars show standard errors.
Cacciatore, Daroit, & Malheiros, 2020). Tests were carried out using
95% confidence limits. All data were analyzed by IBM SPSS (version 25,
Shanghai, China).
3. Result and discussion
3.1. Antibiotic resistance phenotypes
The antibiotic resistance profiles showed nearly half of the S. enterica
strains (n = 12, 46.2%) exhibited multi-antibiotics resistance (MAR)
which are resistant to at least three antibiotic categories; eight strains
(30.8%) are antibiotic-sensitive (AS), which susceptible to all antibiotics
tested; the other six strains (23.1%) are antibiotic-resistance (AR)
S. enterica, which exhibited resistance to one or two tested antibiotics
(Table 3). The large percentage of multi-antibiotics resistance S. enterica
that isolated in food, animal, and clinical samples was widely reported in
previous works (Ahmed & Shimamoto, 2012; Bacci et al., 2012; S.; Chen
et al., 2007; Nghiem, Nguyen, Nguyen, Nguyen, & Vo, 2017). For the
eight AS strains, five were isolated from food samples, one from clinic,
two were reference strains. In this study, the majority of strains tested
were resistant to trimethoprim/sulfamethoxazole (n = 14, 53.8%), fol­
lowed by cefazolin (n = 12, 46.2%) and minocycline (n = 9, 34.6%), all
strains were susceptible to meropenem, ertapenem, and piper­
acillin/tazobactam. The high antibiotic resistance rates for S. enterica
isolated in China were previously reported mainly for ampicillin,
tetracycline, sulfisoxazole, trimethoprim/sulfamethoxazole, ciprofloxa­
cin, and so on (Jiang et al., 2019, 2021; Wu, Luo, Shi, & Li, 2021; Yang
et al., 2019). For the 16 strains isolated from food, of which five were
sensitive strains (31.2%), three were antibiotics-resistance strains
(18.7%), eight were multi antibiotic-resistant bacteria (50%), and the
resistance rate to SXT was the highest (n = 11, 68.8%). There were eight
strains of S. enterica from clinic, including one (12.5%) sensitive, three
(37.5%) single antibiotic-resistant bacteria and four (50%) multi
antibiotic-resistant bacteria.
3.2. Antibiotic resistance genotypes
The prevalence of 14 antibiotic resistance genes (ARGs) was
analyzed by PCR. It showed that all the 8 AS S. enterica strains were
negative for the ARGs tested, 12 of 18 antibiotics-resistance strains were
found to possess at least one gene (Table 3). Among the 14 trimetho­
prim/sulfamethoxazole resistant strains, 9 gave positive amplicons for
the sul1 gene, 10 revealed sul2 gene, and 8 were positive for both genes.
Among 10 fluoroquinolone resistant strains, 7 gave positive amplicons
for the oqxA(B) gene which encodes efflux pumps, 3 was positive
amplicons for the qnrA(B) gene which encodes a protein that confers
5
LWT 149 (2021) 111872
resistance to quinolones (Martínez-Martínez, ). Seven out of ten
TET-resistance strains harbored the tetB gene, neither tetA nor tetC was
detected. The inconsistency between the antibiotic resistance phenotype
and genotype was previously reported in a variety of pathogens such as
E. coli, S. enterica, Staphylococcus aureus, Vibrio parahaemolyticus, and so
on (Lou, Liu, Zhang, Pan, & Zhao, 2016; Nghiem et al., 2017). As shown
in Table 3, some phenotypic resistant strains were negative for the
corresponding genes. The non-resistance genetic factors might be
responsible for this phenomenon, it may indicate the involvement of a
non-specific resistance mechanism. Conversely, some resistance genes
(eg. oqxA, oqxB) were detected while the corresponding resistance
phenotypes were not observed. It is possible that these antibiotic resis­
tant genes are unexpressed in some strains (Nghiem et al., 2017).
Moreover, the mechanism of resistance to a specific antibiotic may be
complex, it may not depend on the expression of a single gene (Ma et al.,
2019).
3.3. Growth characteristics
The lag phase duration (λ) and maximum specific growth rate (μmax)
of different antibiotic resistance phenotypes S. enterica strains under 25,
30 and 35 ◦ C was evaluated. The lag period is the time when microor­
ganisms adapt to the new environment and the hysteresis period of 26
strains is shown in Fig. 1. Great variability of lag time was observed, at
three temperatures tested, the maximum lag time was almost double
that of the minimum value. The μmax is a parameter to characterize the
growth rate of microorganisms. Compared to the lag time, the variability
of μmax was relatively small (data not shown). As expected, the μmax
increased when the temperature went from 25 to 35 ◦ C.
