Advances in Experimental Medicine and Biology 1415

John D. Ash · Eric Pierce · Robert E. Anderson ·

Catherine Bowes Rickman · Joe G. Hollyfield ·
Christian Grimm Editors

Retinal
Degenerative
Diseases XIX
Mechanisms and Experimental Therapy
Advances in Experimental Medicine
and Biology

Volume 1415

Series Editors
Wim E. Crusio, Institut de Neurosciences Cognitives et Intégratives
d’Aquitaine, CNRS and University of Bordeaux, Pessac Cedex, France
Haidong Dong, Departments of Urology and Immunology, Mayo Clinic
Rochester, MN, USA
Heinfried H. Radeke, Institute of Pharmacology and Toxicology, Clinic of
the Goethe University Frankfurt Main, Frankfurt am Main, Hessen,
Germany
Nima Rezaei, Research Center for Immunodeficiencies, Children’s Medical
Center, Tehran University of Medical Sciences, Tehran, Iran
Ortrud Steinlein, Institute of Human Genetics, LMU University Hospital
Munich, Germany
Junjie Xiao, Cardiac Regeneration and Ageing Lab, Institute of
Cardiovascular Sciences, School of Life Science, Shanghai University
Shanghai, China
Advances in Experimental Medicine and Biology provides a platform for
scientific contributions in the main disciplines of the biomedicine and the life
sciences. This series publishes thematic volumes on contemporary research in
the areas of microbiology, immunology, neurosciences, biochemistry,
biomedical engineering, genetics, physiology, and cancer research. Covering
emerging topics and techniques in basic and clinical science, it brings together
clinicians and researchers from various fields.
Advances in Experimental Medicine and Biology has been publishing
exceptional works in the field for over 40 years, and is indexed in SCOPUS,
Medline (PubMed), EMBASE, BIOSIS, Reaxys, EMBiology, the Chemical
Abstracts Service (CAS), and Pathway Studio.
2021 Impact Factor: 3.650 (no longer indexed in SCIE as of 2022)
John D. Ash • Eric Pierce
Robert E. Anderson
Catherine Bowes Rickman
Joe G. Hollyfield • Christian Grimm
Editors

Retinal Degenerative
Diseases XIX
Mechanisms and Experimental
Therapy
Editors
John D. Ash Eric Pierce
Department of Ophthalmology Ocular Genomics Institute
University of Pittsburgh School Department of Ophthalmology
of Medicine Massachusetts Eye and Ear Infirmary
Pittsburgh, PA, USA Harvard Medical School
Boston, MA, USA
Robert E. Anderson
Health Sciences Center Catherine Bowes Rickman
University of Oklahoma Health Department of Ophthalmology
Sciences Center Duke Medical Center
Oklahoma City, OK, USA Durham, NC, USA

Joe G. Hollyfield Christian Grimm

Department of Ophthalmology Laboratory for Retinal Cell Biology
Cleveland Clinic Lerner College Department of Ophthalmology
of Medicine University Hospital Zurich
Cleveland, OH, USA University of Zurich
Schlieren, Switzerland

ISSN 0065-2598     ISSN 2214-8019 (electronic)

Advances in Experimental Medicine and Biology
ISBN 978-3-031-27680-4    ISBN 978-3-031-27681-1 (eBook)
https://doi.org/10.1007/978-3-031-27681-1

© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature
Switzerland AG 2023
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher,
whether the whole or part of the material is concerned, specifically the rights of translation,
reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any
other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this
publication does not imply, even in the absence of a specific statement, that such names are
exempt from the relevant protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in
this book are believed to be true and accurate at the date of publication. Neither the publisher nor
the authors or the editors give a warranty, expressed or implied, with respect to the material
contained herein or for any errors or omissions that may have been made. The publisher remains
neutral with regard to jurisdictional claims in published maps and institutional affiliations.

This Springer imprint is published by the registered company Springer Nature Switzerland AG
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
The editors are pleased dedicate this publication to the memory
of our long-time friend and colleague, Alan M. Laties. Except
for the most recent years, Alan attended each of these biennial
retinal degeneration meetings since they began in 1984. Early
on Alan recognized the importance of our attempt to provide a
continuing international platform for discussions and scientific
exchange to take place among investigators focused on retinal
degeneration research. Through his scientific leadership at the
Foundation Fighting Blindness (formerly the Retinitis
Pigmentosa Foundation), we received the first meeting grant to
partially cover some of the expenses of the RD meeting held in
San Francisco in 1988. The Foundation has provided
continuing support for each of the subsequent meetings in the
form of travel grant support for young investigators.
Born in Beverly, Massachusetts, the son of Russian immigrants,
he attended Harvard College (BA, 1954) and completed
medical school at Baylor College of Medicine (MD, 1959),
followed by a residency in ophthalmology in the Hospital of the
University of Pennsylvania (1961–63). A United States Public
Health Service Special Research Fellowship supported his
vi 

research training in the Institute of Neurological Sciences at

the University of Pennsylvania (1963–64). He joined the faculty
at the University of Pennsylvania in 1965 where he moved
through the academic ranks until retiring as Emeritus
Professor of Ophthalmology at the Perelman School of
Medicine in 2020. He held joint appointments in
Ophthalmology and Neurology where he was the Irene Heinz
Given and John LaPorte Given Research Professor and the
Harold G. Scheie Research Professor in Ophthalmology. He
served as neuro-ophthalmologist at the Hospital of the
University of Pennsylvania while pursuing basic research on
the autonomic innervation of the eye, eye growth, and
therapeutic approaches to eye diseases. He has published 140
original research papers, 30 review articles, and presented
numerous invited lectures at major university medical centers
around the world on a variety of topics critical to the treatment
of diseases of the eye. He was an inventor holding multiple
patents in the area of ophthalmology.
In the early 1970s, Alan was approached by the Retinitis
Pigmentosa Foundation to help them develop a scientific plan
to support targeted research that would lead to an
understanding of the causes of retinitis pigmentosa. At the time,
it was recognized that these diseases were inherited, but only in
a very limited way (autosomal dominant, recessive or
X-linked). At the time, no mutations causing RP had been
identified and the Human Genome Project would not be
initiated for another 20 years. Alan agreed and organized the
first Scientific Advisory Board for this Foundation and served
as Chairman. In this leadership role, Alan helped identify and
direct funding to the first laboratory focused on degenerative
retinal disease research, the Berman-Gund Laboratory at the
Massachusetts Eye and Ear Infirmary, Harvard University.
Research Centers focused on retinal degeneration would later
be expanded to many medical centers in North America,
England, and Europe. Alan recognized the importance and
need for animal models with these inherited retinal diseases
and directed funds from the Foundation to support the
development of the dog models with RP identified by Dr.
Gustavo Aguirre at the College of Veterinary Medicine. In the
early 1980s, Alan initiated a scientific plan for the Foundation
to identify the major genes responsible for RP. This led in 1989
to the discovery of a mutation in the rhodopsin gene
 vii

responsible for an autosomal dominant form of retinitis

pigmentosa. Discovery of mutations in other genes causing
retinitis pigmentosa quickly followed. With the discovery of
RP-65, a gene that causes a recessive form of RP, gene therapy
in a dog model with this recessive disorder could be quickly
initiated because of Dr. Laties’ early support from the
Foundation of these dog model lines. Dr. Laties’ early
leadership was hugely important to gene therapy clinical trials
and a number of other therapies related to these inherited
retinal diseases. To honor Dr. Laties, the Foundation Fighting
Blindness named their physicians’ and physician-scientists’
career development award the Alan Laties Career Development
Program and honored him with the inaugural Llura Liggett
Gund Lifetime Achievement Award.
Dr. Laties was a gifted scientist, outstanding leader, and
compassionate human who enriched the lives of his
contemporaries. He played a key role in nurturing and
expanding research in inherited retinal diseases. He is survived
by his wife Deena Gu, a distinguished artist, daughter Jane
Laties, sons Alex P. Laties and Nicholas P. Robinson, and a
brother, David.
Preface

The XIX International Symposium on Retinal Degeneration was held from

September 26 to October 2, 2021. The symposium was initially planned for
October of 2020 in Mendoza, Argentina. However, the global pandemic made
this meeting impossible. With the availability of vaccines, we decided in
March of 2021 that it would be possible to organize the meeting for late
September of 2021. From the beginning, we planned the meeting as an in-­
person meeting with the capability of switching to a hybrid or fully online
meeting depending on the state of the pandemic, and we moved the in-person
meeting to the United States to reduce travel complications for most attend-
ees. As the delta variant began to surge in the weeks leading up to the meet-
ing, we had to activate the hybrid meeting. The meeting platform we
established allowed both in-person and virtual platform talks as well as both
in-person and virtual attendance. The platform was organized so that all pre-
sentations were live and all participants were able to ask questions. All pre-
sentations, including posters, were recorded and made available 4 months
after the meeting. The in-person sessions were held in the Sonesta Nashville
Airport Hotel in Nashville, TN. Because of COVID concerns, the in-person
attendance was small (118 scientists) compared to previous meetings (~250
scientists), but the overall attendance increased to 344 attendees. The virtual
option was the main driver for the increase in attendance. The meeting pro-
gram included four outstanding keynote presentations from Michael Chiang,
Director of the National Eye Institute on Artificial intelligence for clinical
care and research; Douglas Wallace, National academy of Science member
and Professor at the University of Pennsylvania on Mitochondria and the eti-
ology of disease; David Gamm, Professor at the University of Wisconsin-­
Madison on Ultrathin micromolded 3D scaffolds for outer retina
reconstruction; Valeria Canto-Soler, Professor at the University of Colorado
on Human iPSC-derived 3D retinal tissue for stem cell-based therapies for
retinal degenerative diseases. Drs Chiang and Wallace presented via the vir-
tual platform, while Drs Gamm and Canto-Soler presented from the podium.
The program also included 41 platform talks, with 28 presented in person
from the podium and another 13 presented virtually. In addition, 143 posters
were presented as short talks on the virtual platform. Seventy-three of the
posters were also presented in person during two well-attended poster ses-
sions. New and important data were presented at the meeting, and we were
mentioned in a written article published on NPR, and several attendees were
interviewed by reporters from Science and other journals.

ix
x Preface

The RD2021 Travel award competition was highly successful at attracting

qualified applicants. We received a 35% increase in TA applications for a total
of 196. The applications were reviewed by a panel of 14 expert reviewers,
including 6 women, 8 men, and sceintists from a recognized underrepre-
sented minority (URM). Since funding from European sources is dedicated to
European early career scientists, we included three reviewers from Europe.
Many of the panel members have been prior travel awardees. Each applica-
tion was assigned four reviewers, and reviewers independently scored appli-
cations on a 1–9 scale. Based on scores, the applications are ranked and
slotted into funding sources based on funding agency criteria. We were able
to support full travel awards for 60 in-person early career scientists and
another 41 virtual early-career scientists. This is the largest pool of awardees
at an RD meeting. The awards were balanced between men and women. In
addition, we implemented a new diversity and inclusion policy and dedicated
a minimum of six awards to underrepresented minorities (URM). In the end,
we were able to fund 11 URMs to attend the RD meeting.
Although the pandemic made the RD2021 meeting more complex and
more challenging to organize, the RD2021 meeting was, by all accounts, a
terrific success.

