Short article

A multivalent mRNA monkeypox virus vaccine

(BNT166) protects mice and macaques from
orthopoxvirus disease
Graphical abstract Authors
Adam Zuiani, Charles L. Dulberger,
BNT166 multivalent MPXV mRNA vaccine Nilushi S. De Silva, ..., Richard B. Gaynor,
 ur Sxahin, Asaf Poran
Ug
A35
EV
B6 Correspondence
M1 ugur.sahin@biontech.de (U.Sx.),
MV asaf.poran@biontech.us (A.P.)
H3
In brief
Vaccination Outcome
In 2022–2023, unprecedented outbreaks
Survival of clades I and IIb monkeypox virus driven
Virus Challenge

BNT166
Virus control by human-to-human transmission
demonstrated a need for rapidly scalable
and deployable vaccines against
orthopoxviruses. BNT166 is a multivalent
mpox mRNA vaccine that shows efficacy
Death
Virus Challenge

Saline in multiple preclinical models, supporting

High viral load
its further study in clinical trials.

Highlights
d BNT166 is a multivalent mRNA orthopoxvirus vaccine
encoding MPXV antigens A35, B6, M1, H3

d It elicits robust antibody and T cell responses to EV and MV

antigens

d Immunization protects mice from VACV, clade I and IIb

MPXV, and NHPs from clade I MPXV

d Clinical evaluation of BNT166 safety and immunogenicity is

ongoing (NCT05988203)

Zuiani et al., 2024, Cell 187, 1363–1373

March 14, 2024 ª 2024 The Authors. Published by Elsevier Inc.
https://doi.org/10.1016/j.cell.2024.01.017 ll
 ll
OPEN ACCESS

Short article
A multivalent mRNA monkeypox virus vaccine
(BNT166) protects mice and macaques
from orthopoxvirus disease
Adam Zuiani,1 Charles L. Dulberger,1 Nilushi S. De Silva,1 Meghan Marquette,1 Yu-Jung Lu,1 Gavin M. Palowitch,1
Anja Dokic,2 Ricardo Sanchez-Velazquez,2 Katja Schlatterer,2 Sanjay Sarkar,3 Swagata Kar,4 Bhavna Chawla,4
Alibek Galeev,2 Claudia Lindemann,2 Daniel A. Rothenberg,1 Huitian Diao,1 Alexandra C. Walls,1 Theresa A. Addona,1
Federico Mensa,1 Annette B. Vogel,2 Lynda M. Stuart,1 Robbert van der Most,2 John R. Srouji,1 Özlem Türeci,2,5
Richard B. Gaynor,1 Ug ur Sxahin,2,6,* and Asaf Poran1,7,*
1BioNTech US, Cambridge, MA 02139, USA
2BioNTech SE, Mainz, Germany
3Southern Research, Birmingham, AL, USA
4BioQual, Inc, Rockville, MD, USA
5HI-TRON – Helmholtz Institute for Translational Oncology Mainz by DKFZ, Mainz, Germany
6TRON gGmbH – Translational Oncology at the University Medical Center of the Johannes Gutenberg University, Mainz, Germany
7Lead contact

*Correspondence: ugur.sahin@biontech.de (U.S x.), asaf.poran@biontech.us (A.P.)

https://doi.org/10.1016/j.cell.2024.01.017

SUMMARY

In response to the 2022 outbreak of mpox driven by unprecedented human-to-human monkeypox virus (MPXV)
transmission, we designed BNT166, aiming to create a highly immunogenic, safe, accessible, and scalable next-
generation vaccine against MPXV and related orthopoxviruses. To address the multiple viral forms and increase
the breadth of immune response, two candidate multivalent mRNA vaccines were evaluated pre-clinically: a
quadrivalent vaccine (BNT166a; encoding the MPXV antigens A35, B6, M1, H3) and a trivalent vaccine
(BNT166c; without H3). Both candidates induced robust T cell responses and IgG antibodies in mice, including
neutralizing antibodies to both MPXV and vaccinia virus. In challenge studies, BNT166a and BNT166c provided
complete protection from vaccinia, clade I, and clade IIb MPXV. Furthermore, immunization with BNT166a was
100% effective at preventing death and at suppressing lesions in a lethal clade I MPXV challenge in cynomolgus
macaques. These findings support the clinical evaluation of BNT166, now underway (NCT05988203).

INTRODUCTION rus (VARV), the causative agent of smallpox. Mpox disease

Beginning in May 2022, an outbreak of mpox led to over 90,000
cases worldwide, spanning 115 countries, many of which have
not been previously considered endemic.1,2 Transmission of
this typically zoonotic infection has sustained endemicity in
West and Central Africa for many years, but the scale of the
2022 outbreak driven by unprecedented human-to-human
transmission led to its declaration as a public health emergency
of international concern (PHEIC) by the World Health Organiza-
tion (WHO) in July 2022.3 The PHEIC was later discontinued as
cases declined.4 However, a second large-scale independent
outbreak emerged in 2023 in the Democratic Republic of Congo
(DRC), with significant reported mortality.5,6 These outbreaks
illustrate the potential for orthopoxvirus reemergence and
spread, highlight limitations in the current vaccine supply, and
call for preparedness strategies.
Monkeypox virus (MPXV), the causative agent of mpox disease,
is a member of the orthopoxvirus genus, which includes variola vi-
frequently manifests as a self-limiting infection with symptoms
including fever, headache, fatigue, lymphadenopathy, and skin le-
sions.1 However, lethal disease is possible and most frequently
caused by clade I MPXV infections.7 The 2022 international
outbreak was driven by clade IIb MPXV and was associated with
less severe disease, while the 2023 outbreak in the DRC was driven
by clade I MPXV.5,6,8 Orthopoxviruses have double-stranded DNA
genomes with a high level of similarity between antigens, allowing
immune responses raised to one species to provide cross-protec-
tive immunity to other viruses within the genus. Smallpox was
eradicated by exploiting this cross-protection through global im-
munization campaigns using the orthopoxvirus vaccinia virus
(VACV) as a live virus vaccine. Early generation VACV immunization
provided robust and durable protection against smallpox9 and
MPXV10 but had unfavorable side effects and was restricted
from use in certain populations.11,12 The current, third-generation
orthopoxvirus vaccine is based on modified vaccinia Ankara
(MVA), a non-replicating VACV derivative with an improved safety

Cell 187, 1363–1373, March 14, 2024 ª 2024 The Authors. Published by Elsevier Inc. 1363
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
 ll
OPEN ACCESS
Table 1. MPXV target protein amino acid sequence consensus and identity with VACV and VARV orthologs
Amino acid
sequence VACV VACV – identity/consensus
MPXV protein length protein sequence length (identity [%])
A35 181 A33 172/180 (96%)
B6 317 B5 306/317 (97%)
M1 250 L1 246/250 (98%)
H3 324 H3 304/324 (94%)
profile.13,14 Although MVA vaccines were available for use prior to
May 2022, stockpiles and existing manufacturing capacity did not
meet the demand driven by the 2022 outbreak, necessitating vac-
cine rationing including partial dosing.15 Further, MVA vaccine
effectiveness in individuals receiving a complete two-dose
regimen was estimated at only 66% during the 2022 outbreak,16
and antibody responses wane rapidly over two years.17 The devel-
opment of novel, potent, durable, and safe mpox vaccines is
needed, especially vaccines that can be rapidly manufactured at
scale and distributed globally. The BNT166 program was launched
in May 2022 to develop a next-generation MPXV vaccine as a po-
tential solution for some of these limitations.
Orthopoxviruses have two distinct infectious forms, mature vi-
rions (MVs) and extracellular virions (EVs). Each viral form has a
unique set of surface antigens.18 While immune responses
raised to a single antigen can offer some protection from infec-
tion, both subunit vaccine and monoclonal antibody prophylaxis
studies in animals illustrate the value of combining antibodies to
multiple EV and MV antigens.19–21 Therefore, BNT166 targets
MPXV proteins from both EVs (A35 and B6) and MVs (M1 and
H3). Selection of these antigens was driven by three factors.
First, each protein is immunogenic following natural exposure
to VACV or MPXV and is a proven target of protective immune re-
sponses.22–25 Second, these antigens are conserved across
many orthopoxviruses, including VARV and VACV (Table 1),
increasing the likelihood for cross-protection. Finally, these anti-
gens are suitable for the mRNA platform, as cell surface expres-
sion is expected to elicit relevant antibody specificities.
We evaluated two MPXV mRNA vaccine candidates pre-clini-
cally: BNT166a (quadrivalent) and BNT166c (trivalent, excluding
H3). We demonstrate that multivalent mRNA vaccination matches
data from previous generation vaccines in breadth of protection,
eliciting protective immunity in multiple animal infection models,
including VACV, clade I MPXV, and clade IIb MPXV challenge in
mice and a clade I MPXV challenge of cynomolgus macaques.
This work delineates a blueprint for rapid development of mRNA
vaccines to complex viral pathogens of pandemic potential and
supports the development of BNT166 as a clinical candidate,
with a phase I/II clinical study now underway (NCT05988203).
RESULTS
mRNAs encoding MPXV antigens A35, B6, M1, and H3
are expressed in vitro and immunogenic in vivo
BNT166 consists of individual nucleoside-modified mRNAs
with backbone structures for optimized translational perfor-
mance. Each mRNA encodes for one of the following minimally
1364 Cell 187, 1363–1373, March 14, 2024
Short article
VARV – identity/consensus
VARV protein sequence length (identity [%])
A36 166/180 (92%)
B7 294/316 (93%)
M1 248/250 (99%)
I3 305/325 (94%)
modified clade IIb MPXV antigens: A35, B6, M1, and H3. Two
combination vaccine candidates were evaluated: the quadriva-
lent BNT166a, including all four antigens, and the trivalent
BNT166c, including A35, B6, and M1 (Figure 1A). Expression
and localization of the BNT166-encoded antigens were evalu-
ated using flow cytometry on transfected HEK293T cells (Fig-
ure S1). The quantity of each component RNA delivered by
transfection was equivalent across conditions to allow for direct
antigen comparison of expression. Total protein expression
analysis demonstrated that BNT166 vaccine mRNAs are suc-
cessfully translated in cells in vitro, and surface expression
analysis confirmed that the antigens, all transmembrane pro-
teins, are strongly expressed and correctly localized to the
cell surface, facilitating recognition by immune cells upon
vaccination. Importantly, each antigen is expressed at a similar
level regardless of whether its mRNA was delivered alone or in
combination with other mRNAs. This observation suggests that
co-delivery of multiple vaccine components does not interfere
with the translation of each individual mRNA.
Immunogenicity of BNT166a and BNT166c was initially eval-
uated using BALB/c mice. We first evaluated antibody re-
sponses to BNT166 antigens administered in combination or
separately. Mice were immunized intramuscularly (IM) with
4 mg BNT166a mRNA (1 mg of each component), 4 mg of
BNT166c (1.3 mg of each component), 1 mg of a single compo-
nent antigen lipid nanoparticle (LNP)-encapsulated RNA, or sa-
line on days 0 and 21. Blood was collected weekly until the end
of the study on day 35 and used for antibody immunoassays.
Total immunoglobulin G (IgG) raised to each MPXV antigen
was measured by enzyme-linked immunosorbent assay
(ELISA) for each blood collection (Figures 1B–1E). IgG induction
was observed following the prime dose and increased after the
day 21 boost for all antigens. Importantly, comparable antibody
levels were observed following multivalent or monovalent im-
munizations for each antigen, suggesting no reduction in
response to each antigen when multiple antigens are delivered
simultaneously. To explore whether BNT166 mRNAs have the
potential to induce durable immunity, germinal center (GC) in-
duction was explored in lymph nodes at day 35 by flow cytom-
etry (Figures S2A–S2C). Antigen-specific GC B cells were
observed for all mRNA treatments, consistent with a durable
immune response following BNT166 vaccination. These obser-
vations align with the potent GC induction observed in human
recipients of BNT162b2, suggesting that robust GC formation
is a general feature of the mRNA-LNP platform.26
Splenic T cell responses were examined by IFN-g enzyme-
linked immunosorbent spot assay (ELISpot) 7 days following a
 ll
Short article OPEN ACCESS

A BNT166a – quadrivalent candidate

A35 B6 M1 H3
EV antigen EV antigen MV antigen MV antigen

BNT166c – trivalent candidate

B A35 antibody induction C B6 antibody induction D M1 antibody induction E H3 antibody induction