From the data presented, no significant difference (P > 0.05) was
observed among the growth parameters of AS, AR and MAR strains at
three temperatures (Fig. 2). Similar results were also found in E. coli
(O157:H7 and O26) (Duffy, Walsh, Blair, & McDowell, 2006) and Vibrio
parahemolyticus (Guo, Zhang, Xiao, & Lou, 2014). Duffy et al. (2006)
investigated the growth kinetics of E. coli with different antibiotic
resistance phenotypes and concluded that the lag phases and growth
rates of verocytotoxigenic E. coli were similar regardless of the presence
or absence of antibiotic resistance. In contrast to this result, it was re­
ported that some nalidixic acid and streptomycin resistance E. coli
strains exhibited slightly slower growth than the wild type strains which
has antibiotic sensitivity (Blackburn & Davies, 1994).
3.4. Tolerance to heat
The heat tolerance of S. enterica strains was expressed by the
apparent D-value after exposure to 55 ◦ C for 12 min, 57.5 ◦ C for 3 min
X. Wang et al.
Fig. 3. Apparent D-value of 26 Salmonella strains after exposure to 55 ◦ C (A), 57.5 ◦ C (B) and 60 ◦ C (C). AS, antibiotics-sensitive; AR, antibiotics resistant; MAR,
multi-antibiotics resistant. Columns represent the mean values of three repetitions; error bars represent standard errors.
and 60 ◦ C for 40 s. Great variability in heat tolerance among the 26
strains was shown in Fig. 3. The apparent D-value of the most heat
resistant strain was 3.5–6.4-fold larger than the most heat sensitive one
at three temperatures. The apparent D-value reduced as the treatment
temperature increased, median of the values was 4.25 min, 1.40 min and
0.58 min at 55, 57.5 and 60 ◦ C, respectively.
The comparison of heat resistance for different antibiotic resistance
phenotype S. enterica are presented in Fig. 4 A, B and C. It was observed
that the AS strains showed higher heat resistance at three temperatures
tested, while the difference was significant only at 57.5 ◦ C (P < 0.05). It
illustrated that the acquisition of antibiotics-resistance did not lead to a
higher tolerance to heat at the temperature tested. This is in agreement
with a previous study, which discussed the role of antibiotic resistance in
heat tolerance of Salmonella and found that although there was no sta­
tistical difference in heat tolerance of MAR and AS strains, the AS strains
showed slightly higher heat resistance (Stopforth, Suhalim, Kottapalli,
Hill, & Samadpour, 2008). In line with Salmonella, similar results have
6
LWT 149 (2021) 111872
been obtained for Yersinia enterocolitica and E. coli (Duffy et al., 2006). It
was indicated that the wild-type Y. enterocolitica strain (Doherty et al.,
1998) was more heat resistant than the nalidixic acid resistant mutant,
the acquisition of antibiotic resistance altered behavior of the pathogens
under the high temperature conditions for E. coli (Duffy et al., 2006).
The heat resistance decrease may contribute to the “fitness cost” induced
by antibiotic resistance, which decreased the competitiveness compared
with antibiotic susceptible strains (Björkman, Hughes, & Andersson,
1998; Lindgren, Marcusson, Sandvang, Frimodt-Møller; & Hughes,
2005; Nielsen et al., 2012). However, some previous studies explored
the effect of antibiotics resistance on heat tolerance for foodborne
pathogens and found that there was no significant difference in heat
resistance between sensitive and resistant strains. For instance, the
ability of AS, AR and MAR L. monocytogenes isolates to survive under
58 ◦ C was compared and found no significant differences on the heat
tolerance for the strains with different antibiotic resistance phenotypes
(Komora, Bruschi, Magalhã). Similar features were observed by Akhtar,
X. Wang et al. LWT 149 (2021) 111872

Fig. 4. Apparent D-value of Salmonella strains of the (1) antibiotic resistance phenotype (A–C) AS, AR, MAR; (2) origin (D–F), food, clinic; (3) serotype (G–I), S.
Enteritidis, S. Typhimurium at 55 ◦ C (A, D, G), 57.5 ◦ C (B, E, H) and 60 ◦ C (C, F, I), respectively. Data are the mean of three independent experiments; each box
encloses the central 50th percentile of the data, with the median value displayed as a horizontal line. Vertical lines protruding from each box represent the maximum
and minimum values; the symbol (▴) indicates moderated outliers; symbol (*) indicates significant difference the representative data (P < 0.05); Error bars shows
standard errors.