Pittsburgh, PA, USA John D. Ash

Boston, MA, USA Eric Pierce
Oklahoma City, OK, USA Robert E. Anderson
Durham, NC, USA Catherine Bowes Rickman
Cleveland, OH, USA Joe G. Hollyfield
Schlieren, Switzerland Christian Grimm
Contents

Part I Age-related Macular Degeneration

High-Resolution Imaging Mass Spectrometry of Human

Donor Eye: Photoreceptors Cells and Basal Laminar
Deposit of Age-­Related Macular Degeneration������������������������������������   3
David M. G. Anderson, Ankita Kotnala, Jeffrey D. Messinger,
Nathan Heath Patterson, Jeffrey M. Spraggins, Christine A. Curcio,
Richard M. Caprioli, and Kevin L. Schey
The Noncanonical Role of Complement Factor H
in Retinal Pigment Epithelium (RPE) Cells and Implications
for Age-Related Macular Degeneration (AMD)������������������������������������   9
Angela Armento, David Adrian Merle, and Marius Ueffing
 acular Pigment Carotenoids and Bisretinoid A2E���������������������������� 15
M
Ranganathan Arunkumar and Paul S. Bernstein
Disturbed Matrix Metalloproteinases Activity in Age-Related
Macular Degeneration ���������������������������������������������������������������������������� 21
Beatriz Martins and Rosa Fernandes
Current Views on Chr10q26 Contribution to Age-Related
Macular Degeneration ���������������������������������������������������������������������������� 27
Navdeep Gogna, Lillian F. Hyde, Gayle B. Collin, Lisa Stone,
Jurgen K. Naggert, and Patsy M. Nishina
Untargeted Lipidomic Profiling of Aged Human Retina
With and Without Age-Related Macular Degeneration (AMD)���������� 37
Ankita Kotnala, David M. G. Anderson, Jeffrey D. Messinger,
Christine A. Curcio, and Kevin L. Schey
Decoding Race and Age-Related Macular Degeneration:
GPR 143 Activity Is the Key�������������������������������������������������������������������� 43
Dorothy Tung and Brian S. McKay
 eroxisome Proliferator-Activated Receptor Gamma
P
Coactivator-­1Alpha (PGC-1α): A Transcriptional Regulator at
the Interface of Aging and Age-Related Macular Degeneration? ������ 49
Freya M. Mowat

xi
xii Contents

Regulation of ABCA1 by miR-33 and miR-34a

in the Aging Eye �������������������������������������������������������������������������������������� 55
Florian Peters and Christian Grimm
 he Role of Gene Expression Regulation on Genetic Risk
T
of Age-­Related Macular Degeneration�������������������������������������������������� 61
Rinki Ratnapriya
Elastin Layer in Bruch’s Membrane as a Target
for Immunization or Tolerization to Modulate Pathology
in the Mouse Model of Smoke-Induced Ocular Injury������������������������ 67
Bärbel Rohrer, Nathaniel Parsons, Balasubramaniam Annamalai,
Crystal Nicholson, Elisabeth Obert, Bryan Jones,
and Andrew D. Dick
Repurposing Drugs for Treatment of Age-Related
Macular Degeneration ���������������������������������������������������������������������������� 73
Sarah G. Francisco and Sheldon Rowan

Part II Extracellular Vesicles

Extracellular Vesicle RNA Contents as Biomarkers

for Ocular Diseases���������������������������������������������������������������������������������� 81
Heran Getachew and Eric Pierce
Proteomics of Retinal Extracellular Vesicles: A Review
into an Unexplored Mechanism in Retinal Health
and AMD Pathogenesis���������������������������������������������������������������������������� 87
Adrian V. Cioanca, Riccardo Natoli, and Yvette Wooff

Part III Gene Editing

Prime Editing Strategy to Install the PRPH2

c.828+1G>A Mutation ���������������������������������������������������������������������������� 97
Salvatore Marco Caruso, Yi-Ting Tsai, Bruna Lopes da Costa,
Masha Kolesnikova, Laura A. Jenny, Stephen H. Tsang,
and Peter M. J. Quinn
Analysis of CRB1 Pathogenic Variants Correctable
with CRISPR Base and Prime Editing�������������������������������������������������� 103
Bruna Lopes da Costa, Laura A. Jenny, Irene H. Maumenee,
Stephen H. Tsang, and Peter M. J. Quinn
Generation of an Avian Myeloblastosis Virus (AMV)
Reverse Transcriptase Prime Editor������������������������������������������������������ 109
Yi-Ting Tsai, Bruna Lopes da Costa, Salvatore Marco Caruso,
Nicolas D. Nolan, Sarah R. Levi, Stephen H. Tsang,
and Peter M. J. Quinn
Contents xiii

Part IV Gene Therapy

Preexisting Neutralizing Antibodies against Different

Adeno-Associated Virus Serotypes in Humans
and Large Animal Models for Gene Therapy���������������������������������������� 117
Divya Ail and Deniz Dalkara
Optimization of Capillary-Based Western Blotting
for MYO7A ���������������������������������������������������������������������������������������������� 125
Kaitlyn R. Calabro, Sanford L. Boye, and Shannon E. Boye
AAV Serotypes and Their Suitability for Retinal
Gene Therapy ������������������������������������������������������������������������������������������ 131
Lynn J. A. Ebner and Christian Grimm
Gene Augmentation for Autosomal Dominant CRX-Associated
Retinopathies�������������������������������������������������������������������������������������������� 135
Chi Sun and Shiming Chen
 xnip Gene Therapy of Retinitis Pigmentosa Improves
T
Cone Health���������������������������������������������������������������������������������������������� 143
Yunlu Xue

Part V Human Retinal Degeneration

Factors Affecting Readthrough of Natural Versus

Premature Termination Codons ������������������������������������������������������������ 149
Avigail Beryozkin, Kerstin Nagel-Wolfum, Eyal Banin,
and Dror Sharon
Integrating Computational Approaches to Predict
the Effect of Genetic Variants on Protein Stability
in Retinal Degenerative Disease�������������������������������������������������������������� 157
Michelle Grunin, Ellen Palmer, Sarah de Jong, Bowen Jin,
David Rinker, Christopher Moth, John A. Capra,
Jonathan L. Haines, William S. Bush, and Anneke I. den Hollander
 etwork Biology and Medicine to Rescue: Applications
N
for Retinal Disease Mechanisms and Therapy�������������������������������������� 165
Anupam K. Mondal and Anand Swaroop
Non-syndromic Retinal Degeneration Caused by Pathogenic
Variants in Joubert Syndrome Genes���������������������������������������������������� 173
Riccardo Sangermano, Egle Galdikaité-Braziené,
and Kinga M. Bujakowska
Exonic Variants that Affect Splicing – An Opportunity
for “Hidden” Mutations Causing Inherited Retinal Diseases�������������� 183
Yogapriya Sundaresan, Eyal Banin, and Dror Sharon
 nhanced S-cone Syndrome, a Mini-review������������������������������������������ 189
E
Yiyi Wang, Jessica Wong, Jacque L. Duncan, Austin Roorda,
and William S. Tuten
xiv Contents

Part VI Inflammation

 he Role of Microglia in Inherited Retinal Diseases���������������������������� 197

T
Asha Kumari and Shyamanga Borooah
CD68: Potential Contributor to Inflammation and RPE
Cell Dystrophy������������������������������������������������������������������������������������������ 207
Mayur Choudhary and Goldis Malek
 ene Expression of Clusterin, Tissue Inhibitor
G
of Metalloproteinase-1, and Their Receptors in Retinal
Pigment Epithelial Cells and Müller Glial Cells Is
Modulated by Inflammatory Stresses���������������������������������������������������� 215
Mengmei Zheng, Eun-Jin Lee, Shinwu Jeong,
and Cheryl Mae Craft