107 107 107 107

106 106 106 106

anti-A35 IgG (ng/mL)

anti-M1 IgG (ng/mL)

anti-H3 IgG (ng/mL)

anti-B6 IgG (ng/mL)

105 105 105 105

104 104 104 104

A35 alone B6 alone M1 alone

103 103 103 103
BNT166a BNT166a BNT166a H3 alone
BNT166c BNT166c BNT166c BNT166a
102 102 102 102
0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35
Days post immunization Days post immunization Days post immunization Days post immunization

F A35 T cell induction (Day 7) G B6 T cell induction (Day 7) H M1 T cell induction (Day 7) I H3 T cell induction (Day 7)
2000 800 800 800
ns ns
(per million splenocytes)

(per million splenocytes)

(per million splenocytes)
(per million splenocytes)

1500 600 600 600

IFN- + T cells
IFN- + T cells

IFN- + T cells

IFN- + T cells

1000 400 400 400

500 200 200 200

0 0 0 0
e

a
e

lin

on

66
lin

on

66

lin

on

66

lin

on

66

Sa
Sa

Sa

Sa

al

T1
al

T1

al

T1

al

T1

3
5

B6

BN
BN

BN

BN

H
A3

Figure 1. BNT166a and BNT166c induce IgG and T cell responses to MPXV antigens
(A) Structural representation of the components of the BNT166 vaccine candidates.
(B–E) Serum antibody levels for A35 (B), B6 (C), M1 (D), and H3 (E) by ELISA. Geometric mean values of IgG ng/mL equivalents (± SEM) are shown. The dashed line
indicates lower limit of detection (LLOD).
(F–I) IFN-g ELISpot counts using mouse splenocytes stimulated with A35 (F), B6 (G), M1 (H), and H3 (I) peptide pools. For (F)–(I), bars represent median; statistical
significance assessed using a Kruskal-Wallis test with Dunn’s multiple comparisons test: n = 4–5, *p < 0.05, **p < 0.01, ***p < 0.001; ns, not significant.
See also Figures S1, S2, and S3.

single IM immunization of BALB/c mice with 4 mg BNT166a, 1 mg BNT166 vaccines induce strong MPXV- and VACV-
of each single component antigen LNP-encapsulated RNA, or neutralizing antibody responses
saline (Figure 1). Vaccine-induced responses were detected for VACV- and MPXV-neutralizing antibody levels were determined
all antigens, with A35 driving the most robust T cell response by focus reduction neutralization test (FRNT) and plaque reduc-
(Figures 1F–1I). Consistent with ELISA results, T cell induction tion neutralization test (PRNT), respectively, at day 35 in BALB/c
in multivalent vaccination was comparable to the levels mice. Both FRNT and PRNT assays were conducted either
observed for single antigens, suggesting limited or no interfer- without addition of baby rabbit complement (Figures 2A and
ence resulting from delivery of multiple antigens. 2C) or in its presence (Figures 2B and 2D). The complement
We confirmed the immunogenicity of BNT166 in Wistar neutralization assay was included since inhibition of infection
rats immunized twice with 10 mg of single mRNAs (Fig- via complement cascade activation is an established mode of
ure S3). As in mice, IgG induction was observed in rats action for anti-orthopoxvirus antibodies.21,27 Classic PRNT as-
following the prime dose and increased after the boost for says employ virus preparations dominated by MVs; therefore,
all antigens. sera from mice immunized with single EV targets are not

Cell 187, 1363–1373, March 14, 2024 1365

 ll
OPEN ACCESS Short article

A MPXV neutralization B MPXV neutralization (with complement)

105 105

50% neutralization titer (NT50)

50% neutralization titer (NT50)

104 104

103 103

102 102

101 101

100 100

c
e

e
5

1
B6

B6

3
66

66
66

66
lin

lin
A3

A3
M

M
H

H
Sa

Sa
T1

T1
T1

T1
BN

BN
BN

BN
Individual antigen Individual antigen
immunizations immunizations

C VACV neutralization D VACV neutralization (with complement)

105 105

50% neutralization titer (NT50)

50% neutralization titer (NT50)

104 104

103 103

102 102

101 101

100 100
a

c
e

e
5

1
B6

1
B6

3
66

66
66

66
lin

lin
A3

A3

H
Sa

Sa
T1

T1
T1

T1
BN

BN
BN

BN
Individual antigen Individual antigen
immunizations immunizations

Figure 2. Robust MPXV- and VACV-neutralizing antibody titers following immunization with BNT166 vaccine candidates
(A–D) Neutralizing antibody titers at day 35 were determined by PRNT for MPXV (A and B) and FRNT for VACV (C and D). Neutralizing antibody activity was
measured both in the absence (A and C) and presence (B and D) of baby rabbit complement. The lower and upper limits of detection are indicated where
applicable.
See also Figure S4.

expected to neutralize virus in this assay.28 Consistent with this
expectation, sera from mice immunized with the EV proteins A35
and B6 alone do not show neutralization activity (Figures 2A–2D).
Conversely, sera from animals immunized with the MV protein
M1 (BNT166a or BNT166c) efficiently neutralized VACV and
MPXV both with and without complement. Sera from mice immu-
nized with the MV target H3 alone also show neutralization activ-
ity with the addition of complement against both MPXV and
VACV. M1 likely drives the neutralizing antibody responses
observed in the combination vaccines, with no significant differ-
ences observed between M1 alone, BNT166a, and BNT166c
groups in any neutralization assays (ANOVA). An additional study
was conducted in BALB/c to confirm and further examine
neutralizing antibody responses following vaccine prime and
boost. BALB/c mice were immunized as above with BNT166a
and BNT166c, and serum VACV-neutralizing antibody re-
sponses on days 21 and 35 were measured by FRNT (Figure S4).
Modest neutralizing antibody titers were observed post-prime
for BNT166a and BNT166c (geometric mean titers [GMTs] 130
and 224, respectively), and strong neutralizing antibody titers
were observed post-boost (GMTs 7947 and 5167, respectively).
These results demonstrate that functional antibody responses
are elicited by BNT166 against MPXV with cross-recognition of
a related orthopoxvirus.
BNT166 protects mice in multiple orthopoxvirus
challenge models
Protective efficacy of BNT166a and BNT166c against MPXV was
evaluated in two intranasal (IN) challenge models using the
MPXV-susceptible CAST/Ei mice. Infection of CAST/Ei mice
with a clade I MPXV isolate resulted in a lethal infection of
CAST/Ei,29,30 whereas infection with a clade II isolate from the
2022 outbreak produced a non-lethal infection with high viral
replication rates in the lungs of infected animals.8,31
First, CAST/Ei mice were immunized with either 4 mg of
BNT166a, BNT166c, a bivalent combination of A35 and B6

1366 Cell 187, 1363–1373, March 14, 2024

 ll
Short article OPEN ACCESS

Clade IIb MPXV Clade IIb MPXV

A (high dose)
B (low dose)
CAST/Ei CAST/Ei

Partial sacrifice, Partial sacrifice,

lung collection lung collection
Day 0 Day 21 Day 56 Day 59 Day 63 Day 0 Day 21 Day 56 Day 59 Day 63

Clade IIb MPXV challenge Clade IIb MPXV challenge Clade IIb MPXV challenge Clade IIb MPXV challenge
Experiment 1, day 3 post-infection Experiment 1, day 7 post-infection Experiment 2, day 3 post-infection Experiment 2, day 7 post-infection

1010 1010 1010 1010

Lung MPXV titer (TCID50/g)

Lung MPXV titer (TCID50/g)

Lung MPXV titer (TCID50/g)

Lung MPXV titer (TCID50/g)

109 109 109 109 ns

108 ns 108 108 ns 108

107 107 107 107

106 106 106 106

105 105 105 105

104 104 104 104

103 103 103 103

e

B6

c
66

66

66

66
in

+B

66

lin

66

in

+B

66

in

+B

66
5+
l

l
Sa

Sa

Sa

Sa
T1

T1

T1

T1
T1

T1

T1

T1
5

5
A3

A3

A3

A3
BN

BN

BN

BN
BN

BN

BN

BN
Clade I
C CAST/Ei
MPXV D BALB/c VACV

end end

Day 0 Day 21 Day 56 Day 70 Day 0 Day 21 Day 42 Day 56

Clade I MPXV challenge Clade I MPXV challenge VACV challenge VACV challenge
Body weight change (% of initial)
Body weight change (% of initial)

10 100 10 100
**** ****
80 80
Percent survival

Percent survival
0 Saline 0
A35+B6 Saline
60 BNT166a 60
-10 -10 BNT166a
BNT166c A35
40 40 B6
-20 * -20 M1
20 20 H3
ns
-30 0 -30 0
0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14
Days post challenge Days post challenge Days post challenge Days post challenge

Figure 3. BNT166 vaccine candidates protect mice from MPXV and VACV challenge
(A and B) Lung viral load by 50% tissue culture infectious dose (TCID50) assay for high- (A) and low- (B) dose MPXV clade IIb challenge at days 3 and 7 post-
challenge. LLOD is indicated by a dashed line.
(C) Weight loss and survival of CAST/Ei mice following MPXV clade I challenge.
(D) Weight loss and survival of BALB/c mice following VACV challenge. Weight loss is shown as mean change in body weight (± SEM).
For (A) (n = 4–6) and (B) (n = 4–6), statistical significance was assessed using a Kruskal-Wallis test with Dunn’s multiple comparisons test. For survival data in (C)
(n = 9–10) and (D) (n = 15–16), statistical significance was assessed using Mantel-Cox log rank test. *p < 0.05, **p < 0.01, ****p < 0.0001; ns, not significant.

RNAs, or mock-treated with saline on days 0 and 21. At 5 weeks Second, a lethal clade I MPXV challenge study was conduct-
following the second dose, mice were challenged IN with 9 3 106 ed. CAST/Ei mice were immunized as described above and chal-
plaque-forming units (PFUs) of MPXV (strain hMPXV/USA/ lenged IN with 1 3 105 PFUs of clade I MPXV (strain V79-I-005)
MA001/2022 from the 2022 outbreak). The mice were sacrificed 5 weeks post-boost and monitored for weight loss and survival
at either day 3 or day 7 post-infection, and MPXV virus titers were (Figure 3C). Both BNT166 vaccine candidates provided 100%
measured in the lungs (Figure 3A). Mock-immunized animals had protection from weight loss and death. Mice immunized with a
high viral loads in the lungs at both days 3 and 7, whereas combination of A35 and B6 mRNAs had a small yet significant
BNT166a- and BNT166c-immunized animals displayed no survival benefit. Together, these findings demonstrate that
measurable virus at either timepoint. Mice immunized with the both BNT166 vaccine candidates can provide protection from
A35 and B6 antigens did not have a significant reduction in viral a range of MPXV isolates and strongly support combining EV
titers in the lung on day 3 but had a reduction of viral titers on day and MV antigens for optimal and broad immunity.
7. These findings demonstrate that immunization with only EV To determine whether BNT166 provides cross-protective im-
antigens contributes to a reduction in tissue viral replication munity to another orthopoxvirus, we conducted an IN VACV
in vivo. A second experiment was conducted with a lower inoc- challenge of BNT166a-immunized BALB/c mice. In this study,
ulum (3 3 105 PFUs) from a second lower titer preparation of we also investigated the protective potential of each BNT166
hMPXV/USA/MA001/2022 (Figure 3B). These results closely mRNA component alone. Mice were immunized with either
mirror the findings of the first experiment, confirming that the 4 mg of the multivalent BNT166a, 1 mg of each single mRNA
BNT166 vaccines, BTN166a and BNT166c, can robustly provide component, or mock-treated with saline on days 0 and 21. A le-
protection from the 2022 outbreak MPXV strain. thal challenge dose of 5 3 104 PFUs of VACV-Western Reserve

Cell 187, 1363–1373, March 14, 2024 1367

 ll
OPEN ACCESS Short article

A Experiment scheme C Neutralizing antibody response (MPXV PRNT)

Clade I
104
MPXV Saline
BNT166a

50% neutralization titer (NT50)

end IT MPXV
103 challenge
Day 0 Day 28 Day 60 Day 88
6 saline
6 BNT166a

102
B A35 antibody induction B6 antibody induction
106 Saline 106
A35 IgG enpoint titer

B6 IgG enpoint titer

BNT166a
105 105 101

104 104
-3 28 56 60 66 72 88
103 103 Days post immunization

102 102 D NHP survival (clade I MPXV challenge)

0 15 30 45 60 0 15 30 45 60 100
Days post immunization Days post immunization Saline
80 BNT166a