Fig. 5. Logarithmic reduction of 26 Salmonella isolates after exposure to pH = 3.0 at 37 ◦ C for 18 h. Columns represent the mean values of three repetitions. Data are
the mean of three independent experiments; error bars shows standard errors.

7
X. Wang et al.
Fig. 6. Logarithmic reduction of 26 Salmonella strains of the antibiotic resistance phenotype (A); origin (B); serotype (C) exposed to pH = 3.0 at 37 ◦ C for 18 h. Data
are the mean of three independent experiments; each box encloses the central 50th percentile of the data, with the median value displayed as a horizontal line.
Vertical lines protruding from each box represent the maximum and minimum values; error bars show standard errors.
Maserati, Diez-Gonzalez, and Sampedro (2016), they indicated the
antibiotic sensitivity of E. coli strains was not related to their ability to
heat treatment. Walsh et al. (2005) and Ma et al. (2019) also reported
that no significant differences in the heat tolerance for the strains with
different antibiotic resistance phenotypes. Generally, in terms of exist­
ing studies the acquisition of antibiotic resistance will not increase the
thermal resistance of bacteria, which is a comfortable outcome for food
industry.
The correlation between strain origin, serotype and heat resistance
was analyzed. In this study. The S. enterica serotype (Enteritidis and
Typhimurium) and origin (food and clinical) showed no significant ef­
fect on strain heat resistance (P > 0.05) (Fig. 4D–I). In previous studies,
the effect of serotype and strain origin on heat resistance were differ­
entiated. Shachar and Yaron (2006) compared the heat resistance of
three serotypes Salmonella (Agona, Typhimurium, and Enteritidis), dif­
ferences among the three serotypes was not noticed; Similarly, Guillén,
Marcen, Manas, and Cebrian (2020) and van Asselt and Zwietering
(2006) found the variability in heat resistance among Salmonella sero­
vars except S. Senftenberg strain 775 W is lower than among strains of
other species in general. Similar phenomenon was also reported for
L. monocytogenes (Francis & O’Beirne, 2005; Komora et al., 2017). On
the contrary, Farakos, Hicks, Frye, and Frank (2014) reported that Sal­
monella Tennessee was better able to survive than Salmonella Mon­
tevideo and Salmonella Typhimurium at 70 ◦ C and this conclusion was
supported by Lianou, Stopforth, Yoon, Wiedmann, and Sofos (2006),
who also showed serotype played a significant role (P < 0.05) with
respect to the heat resistance of the organism. Consistent with our re­
sults, the results of Walsh et al. (2005) found that there was no differ­
ence in heat resistance between food and clinical sources of Listeria
monocytogenes (Komora et al., 2017). Resistance to food-related stress
such as heat of bacteria is influenced by internal characteristics, and
only in a few cases the difference of resistance between clinical and food
isolates was also confirmed (Lianou et al., 2006).
3.5. Tolerance to acid
The obvious viability of AS and AR/MAR strains were observed after
exposure to HCl (pH = 3.0) at 37 ◦ C for 18 h (Fig. 5). The Salmonella
population logarithmic reduction ranged from 1.22 to 4.03 log CFU/mL,
average of reduction for AS strains was 2.64 log CFU/mL, 2.99 log CFU/
mL for AR strains and 2.03 log CFU/mL for MAR. The MAR strains
showed higher acid resistance than AS and AR strains, although the
difference was only significant between MAR and AR strains (Fig. 6A).
Previously, some researchers compared the acid tolerance of Salmonella
strains with different antibiotic resistance phenotypes, they observed no
significant correlation between the two biological characteristics
(Bacon, Sofos, Kendall, Belk, & Smith, 2003; Fouladkhah, Geornaras,
Yang, & Sofos, 2013; He & Ahn, 2014; Hughes et al., 2010). There have
been some studies on this topic of other foodborne pathogens such as
8
LWT 149 (2021) 111872
E. coli (O157 and O26), L. monocytogenes and S. aureus. However,
different, or even opposite conclusions were drawn by different re­
searchers. It has been reported in some studies that the antibiotic sus­
ceptible E. coli strain showed higher resistance to acid (lactic acid and
acid food matrix) (Akhtar et al., 2016; Duffy et al., 2006); nevertheless,
some found that there was no significant difference in the tolerance of E.
coli and L. monocytogenes with different antibiotic resistance phenotypes
(Cunha et al., 2016; Fouladkhah et al., 2013). On the contrary, Komora
et al. (2017) and Ma et al. (2019) found antibiotic sensitive strains was
remarkably acid (lactic acid and hydrochloric acid) sensitive than
antibiotic resistant or multiantibiotic-resistant strains.