Part VII Mechanisms of Degeneration

 xonal Transport Defects in Retinal Ganglion Cell Diseases�������������� 223

A
Iskalen Cansu Topcu Okan, Fatma Ozdemir, and Cavit Agca
 onnexins Biology in the Pathophysiology of Retinal Diseases���������� 229
C
Alejandro Ponce-Mora, Andrea Yuste, Giuliana Perini-Villanueva,
María Miranda, and Eloy Bejarano
 ole of Nuclear NAD+ in Retinal Homeostasis�������������������������������������� 235
R
Emily E. Brown, Michael J. Scandura, and Eric Pierce
Retinal Pigmented Epithelium-­Derived Ectopic Norrin Does
Not Promote Intraretinal Angiogenesis in Transgenic Mice���������������� 241
Andrea E. Dillinger and Ernst R. Tamm
Caveolin-1 in Müller Glia Exists as Heat-Resistant, High
Molecular Weight Complexes ���������������������������������������������������������������� 249
Eric N. Enyong, Jami Gurley, Virginie Sjoelung,
and Michael H. Elliott
 ole of VLC-PUFAs in Retinal and Macular Degeneration���������������� 257
R
Aruna Gorusupudi, Uzoamaka Nwagbo, and Paul S. Bernstein
Ocular Amyloid, Condensates, and Aggregates – Higher-Order
Protein Assemblies Participate in Both Retinal Degeneration
and Function�������������������������������������������������������������������������������������������� 263
Michael H. Hayes, DaNae R. Woodard, and John D. Hulleman
 hotoreceptor Ion Channels in Signaling and Disease������������������������ 269
P
Shivangi M. Inamdar, Colten K. Lankford, and Sheila A. Baker
The Role of Peripherin-2/ROM1 Complexes in Photoreceptor
Outer Segment Disc Morphogenesis������������������������������������������������������ 277
Tylor R. Lewis, Muayyad R. Al-Ubaidi, Muna I. Naash,
and Vadim Y. Arshavsky
Contents xv

Human Mutations in Arl3, a Small GTPase Involved

in Lipidated Cargo Delivery to the Cilia, Cause
Retinal Dystrophy������������������������������������������������������������������������������������ 283
Amanda M. Travis and Jillian N. Pearring
Genotype–Phenotype Association in ABCA4-Associated
Retinopathy���������������������������������������������������������������������������������������������� 289
Maximilian Pfau, Wadih M. Zein, Laryssa A. Huryn,
Catherine A. Cukras, Brett G. Jeffrey, Robert B. Hufnagel,
and Brian P. Brooks
Retinal Pathoconnectomics: A Window into
Neurodegeneration���������������������������������������������������������������������������������� 297
Rebecca L. Pfeiffer and Bryan W. Jones
The Role of Ceramide in Inherited Retinal
Disease Pathology������������������������������������������������������������������������������������ 303
Xinye Qian, Tanmay Srinivasan, Jessica He, and Rui Chen
 xtracellular Matrix: The Unexplored Aspects
E
of Retinal Pathologies and Regeneration���������������������������������������������� 309
Dmitri Serjanov and David R. Hyde
Role of TFEB in Diseases Associated with
Lysosomal Dysfunction���������������������������������������������������������������������������� 319
Hsuan-Yeh Pan and Mallika Valapala
Retinoic Acid Receptor-Related Orphan Receptors
(RORs) in Eye Development and Disease���������������������������������������������� 327
Felix Yemanyi, Kiran Bora, Alexandra K. Blomfield,
and Jing Chen

Part VIII Mechanisms of Degeneration – Animal Models

A Novel Mouse Model for Late-­Onset Retinal Degeneration

(L-ORD) Develops RPE Abnormalities Due
to the Loss of C1qtnf5/Ctrp5�������������������������������������������������������������������� 335
Shyamanga Borooah, Anil Chekuri, Shikha Pachauri,
Bhubananda Sahu, Marina Vorochikhina, John J. Suk,
Dirk-­Uwe Bartsch, Venkata R. M. Chavali, Monica M. Jablonski,
and Radha Ayyagari
 omparison of Mouse Models of Autosomal Dominant Retinitis
C
Pigmentosa Due to the P23H Mutation of Rhodopsin�������������������������� 341
Shannon R. Barwick and Sylvia B. Smith
Compensatory Cone-Mediated Mechanisms in Inherited
Retinal Degeneration Mouse Models: A Functional
and Gene Expression Analysis���������������������������������������������������������������� 347
Alicia A. Brunet, David M. Hunt, Carla Mellough,
Alan R. Harvey, and Livia S. Carvalho
xvi Contents

Inhibition of Ryanodine Receptor 1 Reduces Endoplasmic

Reticulum (ER) Stress and Promotes ER Protein
Degradation in Cyclic Nucleotide-Gated
Channel Deficiency���������������������������������������������������������������������������������� 353
Fan Yang, Hongwei Ma, Rekha Garg, Alfred Lewin,
and Xi-Qin Ding
 ouse Choroid Proteome Revisited: Focus on Aging�������������������������� 359
M
Donita Garland, James Harnly, and Radha Ayyagari
Morphological and Functional Comparison
of Mice Models for Retinitis Pigmentosa ���������������������������������������������� 365
Prakadeeswari Gopalakrishnan, Avigail Beryozkin,
Eyal Banin, and Dror Sharon
 urrent Advancements in Mouse Models of Retinal Disease�������������� 371
C
T. J. Hollingsworth, Xiangdi Wang, Raven N. Simpson,
William A. White, Robert W. Williams,
and Monica M. Jablonski
Single-Cell Transcriptomic Profiling of Müller
Glia in the rd10 Retina���������������������������������������������������������������������������� 377
Duygu Sigurdsson and Christian Grimm

Methods for In Vivo Characterization of Proteostasis
in the Mouse Retina �������������������������������������������������������������������������������� 383
Yixiao Wang and Ekaterina S. Lobanova
Absence of PRCD Leads to Dysregulation in Lipid
Homeostasis Resulting in Disorganization
of Photoreceptor Outer Segment Structure������������������������������������������ 389
Sree I. Motipally and Saravanan Kolandaivelu

Expansion Microscopy of Mouse Photoreceptor Cilia ������������������������ 395
Abigail R. Moyel, Michael A. Robichaux, and Theodore Wensel
Rod Photoreceptor-Specific Ablation of Metformin Target,
AMPK, in a Preclinical Model of Autosomal
Recessive Retinitis Pigmentosa �������������������������������������������������������������� 403
Nicholas D. Nolan, Laura A. Jenny, Stephen H. Tsang,
and Xuan Cui
TLR2 Is Highly Overexpressed in Retinal Myeloid
Cells in the rd10 Mouse Model of Retinitis Pigmentosa ���������������������� 409
Alonso Sánchez-Cruz, Enrique J. de la Rosa,
and Catalina Hernández-Sánchez
Environmental Light Has an Essential Effect
on the Disease Expression in a Dominant RPE65 Mutation���������������� 415
Wenjing Wu, Yusuke Takahashi, Xiang Ma, Gennadiy Moiseyev,
and Jian-Xing Ma
Contents xvii

Microglia Preserve Visual Function in a Mouse Model

of Retinitis Pigmentosa with Rhodopsin-P23H Mutant ���������������������� 421
Chen Yu and Daniel R. Saban

Part IX Mechanisms of Degeneration – Metabolism

Measuring the Release of Lactate from Wild-Type

and rd1 Mouse Retina������������������������������������������������������������������������������ 429
Yiyi Chen, Laimdota Zizmare, Christoph Trautwein,
and François Paquet-Durand
Aerobic Glycolysis in Photoreceptors Supports Energy
Demand in the Absence of Mitochondrial Coupling���������������������������� 435
Daniel T. Hass, Celia M. Bisbach, Martin Sadilek,
Ian R. Sweet, and James B. Hurley

Redox Status in Retinitis Pigmentosa���������������������������������������������������� 443
L. Olivares-González, S. Velasco, I. Campillo, J. M. Millán,
and R. Rodrigo
Perspectives on Retinal Dolichol Metabolism,
and Visual Deficits in Dolichol Metabolism-Associated
Inherited Disorders���������������������������������������������������������������������������������� 449
Sriganesh Ramachandra Rao, Steven J. Pittler,
and Steven J. Fliesler
Retinal Metabolic Profile on IMPG2 Deficiency Mice
with Subretinal Lesions �������������������������������������������������������������������������� 457
Rong Xu, Yekai Wang, Jianhai Du, and Ezequiel M. Salido

Part X Neuroprotection

Glutathione Coating of Liposomes Enhances the Delivery

of Hydrophilic Cargo to the Inner Nuclear Layer
in Retinal Cultures ���������������������������������������������������������������������������������� 467
Gustav Christensen and François Paquet-Durand
Modification of Müller Glial Cell Fate and Proliferation
with the Use of Small Molecules ������������������������������������������������������������ 473
Marcus J. Hooper
A Potential Neuroprotective Role for Pyruvate Kinase
2 in Retinal Degeneration������������������������������������������������������������������������ 479
Jiaming Zhou, Michel Rasmussen, and Per Ekström

Part XI Photoreceptors

Critical Role of VEGF as a Direct Regulator

of Photoreceptor Function���������������������������������������������������������������������� 487
Jianyan Hu, Meili Zhu, Dai Li, Qiang Wu, and Yun-Zheng Le
xviii Contents


Lysine Ubiquitylation Drives Rhodopsin Protein Turnover���������������� 493
Allen P. F. Chen, Leon Chea, Eun-Jin Lee,
and Jonathan H. Lin
 Silico Prediction of MYO1C-­Rhodopsin Interactions
In
and Its Significance in Protein Localization
and Visual Function �������������������������������������������������������������������������������� 499
Glenn P. Lobo, Rakesh Radhakrishnan, Matthias Leung,
Andrew Gruesen, Hans-­Joachim Knölker, Frederik J. van Kuijk,
and Sandra R. Montezuma
A Ciliary Branched Actin Network Drives
Photoreceptor Disc Morphogenesis�������������������������������������������������������� 507
William J. Spencer and Vadim Y. Arshavsky

Part XII RPE


Revisiting the Daily Timing of POS Phagocytosis�������������������������������� 515
Antonio E. Paniagua, Harjas S. Sabharwal, Kausalya Kethu,
Andrew W. Chang, and David S. Williams
Inhibition of Bacterial Peptidoglycan Cytopathy
by Retina Pigment Epithelial PGRP2 Amidase������������������������������������ 521
Marlyn P. Langford, Laura A. Perilloux-Lyons,
and A. Scott Kavanaugh
Understanding Ischemic Retinopathies: The Role
of Succinate and Its Receptor in Retinal
Pigment Epithelium �������������������������������������������������������������������������������� 527
Bilge Esin Ozturk