M1 antibody induction H3 antibody induction

Percent survival
106 106 60
H3 IgG enpoint titer
M1 IgG enpoint titer

105 105
40
104 104

103 103 20

102 102 p = 0.0048

0
0 15 30 45 60 0 15 30 45 60 0 4 8 12 16 20 24 28
Days post immunization Days post immunization Days post challenge

E Weight loss (individual animals, saline) Weight loss (individual animals, BNT166a) Weight loss (group mean)
5 5 5
Body weight change (% of initial)
Body weight change (% of initial)

Body weight change (% of initial)

Saline
BNT166a
0 0 0

-5 -5 -5

-10 -10 -10

-15 -15 -15

-20 -20 -20

0 4 8 12 16 20 24 28 0 4 8 12 16 20 24 28 0 4 8 12 16 20 24 28
Days post challenge Days post challenge Days post challenge

F Viremia (individual animals, saline) Viremia (individual animals, BNT166a) Viremia (group mean)
Blood viral load (genome copies/mL)

Blood viral load (genome copies/mL)

Blood viral load (genome copies/mL)

107 107 107 Saline

BNT166a
106 106 106

105 105 105

104 104 104

103 103 103

0 4 8 12 16 20 24 28 0 4 8 12 16 20 24 28 0 4 8 12 16 20 24 28
Days post challenge Days post challenge Days post challenge

G Lesions counts (individual animals, saline) Lesions counts (individual animals, BNT166a) Lesion count (group mean)
300 300 300
Saline
250 250 250 BNT166a
Number of lesions
Number of lesions

Number of lesions

200 200 200

150 150 150

100 100 100

50 50 50

0 0 0

0 4 8 12 16 20 24 28 0 4 8 12 16 20 24 28 0 4 8 12 16 20 24 28
Days post challenge Days post challenge Days post challenge

(legend on next page)

1368 Cell 187, 1363–1373, March 14, 2024


Short article
(WR) was administered IN 3 weeks following the second vacci-
nation dose, and mice were monitored for weight loss and death
(Figure 3D). Mock-immunized and mice immunized with H3
alone rapidly succumbed to infection, but mice immunized with
either the multivalent BNT166a or the single components A35,
B6, and M1 were fully protected from death. Mice receiving
M1 alone displayed transient weight loss post-challenge in
contrast to mice immunized with A35 or B6, consistent with pre-
vious reports of EV antigen immunization yielding protection su-
perior to MV antigen immunization in the IN VACV challenge
model.19,23 These findings demonstrate the potential of
BNT166 to protect against a range of orthopoxviruses.
BNT166a-vaccinated macaques are protected from a
lethal clade I MPXV challenge
To evaluate BNT166 immunity in a model that better represents
human mpox, including development of lesions, we used a non-
human primate (NHP) MPXV challenge model. Twelve cynomol-
gus macaques were divided into two groups of six and received
either a day 0 prime and day 28 boost immunization with 30 mg
BNT166a or mock saline treatment (Figure 4A). IgG responses
to each antigen were measured up to day 56 using ELISA.
High IgG titers were detected to all four antigens, which were
further increased by the second immunization (Figure 4B). Serum
MPXV-neutralizing antibodies were observed following adminis-
tration of the second vaccine dose (Figure 4C). At day 60, all an-
imals were administered a lethal intratracheal (IT) dose of 5 3 107
PFUs of clade I MPXV (strain V79-I-005) and monitored for
28 days for disease symptoms including weight loss, lesions,
respiratory distress, and death. In comparison to the mock-
treated group, where five out of six (83.3%) succumbed to infec-
tion, all BNT166a-vaccinated animals survived until the conclu-
sion of the study (Figure 4D). The BNT166a-vaccinated animals
exhibited mild disease symptoms, including rapidly resolving
weight loss (Figure 4E) and transient viremia (Figure 4F). Tissue
samples were collected from the lungs and lung draining lymph
nodes following the death or euthanasia of each animal and
analyzed by histology (Figure S5). Moderate to marked inflam-
mation of the lungs was observed in three vaccinated animals
and all six controls. Interestingly, inflammation of the lymph no-
des was observed in five control animals but not in BNT166a-
vaccinated macaques, and moderate hyperplasia of lymphoid
tissue was observed in six out of six BNT166a-vaccinated ani-
mals compared with only one out of six control animals, consis-
tent with resolving inflammation in BNT166a animals at the end
of the study. Critically, BNT166a-vaccinated animals showed
limited or no lesions following infection, indicating infection
was well controlled in these animals despite stringent challenge
conditions (Figure 4G). Four of six BNT166a-vaccinated animals
showed no signs of lesions, and the remaining two animals had 6
Figure 4. BNT166a protects macaques from a lethal clade I MPXV challenge
(A) Schematic illustrating experiment design.
(B) Serum antibody levels to the BNT166 antigens prior to challenge measured by ELISA.
(C–G) MPXV-neutralizing antibody levels over the entire study period determined by PRNT (C). Animals were monitored for survival (D), weight loss (E), viremia (F),
and lesion development (G) for 28 days post-infection. For group mean plots, mean or geometric mean (± SEM) are shown. Dashed lines indicate baseline value.
For (D), significance was assessed using Mantel-Cox log rank test: n = 6, *p < 0.05, ****p < 0.0001; ns, not significant.
See also Figure S5.
ll
OPEN ACCESS
or fewer rapidly resolving lesions. In contrast, two saline-treated
animals died prior to lesion development, and all four remaining
control group animals developed substantial lesions.
DISCUSSION
Here, we show that multivalent mRNA vaccines encoding MPXV
antigens were immunogenic and induced protective immunity to
multiple orthopoxviruses in small animal models and NHPs.
These results demonstrate that an mRNA vaccine has the poten-
tial to protect against orthopoxvirus disease and, importantly,
that this technology could be leveraged to rapidly respond to
current and future orthopoxvirus outbreaks.
The design of BNT166 draws extensively from the study of im-
mune responses to live VACV vaccines that formed the basis of
the successful global campaign to eradicate smallpox. Live
VACV exposes the immune system to the complete viral prote-
ome, including more than 30 virion surface proteins,18 though
with differing immunogenicity, suggesting that responses to
some antigens are most critical for immunity.32,33 Previous pro-
tein and DNA subunit vaccine studies established that delivery of
a few antigens can closely mirror VACV-induced immunity. This
was also demonstrated by recent studies using mRNA-based
vaccines encoding different subsets of the MPXV antigens
A35, B6, A29, E8, M1, and H3, all reporting immunogenicity
and/or protection of mice from VACV challenge.34–40 Subunit
vaccines may ultimately have advantages to live virus ap-
proaches by focusing the vaccine response only on targets elic-
iting protective immunity. The robust immunogenicity and cross-
protection data presented here suggests that BNT166 can
exploit the immense potential of the mRNA platform to meet
this goal.
Two EV proteins, A35 and B6, and two MV proteins, M1 and
H3, were selected for inclusion in BNT166. These targets were
selected based on their favorable profile in previous studies of
immunity to VARV, VACV, and MPXV.19,22–24 All are highly immu-
nogenic following VACV immunization or in MPXV convalescent
subjects.32,33 A35, B6, and M1 have been studied extensively as
effective targets of subunit vaccines, protecting mice and ma-
caques from lethal orthopoxvirus disease. Additionally, anti-
bodies to all four antigens have previously been shown to protect
animals in monoclonal and/or polyclonal antibody prophylaxis
studies.21,41,42 This work demonstrates that these antigens are
effective targets of immunity to MPXV and VACV in the context
of mRNA vaccination. Our component analysis study in the
VACV challenge model confirms that A35, B6, and M1 have
the greatest individual protective potential, while H3 alone was
insufficient for protection. These results strongly support the in-
clusion of A35, B6, and M1 in the BNT166 vaccine candidates.
The finding that M1 immunization alone yielded 100% protection
Cell 187, 1363–1373, March 14, 2024 1369
 ll
OPEN ACCESS
from VACV challenge in contrast to previous studies using re-
combinant protein and DNA vaccines also highlights the poten-
tial of mRNA technology to generate more potent immune re-
sponses than other subunit vaccine approaches.23,43 While
immunization with H3 alone did not match the degree of protec-
tion of the other BNT166a constituent antigens, the inclusion of
H3 provides benefits by broadening the elicited response,
increasing the likelihood of cross-protective immunity, and
inducing antibodies capable of neutralizing both MPXV and
VACV in the presence of complement proteins.
The antigen-specific immunity needed for protection from or-
thopoxvirus disease varied depending on the challenge system
used. Both EV antigens, A35 and B6, and the MV antigen M1 pro-
vided complete protection from lethality in the VACV IN chal-
lenge of BALB/c mice. However, immunization with A35 and
B6 provided only minimal protection in the MPXV challenge of
CAST/Ei mice. The reduced efficacy of EV immunization in
CAST/Ei mice may reflect differences in pathogenesis between
VACV and MPXV or perhaps differences in baseline immune pro-
files between CAST/Ei and BALB/c mice. CAST/Ei mice are
moderately deficient in IFN-g production and have a reduced
representation of NK cells,44–46 potentially impacting protective
effector functions like antibody-dependent cellular cytotoxicity
(ADCC) relevant for immunity to EVs.47 Regardless, our findings
in each mouse model collectively support the inclusion of both
EV and MV targets for optimal protection. Additionally, these
data illustrate the value of using multiple challenge systems
when evaluating vaccine efficacy pre-clinically.
The best model for human orthopoxvirus disease is thought to
be the clade I MPXV challenge of macaques, recapitulating many
aspects of human smallpox and mpox disease including the
development of lesions across the body. Our lethal clade I
MPXV challenge study in cynomolgus macaques was a stringent
test of BNT166a efficacy. Not only were robust immune re-
sponses observed to the BNT166-encoded antigens and
100% protection from death observed following challenge, but
excellent control of the development of lesions was also
observed. These results exceeded expectations set by the per-
formance of current generation VACV-derivative vaccines in pre-
vious studies.24,48 Therefore, we believe these results most
clearly illustrate the potential for BNT166 mitigation of orthopox-
virus disease.
Two independent outbreaks of human-to-human MPXV trans-
mission in 2022–2023 revealed an unexpected need for rapidly
scalable orthopoxvirus vaccines. We demonstrate here that a
multivalent mRNA vaccine, BNT166, has the potential to fulfill
this need. Clinical evaluation of BNT166 is underway with a
phase I/II clinical trial (NCT05988203) investigating the safety
and immunogenicity of the vaccine, with the aim that in the
future, it could reduce ongoing transmission by increasing vac-
cine availability and serve as an outbreak preparedness measure
for a safe and effective vaccine.
Limitations of the study
While BNT166 induces GC formation, a correlate of durable im-
munity, the durability of immune responses elicited by BNT166
was not directly evaluated. Assessment of the durability of
1370 Cell 187, 1363–1373, March 14, 2024
Short article
mRNA-vaccine-induced immune responses in humans is of in-
terest for future work.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d RESOURCE AVAILABILITY
B Lead contact
B Materials availability
B Data and code availability
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Cells
B Viruses
B Mice
B Rats
B Monkeys
d METHOD DETAILS
B Vaccine design and composition
B Measurement of in vitro expression of BNT166 anti-
gens by flow cytometry
B Recombinant protein production
B MPXV antigen ELISA (mouse and rat serum samples)
B MPXV PRNT (mouse samples)
B VACV focus reduction neutralization test (FRNT)
B Measurement of germinal center induction by flow
cytometry
B MPXV antigen ELISpot (mouse splenocytes)
B Rodent studies
B Mouse lung TCID50 assay
B Macaque clade I MPXV challenge study
B MPXV antigen ELISA (NHP serum samples)
B NHP viral load determination by real-time quantitative
PCR (qPCR)
B NHP MPXV PRNT
B NHP histology
ACKNOWLEDGMENTS
We are grateful to the BioNTech SE team for their contributions to BNT166. We
especially thank Daniel Kallin, Coral Moretti, Madeline Worob, Alyssa Kruithof,
Ryan Cruse, Madison Russo, Ella Gildersleeve, and Jihui Che for peptide syn-
thesis and manufacturing; Yiling Qiu for flow cytometry support; Roman Röse-
mann and Janina Caesar for their support with the rat immunogenicity study;
Daniel Cui Zhou and John Welle from Acumen Medical Communications for
graphic design support; and our colleagues at BioModels, LLC, BIOQUAL,
Inc., Nexelis Laboratories, and Southern Research for their support. BNT166
is sponsored by BioNTech SE, and the clinical trials are being funded in part
by The Coalition for Epidemic Preparedness Innovations (CEPI).
AUTHOR CONTRIBUTIONS
Conceptualization, U.S., A.P., A.Z., and C.D.; methodology, A.Z., C.D., N.D.S.,
G.M.P., S.S., S.K., B.C., A.G., C.L., D.A.R., H.D., A.W., and L.M.S.; investiga-
tion, A.Z., C.D., N.D.S., M.M., Y.L., G.M.P., A.D., R.S.V., K.S., S.S., S.K., B.C.,
D.A.R., and H.D.; data curation, A.P., A.Z., C.D., G.M.P., J.R.S., D.A.R., and
H.D.; writing – original draft, A.P. and A.Z.; writing – review & editing and super-
vision, U.S., A.P., R.B.G., O.T., J.R.S., T.A., R.v.d.M., L.M.S., A.V., and F.M.