The acid tolerance of S. enterica with different serotypes were
compared and we found that the S. Enteritidis strains were significantly
more acid sensitive than S. Typhimurium strains. Different from this
study, Guillén et al. (2020), who determined the acid resistance of 15
Salmonella strains (include 9 serotypes) and found no significant dif­
ferences among the strains with different serotypes (P > 0.05). Lianou
and Koutsoumanis (2013) also reported that the acid inactivation ki­
netics of Salmonella strains are not affected by their serotype, origin or
antibiotic resistance profile. In addition, the tolerance to acid of strains
with different sources were also compared, the food origin strains
showed lower acid resistance compared with those from clinical, while it
did not show to be statistically significant s (P > 0.05) (Fig. 6C).
4. Conclusion
Due to the increase of antibiotics resistance, the clinical treatment of
S. enterica associated diseases becomes complex. It is important to assess
the risk of antibiotics resistant S. enterica and take corrective measures to
reduce or eliminate the contamination in the food chain before con­
sumption. Thus, determination of the growth and survival characteris­
tics and parameters of S. enterica strains with different antibiotic
resistance phenotypes are the key steps to realize the goal. The present
study investigated the growth and survival characteristics of S. enterica
with different antibiotic resistance phenotypes. The results from this
study found the stress resistance differences between the of AS, AR and
MAR strains. Generally, it demonstrated that the acquisition of antimi­
crobial resistance of S. enterica did not increased the tolerance to adverse
environments, and it will even reduce its viability. While no significant
differences were observed in growth characteristics among strains. The
differences in growth, inactivation and resistance to environmental of
strains lead to the divergence of parameters in exposure assessment, and
it has an impact on the accuracy of quantitative risk assessment results,
which has guiding significance for the intervention measures in the
process of processing. Due to the limited number of strains, the influence
of antibiotic resistance on the survival ability of bacteria under adverse
conditions still needs to be explored. Moreover, further investigation
will be needed to reveal the mechanisms responsible for the correlation
between antibiotic resistance and other biological characteristics related
X. Wang et al.
to food safety.
CRediT authorship contribution statement
Xiang Wang: Conceptualization, Methodology, Writing – original
draft, Supervision, Funding acquisition. Yani Xie: Methodology, Inves­
tigation, Formal analysis, Writing – original draft. Hua Cai: Conceptu­
alization, Methodology, Resources. Shenggang Duan: Methodology,
Resources. Xia Song: Methodology, Resources. Yufan Wu: Methodol­
ogy, Writing – review & editing. Taisong Fang: Methodology, Investi­
gation, Data curation. Qingli Dong: Validation, Project administration,
Funding acquisition, Writing – review & editing. Hong Liu: Project
administration, Writing – review & editing.
Declaration of competing interest
Conflict of Interest Statement: The authors declare that the research
was conducted in the absence of any commercial or financial relation­
ships that could be construed as a potential conflict of interest.
Acknowledgments
This study was funded by the National Natural Science Foundation of
China (Grant No. 31801455) and the National Key Research and
Development Program of China (Grant No. 2019YFE0103800).
References
Ahmed, A. M., & Shimamoto, T. (2012). Genetic analysis of multiple antimicrobial
resistance in Salmonella isolated from diseased broilers in Egypt. Microbiology and
Immunology, 56(4), 254–261. https://doi.org/10.1111/j.1348-0421.2012.00429.x
Akhtar, M., Maserati, A., Diez-Gonzalez, F., & Sampedro, F. (2016). Does antibiotic
resistance influence shiga-toxigenic Escherichia coli O26 and O103 survival to stress
environments? Food Control, 68, 330–336. https://doi.org/10.1016/j.
foodcont.2016.04.011
Al-Nabulsi, A. A., Osaili, T. M., Shaker, R. R., Olaimat, A. N., Jaradat, Z. W.,
Elabedeen, N. A. Z., et al. (2015). Effects of osmotic pressure, acid, or cold stresses on
antibiotic susceptibility of Listeria monocytogenes. Food Microbiology, 46, 154–160.
https://doi.org/10.1016/j.fm.2014.07.015
Arvizu-Medrano, S. M., & Escartin, E. F. (2005). Effect of acid shock with hydrochloric,
citric, and lactic acids on the survival and growth of Salmonella typhi and Salmonella
Typhimurium in acidified media. Journal of Food Protection, 68(10), 2047–2053.
https://doi.org/10.4315/0362-028x-68.10.2047
Stopforth, J. D., Suhalim, R., Kottapalli, B., Hill, W. E., & Samadpour, M. (2008). Thermal
inactivation D- and z-values of multidrug-resistant and non-multidrug-resistant
Salmonella serotypes and survival in ground beef exposed to consumer-style
cooking. Journal of Food Protection, 71(3), 509–515, 507.
van Asselt, E. D., & Zwietering, M. H. (2006). A systematic approach to determine global
thermal inactivation parameters for various food pathogens. International Journal of
Food Microbiology, 107(1), 73–82. https://doi.org/10.1016/j.
ijfoodmicro.2005.08.014
Bacci, C., Boni, E., Alpigiani, I., Lanzoni, E., Bonardi, S., & Brindani, F. (2012).