The Amphipathic Helix in Visual Cycle Proteins: A Review���������������� 533
Sheetal Uppal, Eugenia Poliakov, Susan Gentleman,
and T. Michael Redmond

The Retinal Pigment Epithelium: Cells That Know the Beat!������������ 539
Elora M. Vanoni and Emeline F. Nandrot

Part XIII Stem Cell Models and Therapies

Retinal Organoids: A Human Model System

for Development, Diseases, and Therapies�������������������������������������������� 549
Sangeetha Kandoi and Deepak A. Lamba

Modeling Retinitis Pigmentosa with Patient-Derived iPSCs �������������� 555
Yeh Chwan Leong and Jane C. Sowden

Primary Retinal Cell Cultures as a Model to Study
Retina Biology������������������������������������������������������������������������������������������ 565
Germán A. Michelis, Luis E. Politi, and S. Patricia Becerra
Contents xix

Generation of CRB1 RP Patient-­Derived iPSCs

and a CRISPR/Cas9-­Mediated Homology-Directed
Repair Strategy for the CRB1 c.2480G>T Mutation���������������������������� 571
Bruna Lopes da Costa, Yao Li, Sarah R. Levi, Stephen H. Tsang,
and Peter M. J. Quinn
Inducing Neural Regeneration from Glia Using Proneural
bHLH Transcription Factors������������������������������������������������������������������ 577
Levi Todd

Index�������������������������������������������������������������������������������������������������������� 583
 Part I
Age-related Macular Degeneration
 High-Resolution Imaging Mass
Spectrometry of Human Donor Eye:
Photoreceptors Cells and Basal
Laminar Deposit of Age-­Related
Macular Degeneration

David M. G. Anderson, Ankita Kotnala,

Jeffrey D. Messinger, Nathan Heath Patterson,
Jeffrey M. Spraggins, Christine A. Curcio,
Richard M. Caprioli, and Kevin L. Schey

Abstract nohistochemistry. Although both techniques

Pathologies of the retina are clinically visual-
ized in vivo with OCT and ex vivo with immu-
D. M. G. Anderson · N. H. Patterson · R. M. Caprioli
· K. L. Schey (*)
Department of Biochemistry, Vanderbilt University,
Nashville, TN, USA
Mass Spectrometry Research Center, Vanderbilt
University School of Medicine, Nashville, TN, USA
e-mail: k.schey@vanderbilt.edu
A. Kotnala
Department of Biochemistry, Vanderbilt University,
Nashville, TN, USA
Department of Ophthalmology and Visual Sciences,
University of Alabama at Birmingham,
Birmingham, AL, USA
J. D. Messinger · C. A. Curcio
Department of Ophthalmology and Visual Sciences,
University of Alabama at Birmingham,
Birmingham, AL, USA
J. M. Spraggins
Mass Spectrometry Research Center, Vanderbilt
University School of Medicine, Nashville, TN, USA
Department of Ophthalmology and Visual Sciences,
University of Alabama at Birmingham,
Birmingham, AL, USA
Department of Cell and Developmental Biology,
Vanderbilt University School of Medicine,
Nashville, TN, USA
provide valuable information on prognosis
and disease state, a comprehensive method for
fully elucidating molecular constituents pres-
ent in locations of interest is desirable. The
purpose of this work was to use multimodal
imaging technologies to localize the vast num-
ber of molecular species observed with
matrix-assisted laser desorption ionization
imaging mass spectrometry (MALDI IMS) in
aged and diseased retinal tissues. Herein,
MALDI IMS was utilized to observe molecu-
lar species that reside in photoreceptor cells
and also a basal laminar deposit from two
human donor eyes. The molecular species
observed to accumulate in these discrete
regions can be further identified and studied to
attempt to gain a greater understanding of bio-
logical processes occurring in debilitating eye
diseases such as age-related macular degener-
ation (AMD).
Keywords
Age-related macular degeneration · Macula ·
Retinal pigment epithelium · Photoreceptors ·
Basal lamina deposit · MALDI IMS