Short article
DECLARATION OF INTERESTS
U.S. and O.T. are management board members and employees at BioNTech
SE. R.B.G. serves on the Board of Directors for Alkermes PLC, Infinity Pharma-
ceuticals, and Zai Laboratory; serves on the Scientific Advisory Board for Leap
Therapeutics; is a consultant for Third Rock Ventures; and is a stockholder and
employee of BioNTech US. B.C. and S.K. are employees of Bioqual, Inc. S.S. is
an employee of Southern Research. A.Z., C.L.D., N.D.S., M.M., Y.J.L., G.M.P.,
A.D., R.S.V., K.S., A.G., C.L., D.A.R., H.D., A.C.W., T.A.A., F.M., A.B.V., L.M.S.,
R.v.d.M., J.R.S., and A.P. are current/past employees of BioNTech SE/Bio-
NTech US, are stockholders, and/or are inventors on patents and patent appli-
cations related to RNA vaccines.
Received: October 4, 2023
Revised: November 13, 2023
Accepted: January 12, 2024
Published: February 15, 2024
REFERENCES
1. Gessain, A., Nakoune, E., and Yazdanpanah, Y. (2022). N. Engl. J. Med.
387, 1783–1793. https://doi.org/10.1056/NEJMra2208860.
2. Thornhill, J.P., Barkati, S., Walmsley, S., Rockstroh, J., Antinori, A., Harri-
son, L.B., Palich, R., Nori, A., Reeves, I., Habibi, M.S., et al. (2022). Mon-
keypox Virus Infection in Humans across 16 Countries - April-June 2022.
N. Engl. J. Med. 387, 679–691. https://doi.org/10.1056/NEJMoa2207323.
3. Nuzzo, J.B., Borio, L.L., and Gostin, L.O. (2022). The WHO Declaration of
Monkeypox as a Global Public Health Emergency. JAMA 328, 615–617.
https://doi.org/10.1001/jama.2022.12513.
4. Ghebreyesus, T.A. (2023). Fifth Meeting of the International Health Regu-
lations (2005) (IHR) Emergency Committee on the Multi-Country Outbreak
of Mpox (Monkeypox). https://www.who.int/news/item/11-05-2023-fifth-
meeting-of-the-international-health-regulations-(2005)-(ihr)-emergency-
committee-on-the-multi-country-outbreak-of-monkeypox-(mpox.
5. Organization, W.H. (2023). Disease Outbreak News; Mpox (Monkeypox) in
the Democratic Republic of the Congo. Available at: https://www.who.int/
emergencies/disease-outbreak-news/item/2023-DON493
6. Kibungu, E.M., Vakaniaki, E.H., Kinganda-Lusamaki, E., Kalonji-Mukendi,
T., Pukuta, E., Hoff, N.A., Bogoch, I.I., Cevik, M., Gonsalves, G.S., Hens-
ley, L.E., et al. (2024). Clade I-Associated Mpox Cases Associated with
Sexual Contact, the Democratic Republic of the Congo. Emerg. Infect.
Dis. 30, 172–176. https://doi.org/10.3201/eid3001.231164.
7. Bunge, E.M., Hoet, B., Chen, L., Lienert, F., Weidenthaler, H., Baer, L.R.,
and Steffen, R. (2022). The changing epidemiology of human
monkeypox-A potential threat? A systematic review. PLoS Negl. Trop.
Dis. 16, e0010141. https://doi.org/10.1371/journal.pntd.0010141.
8. Americo, J.L., Earl, P.L., and Moss, B. (2023). Virulence differences of
mpox (monkeypox) virus clades I, IIa, and IIb.1 in a small animal model.
Proc. Natl. Acad. Sci. USA 120, e2220415120. https://doi.org/10.1073/
pnas.2220415120.
9. Amanna, I.J., Carlson, N.E., and Slifka, M.K. (2007). Duration of humoral
immunity to common viral and vaccine antigens. N. Engl. J. Med. 357,
1903–1915. https://doi.org/10.1056/NEJMoa066092.
10. Hammarlund, E., Lewis, M.W., Carter, S.V., Amanna, I., Hansen, S.G.,
Strelow, L.I., Wong, S.W., Yoshihara, P., Hanifin, J.M., and Slifka, M.K.
(2005). Multiple diagnostic techniques identify previously vaccinated indi-
viduals with protective immunity against monkeypox. Nat. Med. 11, 1005–
1011. https://doi.org/10.1038/nm1273.
11. Nalca, A., and Zumbrun, E.E. (2010). ACAM2000: the new smallpox vac-
cine for United States Strategic National Stockpile. Drug Des. Devel.
Ther. 4, 71–79. https://doi.org/10.2147/dddt.s3687.
12. Beachkofsky, T.M., Carrizales, S.C., Bidinger, J.J., Hrncir, D.E., Whitte-
more, D.E., and Hivnor, C.M. (2010). Adverse events following smallpox
ll
OPEN ACCESS
vaccination with ACAM2000 in a military population. Arch. Dermatol.
146, 656–661. https://doi.org/10.1001/archdermatol.2010.46.
13. Overton, E.T., Lawrence, S.J., Wagner, E., Nopora, K., Rösch, S., Young,
P., Schmidt, D., Kreusel, C., De Carli, S., Meyer, T.P., et al. (2018). Immu-
nogenicity and safety of three consecutive production lots of the non repli-
cating smallpox vaccine MVA: A randomised, double blind, placebo
controlled phase III trial. PLoS One 13, e0195897. https://doi.org/10.
1371/journal.pone.0195897.
14. Turner Overton, E., Schmidt, D., Vidojkovic, S., Menius, E., Nopora, K.,
Maclennan, J., and Weidenthaler, H. (2023). A randomized phase 3 trial
to assess the immunogenicity and safety of 3 consecutively produced
lots of freeze-dried MVA-BN(R) vaccine in healthy adults. Vaccine 41,
397–406. https://doi.org/10.1016/j.vaccine.2022.10.056.
15. Zaeck, L.M., Lamers, M.M., Verstrepen, B.E., Bestebroer, T.M., van
Royen, M.E., Götz, H., Shamier, M.C., van Leeuwen, L.P.M., Schmitz,
K.S., Alblas, K., et al. (2023). Low levels of monkeypox virus-neutralizing
antibodies after MVA-BN vaccination in healthy individuals. Nat. Med.
29, 270–278. https://doi.org/10.1038/s41591-022-02090-w.
16. Deputy, N.P., Deckert, J., Chard, A.N., Sandberg, N., Moulia, D.L., Bark-
ley, E., Dalton, A.F., Sweet, C., Cohn, A.C., Little, D.R., et al. (2023). Vac-
cine Effectiveness of JYNNEOS against Mpox Disease in the United
States. N. Engl. J. Med. 388, 2434–2443. https://doi.org/10.1056/
NEJMoa2215201.
17. Ilchmann, H., Samy, N., Reichhardt, D., Schmidt, D., Powell, J.D., Meyer,
T.P.H., Silbernagl, G., Nichols, R., Weidenthaler, H., De Moerlooze, L.,
et al. (2023). One- and Two-Dose Vaccinations With Modified Vaccinia
Ankara-Bavarian Nordic Induce Durable B-Cell Memory Responses Com-
parable to Replicating Smallpox Vaccines. J. Infect. Dis. 227, 1203–1213.
https://doi.org/10.1093/infdis/jiac455.
18. Lamb, R.A.P., and Griffith, D. (2007). Paramyxoviridae: the viruses and
their replication. In Fields virology, Fifth Edition, D.N.K.B.N. Fields and
P.M. Howley, eds. (Lippincott, Williams, and Wilkins), pp. 1449–1496.
19. Hooper, J.W., Custer, D.M., and Thompson, E. (2003). Four-gene-combi-
nation DNA vaccine protects mice against a lethal vaccinia virus challenge
and elicits appropriate antibody responses in nonhuman primates.
Virology 306, 181–195. https://doi.org/10.1016/s0042-6822(02)00038-7.
20. Golden, J.W., Zaitseva, M., Kapnick, S., Fisher, R.W., Mikolajczyk, M.G.,
Ballantyne, J., Golding, H., and Hooper, J.W. (2011). Polyclonal antibody
cocktails generated using DNA vaccine technology protect in murine
models of orthopoxvirus disease. Virol. J. 8, 441. https://doi.org/10.
1186/1743-422X-8-441.
21. Gilchuk, I., Gilchuk, P., Sapparapu, G., Lampley, R., Singh, V., Kose, N.,
Blum, D.L., Hughes, L.J., Satheshkumar, P.S., Townsend, M.B., et al.
(2016). Cross-Neutralizing and Protective Human Antibody Specificities
to Poxvirus Infections. Cell 167, 684–694.e9. https://doi.org/10.1016/j.
cell.2016.09.049.
22. Davies, D.H., McCausland, M.M., Valdez, C., Huynh, D., Hernandez, J.E.,
Mu, Y., Hirst, S., Villarreal, L., Felgner, P.L., and Crotty, S. (2005). Vaccinia
virus H3L envelope protein is a major target of neutralizing antibodies in
humans and elicits protection against lethal challenge in mice. J. Virol.
79, 11724–11733. https://doi.org/10.1128/JVI.79.18.11724-11733.2005.
23. Fogg, C., Lustig, S., Whitbeck, J.C., Eisenberg, R.J., Cohen, G.H., and
Moss, B. (2004). Protective immunity to vaccinia virus induced by vaccina-
tion with multiple recombinant outer membrane proteins of intracellular
and extracellular virions. J. Virol. 78, 10230–10237. https://doi.org/10.
1128/JVI.78.19.10230-10237.2004.
24. Golden, J.W., Josleyn, M., Mucker, E.M., Hung, C.F., Loudon, P.T., Wu,
T.C., and Hooper, J.W. (2012). Side-by-side comparison of gene-based
smallpox vaccine with MVA in nonhuman primates. PLoS One 7,
e42353. https://doi.org/10.1371/journal.pone.0042353.
25. Buchman, G.W., Cohen, M.E., Xiao, Y., Richardson-Harman, N., Silvera,
P., DeTolla, L.J., Davis, H.L., Eisenberg, R.J., Cohen, G.H., and Isaacs,
S.N. (2010). A protein-based smallpox vaccine protects non-human
Cell 187, 1363–1373, March 14, 2024 1371
 ll
OPEN ACCESS
primates from a lethal monkeypox virus challenge. Vaccine 28, 6627–
6636. https://doi.org/10.1016/j.vaccine.2010.07.030.
26. Turner, J.S., O’Halloran, J.A., Kalaidina, E., Kim, W., Schmitz, A.J., Zhou,
J.Q., Lei, T., Thapa, M., Chen, R.E., Case, J.B., et al. (2021). SARS-CoV-2
mRNA vaccines induce persistent human germinal centre responses. Na-
ture 596, 109–113. https://doi.org/10.1038/s41586-021-03738-2.
27. Benhnia, M.R.E.I., McCausland, M.M., Moyron, J., Laudenslager, J.,
Granger, S., Rickert, S., Koriazova, L., Kubo, R., Kato, S., and Crotty, S.
(2009). Vaccinia virus extracellular enveloped virion neutralization in vitro
and protection in vivo depend on complement. J. Virol. 83, 1201–1215.
https://doi.org/10.1128/JVI.01797-08.
28. Moss, B. (2011). Smallpox vaccines: targets of protective immunity. Immu-
nol. Rev. 239, 8–26. https://doi.org/10.1111/j.1600-065X.2010.00975.x.
29. Americo, J.L., Sood, C.L., Cotter, C.A., Vogel, J.L., Kristie, T.M., Moss, B.,
and Earl, P.L. (2014). Susceptibility of the wild-derived inbred CAST/Ei
mouse to infection by orthopoxviruses analyzed by live bioluminescence im-
aging. Virology 449, 120–132. https://doi.org/10.1016/j.virol.2013.11.017.
30. Americo, J.L., Moss, B., and Earl, P.L. (2010). Identification of wild-derived
inbred mouse strains highly susceptible to monkeypox virus infection for
use as small animal models. J. Virol. 84, 8172–8180. https://doi.org/10.
1128/JVI.00621-10.
31. Warner, B.M., Klassen, L., Sloan, A., Deschambault, Y., Soule, G., Bana-
dyga, L., Cao, J., Strong, J.E., Kobasa, D., and Safronetz, D. (2022). In vitro
and in vivo efficacy of tecovirimat against a recently emerged 2022 mon-
keypox virus isolate. Sci. Transl. Med. 14, eade7646. https://doi.org/10.
1126/scitranslmed.ade7646.
32. Townsend, M.B., Keckler, M.S., Patel, N., Davies, D.H., Felgner, P.,
Damon, I.K., and Karem, K.L. (2013). Humoral immunity to smallpox vac-
cines and monkeypox virus challenge: proteomic assessment and clinical
correlations. J. Virol. 87, 900–911. https://doi.org/10.1128/JVI.02089-12.
33. Otter, A.D., Jones, S., Hicks, B., Bailey, D., Callaby, H., Houlihan, C., Ram-
pling, T., Gordon, N.C., Selman, H., Satheshkumar, P.S., et al. (2023).
Monkeypox virus-infected individuals mount comparable humoral im-
mune responses as Smallpox-vaccinated individuals. Nat. Commun. 14,
5948. https://doi.org/10.1038/s41467-023-41587-x.
34. Freyn, A.W., Atyeo, C., Earl, P.L., Americo, J.L., Chuang, G.Y., Natarajan,
H., Frey, T.R., Gall, J.G., Moliva, J.I., Hunegnaw, R., et al. (2023). An mpox
virus mRNA-lipid nanoparticle vaccine confers protection against lethal
orthopoxviral challenge. Sci. Transl. Med. 15, eadg3540. https://doi.org/
10.1126/scitranslmed.adg3540.
35. Yang, X., Hu, C., Yang, X., Yang, X., Hu, X., Wang, X., Liu, C., Yuan, Y., Du,
S., Wang, P.G., and Lin, J. (2023). Evaluation and comparison of immune
responses induced by two Mpox mRNA vaccine candidates in mice.
J. Med. Virol. 95, e29140. https://doi.org/10.1002/jmv.29140.
36. Hou, F., Zhang, Y., Liu, X., Murad, Y.M., Xu, J., Yu, Z., Hua, X., Song, Y.,
Ding, J., Huang, H., et al. (2023). mRNA vaccines encoding fusion proteins
of monkeypox virus antigens protect mice from vaccinia virus challenge.
Nat. Commun. 14, 5925. https://doi.org/10.1038/s41467-023-41628-5.
37. Sang, Y., Zhang, Z., Liu, F., Lu, H., Yu, C., Sun, H., Long, J., Cao, Y., Mai,
J., Miao, Y., et al. (2023). Monkeypox virus quadrivalent mRNA vaccine in-
duces immune response and protects against vaccinia virus. Signal Trans-
duct. Target. Ther. 8, 172. https://doi.org/10.1038/s41392-023-01432-5.
38. Zeng, J., Li, Y., Jiang, L., Luo, L., Wang, Y., Wang, H., Han, X., Zhao, J., Gu,
G., Fang, M., et al. (2023). Mpox multi-antigen mRNA vaccine candidates
by a simplified manufacturing strategy afford efficient protection against
lethal orthopoxvirus challenge. Emerg. Microbes Infect. 12, 2204151.
https://doi.org/10.1080/22221751.2023.2204151.
39. Zhang, R.R., Wang, Z.J., Zhu, Y.L., Tang, W., Zhou, C., Zhao, S.Q., Wu,
M., Ming, T., Deng, Y.Q., Chen, Q., et al. (2023). Rational development
of multicomponent mRNA vaccine candidates against mpox. Emerg. Mi-
crobes Infect. 12, 2192815. https://doi.org/10.1080/22221751.2023.
2192815.
1372 Cell 187, 1363–1373, March 14, 2024
Short article
40. Fang, Z., Monteiro, V.S., Renauer, P.A., Shang, X., Suzuki, K., Ling, X., Bai,
M., Xiang, Y., Levchenko, A., Booth, C.J., et al. (2023). Polyvalent mRNA
vaccination elicited potent immune response to monkeypox virus surface an-
tigens. Cell Res. 33, 407–410. https://doi.org/10.1038/s41422-023-00792-5.
41. Lustig, S., Fogg, C., Whitbeck, J.C., Eisenberg, R.J., Cohen, G.H., and
Moss, B. (2005). Combinations of polyclonal or monoclonal antibodies
to proteins of the outer membranes of the two infectious forms of vaccinia
virus protect mice against a lethal respiratory challenge. J. Virol. 79,
13454–13462. https://doi.org/10.1128/JVI.79.21.13454-13462.2005.
42. Crickard, L., Babas, T., Seth, S., Silvera, P., Koriazova, L., and Crotty, S.
(2012). Protection of rabbits and immunodeficient mice against lethal
poxvirus infections by human monoclonal antibodies. PLoS One 7,
e48706. https://doi.org/10.1371/journal.pone.0048706.
43. Golden, J.W., Josleyn, M.D., and Hooper, J.W. (2008). Targeting the
vaccinia virus L1 protein to the cell surface enhances production of
neutralizing antibodies. Vaccine 26, 3507–3515. https://doi.org/10.1016/
j.vaccine.2008.04.017.
44. Earl, P.L., Americo, J.L., and Moss, B. (2020). Natural killer cells expanded
in vivo or ex vivo with IL-15 overcomes the inherent susceptibility of CAST
mice to lethal infection with orthopoxviruses. PLoS Pathog. 16, e1008505.
https://doi.org/10.1371/journal.ppat.1008505.
45. Earl, P.L., Americo, J.L., and Moss, B. (2012). Lethal monkeypox virus
infection of CAST/EiJ mice is associated with a deficient gamma interferon
response. J. Virol. 86, 9105–9112. https://doi.org/10.1128/JVI.00162-12.
46. Earl, P.L., Americo, J.L., and Moss, B. (2017). Insufficient Innate Immunity
Contributes to the Susceptibility of the Castaneous Mouse to Orthopoxvi-
rus Infection. J. Virol. 91, e01042-17. https://doi.org/10.1128/JVI.
01042-17.
47. Cohen, M.E., Xiao, Y., Eisenberg, R.J., Cohen, G.H., and Isaacs, S.N.
(2011). Antibody against extracellular vaccinia virus (EV) protects mice
through complement and Fc receptors. PLoS One 6, e20597. https://
doi.org/10.1371/journal.pone.0020597.
48. Earl, P.L., Americo, J.L., Wyatt, L.S., Eller, L.A., Whitbeck, J.C., Cohen,
G.H., Eisenberg, R.J., Hartmann, C.J., Jackson, D.L., Kulesh, D.A., et al.
(2004). Immunogenicity of a highly attenuated MVA smallpox vaccine
and protection against monkeypox. Nature 428, 182–185. https://doi.
org/10.1038/nature02331.
49. Su, H.P., Singh, K., Gittis, A.G., and Garboczi, D.N. (2010). The structure of
the poxvirus A33 protein reveals a dimer of unique C-type lectin-like do-
mains. J. Virol. 84, 2502–2510. https://doi.org/10.1128/JVI.02247-09.
50. Su, H.P., Garman, S.C., Allison, T.J., Fogg, C., Moss, B., and Garboczi,
D.N. (2005). The 1.51-Angstrom structure of the poxvirus L1 protein, a
target of potent neutralizing antibodies. Proc. Natl. Acad. Sci. USA 102,
4240–4245. https://doi.org/10.1073/pnas.0501103102.
51. da Fonseca, F.G., Wolffe, E.J., Weisberg, A., and Moss, B. (2000). Charac-
terization of the vaccinia virus H3L envelope protein: topology and post-
translational membrane insertion via the C-terminal hydrophobic tail.
J. Virol. 74, 7508–7517. https://doi.org/10.1128/jvi.74.16.7508-7517.2000.
52. Singh, K., Gittis, A.G., Gitti, R.K., Ostazeski, S.A., Su, H.P., and Garboczi,
D.N. (2016). The Vaccinia Virus H3 Envelope Protein, a Major Target of
Neutralizing Antibodies, Exhibits a Glycosyltransferase Fold and Binds
UDP-Glucose. J. Virol. 90, 5020–5030. https://doi.org/10.1128/JVI.
02933-15.
53. Husain, M., Weisberg, A.S., and Moss, B. (2006). Existence of an operative
pathway from the endoplasmic reticulum to the immature poxvirus mem-
brane. Proc. Natl. Acad. Sci. USA 103, 19506–19511. https://doi.org/10.
1073/pnas.0609406103.
54. Isidro, J., Borges, V., Pinto, M., Ferreira, R., Sobral, D., Nunes, A., Santos,
J.D., Mixão, V., Santos, D., Duarte, S., et al. (2022). Multi-country outbreak
of Monkeypox virus: genetic divergence and first signs of microevolution.
https://virological.org/t/multi-country-outbreak-of-monkeypox-virus-
genetic-divergence-and-first-signs-of-microevolution/806/1.