Phenotypic and genotypic features of antibiotic resistance in Salmonella enterica
isolated from chicken meat and chicken and quail carcasses. International Journal of
Food Microbiology, 160(1), 16–23. https://doi.org/10.1016/j.
ijfoodmicro.2012.09.014
Bacon, R. T., Sofos, J. N., Kendall, P. A., Belk, K. E., & Smith, G. C. (2003). Comparative
analysis of acid resistance between susceptible and multi-antimicrobial-resistant
Salmonella strains cultured under stationary-phase acid tolerance-inducing and
noninducing conditions. Journal of Food Protection, 66(5), 732–740. https://doi.org/
10.4315/0362-028x-66.5.732
Baranyi, J., & Pin, C. (1999). Estimating bacterial growth parameters by means of
detection times. Applied and Environmental Microbiology, 65(2), 732–736.
Biesta-Peters, E. G., Reij, M. W., Joosten, H., Gorris, L. G., & Zwietering, M. H. (2010).
Comparison of two optical-density-based methods and a plate count method for
estimation of growth parameters of Bacillus cereus. Applied and Environmental
Microbiology, 76(5), 1399–1405.
Björkman, J., Hughes, D., & Andersson, D. I. (1998). Virulence of antibiotic-resistant
Salmonella Typhimurium. Proceedings of the National Academy of Sciences, 95(7),
3949–3953.
Blackburn, C. D., & Davies, A. R. (1994). Development of antibiotic-resistant strains for
the enumeration of foodborne pathogenic bacteria in stored foods. International
Journal of Food Microbiology, 24(1–2), 125–136.
Cesar López-Romero, J., Valenzuela-Melendres, M., Juneja, V. K., Garcia-Davila, J.,
Pedro Camou, J., Pena-Ramos, A., et al. (2018). Effects and interactions of gallic
acid, eugenol and temperature on thermal inactivation of Salmonella spp. in ground
9
LWT 149 (2021) 111872
chicken. Food Research International, 103, 289–294. https://doi.org/10.1016/j.
foodres.2017.10.055
Chen, S., Cui, S. H., McDermott, P. F., Zhao, S. H., White, D. G., Paulsen, I., et al. (2007).
Contribution of target gene mutations and efflux to decreased susceptibility of
Salmonella enterica serovar Typhimurium to fluoroquinolones and other
antimicrobials. Antimicrobial Agents and Chemotherapy, 51(2), 535–542. https://doi.
org/10.1128/Aac.00600-06
Chen, C. Y., Nace, G. W., & Irwin, P. L. (2003). A 6 × 6 drop plate method for
simultaneous colony counting and MPN enumeration of Campylobacter jejuni, Listeria
monocytogenes, and Escherichia coli. Journal of Microbiological Methods, 55(2),
475–479. https://doi.org/10.1016/s0167-7012(03)00194-5
Chen, X., Zhang, W. Q., Pan, W. J., Yin, J. J., Pan, Z. M., Gao, S., et al. (2012). Prevalence
of qnr, aac(6 ’)-Ib-cr, qepA, and oqxAB in Escherichia coli isolates from Humans,
Animals, and the Environment. Antimicrobial Agents and Chemotherapy, 56(6),
3423–3427. https://doi.org/10.1128/aac.06191-11
Chiu, C. H., Wu, T. L., Su, L. H., Chu, C. S., Chia, J. H., Kuo, A. J., et al. (2002). The
emergence in Taiwan of fluoroquinolone resistance in Salmonella enterica serotype
choleraesuis. New England Journal of Medicine, 346(6), 413–419. https://doi.org/
10.1056/NEJMoa012261
Crump, J. A., Kretsinger, K., Gay, K., Hoekstra, R. M., Vugia, D. J., Hurd, S., et al. (2008).