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 3

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_1
4 D. M. G. Anderson et al.
1 Introduction
Matrix-assisted laser desorption ionization
imaging mass spectrometry (MALDI IMS) can
localize and display the tissue distributions of
hundreds to thousands of molecules, at cellular
resolution, without the need for antibodies or
radioisotopes [1]. With effective co-registration
to multimodal optical imaging and optical
coherence topography (OCT) microscopy, these
distributions can be accurately correlated to
very small histological features of the neural
retina and retinal pigment epithelium (RPE).
MALDI IMS methods have been used to exam-
ine eye tissues including the retina [2–4], optic
nerve [4–6], lens [7, 8], and cornea [9]. Distinct
cell and synaptic layers of the retina have unique
layer-specific lipid and metabolite signatures
distinguished by IMS [4, 10, 11]. By applying
multimodal optical imaging technologies with
accurate registration and incorporating data-rich
IMS images [12], cellular and subcellular local-
ization of specific molecules informative to cell-
specific biochemistry can be observed. Human
retinal lipid composition studies have been per-
formed in the past. The results, while valuable,
provide limited information on cellular origin,
as experiments require dissections followed by
solvent extractions. MALDI IMS offers a
“molecular microscope” that localizes tissue
components in situ by molecular weights [11],
simultaneously providing hundreds to thou-
sands of spatially resolved signals. In this study,
we used a newly developed method of high-
accuracy registration [12] to co-­ register high
spatial resolution IMS images with OCT auto-
fluorescence and histological images of the
same tissue to examine subcellular localizations
and molecular features of photoreceptors and
AMD pathology.
2 Methods
This section has been summarized from Anderson
et al. [3]; for detailed explanations, please see
this reference.
2.1 Tissue Acquisition
and Characterization
Whole eyes were obtained from deceased human
donors via Advancing Sight Network (formerly
the Alabama Eye Bank) by the UAB authors.
2.2 Tissue Handling and Ex Vivo
Imaging
Methods were optimized for multimodal ex vivo
clinical imaging of the ocular fundus [13]. Globes
with lens and iris in place were immersed in buff-
ered 4% paraformaldehyde overnight. Iris and
lens were removed before imaging.
For imaging with OCT and scanning laser
ophthalmoscopy, globes were immersed in buffer
facing frontward within a custom-built chamber
with a 60-diopter lens [13]. Spectral domain
OCT images were captured with a Spectralis
(HRA&OCT, HRA2; Heidelberg Engineering).
Tissues were embedded in 2.5% carboxy-
methyl cellulose (Sigma C9481), and serial
10 μm cryosections were collected on Superfrost
glass slides and on large, 45 × 45 mm in-house,
polylysine-coated indium-tin-oxide (ITO) slides
(Delta Technologies Loveland, CO, USA).
2.3 MALDI IMS Analysis
The matrices 2,5-dihydroxyacetophenone (DHA)
and 1,5-diaminonaphthalene (DAN) (Sigma
Aldrich, St. Louis, MO, USA) were applied to
tissue sections by sublimation [14]. MALDI IMS
data were acquired with a laser spot size of
10–15 μm in full scan mode using a Bruker
SolariX 9.4T FTICR mass spectrometer (Bruker
Daltonics Billerica, MA, USA). Following data
acquisition, an advanced image registration
workflow [12] was performed. More detailed
information of the image registration process can
be found in publications by Patterson et al. [12]
and Anderson et al. [3]. Molecular identifications
were made using LC-MS of chloroform-­methanol
extracts from adjacent tissue sections.
High-Resolution Imaging Mass Spectrometry of Human Donor Eye: Photoreceptors Cells and Basal…
3 Results
3.1 Signals Specific
to Photoreceptors and RPE
Figure 1a shows MALDI IMS and optical micros-
copy focusing on photoreceptors and their
­support cells. The RPE sends delicate processes
in the apical direction to contact photoreceptor
outer segments, near the RPE cell body for rods
and 10–15 μm above the cell body, to contact
cone outer segments, which are shorter. Figure 1a
is color-coded depiction of photoreceptor and
RPE compartments associated with IMS signals
in Fig. 1b (blue ONL, red inner segments, yellow
outer segments, green RPE).
Figure 1b shows MALDI IMS images over-
laid with H&E images from this donor. The pho-
toreceptors on the left side of the image are
attached to the RPE and detached from the RPE
on the right side, a common artifact which can
occur during sample preparation. In Fig. 1a, the
signal at m/z 818.575 was observed with high
abundance in the ONL and was identified as
PE(20:0_22:6) (blue). This region is comprised
of the photoreceptor cell bodies and processes of
Müller (radial) glia. A highly localized signal can
be observed with high abundance along a narrow
band aligned with photoreceptor inner segments
at m/z 1426.0 (red). This signal was identified as
Fig. 1 MALDI IMS signals consistent with localization
to photoreceptor and RPE compartments. (a) Schematic
diagram of outer retina, excerpted from Fig. 1a. Blue,
pink, yellow, and green bands indicate layers formed by
highly compartmentalized and vertically aligned photore-
ceptors and RPE cells in panels b, c. Layers: OPL outer
plexiform layer, ONL outer nuclear layer, ELM external
limiting membrane, RPE retinal pigment epithelium, BrM
Bruch’s membrane, R rod, C cone photoreceptors. (b–f)
5
a cardiolipin CL(70:5). Cardiolipins are highly
abundant in mitochondria, which are abundant in
the ellipsoid portion of photoreceptor inner seg-
ments. At the distal part of the photoreceptor
cells, outer segments are highly interleaved with
apical processes of RPE cells. A DHA-containing
PE(18:0_22:6) is observed at m/z 790.539 (yel-
low) in panel D which can be observed with high
abundance in the outer segments, while a signal
observed at m/z 728.596 (green) is localized
above and within the RPE.
3.2 Signals Specific to Basal
Laminar Deposit
Figure 2 shows multimodal imaging of a 93-year-­
old donor tissue with the imaging modalities
separated into panels. Figure 2a displays ex vivo
OCT hyperreflective foci (yellow arrowhead) and
an RPE elevation (green arrowhead) near the
fovea. Figure 2b shows that retinal layers are vis-
ible in H&E-stained sections after IMS data
acquisition. The inset magnifies BLamD (PASH
staining of an alternate section), clearly indicat-
ing thickened extracellular matrix between the
RPE plasma membrane and its native basal lam-
ina. Figure 2c shows autofluorescence of the ele-
vated RPE layer and anteriorly migrated RPE
cells, which account for high-risk-indicating
MALDI IMS images and H&E-stained tissue images
overlaid in perifoveal retina displaying signals from mul-
tiple lipid classes that localize to subcellular compart-
ments of the photoreceptor cells. (b) Overlay showing
four separate signals. (c) Localized to ONL. (d) Localized
to photoreceptor inner and outer segments. (e) Localized
to mitochondria-rich photoreceptor inner segments. (f)
Localized to RPE apical processes
6 D. M. G. Anderson et al.
Fig. 2 Imaging mass spectrometry (IMS) for molecularly
informed optical coherence tomography (OCT) and
tissue-­level target discovery. Asterisk, foveal pit; RPE,
retinal pigment epithelium. Color-coded arrowheads rep-
resent corresponding structures across modalities, in a
93-year-old human donor eye. (a) OCT B-scan shows
subretinal hyperreflective material (yellow) and an RPE
elevation (green). (b) H&E stained cryosection shows
hyperreflective foci of clinical OCT. Figure 2d
shows that a sphingomyelin-related lipid
(PE-Cer-NMe2(42:1)) at m/z 799.671 [15] is
highly abundant and localizes to BLamD and
RPE, building on previous histochemical and
chromatography findings of lipids in this deposit
[16, 17].
pigmented debris (yellow) and dysmorphic RPE overly-
ing BLamD. Insert, BLamD with basal mound (arrow).
Basal mounds contain soft druse material. Layers: GCL
ganglion cell, INL inner nuclear, HFL Henle fiber, ONL
outer nuclear. (c) Autofluorescent, pigmented debris (yel-
low) and dysmorphic RPE (green). (d) IMS reveals an m/z
signal at 799.673, restricted to BLamD and not detected in
the RPE
4 Conclusions
MALDI IMS combined with multimodal imag-
ing methods and ex vivo OCT provides a power-
ful tool to elucidate the molecular composition
and localization of molecular species in key
regions and pathology associated with ocular dis-
High-Resolution Imaging Mass Spectrometry of Human Donor Eye: Photoreceptors Cells and Basal…
ease. Understanding molecular processes occur-
ring in BLamD in early AMD is important as
they are early-identified histologic risk factors
for AMD progression [18] and are just now being
recognized clinically [19, 20].
Acknowledgments This project was supported by the
National Institutes of Health P41 GM103391 (R.M.C.)
and R01 EY027948 (C.A.C.). Support was also received
by a Research to Prevent Blindness Catalyst Award for
Innovative Research Approaches for Age-Related Macular
Degeneration to K.L.S.
References
1. Caprioli RM, Farmer TB, Gile J. Molecular imag-
ing of biological samples: localization of peptides
and proteins using MALDI-TOF MS. Anal Chem.
1997;69(23):4751–60.
2. Bowrey HE, Anderson DM, Pallitto P, Gutierrez DB,
Fan J, Crouch RK, et al. Imaging mass spectrometry
of the visual system: advancing the molecular under-
standing of retina degenerations. Proteomics Clin
Appl. 2016;10(4):391–402.
3. Anderson DMG, Messinger JD, Patterson NH, Rivera
ES, Kotnala A, Spraggins JM, et al. Lipid landscape
of the human retina and supporting tissues revealed
by high resolution imaging mass spectrometry. bioR
xiv:2020:2020.04.08.029538.
4. Zemski Berry KA, Gordon WC, Murphy RC, Bazan
NG. Spatial organization of lipids in the human retina
and optic nerve by MALDI imaging mass spectrom-
etry. J Lipid Res. 2014;55(3):504–15.
5. Anderson DM, Spraggins JM, Rose KL, Schey
KL. High spatial resolution imaging mass spectrom-
etry of human optic nerve lipids and proteins. J Am
Soc Mass Spectrom. 2015;26(6):940–7.
6. Stark DT, Anderson DMG, Kwong JMK, Patterson
NH, Schey KL, Caprioli RM, et al. Optic nerve regen-
eration after crush remodels the injury site: molecu-
lar insights from imaging mass spectrometryoptic
nerve regeneration imaging mass spectrometry. Invest
Ophthalmol Vis Sci. 2018;59(1):212–22.
7. Grey AC, Schey KL. Age-related changes in the spa-
tial distribution of human lens alpha-crystallin prod-
ucts by MALDI imaging mass spectrometry. Invest
Ophthalmol Vis Sci. 2009;50(9):4319–29.
8. Stella DR, Floyd KA, Grey AC, Renfrow MB,
Schey KL, Barnes S. Tissue localization and solu-
bilities of alphaA-crystallin and its numerous
C-terminal truncation products in pre- and postcata-
ractous ICR/f rat lenses. Invest Ophthalmol Vis Sci.
2010;51(10):5153–61.
7
9. Chen Y, Jester JV, Anderson DM, Marchitti SA, Schey
KL, Thompson DC, et al. Corneal haze phenotype
in Aldh3a1-null mice: in vivo confocal microscopy
and tissue imaging mass spectrometry. Chem Biol
Interact. 2017;276:9–14.
10. Anderson DM, Ablonczy Z, Koutalos Y, Spraggins
J, Crouch RK, Caprioli RM, et al. High reso-
lution MALDI imaging mass spectrometry of
retinal tissue lipids. J Am Soc Mass Spectrom.
2014;25(8):1394–403.
11. Anderson DMG, Ablonczy Z, Koutalos Y,
Hanneken AM, Spraggins JM, Calcutt MW, et al.
Bis(monoacylglycero)phosphate lipids in the retinal
pigment epithelium implicate lysosomal/endosomal
dysfunction in a model of Stargardt disease and
human retinas. Sci Rep. 2017;7(1):17352.
12. Patterson NH, Tuck M, Van de Plas R, Caprioli
RM. Advanced registration and analysis of
MALDI imaging mass spectrometry measurements
through autofluorescence microscopy. Anal Chem.
2018;90(21):12395–403.
13. Pang CE, Messinger JD, Zanzottera EC, Freund KB,
Curcio CA. The onion sign in neovascular age-related
macular degeneration represents cholesterol crystals.
Ophthalmology. 2015;122(11):2316–26.
14. Hankin J, Barkley R, Murphy R. Sublimation as
a method of matrix application for mass spec-
trometric imaging. J Am Soc Mass Spectrom.
2007;18(9):1646–52.
15. Liu A, Chang J, Lin Y, Shen Z, Bernstein PS. Long-­
chain and very long-chain polyunsaturated fatty acids
in ocular aging and age-related macular degeneration.
J Lipid Res. 2011;51:3217–29.
16. Curcio CA, Presley JB, Malek G, Medeiros NE,
Avery DV, Kruth HS. Esterified and unesteri-
fied cholesterol in drusen and basal deposits of
eyes with age-related maculopathy. Exp Eye Res.
2005;81(6):731–41.
17. Wang L, Li C-M, Rudolf M, Belyaeva OV, Chung
BH, Messinger JD, et al. Lipoprotein particles of
intraocular origin in human Bruch membrane: an
unusual lipid profile. Invest Ophthalmol Vis Sci.
2009;50(2):870–7.
18. Sarks SH. Ageing and degeneration in the macular
region: a clinico-pathological study. Br J Ophthalmol.
1976;60(5):324–41.
19. Tan ACS, Astroz P, Dansingani KK, Slakter JS,
Yannuzzi LA, Curcio CA, et al. The plateau, an
optical coherence tomographic signature of geo-
graphic atrophy: evolution, multimodal imaging,
and candidate histology. Invest Ophthalmol Vis Sci.
2017;58(4):2349–58.
20. Sura AA, Chen L, Messinger JD, Swain TA, McGwin
G Jr, Freund KB, et al. Measuring the contributions of
basal laminar deposit and Bruch’s membrane in age-­
related macular degeneration. Invest Ophthalmol Vis
Sci. 2020;61(13):19.
 The Noncanonical Role
of Complement Factor H in Retinal
Pigment Epithelium (RPE) Cells
and Implications for Age-Related
Macular Degeneration (AMD)

Angela Armento, David Adrian Merle,

and Marius Ueffing

Abstract pathway of the complement system, and the

Age-related macular degeneration (AMD) is a
complex degenerative disease of the retina.
Dysfunction of the retinal pigment epithelium
(RPE) occurs in early stages of AMD, and
progressive RPE atrophy leads to photorecep-
tor death and visual impairments that ulti-
mately manifest as geographic atrophy (GA),
one of the late-stage forms of AMD. AMD is
caused by a combination of risk factors includ-
ing aging, lifestyle choices, and genetic pre-
disposition. A gene variant in the complement
factor H gene (CFH) that leads to the Y402H
polymorphism in the factor H protein (FH)
confers the second highest risk for the devel-
opment and progression of AMD. FH is a
major negative regulator of the alternative
FH Y402H variant leads to increased comple-
ment activation, which is detectable in AMD
patients. For this reason, various therapeutic
approaches targeting the complement system
have been developed, however, so far with
very limited or no efficacy. Interestingly,
recent studies suggest roles for FH beyond
complement regulation. Here, we will discuss
the noncanonical functions of FH in RPE cells
and highlight the potential implications of
those functions for future therapeutic
approaches.
Keywords
Age-related macular degeneration (AMD) ·
Retinal pigment epithelium (RPE) cells ·
Intracellular complement factor H (CFH)