Short article
55. Selhorst, P., Rezende, A.M., Block, T.d., Coppens, S., Smet, H., Mariën, J.,
Hauner, A., Brosius, I., Liesenborghs, L., Bottieau, E., et al. (2022). Belgian
Case of Monkeypox Virus Linked to Outbreak in Portugal. https://
virological.org/t/belgian-case-of-monkeypox-virus-linked-to-outbreak-in-
portugal/801/6.
56. Antwerpen, M.H., Lang, D., Zange, S., Walter, M.C., and Wölfel, R. (2022),
First German genome sequence of Monkeypox virus associated to
multi-country outbreak in May 2022. https://virological.org/t/first-german-
genome-sequence-of-monkeypox-virus-associated-to-multi-country-
outbreak-in-may-2022/812.
ll
OPEN ACCESS
57. Sahin, U., Muik, A., Derhovanessian, E., Vogler, I., Kranz, L.M., Vormehr,
M., Baum, A., Pascal, K., Quandt, J., Maurus, D., et al. (2020). COVID-
19 vaccine BNT162b1 elicits human antibody and T(H)1 T cell responses.
Nature 586, 594–599. https://doi.org/10.1038/s41586-020-2814-7.
58. Kulesh, D.A., Loveless, B.M., Norwood, D., Garrison, J., Whitehouse, C.A.,
Hartmann, C., Mucker, E., Miller, D., Wasieloski, L.P., Jr., Huggins, J., et al.
(2004). Monkeypox virus detection in rodents using real-time 3’-minor
groove binder TaqMan assays on the Roche LightCycler. Lab. Invest.
84, 1200–1208. https://doi.org/10.1038/labinvest.3700143.
Cell 187, 1363–1373, March 14, 2024 1373
 ll
OPEN ACCESS Short article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Monkeypox Virus A35R Monoclonal ProteoGenix SAS PTX18825-100
antibody (clone SAA0287)
Anti-Monkeypox Virus (Clone: MPXV-13) Leinco Technologies, Inc. LT555
Monkeypox virus M1R Monoconal ProteoGenix SAS PTX18822-100
antibody (SAA0284)
Monkeypox virus H3L Monoconal ProteoGenix SAS PTX18820-100
antibody (SAA0282)
Alexa Fluor 647 AffiniPure Jackson Immunoresearch 109-605-003; RRID: AB_2337880
Goat Anti-human IgG (H + L)
Alexa Fluor 647 AffiniPure Jackson Immunoresearch 715-605-150; RRID: AB_2340862
Donkey Anti-Mouse IgG (H + L)
Anti-Mouse IgG, Fcg specific, HRP Jackson ImmunoResearch 115-035-071; RRID: AB_2338506
Mouse IgG-UNLB Southern Biotech 0107–01; RRID: AB_2732898
Brilliant Violet 605 anti-mouse CD19 (clone 6D5) Biolegend 115539; RRID: AB_11203538
Brilliant Violet 785 anti-mouse/human Biolegend 103245; RRID: AB_2563256
CD45R/B220 (clone RA3-6B2)
PE/Cyanine7 anti-mouse CD95 (clone SA367H8) Biolegend 152617; RRID: AB_2910313
FITC anti-mouse/human GL7 Antigen (clone GL7) Biolegend 144603; RRID: AB_2561697
PE anti-DYKDDDDK Tag (clone L5) Biolegend 637309; RRID: AB_2563148
APC anti-DYKDDDDK Tag (clone L5) Biolegend 637307; RRID: AB_2561497
Brilliant Violet 421 anti-mouse CD11c (clone N418) Biolegend 117329; RRID: AB_10897814
Brilliant Violet 421 anti-mouse F4/80 (clone BM8) Biolegend 123131; RRID: AB_2563102
Brilliant Violet 421 anti-mouse CD4 (clone GK1.5) Biolegend 100437; RRID: AB_11203718
Brilliant Violet 421 anti-mouse CD8a (clone 53-6.7) Biolegend 100737; RRID: AB_2562558
Brilliant Violet 421 anti-mouse Biolegend 108433; RRID: AB_2562903
Ly-6G/Ly-6C (Gr-1) (clone RB6-8C5)
Goat a-Monkey IgG (H + L)-HRP ThermoFisher PA184631; RRID: AB_933605
Bacteria and virus strains
Clade IIb monkeypox virus BEI Resources NR-58622
(hMPXV/USA/MA001/2022)
Clade I monkeypox virus (Zaire 79/V79-I-005) BEI Resources NR-21738
Vaccinia virus Western Reserve BEI Resources NR-56
Vaccinia virus (tissue culture adapted) ATCC VR-1354
Critical commercial assays
ELISpot SixPak, Mouse IFN-g R&D Systems XEL485 (P352798)
Chemicals, peptides, and recombinant proteins
Fixable Viability Dye eFluor 450 eBioscience 65-0863-14
Fixation Buffer Biolegend 420801
Permeabilization Buffer (103) eBioscience 00-8333-56
Physiological Saline [Sodium Innaxon/AdipoGen IAX-900-003
ELISAChloride 0.9%] Endotoxin-free
Casein blocking buffer Sigma-Aldrich B6429
1-Step TMB ELISA Substrate Solution Thermo Fisher Scientific 34029
Crystal violet Sigma Aldrich HT90132-1L
(Continued on next page)