Clinical response and outcome of infection with Salmonella enterica serotype typhi
with decreased susceptibility to fluoroquinolones: A United States FoodNet
multicenter retrospective cohort study. Antimicrobial Agents and Chemotherapy, 52
(4), 1278–1284. https://doi.org/10.1128/aac.01509-07
Cunha, S., Komora, N., Magalhaes, R., Almeida, G., Ferreira, V., & Teixeira, P. (2016).
Characterization of clinical and food Listeria monocytogenes isolates with different
antibiotic resistance patterns through simulated gastrointestinal tract conditions and
environmental stresses. Microbial Risk Analysis, 1, 40–46. https://doi.org/10.1016/j.
mran.2015.08.001
Cuppers, H., & Smelt, J. (1993). Time to turbidity measurement as a tool for modeling
spoilage by Lactobacillus. Journal of Industrial Microbiology and Biotechnology, 12
(3–5), 168–171.
Deekshit, V. K., Kumar, B. K., Rai, P., Srikumar, S., Karunasagar, I., & Karunasagar, I.
(2012). Detection of class 1 integrons in Salmonella Weltevreden and silent antibiotic
resistance genes in some seafood-associated nontyphoidal isolates of Salmonella in
south-west coast of India. Journal of Applied Microbiology, 112(6), 1113–1122.
https://doi.org/10.1111/j.1365-2672.2012.05290.x
Doherty, A. M., McMahon, C. M. M., Sheridan, J. J., Blair, I. S., McDowell, D. A., &
Hegarty, T. (1998). Thermal resistance of Yersinia enterocolitica and Listeria
monocytogenes in meat and potato substrates. Journal of Food Safety, 18(2), 69–83.
https://doi.org/10.1111/j.1745-4565.1998.tb00204.x
Doyle, M. P., Busta, F., Cords, B. R., Davidson, P. M., Hawke, J., Hurd, H. S., et al. (2006).
Antimicrobial resistance: Implications for the food system: An expert report.
Comprehensive Reviews in Food Science and Food Safety, 5, 71–137.
Duffy, G., Walsh, C., Blair, I. S., & McDowell, D. A. (2006). Survival of antibiotic resistant
and antibiotic sensitive strains of E-coli O157 and E-coli O26 in food matrices.
International Journal of Food Microbiology, 109(3), 179–186. https://doi.org/
10.1016/j.ijfoodmicro.2006.01.024
Farakos, S. M. S., Hicks, J. W., Frye, J. G., & Frank, J. F. (2014). Relative survival of four
serotypes of Salmonella enterica in low-water activity whey protein powder held at 36
and 70 ◦ C at various water activity levels. Journal of Food Protection, 77(7),
1198–1200. https://doi.org/10.4315/0362-028x.Jfp-13-327
Fouladkhah, A., Geornaras, I., Yang, H., & Sofos, J. N. (2013). Lactic acid resistance of
Shiga toxin-producing Escherichia coli and multidrug-resistant and susceptible
Salmonella Typhimurium and Salmonella Newport in meat homogenate. Food
Microbiology, 36(2), 260–266. https://doi.org/10.1016/j.fm.2013.06.005
Founou, L. L., Founou, R. C., & Essack, S. Y. (2016). Antibiotic resistance in the food
chain: A developing country-perspective. Frontiers in Microbiology, 7, 19. https://doi.
org/10.3389/fmicb.2016.01881
Francis, G. A., & O’Beirne, D. (2005). Variation among strains of Listeria monocytogenes:
Differences in survival on packaged vegetables and in response to heat and acid
conditions. Food Control, 16(8), 687–694. https://doi.org/10.1016/j.
foodcont.2004.06.005
Gan, L., & Li, Y. (2020). Resistance mechanism of Escherichia coli to carbapenems. The
Chinese Journal of Clinical Pharmacology, 36(18), 2896–2900.
Greenacre, E. J., & Brocklehurst, T. F. (2006). The acetic acid tolerance response induces
cross-protection to salt stress in Salmonella Typhimurium. International Journal of
Food Microbiology, 112(1), 62–65. https://doi.org/10.1016/j.
ijfoodmicro.2006.05.012
Guillén, S., Marcen, M., Manas, P., & Cebrian, G. (2020). Differences in resistance to
different environmental stresses and non-thermal food preservation technologies
among Salmonella enterica subsp. enterica strains. Food Research International, 132,
15. https://doi.org/10.1016/j.foodres.2020.109042
Guo, D., Zhang, Z., Xiao, L., & Lou, Y. (2014). Comparison of growth characteristic of
different antibiotic resistant pathogenic Vibrio parahaemolyticus. Science and
Technology of Food Industry, 35(19), 137–141.