A. Armento (*) · M. Ueffing

Institute for Ophthalmic Research, Department for
Ophthalmology, Eberhard Karls University of
Tübingen, Tübingen, Germany
e-mail: angela.armento@uni-tuebingen.de;
marius.ueffing@uni-tuebingen.de
D. A. Merle
Institute for Ophthalmic Research, Department for
Ophthalmology, Eberhard Karls University of
Tübingen, Tübingen, Germany
Department of Ophthalmology, Medical University of
Graz, Graz, Austria
e-mail: david.merle@medunigraz.at
1 Introduction
Age-related macular degeneration (AMD) is a
complex and progressive disease of the macula,
which affects mainly the elderly population,
especially in the developed countries [1, 2]. Due
to demographic changes in western societies,
AMD incidence is constantly rising, and the con-
comitant visual impairment threatens not only

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 9

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_2
10
the individual’s quality of life but also poses a
significant burden on healthcare systems world-
wide [3]. The early stages of the disease are char-
acterized by the presence of enlarging drusen in
the retina. With disease progression, early AMD
advance to late stages: wet or dry AMD. Wet
AMD is defined by the presence of neovascular-
ization in the retina, while dry AMD is limited to
progressive RPE and retinal atrophy, called geo-
graphic atrophy (GA), without newly formed
vessels. Around 10% of the cases constitute wet
AMD, and intravitreal anti-VEGF is effective in
treating most cases. However, only recently,
one approved treatment has become available for
dry AMD in the US [2, 8].
The main pathogenetic driver for AMD is
advanced age. Specific genetic factors can pre-
dispose for AMD or protect from it. Unhealthy
lifestyle habits, like smoking or malnutrition,
can further increase the risk for AMD. The com-
bination of those risk factors leads to pathologi-
cal changes in the retina, involving a plethora of
cellular mechanisms promoting disease pro-
gression [4].
2 Complement System in AMD
Among the processes involved in AMD, the com-
plement system is associated to AMD at different
levels. First of all, many single nucleotide poly-
morphisms (SNPs) associated with AMD cluster
into genes of the alternative pathway of the com-
plement system with the Complement Factor H
(CFH) gene carrying the second highest risk for
AMD [5]. The most common risk haplotype
causes an amino acid substitution from tyrosine
to histidine at position 402 (called Y402H) in
proteins coded by CFH, which are full length FH
and a truncated version, FHL-1 [6, 7]. The com-
plement system is a part of the innate immune
system designed to recognize and mediate the
removal of pathogens or waste material [8]. The
eye is an immune-privileged organ, meaning that
inflammation needs to be strictly limited, and
therefore uncontrolled complement activation is
deleterious [8]. FH is a major negative regulator
of the complement system, and the AMD variant
A. Armento et al.
402H of FH causes uncontrolled complement
activation in vitro and in vivo [9]. Moreover,
complement factors accumulate in drusen [10],
and increased complement system activation has
been detected in AMD patients, independent of
their genotype [11].
Due to the strong implications of complement
system activation in AMD pathology, various
complement inhibitors have been tested in clini-
cal trials. However, most agents that entered
phase II were discontinued due to a reported lack
of efficacy. Interestingly, in some clinical trials, a
group of subjects showed improvements, while
others did not [12]. Apparently, one of the sus-
pected reasons for the observed lack of efficacy is
a lack of patient’s stratification and identification
of those patients that are likely to benefit from
complement inhibition. Moreover, several stud-
ies point to a lack of understanding of the role of
FH in AMD pathology, especially in RPE cells,
which are degenerating in AMD.
3 Noncanonical Role
of Complement Factor H
in RPE Cells
RPE cells exert several functions vital for retinal
homeostasis, which are impaired in AMD [13].
First of all, RPE cells are responsible for phago-
cytosis of shed photoreceptor outer segments
(POS) and recycling of visual pigments, needed
for a proper visual cycle. This process is energy
intensive, requiring constant mitochondrial res-
piration and glycolysis within RPE cells. Due to
a lack of the inner retina vasculature in the mac-
ula, RPE cells are vital to ascertain nutrient sup-
ply from the choriocapillaris. Any pathological
disruption or perturbance of metabolic activity
of RPE cells would affect the amount of nutri-
ents that can reach the neuroretina. Indeed, the
so-­called bioenergetics crisis of RPE cells has
been described for AMD pathology [14].
Moreover, RPE cells quench short UV light as
well as the continuous influx of peroxidized lip-
ids from phagocytosed photoreceptor outer seg-
ments and thus need a high degree of antioxidant
capacity as well as perfect functioning of their
The Noncanonical Role of Complement Factor H in Retinal Pigment Epithelium (RPE) Cells and…
mitochondria to protect the retina from exces-
sive oxidative stress.
Our recent work demonstrates that FH is
endogenously produced by RPE cells. Within
RPE cells, FH is acting locally supporting retinal
homeostasis [15, 16]. This function of FH is con-
text dependent, and we suggest that locally pro-
duced FH exerts specific functions at the
RPE/retina interface. Most of these newly dis-
covered functions (summarized in Fig. 1) affect a
balanced regulation of immune competence and
surveillance as well as regulating oxidative stress
response and energy metabolism, mechanisms
which are part of AMD pathology [8].
FH plays a protective role against oxidative
stress in RPE cells. Exogenously applied recom-
binant FH protects RPE cells from damage
induced by the exposure to lipid oxidation prod-
ucts [17, 18]. In parallel, loss of endogenous FH
in RPE cells, via CFH silencing, also led to
increased vulnerability to oxidative stress,
increased levels of oxidized lipids, and reduced
viability [15]. Interestingly, addition of recombi-
nant FH in CFH-silenced RPE cells did not cause
any rescuing effects [15]. This finding indicates
that, although exogenous FH is protective, a
proper intracellular FH function must be present
to ascertain physiological balance and resilience
to stress. This phenomenon may be explained by
impaired mitochondrial function seen in iPSC-­
RPE cells carrying the CFH Y402H polymor-
phism [19] and CFH-silenced hTERT-RPE1 cells
[15]. In both models, major processes involved in
energy production, glycolysis, and mitochondrial
respiration are impaired. In addition, a misbal-
ance in the degree of mitochondria turnover
seems to be involved, with an exaggerated
increase in mitophagy [15, 19]. Moreover, it has
been shown in iPSC-RPE carrying CFH 402H
variant that mitochondria are enlarged and accu-
mulating [20]. Mitochondria are essential for a
correct response to oxidative stress; therefore,
damage or dysfunction of these organelles is del-
eterious in such an oxidative milieu like the ret-
ina. Accumulation of oxidized lipids has been
reported in RPE cells under FH dysregulation
and induced oxidative stress, when FH function
was impaired as a consequence of CFH silencing
11
[15] or in the presence of the CFH 402H variant
[20]. Moreover, accumulation of lipids was
shown also in cfh Y402H mouse models of AMD,
especially when subjected to high cholesterol
diet [21].
The mechanism of action of intracellular FH
is not fully elucidated. Based on the data gener-
ated in iPSC-RPE cells carrying the CFH 402H
variant, it has been speculated that more than one
signaling pathway mediates the effects of FH
[19]. Specifically, it has been postulated that the
NF-kB pathway and mTOR pathway are likely
involved, in concomitance with autophagy and
proteasome activity dysregulation, which ulti-
mately lead to mitochondrial damage [19].
In our model of CFH-silenced hTERT-RPE1
cells, we could verify these hypotheses. Indeed,
we found that in absence of endogenous FH, both
the NF-kB and mTOR pathway are upregulated,
with NF-kB triggering pro-inflammatory cyto-
kine expression [22] and the mTOR pathway
modulating mitochondrial respiration, but not
glycolysis [23]. The mTOR pathway is a major
regulator of autophagy [24]. Dysfunction in the
autophagy-lysosomal axis in iPSC-RPE cells
with CFH high risk was reported but is not regu-
lated by this pathway. Its dysfunction rather
depends on the accumulation of complement
activation products [25]. Based on our analyses
of the intracellular FH protein interactions that
form a functional interactome in RPE cells, we
suggest a regulatory role of FH in interaction
with the ubiquitin proteasome system (UPS) and
RB1/E2F signaling, adding a new level of com-
plexity in the understanding of FH mechanism of
action [23]. Interestingly, and based on studies in
other cell types than RPE, it has already been
suggested that FH has a noncanonical intracellu-
lar function, independent from complement acti-
vation. In clear renal cell carcinoma cells and
kidney endothelial cells, FH knockdown impairs
cellular homeostasis, at least partially via NF-kB
activation [26, 27].
The synopsis of these findings indicates that
understanding the function of FH in a specific
cell and tissue context is key. In the context of
AMD, it is important to advance our understand-
ing on how RPE cells interact with the neuroret-
12
Fig. 1 Schematic representation of the noncanonical functions of FH in RPE cells
ina once intracellular FH dysregulation or a CFH
402H high risk variant perturbs intracellular
homeostasis within these cells. In this regard, we
have recently established a novel coculture model
of RPE and neuroretina. Using this system, we
show that CFH-silenced RPE cells promote reti-
nal degeneration, which could not be rescued by
the addition of exogenous FH. Moreover, we
showed that the damage occurred at the level of
mitochondrial activity and lipid oxidation in the
photoreceptors, rather than a canonical inflam-
mation or complement activation [16].
4 Future Perspective
Recent works of several groups, including ours,
emphasize a noncanonical and intracellular role
of FH in RPE cells. Besides their reduced capac-
ity to dampen alternative complement activity,
CFH risk polymorphisms such as Y402H impair
RPE homeostasis and are likely contributing to
promote AMD. In consequence, a simple comple-
A. Armento et al.
ment pathway inhibitor strategy to treat AMD
progression may not suffice. Rational re-­balancing
strategies in a form of combinatorial therapies
may be needed to target several drivers of AMD
molecular pathology in a systems-­oriented fash-
ion simultaneously. More specifically, the increase
of alternative complement pathway activity at the
Bruch’s membrane/RPE interface may have to be
considered concomitantly with pro-inflammatory,
oxidative stress-­ related perturbation and meta-
bolic disbalance of RPE and neuroretina to
achieve effective future therapeutic regimes for
dry AMD. Last but not least, a very thorough
stratification of patient groups may be needed to
move to an individualized and rational therapy for
dry AMD of the future.
References
1. Ferris FL 3rd, Wilkinson CP, Bird A, Chakravarthy
U, Chew E, Csaky K, et al. Clinical classification of
age-related macular degeneration. Ophthalmology.
2013;120(4):844–51.
The Noncanonical Role of Complement Factor H in Retinal Pigment Epithelium (RPE) Cells and…
2. van Lookeren Campagne M, LeCouter J, Yaspan BL,
Ye W. Mechanisms of age-related macular degen-
eration and therapeutic opportunities. J Pathol.
2014;232(2):151–64.
3. Wong WL, Su X, Li X, Cheung CM, Klein R, Cheng
CY, et al. Global prevalence of age-related macular
degeneration and disease burden projection for 2020
and 2040: a systematic review and meta-analysis.
Lancet Glob Health. 2014;2(2):e106–16.
4. Armstrong RA, Mousavi M. Overview of risk factors
for age-related macular degeneration (AMD). J Stem
Cells. 2015;10(3):171–91.
5. Fritsche LG, Fariss RN, Stambolian D, Abecasis GR,
Curcio CA, Swaroop A. Age-related macular degen-
eration: genetics and biology coming together. Annu
Rev Genomics Hum Genet. 2014;15:151–71.
6. Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS,
Haynes C, et al. Complement factor H polymor-
phism in age-related macular degeneration. Science.
2005;308(5720):385–9.
7. Day AJ, Willis AC, Ripoche J, Sim RB. Sequence
polymorphism of human complement factor
H. Immunogenetics. 1988;27(3):211–4.
8. Armento A, Ueffing M, Clark SJ. The complement
system in age-related macular degeneration. Cell Mol
Life Sci. 2021;78(10):4487–505.
9. Skerka C, Lauer N, Weinberger AA, Keilhauer
CN, Suhnel J, Smith R, et al. Defective comple-
ment control of factor H (Y402H) and FHL-1 in
age-related macular degeneration. Mol Immunol.
2007;44(13):3398–406.
10. Mullins RF, Russell SR, Anderson DH, Hageman
GS. Drusen associated with aging and age-related
macular degeneration contain proteins common to
extracellular deposits associated with atherosclero-
sis, elastosis, amyloidosis, and dense deposit disease.
FASEB J. 2000;14(7):835–46.
11. Heesterbeek TJ, Lechanteur YTE, Lores-Motta L,
Schick T, Daha MR, Altay L, et al. Complement
activation levels are related to disease stage in
AMD. Invest Ophthalmol Vis Sci. 2020;61(3):18.
12. Park DH, Connor KM, Lambris JD. The challenges
and promise of complement therapeutics for ocular
diseases. Front Immunol. 2019;10:1007.
13. Strauss O. The retinal pigment epithelium in visual
function. Physiol Rev. 2005;85(3):845–81.
14. Fisher CR, Ferrington DA. Perspective on AMD
pathobiology: a bioenergetic crisis in the RPE. Invest
Ophthalmol Vis Sci. 2018;59(4):AMD41–AMD7.
15. Armento A, Honisch S, Panagiotakopoulou V,
Sonntag I, Jacob A, Bolz S, et al. Loss of comple-
ment factor H impairs antioxidant capacity and
energy metabolism of human RPE cells. Sci Rep.
2020;10(1):10320.
16. Armento A, Murali A, Marzi J, Arrango-Gonzalez
B, Kilger E, Clark SJ, et al. FH loss in RPE cells
causes retinal degeneration in a human RPE-­
13
porcine retinal explant co-culture model. bioR
xiv:2021:2021.07.26.453778.
17. Borras C, Canonica J, Jorieux S, Abache T, El
Sanharawi M, Klein C, et al. CFH exerts anti-oxidant
effects on retinal pigment epithelial cells indepen-
dently from protecting against membrane attack com-
plex. Sci Rep. 2019;9(1):13873.
18. Krilis M, Qi M, Qi J, Wong JWH, Guymer R,
Liew G, et al. Dual roles of different redox forms
of complement factor H in protecting against age
related macular degeneration. Free Radic Biol Med.
2018;129:237–46.
19. Ebeling MC, Geng Z, Kapphahn RJ, Roehrich H,
Montezuma SR, Dutton JR, et al. Impaired mitochon-
drial function in iPSC-retinal pigment epithelium
with the complement factor H polymorphism for age-­
related macular degeneration. Cell. 2021;10(4):789.
20. Hallam D, Collin J, Bojic S, Chichagova V, Buskin A,
Xu Y, et al. An induced pluripotent stem cell patient
specific model of complement factor H (Y402H)
polymorphism displays characteristic features of
age-related macular degeneration and indicates a
beneficial role for UV light exposure. Stem Cells.
2017;35(11):2305–20.
21. Ding JD, Kelly U, Groelle M, Christenbury JG, Zhang
W, Bowes Rickman C. The role of complement dys-
regulation in AMD mouse models. Adv Exp Med
Biol. 2014;801:213–9.
22. Armento A, Schmidt TL, Sonntag I, Merle DA,
Jarboui MA, Kilger E, et al. CFH loss in human RPE
cells leads to inflammation and complement system
dysregulation via the NF-kappaB pathway. Int J Mol
Sci. 2021;22(16):8727.
23. Merle D, Provenzano F, Jarboui MA, Kilger E, Clark
S, Deleidi M, et al. mTOR inhibition via Rapamycin
treatment partially reverts the deficit in energy
metabolism caused by FH loss in RPE cells. bioR
xiv:2021:2021.10.29.466270.
24. Wang Y, Zhang H. Regulation of autophagy by mTOR
signaling pathway. In: Qin Z-H, editor. Autophagy:
biology and diseases: basic science. Singapore:
Springer; 2019. p. 67–83.
25. Cerniauskas E, Kurzawa-Akanbi M, Xie L, Hallam D,
Moya-Molina M, White K, et al. Complement modu-
lation reverses pathology in Y402H-retinal pigment
epithelium cell model of age-related macular degen-
eration by restoring lysosomal function. Stem Cells
Transl Med. 2020;9(12):1585–603.
26. Daugan MV, Revel M, Thouenon R, Dragon-Durey
MA, Robe-Rybkine T, Torset C, et al. Intracellular
factor H drives tumor progression independently
of the complement cascade. Cancer Immunol Res.
2021;9:909–25.
27. Mahajan S, Jacob A, Kelkar A, Chang A, McSkimming
D, Neelamegham S, et al. Local complement factor H
protects kidney endothelial cell structure and func-
tion. Kidney Int. 2021;100(4):824–36.
 Macular Pigment Carotenoids
and Bisretinoid A2E