e1 Cell 187, 1363–1373.e1–e7, March 14, 2024

 ll
Short article OPEN ACCESS

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Baby rabbit complement Cedarlane CL3441
ExpiFectamine293 kit ThermoFisher A14525
Ni-sepharose Excel beads Cytiva 17371201
MPXV M1(residues 1–185) This paper NA
MPXV A35(residues 58–181) This paper NA
MPXV B6(residues 20–279) This paper NA
MPXV H3(residues 1–282) This paper NA
LIVE/DEAD Fixable Near-IR Life Technologies L10119
Dead Cell Stain Kit
SuperBlock Blocking Buffer Thermo Scientific 37516
Experimental models: cell lines
Vero ATCC CRL-1586; RRID: CVCL_0574
Expi293F ThermoFisher A14527; RRID: CVCL_D615
HEK293T ATCC CRL-1573; RRID: CVCL_0045
Vero E6-TMPRSS2-T2A-ACE2 cells BEI Resources NR-58622
Experimental models: organisms/strains
BALB/c Taconic Biosciences BALB/cAnNTac; RRID: IMSR_TAC:BALB
BALB/c Jackson Laboratory 000651, BALB/cJ; RRID: IMSR_JAX:000651
BALB/c Envigo BALB/cAnNHsd; RRID: IMSR_ENV:HSD-047
CAST/Ei Jackson Laboratory 000928, CAST/EiJ; RRID: IMSR_JAX:000928
Wistar Rats Janvier Labs RjHan:WI
Cynomolgus macaques (Macaca fascicularis) PrimGen N/A
Software and algorithms
Flowjo BD Version 10.8.1
GraphPad Prism GraphPad Software, LLC Version 9.3.1
PyMOL Schrodinger Version 2.5.5
ImmunoCapture ImmunoSpot Version 7.0.13.1
ImmunoSpot analysis software ImmunoSpot version 7.0.26.0

RESOURCE AVAILABILITY

Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Asaf Poran
(asaf.poran@biontech.us).

Materials availability
There are restrictions to the availability of the DNA/mRNA constructs presented in the study, subject to completion of a material trans-
fer agreement.

Data and code availability

d All data reported in this paper will be shared by the lead contact upon request.
d This paper does not report original code.
d Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cells
Vero and HEK293T cells were obtained from the American Type Culture Collection (ATCC). Expi293F cells were obtained from Ther-
mofisher. Vero E6-TMPRSS2-T2A-ACE2 cells were obtained from Biodefense and Emerging Infections Research Resources Repos-
itory (BEI Resources).

Cell 187, 1363–1373.e1–e7, March 14, 2024 e2

 ll
OPEN ACCESS Short article

Viruses
Clade IIb monkeypox virus (hMPXV/USA/MA001/2022), Clade I monkeypox Virus (Zaire 79/V79-I-005) and Vaccinia virus Western
Reserve were obtained from BEI Resources. Tissue culture adapted vaccinia virus was obtained from ATCC. Virus stocks were either
used directly from supplier stocks or propagated and titered in Vero cells prior to use.

Mice
Studies in mice were conducted at multiple sites: Biomodels LLC (Waltham, MA), Bioqual (Rockville, MD), and Nexelis Laboratories Can-
ada Inc. (Laval, QC). Housing and care of mice conformed to the standards of the Association for Assessment and Accreditation of Lab-
oratory Animal Care (AAALAC). The Institutional Animal Care and Use Committees (IACUC) of Bioqual Inc. reviewed and approved MPXV
and VACV challenge protocols (protocol numbers 22-114P and 23-054P). The IACUC of Biomodels, Inc. reviewed the protocols for
BALB/c immunogenicity studies (protocol number 22-0624-1). CAST/EiJ mice were obtained from Jackson Laboratory. BALB/c mice
were obtained either from Jackson Laboratory (BALB/cJ), Taconic Biosciences (BALB/cAnNTac), or Envigo RMS LLC (BALB/cAnNHsd).

Rats
Wistar Rats were obtained from Janvier Labs at the age of 7 weeks and body weight of approximately 200g and housed at the animal
facility of BioNTech SE (Munich). Rats were used for the study after approximately 1 week of acclimatization. The study was approved
by the local authority (Regierung von Oberbayern) and was performed in strict accordance with the German Animal Welfare Act and
German regulations (Tierschutzgesetz – TierSchG. Verordnung zum Schutz von zu Versuchszwecken oder zu anderen wissenschaft-
lichen Zwecken verwendeten Tieren – TierSchVersV), the European guidelines for the care and use of laboratory animals (Directive
2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific
purposes), the recommendations of the German Society of Laboratory Animal Science (GV-SOLAS), and the Federation of European
Laboratory Animal Science Associations (FELASA).

Monkeys
Cynomolgus macaques were purchased from PrimGen for studies conducted at Southern Research (Birmingham, AL). Southern
Research Institute is fully accredited by AAALAC International and animal care complied with the Guide for the Care and Use of Lab-
oratory Animals, 8th Edition. The study protocol was reviewed and approved by the Southern Research IACUC (protocol number 23-
05-012B).

METHOD DETAILS

Vaccine design and composition

WT amino acid sequences for A35, B6, M1 and H3 were used for the BNT166 mRNA-encoded open reading frames. A35 is a type II
integral membrane protein consisting of a disulfide-bonded homodimer with a C-terminal ectodomain and an N-terminal transmem-
brane domain.49 B6, M1 and H3 are type I integral membrane proteins with N-terminal ectodomains and C-terminal transmembrane
helices.50–52 Both A35 and B6 mRNAs use fully wildtype (WT) viral sequences derived from early cases in the 2022 outbreak, which
include the native signal peptide of these proteins. WT versions of A35 and B6 are expected to traffic to the cell surface in mRNA-
transfected cells. WT versions of the MV targets M1 and H3, are not efficiently delivered to the endoplasmic reticulum for eventual
transit to the plasma membrane.43 During viral replication, embedding of MV proteins into the MV envelope is distinct from the normal
host cell biosynthesis pathway for integral membrane proteins and they lack native signal peptides.53 A signal peptide from the Her-
pes Simplex Virus 1 gD protein was therefore added to the N-termini of WT M1 and H3 to facilitate the correct trafficking for cell sur-
face display. In Figure 1A, the B6 structure is predicted by AlphaFold. The A35, M1 and H3 structures are of the VACV orthologs (Pro-
tein DataBank [PDB] IDs 3K7B, 2I9L, and 5EJ0).
Clade IIb MPXV WT sequences from May 2022 – including US isolate MPXV_USA_2022_MA001, Portugal isolates,54 Belgium iso-
lates55 (GenBank: ON622712.1), and German isolate56 were aligned to the closest known reference sequence GenBank: MT903345.
For all 2022 sequences, the antigens A35, B6, M1, and H3 have 100% identity to the reference sequence; the consensus WT
sequence therefore corresponded exactly to the reference strain. BNT166 vaccines use the same RNA platform including perfor-
mance-optimizing backbone design, nucleoside-modified chemistry, and lipid nanoparticle (LNP) formulation as BNT162b2.57

Measurement of in vitro expression of BNT166 antigens by flow cytometry

HEK293T cells were seeded in DMEM supplemented with 10% FBS in 12-well plates with a cell density of 4 3 105 cells/well 6 h prior
to transfection. For transfection, LNP-formulated RNA was diluted to 200 ng total RNA in 100 mL Opti-MEM for individual constructs,
and 200 ng per construct for the combinations (BNT166a and c). RNA and Opti-MEM mixture was then added directly to the cells
(100 mL/well). The plate was gently mixed and centrifuged at 500 3 g for 5 min at room temperature before incubating at 37
C
and 5% CO2 for 18 h. Following the incubation, cells were prepared for subsequent FACS analysis. Culture media was removed
from the 12-well plates and the cells were gently liberated from the plate surface by pipetting in cold DPBS. Each sample was
then split into two, with one-half used for detection of total protein and the other for surface protein (by fixing and permeabilizing
or fixing alone, respectively).

e3 Cell 187, 1363–1373.e1–e7, March 14, 2024

 ll
Short article OPEN ACCESS

For total protein detection, cells were transferred to a 96-well plate and stained with 50 mL Fixable Viability Dye eFluor 450 diluted
1:500 in DPBS for 15 min at room temperature. Cells were then washed with FACS buffer (13 DPBS, 1% BSA, 5 mM EDTA), centri-
fuged at 300 3 g for 5 min at 4
C and fixed with 100 mL Fixation Buffer for 12 min at room temperature. Following fixation, cells were
washed with 13 Permeabilization Buffer, centrifuged at 500 3 g for 5 min at 4
C and stained with an appropriate primary antibody
diluted in Permeabilization Buffer. Afterward, cells were washed twice with 13 Permeabilization Buffer, centrifuged at 500 3 g for
5 min at 4
C, and incubated with a secondary donkey anti-mouse or goat anti-human antibody labeled with Alexa Fluor 647 for
30 min at 4
C. Finally, cells were washed twice with 13 Permeabilization Buffer as described above and resuspended in 180 mL
FACS buffer before acquisition on a BD FACS Celesta II.
For surface protein detection, the remaining cells for each sample were transferred to another 96-well plate. Cells were stained
directly for 30 min at 4
C with 50 mL of pre-mixed Fixable Viability Dye eFluor 450, diluted 1:500, and the appropriate primary antibody
diluted together in DPBS. Cells were then washed with DPBS, centrifuged at 300 3 g for 5 min at 4
C, and incubated with a secondary
donkey anti-mouse or goat anti-human antibody labeled with Alexa Fluor 647, diluted 1:500 in DPBS, for 30 min on ice. Following the
secondary staining, cells were again washed with DPBS, centrifuged at 300 3 g for 5 min at 4
C, and fixed by the addition of 100 mL
Fixation Buffer for 12 min at room temperature. Finally, the cells were centrifuged at 500 3 g for 5 min at room temperature, washed
twice with FACS buffer and resuspended in 180 mL FACS buffer before acquisition with a BD FACS Celesta II.