He, X., & Ahn, J. (2014). Assessment of efflux-mediated antibiotic-resistant Salmonella
enterica serovar Typhimurium under simulated gastrointestinal conditions. Annals of
Microbiology, 64(2), 581–587. https://doi.org/10.1007/s13213-013-0691-0
Heckler, C., Silva, C. M. M., Cacciatore, F. A., Daroit, D. J., & Malheiros, P. D. (2020).
Thymol and carvacrol in nanoliposomes: Characterization and a comparison with
free counterparts against planktonic and glass-adhered Salmonella. Lwt-Food Science
and Technology, 127, 109382. https://doi.org/10.1016/j.lwt.2020.109382
Helms, M., Vastrup, P., Gerner-Smidt, P., & Molbak, K. (2002). Excess mortality
associated with antimicrobial drug-resistant Salmonella Typhimurium. Emerging
Infectious Diseases, 8(5), 490–495. https://doi.org/10.3201/eid0805.010267
X. Wang et al.
Hughes, M. K., Yanamala, S., Francisco, M. S., Loneragan, G. H., Miller, M. F., &
Brashears, M. M. (2010). Reduction of multidrug-resistant and drug-susceptible
Salmonella in ground beef and freshly harvested beef briskets after exposure to
commonly used industry antimicrobial interventions. Journal of Food Protection, 73
(7), 1231–1237. https://doi.org/10.4315/0362-028x-73.7.1231
Humphries, R. M., Abbott, A. N., & Hindler, J. A. (2019). Understanding and addressing
CLSI breakpoint revisions: A primer for clinical laboratories. Journal of Clinical
Microbiology, 57(6). https://doi.org/10.1128/JCM.00203-19
Jiang, Z. H., Anwar, T. M., Peng, X. Q., Biswas, S., Elbediwi, M., Li, Y., et al. (2021).
Prevalence and antimicrobial resistance of Salmonella recovered from pig-borne food
products in Henan, China. Food Control, 121. https://doi.org/10.1016/j.
foodcont.2020.107535
Jiang, Z. H., Paudyal, N., Xu, Y. H., Deng, T. W., Li, F., Pan, H., et al. (2019). Antibiotic
resistance profiles of Salmonella recovered from finishing pigs and slaughter facilities
in Henan, China. Frontiers in Microbiology, 10. https://doi.org/10.3389/
fmicb.2019.01513
Kang, I. B., & Seo, K. H. (2020). Variation of antibiotic resistance in Salmonella
Enteritidis, Escherichia coli O157:H7, and Listeria monocytogenes after exposure to
acid, salt, and cold stress. Journal of Food Safety, 6. https://doi.org/10.1111/
jfs.12804
Komora, N., Bruschi, C., Magalhães, R., Ferreira, V., & Teixeira, P. (2017). Survival of
Listeria monocytogenes with different antibiotic resistance patterns to food-associated
stresses. International Journal of Food Microbiology, 245, 79–87. https://doi.org/
10.1016/j.ijfoodmicro.2017.01.013
Lianou, A., & Koutsoumanis, K. P. (2013). Evaluation of the strain variability of
Salmonella enterica acid and heat resistance. Food Microbiology, 34(2), 259–267.
https://doi.org/10.1016/j.fm.2012.10.009
Lianou, A., Stopforth, J. D., Yoon, Y., Wiedmann, M., & Sofos, J. N. (2006). Growth and
stress resistance variation in culture broth among Listeria monocytogenes strains of
various serotypes and origins. Journal of Food Protection, 69(11), 2640–2647.
Li, R., Lai, J., Wang, Y., Liu, S., Li, Y., Liu, K., et al. (2013). Prevalence and
characterization of Salmonella species isolated from pigs, ducks and chickens in
Sichuan Province, China. International Journal of Food Microbiology, 163(1), 14–18.
https://doi.org/10.1016/j.ijfoodmicro.2013.01.020
Lindgren, P. K., Marcusson, L. L., Sandvang, D., Frimodt-Møller, N., & Hughes, D. (2005).
Biological cost of single and multiple norfloxacin resistance mutations in Escherichia
coli implicated in urinary tract infections. Antimicrobial Agents and Chemotherapy, 49
(6), 2343–2351.