Ranganathan Arunkumar and Paul S. Bernstein

Abstract Keywords

Lutein (L), zeaxanthin (Z), and meso-­ Abca4 · A2E · Antioxidant · Bisretinoids ·
zeaxanthin (MZ) are the three macular pig- Carotenoids · Lipofuscin · Macular pigments
ments (MP) carotenoids that uniquely · Photo-oxidation · Retina · Retinal pigment
accumulate in the macula lutea region of the epithelium
human retina. L and Z are obtained by humans
through dietary intake. The third MP, MZ, is
rarely present in diet, and its abundance in the 1 Introduction
human fovea is due to the metabolic conver-
sion of dietary L by the retinal pigment epithe- Carotenoids are natural pigments synthesized by
lium’s RPE65 enzyme. The major functions of photosynthetic bacteria, algae, yeast, and plants.
MP in ocular health are to filter high-intensity, L, Z, and MZ are oxygenated carotenoids (xan-
phototoxic blue light and to act as effective thophylls) obtained by humans through dietary
antioxidants for scavenging free radicals. The intake of leafy greens, fruits, and vegetables.
pyridinium bisretinoid, N-retinylidene-N-­ Among the 15 major dietary carotenoids detected
retinylethanolamine (A2E), contributes to in human serum, these three xanthophyll carot-
drusen formation in dry age-related macular enoids selectively accumulate with a unique dis-
degeneration (AMD) and to the autofluores- tribution in the macular region of human retina
cent flecks in autosomal recessive Stargardt [1]. The MP’s total concentration is about 1 mM
disease (STGD1). Retinal carotenoids attenu- at the fovea, and its concentration declines to less
ate A2E formation and can directly and indi- than 10 μM in the peripheral retina [2]. The ratio
rectly alleviate A2E-mediated oxidative of L:Z:MZ in the peripheral retina is about 3:1:0,
damage. In this chapter, we review these more and the concentration of total carotenoids rises
recently recognized interconnections between 100-fold in the macula lutea with a change in the
MP carotenoids and A2E bisretinoids. ratio of L:Z:MZ of about 1:1:1, as measured by
high-performance liquid chromatography
(HPLC) [3]. More recently, high-resolution con-
R. Arunkumar · P. S. Bernstein (*) focal resonance Raman microscopy imaging of
Department of Ophthalmology and Visual Sciences, the human retina from our laboratory has showed
John A. Moran Eye Center, University of Utah that the ratio of Z + MZ:L can be greater than 9:1
School of Medicine, Salt Lake City, UT, USA at the foveal center, while L is more diffusely dis-
e-mail: paul.bernstein@hsc.utah.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 15