Recombinant protein production

Expi293F cells were grown at 37
C to a cell density of approximately 3 x 106 viable cells per mL of culture, with >95% viability as
measured prior to transfection. Individual cell cultures were generated to a final volume of 750 mL. To prepare the transfection
mixture, 750 mg of purified plasmid DNA (encoding constructs designed for recombinant production with a ‘‘secrecon’’ signal peptide
on the N-terminus and an FLAG-His6 tag on the C-terminus) was added to 25 mL of Opti-MEM I Reduced Serum Media. Additionally,
1 mL of ExpiFectamine293 was added to 25 mL of Opti-MEM I Reduced Serum Media. These two mixtures were combined with
gentle inversion and allowed to equilibrate at RT for 15 min. The resulting complexation reaction mixture was added drop-wise to
the cell cultures with gentle swirling during the addition. The resulting transfected culture was placed in a 32
C shaking (140 rpm)
incubator with 80% relative humidity and 8% CO2 partial pressure. At 20 h post-transfection, the cultures were removed from the
incubator and transfection kit enhancers 1 and 2 were added at the recommended volumes, and the cultures were returned to
the shaking incubator for 5 additional days.
Cultures were harvested after a total of 6 days of transient transfection via centrifugation at 8,000 rpm in a JLA-8.1000 rotor
(12,250 3 g) for 45 min at 4
C. The supernatant was then applied to a 0.22 mm filter membrane to remove solid debris from the
solution. The target proteins were purified via immobilized metal affinity chromatography (IMAC) using a batch binding method.
Briefly, 4 mL of an 80% (v/v) slurry of Ni-sepharose Excel beads were added to a 20-mL disposable column and equilibrated via grav-
ity flow with at least 3 column volumes of IMAC equilibration buffer (25 mM Tris-HCl pH 8.0, 300 mM sodium chloride, 10% glycerol).
The beads were then resuspended in 5 mL of equilibration buffer and added directly to the filtered culture supernatant and allowed to
stir gently at 4
C for 2 h. The beads were then collected with a disposable filter using a vacuum to carefully not allow the beads to dry
out. The beads were washed with 100 mL of IMAC wash buffer (25 mM Tris-HCl pH 8.0, 300 mM sodium chloride, 10% glycerol,
15 mM imidazole) and carefully vacuum filtered 5 total times to remove non-selectively bound protein to the beads. The beads
were then resuspended in 10 mL of IMAC wash buffer and transferred to the 20 mL disposable column used previously and allowed
to drain via gravity flow to pack the beads. Protein was eluted using successive 1 mL additions of IMAC elution buffer (25 mM Tris-HCl
pH 8.0, 300 mM sodium chloride, 10% glycerol, 250 mM imidazole). Positive fractions were determined by SDS-PAGE analysis and
pooled. Pooled protein was concentrated with a 10 kDa MWCO centrifuge filter until a final volume of 500 mL was achieved. The
concentrated protein was applied to an S6 size exclusion column (equilibrated in 10 mM HEPES pH 7.4, 150 mM NaCl) and the ex-
pected monomer or dimer was purified via molecular size from a small fraction of unproductive larger order aggregates. The major
size exclusion chromatography peak corresponding to expected monomer or dimer was pooled and buffer exchanged into storage
buffer (13 PBS pH 7.2, 10% glycerol) using a PD-10 desalting column. Final protein concentration was determined by measuring
absorption at 280 nm on a Nanodrop. Aliquots were calculated to a final protein mass of 100 mg each and flash frozen in liquid nitrogen
for storage at 80
C.

MPXV antigen ELISA (mouse and rat serum samples)

ELISA plates were coated with 100 ng recombinant protein in 100 mL DPBS in rows A through F and a dilution series of purified IgG in
rows G and H. The plates were covered and incubated at 4
C overnight. The following morning the plates were washed three times
with 300 mL/well PBS-T using a plate washer. The wells were then blocked with 250 mL of a blocking buffer containing casein. The
block step proceeded for 1 h at 37
C. Block solution was removed, and the plates were washed three times with 300 mL/well PBS-T. A
33 dilution series of each serum sample beginning at a 1003 dilution was generated using blocking buffer as diluent. 100 mL of each
dilution for each sample was applied to two wells coated with the target antigen. Wells coated with purified IgG received 100 mL of
blocking buffer at this step. The plates were then incubated at 37
C for 1 h and washed three times with 300 mL/well PBS-T. Anti-
mouse or anti-rat IgG-HRP was diluted 1:5000 in blocking buffer and 100 mL applied to each well. Plates were incubated with sec-
ondary antibody for 45 min at 37
C, then they were washed three times with 300 mL/well PBS-T. Plates were developed by adding
100 mL/well TMB substrate and incubating for 8 min at RT. Development was stopped by adding 100 mL 0.16 M sulfuric acid to each

Cell 187, 1363–1373.e1–e7, March 14, 2024 e4

 ll
OPEN ACCESS Short article

well. Absorbance was read at 450 nm using a plate reader (Envision). The antibody level quoted for each sample is in IgG concen-
tration equivalents (ng IgG/mL) determined by using the IgG-coated wells on each plate as a standard curve and performing inter-
polation in Graphpad Prism 9.

MPXV PRNT (mouse samples)

Vero E6 cells were seeded in 24-well plates at a concentration of 2.53105 cells/well and incubated overnight at 37
C, 5% CO2 until the
cells reached 90–100% confluency. On the day of cell seeding, serum test samples and controls were heat-inactivated at 56
C for 30 min
and used to generate a 2-fold dilution series in 96-well plates. Serum dilutions were combined with MPXV virus either in the presence or
absence of 10% baby rabbit complement and incubated overnight at 4
C. The day following cell seeding, media was removed from cells
and replaced with 100 mL of virus and serum dilution mixture. Following a 1 h incubation at 37
C, 5% CO2 with rocking at intervals the virus
and serum solutions were removed from cells and replaced with 500 mL overlay media containing 0.5% methylcellulose. The plates were
then incubated at 37
C in 5% CO2 for two days. Following this infection step, A 0.4% Crystal Violet stain solution was added to each well
in a volume of 250 mL, and the plates were incubated at RT for 30–120 min. After staining, the Crystal Violet solution was removed from the
plates by decanting and the plates were inverted and set aside to dry. Dried plates were scanned with a flatbed scanner and desktop
scanning software to create digital images for each plate, which were used for manual counting of plaques in each well. 50% neutrali-
zation titers (NT50) were calculated based on the average number of plaques detected in the virus control wells. The limits of detection
were set at half the lowest test serum dilution and twice the highest dilution tested.

VACV focus reduction neutralization test (FRNT)

Following heat inactivation of each serum sample, a 2-fold serum dilution series was generated, combined with VACV in a 96-well
plate and incubated for 1 h at 37
C. Virus and serum dilutions were then transferred to a 96-well plate containing Vero cells and further
incubated for 1 h at 37
C with 5% CO2. All media was then removed from the plate and a 0.5% methylcellulose-containing media is
added to the plates. Following incubation for 18 h at 33
C with 5% CO2, infected Vero cells were then fixed with 4% paraformalde-
hyde, stained with detection antibodies, and imaged and analyzed with an automated plate reader. The neutralizing titer of a serum
sample is calculated as the reciprocal serum dilution corresponding to a 50% reduction in viral foci, the 50% neutralization antibody
titer (NT50). FRNTs were conducted both in the presence and absence of 4% baby rabbit complement during the initial incubation
step. The LLOD is set at half the lowest test serum dilution tested.

Measurement of germinal center induction by flow cytometry

Single cell suspensions of ipsilateral inguinal lymph nodes (LNs) from immunized or control mice were washed in FACS buffer (PBS con-
taining 1% BSA) and collected by centrifugation at 300 x g. Cell pellets were resuspended in FACS buffer containing 1 mg/mL of either
A35, B6, M1, or H3 and incubated on ice for 30 min. Each LN suspension was treated only with protein corresponding to the immuni-
zation of the source animal; saline treated animals were placed in M1 solution. Following the antigen stain, 100 mL of FACs buffer was
added to the cells and they were centrifuged at 300 x g for 5 min at 4
C. The supernatants were decanted, cell pellets resuspended in
200 mL FACS buffer, and centrifugation repeated. This wash step was repeated once and then cell pellets were resuspended in stain
solution, FACS buffer containing: LIVE/DEAD Fixable Near-IR Dead Cell Stain solution, anti-mouse CD19-BV605, anti-mouse/human
CD45R/B220-BV785, anti-mouse CD95-PECy7, anti-mouse/human GL7-FITC, anti-mouse CD11c-BV421, anti-mouse F4/80-
BV421, anti-mouse CD4-BV421, anti-mouse CD8a-BV421, anti-mouse Ly-6G/Ly-6C (Gr-1)-BV421, anti-Flag Tag-PE and anti-Flag
Tag-APC. Antigen binding to B cells was detected via anti-Flag antibody recognition of Flag-Tag-bearing recombinant MPXV proteins
bound on the cell surface. Following the antigen stain, 100 mL of FACs buffer was added to the cells and they were centrifuged at 300 x g
for 5 min at 4
C. The cells were washed once as above, resuspended in 200 mL FACS buffer and analyzed on a BD Symphony A5.

MPXV antigen ELISpot (mouse splenocytes)

ELISpot assays with fresh splenocytes were performed according to the manufacturer’s protocol (with minor modifications as
described below) using the R&D systems mouse IFN-g ELISpot kit. Briefly, 96-well ELISpot plates were blocked with serum-free assay
media (X-VIVO +1% Pen-Strep +1% Glutamax) for at least 1 h at 37
C. 100 mL of the splenocyte solution (3 3 105 cells) were transferred
to the respective well of the 96-well ELISpot plate. Another 100 mL of overlapping 15mer peptide pools spanning a given antigen or con-
trols were added at 0.3 mM final concentration per peptide. For a positive control, the splenocytes were stimulated with 0.3 mM ConA.
For a non-stimulation control, medium with DMSO equivalent to the highest volume of peptide mix was added. Plates were incubated
overnight in a 37
C humidified incubator with 5% CO2 and after approximately 20 h, cells were removed from the plates and detection of
spots was initiated according to manufacturer’s protocol. Briefly, the detection antibody was added for an overnight incubation at 4
C.
Streptavidin-ALP (alkaline phosphatase), and the ready-to-use substrate were then added to the wells according to the manufacturer’s
protocol. After plate drying for several days, an ELISpot plate reader (ImmunoSpot S6 Core Analyzer, CTL) was used to count and
analyze spot numbers per well. Saturated wells were assigned a value of 1500 spots.

Rodent studies
i) Primary antibody immunogenicity study in BALB/c (conducted at Biomodels, Waltham, MA) – Groups of six male BALB/cAnNTac
mice were administered an IM injection of either one of the BNT166 monovalent LNP-formulated mRNAs (1 mg/animal), BNT166a