Lou, Y., Liu, H. Q., Zhang, Z. H., Pan, Y. J., & Zhao, Y. (2016). Mismatch between
antimicrobial resistance phenotype and genotype of pathogenic Vibrio
parahaemolyticus isolated from seafood. Food Control, 59, 207–211. https://doi.org/
10.1016/j.foodcont.2015.04.039
Ma, Y., Lan, G., Li, C., Cambaza, E. M., Liu, D., Ye, X., et al. (2019). Stress tolerance of
Staphylococcus aureus with different antibiotic resistance profiles. Microbial
Pathogenesis, 133. https://doi.org/10.1016/j.micpath.2019.103549
Martínez-Martínez, L., Pascual, A., & Jacoby, G. A. (1998). Quinolone resistance from a
transferable plasmid. The Lancet, 351(9105), 797–799.
10
LWT 149 (2021) 111872
Nghiem, M. N., Nguyen, V. T., Nguyen, T. T. H., Nguyen, T. D., & Vo, T. T. B. (2017).
Antimicrobial resistance gene expression associated with multidrug resistant
Salmonella spp. isolated from retail meat in Hanoi, Vietnam. International
Microbiology, 20, 85–93.
Nielsen, K. L., Pedersen, T. M., Udekwu, K. I., Petersen, A., Skov, R. L., Hansen, L. H.,
et al. (2012). Fitness cost: A bacteriological explanation for the demise of the first
international methicillin-resistant Staphylococcus aureus epidemic. Journal of
Antimicrobial Chemotherapy, 67(6), 1325–1332.
Qiao, J., Zhang, Q., Alali, W. Q., Wang, J., Meng, L., Xiao, Y., et al. (2017).
Characterization of extended-spectrum beta-lactamases (ESBLs)-producing
Salmonella in retail raw chicken carcasses. International Journal of Food Microbiology,
248, 72–81. https://doi.org/10.1016/j.ijfoodmicro.2017.02.016
Randall, L. P., Cooles, S. W., Osborn, M. K., Piddock, L. J. V., & Woodward, M. J. (2004).
Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five
serotypes of Salmonella enterica isolated from humans and animals in the UK. Journal
of Antimicrobial Chemotherapy, 53(2), 208–216. https://doi.org/10.1093/jac/
dkh070
Shachar, D., & Yaron, S. (2006). Heat tolerance of Salmonella enterica serovars Agona,
Enteritidis, and Typhimurium in peanut butter. Journal of Food Protection, 69(11),
2687–2691. https://doi.org/10.4315/0362-028x-69.11.2687
Vuthy, Y., Lay, K. S., Heng, S., Kerleguer, A., & Aidara-Kane, A. (2017). Antibiotic
susceptibility and molecular characterization of resistance genes among Escherichia
coli and among Salmonella subsp in chicken food chains. Asian Pacific Journal of
Tropical Biomedicine, 7(7), 670–674. https://doi.org/10.1016/j.apjtb.2017.07.002
Walls, I., & Scott, V. N. (1997). Use of predictive microbiology in microbial food safety
risk assessment. International Journal of Food Microbiology, 36(2–3), 97–102. https://
doi.org/10.1016/S0168-1605(97)01260-9
Walsh, C., Duffy, G., Sheridan, J. J., Fanning, S., Blair, I. S., & McDowell, D. A. (2005).
Thermal resistance of antibiotic-resistant and antibiotic-sensitive Salmonella spp. on
chicken meat. Journal of Food Safety, 25(4), 288–302. https://doi.org/10.1111/
j.1745-4565.2005.00021.x
Wang, X., Devlieghere, F., Geeraerd, A., & Uyttendaele, M. (2017). Thermal inactivation
and sublethal injury kinetics of Salmonella enterica and Listeria monocytogenes in
broth versus agar surface. International Journal of Food Microbiology, 243, 70–77.
https://doi.org/10.1016/j.ijfoodmicro.2016.12.008
Wang, H. H., Huang, M. Y., Zeng, X. M., Peng, B., Xu, X. L., & Zhou, G. H. (2020).
Resistance Profiles of Salmonella isolates exposed to stresses and the expression of
small non-coding RNAs. Frontiers in Microbiology, 11, 10. https://doi.org/10.3389/
fmicb.2020.00130
Wu, L. J., Luo, Y., Shi, G. L., & Li, Z. Y. (2021). Prevalence, clinical characteristics and
changes of antibiotic resistance in children with nontyphoidal Salmonella infections
from 2009-2018 in chongqing, China. Infection and Drug Resistance, 14, 1403–1413.
https://doi.org/10.2147/Idr.S301318
Yang, X. J., Wu, Q. P., Zhang, J. M., Huang, J. H., Chen, L., Wu, S., et al. (2019).
Prevalence, bacterial load, and antimicrobial resistance of Salmonella serovars
isolated from retail meat and meat products in China. Frontiers in Microbiology, 10.
https://doi.org/10.3389/fmicb.2019.02121