e5 Cell 187, 1363–1373.e1–e7, March 14, 2024

 ll
Short article OPEN ACCESS

quadrivalent vaccine candidate (4 mg/animal), or BNT166c trivalent vaccine candidate (4 mg/animal) on study days 0 and 21. A group
of six mice was also administered saline (0.9% NaCl) as a vehicle control on the same days. Blood was collected via retro-orbital
bleed from all animals under isoflurane anesthesia on days 0, 7, 14, 21, and 28 and by cardiac puncture on day 35 and used for
ELISA, MPXV PRNT and VACV FRNT. Animals were euthanized by CO2 asphyxiation on day 35 and inguinal lymph nodes collected
and used to prepare single cell suspensions for flow cytometry.
ii) T cell immunogenicity study in BALB/c (conducted at Biomodels, Waltham, MA) – Groups of five 6–8 week old male BALB/
cAnNTac mice were administered a single IM injection of each of the monovalent mRNA (1 mg/animal) or the BNT166a multivalent
vaccine candidate (4 mg/animal). A group of 5 mice was also administered saline (0.9% NaCl) as a vehicle control on the same
day. Animals were euthanized by CO2 asphyxiation on day 7, spleens harvested and splenocytes cell preparations used for
ELISpot assay.
iii) Second antibody immunogenicity study in BALB/c (conducted at Nexelis Laboratories Canada Inc., Laval, QC) – Groups of 16
male and female 6–8 week old BALB/cJ mice were administered an IM injection of either BNT166a quadrivalent (4 mg/animal) or
BNT166c trivalent vaccine candidate (4 mg/animal) on study days 0 and 21. A group of 16 mice was also administered saline
(0.9% NaCl) as a vehicle control on the same days. Serum was collected on days 0, 21, and 35 and used for VACV FRNT.
iv) Antibody immunogenicity study in Wistar rats (conducted at BioNTech SE, Munich, Germany) – Groups of 5 8–9 week old Wistar
rats were immunized IM with 10 mg of monovalent BNT166 mRNAs or physiological saline (0.9% NaCl) on study days 0 and 28. Serum
was collected weekly and analyzed for anti-MPXV antibody levels by ELISA until study day 42.
v) Clade IIb MPXV protection in CAST/Ei (conducted a Bioqual, Inc, Rockville, MD) – In a first experiment, groups of 10 male
CAST/EiJ mice were administered an IM injection of 4 mg/animal of either BNT166a quadrivalent, BNT166c trivalent vaccine candi-
date, or a bivalent combination of A35 and B6 mRNAs on study days 0 and 21. A group of 10 mice was also administered saline
(0.9% NaCl) as a vehicle control on the same days. 5 weeks following the second vaccine dose, all animals were challenged IN
with 9 3 106 PFU clade IIb MPXV (strain hMPXV/USA/MA001/2022) in a total volume of 50 mL per animal. Animals were sacrificed
on either day 3 or day 7 post infection and lungs collected for viral load measures. A second replicate experiment was conducted
as above, but a lower inoculum dose was used (3 3 105 PFU) as a high titer challenge stock was not available at the time of the
replicate experiment.
vi) Clade I MPXV protection in CAST/Ei (conducted a Bioqual, Inc, Rockville, MD) –Groups of 10 male CAST/EiJ mice were admin-
istered an IM injection of 4 mg/animal of either BNT166a quadrivalent, BNT166c trivalent vaccine candidate, or a bivalent combination
of A35 and B6 mRNAs on study days 0 and 21. A group of 10 mice was also administered saline (0.9% NaCl) as a vehicle control on
the same days. 5 weeks following the second vaccine dose, all animals were challenged IN with 1 3 105 PFU clade 1 MPXV (strain
Zaire 79/V79-I-005) in a total volume of 50 mL per animal. Animals were monitored daily for weight loss and survival for 14 days
following challenge.
vii) VACV protection in BALB/c (conducted a Bioqual, Inc, Rockville, MD) – Groups of 16 male and female BALB/cAnNHsd mice
were administered an IM injection of either BNT166a quadrivalent vaccine candidate (4 mg/animal), A35 mRNA alone (1 mg/animal),
B6 mRNA alone (1 mg/animal), M1 mRNA alone (1 mg/animal), or H3 mRNA alone (1 mg/animal) on study days 0 and 21. A group of 16
mice was also administered saline (0.9% NaCl) as a vehicle control on the same days. 5 weeks following the second vaccine dose, all
animals were challenged IN with 5 3 104 PFU VACV-Western Reserve in a total volume of 50 mL per animal. Animals were monitored
daily for weight loss and survival for 14 days following challenge.

Mouse lung TCID50 assay

Following euthanasia, lungs were collected, weighed, and placed into pre-labeled Sarstedt (or similar) cryovials, snap-frozen on dry
ice and stored at % -70
C until testing. Prior to testing in the viral load assays, the tissues were homogenized in DMEM for approx-
imately 20 s using a hand-held tissue homogenizer and then spun down to remove debris and supernatants tested in the viral load
assays. Vero TMPRSS2 cells were plated at 25,000 cells/well in DMEM +10% FBS + gentamicin and the cultures were incubated at
37
C, 5.0% CO2. Media was aspirated out and replaced with fresh media and a serial dilution of live virus or organ suspension. The
plates for the samples were incubated again at 37
C, 5.0% CO2 for four days. After four days, wells were visually inspected for cyto-
pathic effect (CPE). Non-infected wells were identified by a clear confluent cell layer. Infected cells demonstrated cell rounding. The
TCID50 was calculated using the Reed-Muench formula. If no infection was observed, an arbitrary titer value of the lower limit of
detection was reported based on the specific assay conditions.

Macaque clade I MPXV challenge study

A non-human primate (NHP) clade I MPXV challenge study was conducted at Southern Research (Birmingham, AB). 12 male, MPXV-
seronegative cynomolgus macaques ages 2.5–5.5 years were obtained from PrimGen. Following an acclimation period at Southern
Research, animals were IM administered either 30 mg BTN166a on study days 0 and 28 or mock-treated with physiological saline
(0.9% NaCl). On study day 60, animals were anesthetized and challenged with a target dose of 5 3 107 PFU of clade I MPXV via
the intratracheal (IT) route. For 28 days post infection animals were monitored for death, moribund condition and specific disease
signs including fever, poxvirus lesions, lethargy, appetite loss, depression, weakness, recumbency, dehydration, dyspnea, cough,
eating, nasal discharge, ocular discharge, edema.

Cell 187, 1363–1373.e1–e7, March 14, 2024 e6

 ll
OPEN ACCESS Short article

MPXV antigen ELISA (NHP serum samples)

ELISA plates were coated with 100 ng recombinant protein in 100 mL PBS and incubated at 4
C overnight. The following morning the
plates were washed three times with 300 mL/well PBS-T using a plate washer. The wells were then blocked with 200 mL of SuperBlock
solution. The block step proceeded for 1 h at room temperature. Block solution was removed, and the plates again washed three
times with 300 mL/well PBS-T. A dilution series of each serum sample was generated in PBS+1%BSA. 100 mL of each dilution for
each sample was applied to two wells coated with the target antigen. The plates were then incubated at room temperature for
1 h and washed three times with 300 mL/well PBS-T. Anti-monkey IgG-HRP was diluted 1:200,000 in blocking buffer and 100 mL
applied to each well. Plates were incubated with secondary antibody for 60 min at room temperature, then they were washed three
times with 300 mL/well PBS-T. Plates were developed by adding 100 mL/well TMB substrate and incubating for 20 min at RT. Devel-
opment was stopped by adding 100 mL 1 N sulfuric acid to each well. Absorbance was read at 450 nm using a plate reader and
endpoint dilution reported as the IgG titer.

NHP viral load determination by real-time quantitative PCR (qPCR)

Bood viral loads were be measured using a real-time qPCR method for detection of MPXV genomes using the following primers and
probe combination for detection of the gene encoding the DNA polymerase of multiple orthopoxviruses: OPE9L-F1880 (50 -GAA-
CATTTTTGGCAGAGAGAGCC), OPE9L-R2057 (50 -CAACTCTTAGCCGAAGCGTATGAG) and TaqMan probe OPE9L-p1924S56
(FAM/CAGGCTACC/ZEN/AGTTCAA/3IABkFQ).58 Briefly, whole blood was inactivated by adding ATL/Proteinase K lysis buffer (Qia-
gen) and incubating at 56
C for at least 1 h. DNA extraction from inactivated blood and positive control vaccina virus stocks was
performed using a Qiagen QIAmp DNA Mini extraction kit. All qPCR reactions were performed using the TaqMan Fast Advanced
Master Mix and run with serially diluted, quantified dsDNA gBlock standards in parallel to enable quantitation of viral DNA in each
biological sample from a standard curve.

NHP MPXV PRNT

Serum samples were serially diluted in DMEM containing Glutamax and 2% FBS and added to an equal volume of solution containing
MPXV. The combined serum-virus solutions were incubated at 37
C and 100 mL of each serum-virus mixture was added to a fresh
24-well plate containing confluent Vero cells in triplicate and the plates returned to a 37
C tissue culture incubator. Neutralization
endpoint titers were calculated based on the reciprocal dilution of the test serum that produced 50% plaque reduction compared
to the virus control.

NHP histology
Lung and lymph node tissues collected from each animal at the time they succumbed to MPXV infection or were sacrificed at the end
of the study period were processed to slides. The fixed tissues were trimmed, processed, and sectioned using a microtome (approx-
imately 5-mm sections). Tissue sections were mounted on glass slides, stained with H&E, and examined microscopically. All slides
were submitted to a veterinary pathologist for evaluation using a four-step grading system to rank the severity of microscopic obser-
vations for comparison among groups.

e7 Cell 187, 1363–1373.e1–e7, March 14, 2024

 ll
Short article OPEN ACCESS

Supplemental figures
A A35 expression B B6 expression
total protein
104 104
surface protein

HEK population
HEK population

103 103

MFI of total
MFI of total

102 102

101 101

100 100

c
e

e
a

T
T

66
66

66
on

on
66

N
N

T1
T1

T1
al

al
T1
5

B6

BN
BN

BN
BN
A3

C M1 expression D H3 expression
104 104
HEK population

HEK population

103 103
MFI of total

MFI of total

102 102

101 101

NA
100 100
a

a
c

c
e

e
T

T
66

66
66

66
on

on
N

N
T1

T1
T1

T1
al

al
1

3
BN

BN
BN

BN
M

Figure S1. In vitro expression of MPXV antigens from BNT166 mRNAs, related to Figure 1
(A–D) HEK293T cells were transfected with 200 ng of formulated RNA. Cells transfected with the multivalent vaccine candidates BNT166a and BNT166c were
compared to non-transfected cells and cells transfected with a monovalent RNA-LNP component. Antigen expression level was measured by flow cytometry 18 h
post-transfection for A35 (A), B6 (B), M1 (C), and H3 (D). In (D), H3 analysis for BNT166c is excluded as H3 is not included in this vaccine. Antigen expression is
shown as median fluorescence intensity (MFI) of total live cells for both intracellular (total protein, black bars, left) and surface (surface protein, gray bars, right)
staining conditions. The mean of technical triplicates is shown (+ SEM).
 ll
OPEN ACCESS Short article

A Live Dump – B220+ CD10+ GL7+ CD95+

GC
4.06

Ag+
13.9
B cells
93.5
B220

GL7

Ag
CD19 CD95 Ag

B Total germinal center B cells C Antigen specifc germinal center B cells

25 25
Germinal center B cells (% of B cells)

Antigen+ cells (% of GC B cells)

20 20

15 15

10 10

5 5

0 0
A35 B6 M1 H3 Saline A35 B6 M1 H3 Saline

Figure S2. Induction of germinal centers following vaccination with monovalent BNT166 mRNAs, related to Figure 1
Following prime and boost IM vaccination in BALB/c mice, inguinal LNs were harvested and analyzed for the presence of GC B cells by flow cytometry.
(A) Representative dot plots and gating strategy for total GC B cells (Live Dump CD19+B220+CD95+GL7+) and antigen double-positive (Ag+) GC B cells.
Sequential gating events are shown left to right.
(B and C) Summary data for the fraction of GC B cells in the LN (B) and the fraction of Ag+ cells among total GC B cells (C). Mean ± SEM is shown (n = 3–6).
 ll
Short article OPEN ACCESS

A A35 antibody induction B B6 antibody induction

10 8 10 8

10 7 10 7
anti-A35 IgG (ng/mL)

anti-B6 IgG (ng/mL)

10 6 10 6

10 5 10 5

10 4 10 4

10 3 10 3

10 2 10 2

0 5 10 15 20 25 30 35 40 45 0 5 10 15 20 25 30 35 40 45
Days post immunization Days post immunization

C M1 antibody induction D H3 antibody induction

10 8 10 8

10 7 10 7
anti-H3 IgG (ng/mL)
anti-M1 IgG (ng/mL)

10 6 10 6

10 5 10 5

10 4 10 4

10 3 10 3

10 2 10 2

0 5 10 15 20 25 30 35 40 45 0 5 10 15 20 25 30 35 40 45
Days post immunization Days post immunization

Figure S3. BNT166 component mRNAs induce IgG responses in rats, related to Figure 1
(A–E) Wistar rats were immunized with 10 mg of an individual MPXV-antigen encoding mRNA on days 0 and 28. Serum antibody levels for A35 (A), B6 (B), M1 (C),
and H3 (D) were measured by ELISA. Geometric mean values of IgG ng/mL equivalents (± SEM) are shown (n = 5 per group). The lower limit of detection is
indicated with a dashed line and is set at half the lowest test serum dilution tested.
 ll
OPEN ACCESS Short article

VACV neutralization
105 Saline
BNT166a
BNT166c

50% neutralization titer (NT50) 104

103

102

101

100
Day 21 Day 35

Figure S4. Neutralizing antibody responses following BNT166a and BNT166c prime and boost immunizations, related to Figure 2
BALB/c mice were immunized with BNT166a or BNT166c on days 0 and 21, and serum VACV-neutralizing antibodies were measured on day 21 and day 35 by
FRNT (n = 16 per group). The summary line indicates the median value. The lower limit of detection is indicated with a dashed line and is set at half the lowest test
serum dilution tested.
 ll
Short article OPEN ACCESS

A Lung B Lymph node

BNT166a Saline BNT166a Saline

4x 4x

40x 40x

Figure S5. Histopathology in the lungs and lymph nodes of macaques intratracheally challenged with clade I MPXV, related to Figure 4
(A and B) Representative images of caudal lung lobes (A) and mediastinal lymph nodes (B) from animals intramuscularly administered with either BNT166a or
saline. Stained with hematoxylin and eosin. Images captured at 43 (top) and 403 (bottom).