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_3
16 R. Arunkumar and P. S. Bernstein

tributed across the macula at a relatively lower aided by conjugated double-bond structure with
concentration [4]. Retinal carotenoids mainly the hydrophilic group on the ionone ring [2]. The
localize to the outer plexiform (Henle fiber) layer absorption maximum of L is around 445 nm, and
and the inner plexiform layer, with axial exten- Z is around 450 nm, corresponding with the haz-
sion from the inner limiting membrane to the ardous blue light range of 430–500 nm.
outer limiting membrane. The specificity in the Depending on the retinal carotenoid concentra-
distribution of retinal carotenoids in the human tion, they are estimated to absorb 40–90% of
retina may be due to the selective uptake of reti- incident short-wavelength, high-energy photo-
nal carotenoids by carotenoid binding proteins toxic blue light [8].
StARD3 (L binding protein) and GSTP1 (Z and Retinal carotenoids with conjugated double
MZ binding protein). The other major factors that bond (C=C) structures are associated with greater
influence the MP carotenoid distributions and singlet oxygen quenching. Z has 11 conjugated
concentrations between individuals are the double bonds and is 50% better at quenching sin-
amount of oral intake of carotenoids and their glet oxygen relative to L with its 10-conjugated
bioavailability [5]. L is present in higher concen- double bonds [9]. MZ, a stereoisomer of Z, with
trations in the diet, but it is converted to MZ by an identical 11-conjugated double-bond structure
the RPE65 enzyme, and the preferential accumu- would be expected to possess the same antioxi-
lation of Z and MZ at the foveal center may be dant properties as Z, but it exhibited better singlet
due to their higher antioxidant potential relative oxygen quenching properties relative to L and Z
to L. The fovea is prone to photo-damage caused [9]. Furthermore, the antioxidant activity of all
by light-induced oxidative stress from reactive three retinal carotenoids as a mixture showed bet-
oxygen species, and singlet oxygen can be gener- ter singlet oxygen quenching ability than any of
ated by photo-oxidation of A2E and other bisreti- the individual MP carotenoids. Retinal carot-
noid components of lipofuscin [6]. A2E acts as a enoids not only quench singlet oxygen, but they
photosensitizer in the presence of short-­ also quench superoxide anion radicals and
wavelength blue light and oxygen that generate hydroxyl radicals, the major causative agents of
reactive oxygen caused by photo-oxidation and lipid peroxidation and light-induced damage [10,
photo-degradation, resulting in retinal degenera- 11]. Generally, retinal carotenoids are better
tion and apoptosis of photoreceptor and RPE hydroxyl radical scavengers than superoxide
cells [7]. Supplementation with retinal carot- anion scavengers, and Z exhibits better hydroxyl
enoids potentially attenuates harmful blue light radical scavenging activity than lutein [10]. MP
and effectively scavenges singlet oxygen and carotenoids protect the retina, which is vulnera-
reactive free radicals in ocular tissues and in bio- ble to oxidative damage caused by exposure to
chemical assays. light, high concentration of oxygen, abundant
photosensitizers, and high concentrations of
polyunsaturated fatty acids (PUFAs).
2 Structure and Function
of the Retinal Carotenoids
3 A2E Bisretinoids
Retinal carotenoids are characterized by the pres-
ence of hydroxyl (O-H) functional groups In the visual cycle, the activation of rhodopsin by
attached at the 3 and 3′ positions of terminal ion- a photon of light during phototransduction results
one rings connected by an isoprenoid backbone in the isomerization of 11-cis-retinal to all-trans-­
structure (Fig. 1). The presence of hydroxyl retinal in photoreceptor outer segments and the
groups and the conjugated double bonds struc- release of all-trans-retinal, which is subsequently
ture determine the light-absorbing properties and reduced to all-trans-retinol and transported to the
antioxidant activities of retinal carotenoids. The RPE cells. In the RPE, the all-trans-retinol is
light filtering function of retinal carotenoids is either stored as a fatty acid ester or is converted
Macular Pigment Carotenoids and Bisretinoid A2E
HO
Lutein
HO
Zeaxanthin
HO
Meso-Zeaxanthin
Fig. 1 Structures of the macular carotenoids: lutein (L), zeaxanthin (Z), meso-zeaxanthin (MZ), and N-retinylidene-N-­
retinylethanolamine (A2E)
back to an 11-cis-retinoid that is transported back
to the photoreceptor outer segment, which can
bind to opsin to produce a regenerated visual pig-
ment. Some all-trans-retinal in the photoreceptor
outer segments reacts with phosphatidylethanol-
amine (PE) to form N-retinylidene-PE (NRPE),
which is transported or “flipped” by the ATP-­
binding cassette, subfamily A, member 4
(ABCA4) protein present in photoreceptor outer
segments. ABCA4 translocates NRPE across the
lipid bilayer from the luminal side to the cyto-
plasmic side of the disc membrane. NRPE
released on the cytoplasmic side is hydrolyzed
into all-trans-retinal and reduced to all-trans-­
retinol by retinol dehydrogenases (RDHs) [12]. If
ABCA4 does not effectively translocate NRPE, it
reacts with one more molecule of all-trans-­retinal
to form a toxic bisretinoid, dihydropyridinium-­
A2PE. Dihydropyridinium-A2PE is further
oxidized either to A2-dihydropyridine-PE
­ loss of membrane integrity and perturbs mem-
(A2-DHP-PE) by eliminating one hydrogen or to
phosphatidylethanolamine-pyridinium bisreti-
noid (A2PE) by eliminating two hydrogens in the
acidic and oxidizing environment (Fig. 2). During
phagocytosis of photoreceptor outer segments by
17
OH
OH
OH
N
OH
A2E
RPE, A2PE is further hydrolyzed to A2E by
phospholipase D inside RPE phagosomes.
Mutation or dysfunction in the ABCA4 gene
leads to excessive accumulation of A2E and other
bisretinoids in RPE lipofuscin, resulting in reti-
nal cell death and vision loss. A2E is reported to
accumulate with aging and dry AMD and in
STGD1 [13].
A2E (C42H58ON; molecular weight, 592) is a
well-characterized component of lipofuscin. It
exhibits absorbance in both the UV and visible
regions of the spectrum [A2E: absorbance max-
ima (λmax) are 440 and 340 nm, and iso-A2E’s
λmax are 430 and 340 nm]. A2E’s hydrophobic
side arms and positively charged hydrophilic
head group confer an amphiphilic structure
(Fig. 1). A2E has a detergent-like structure that
may influence membrane properties and inhibit
the lysosomal degradation of lipids. A2E induces
brane stability, and it inhibits cytochrome C oxy-
genase and the ATP-driven proton pump. A2E
photo-oxidation products can activate the com-
plement system and cause inflammation and
DNA damage [12, 13].
18
Fig. 2 The visual cycle and bisretinoid formation in pho-
toreceptor outer segments and RPE. When a photon of
light is captured by the visual chromophore, its 11-cis-­
retinal (11-cis-RAL) Schiff base chromophore photoi-
somerizes to all-trans-retinal (all-trans-RAL). The
released all-trans-RAL from opsin is reduced to all-trans-­
retinol (all-trans-ROL) by retinol dehydrogenases
(RDHs). Alternatively, some all-trans-RAL reacts with
phosphatidylethanolamine (PE) in the photoreceptor outer
segments to form N-retinylidene-PE (NRPE), which is
transported by ABCA4. The bisretinoid synthesis path-
way (red) is initiated when NRPE, rather than hydrolyzing
to all-trans-ROL and PE, reacts with a second molecule of
retinaldehyde. A multistep pathway leads to the formation
of the intermediate dihydropyridinium-A2PE. Auto-­
oxidation of dihydropyridinium-A2PE with loss of two
4 Retinal Carotenoids
Attenuate Bisretinoids
in Various Systems
4.1 In Vitro
A2E and its precursor A2PE can be irradiated
with 430 nm blue light and analyzed by fast atom
bombardment mass spectroscopy (FAB-MS).
The FAB-MS spectra after irradiation not only
showed a molecular ion peak at m/z 592 and 1223
attributable to A2E and A2PE, but they also
R. Arunkumar and P. S. Bernstein
hydrogens generates A2PE, and loss of one hydrogen gen-
erates A2-DHP-PE; phosphate hydrolysis of the latter
produces A2-DHP-E. A2E, lysoA2PE, and A2-GPE are
produced from A2PE. Reaction of the all-trans-RAL
dimer with PE with the formation of a Schiff base linkage
generates all-trans-retinal dimer-PE (atRALdi-PE), and
phosphate hydrolysis of the latter yields all-trans-retinal
dimer-ethanolamine (atRALdi-E). All-trans-ROL is
transported into RPE cells where all-trans-ROL is esteri-
fied to fatty acids to make all-trans retinyl esters (all-­
trans-­RE) by the enzyme lecithin retinol acyl transferase
(LRAT). All-trans-RE is converted to 11-cis retinol
(11-cis-ROL) by the RPE65 isomerohydrolase. 11-cis
retinol dehydrogenase (11cRDH) oxidizes 11-cis-ROL to
11-cis-RAL which enters the photoreceptor outer seg-
ments for the regeneration of opsin
showed additional peaks at m/z 608, 624, 640,
656, 672, and 688, as well as 1239, 1255, 1271,
and 1286. The additional higher m/z peaks are
photo-oxidation products of A2E and A2PE
formed by the insertion of oxygen atoms at the
C=C bonds along the side arms of A2E and
A2PE. When A2E and A2PE are irradiated at
430 nm in the presence of L and Z, the additional
photo-oxidized peaks are absent [14]. Singlet
oxygen quenching abilities of retinal carotenoids
were studied in the presence of endoperoxide
1,4-dimethylnapthalene (1 mM), which releases
Macular Pigment Carotenoids and Bisretinoid A2E 19

singlet oxygen with a half-life time of 5 h. @ 3.1-fold in the zeaxanthin-supplemented

25 °C. The endoperoxide was incubated with
A2E (500 μM) with and without retinal carot-
enoids (500 μM to 4 mM). A2E oxidation was
measured using HPLC, and it was found that reti-
nal carotenoids effectively quench singlet oxygen
products in a concentration-dependent manner.
Furthermore, Z was observed to be a better sin-
glet oxygen quencher than L [14].
group. A2E levels increased sixfold in the
unsupplemented control group, whereas there
was minimal increase in A2E in the MP carot-
enoid supplemented group, and their A2E lev-
els were significantly lower than the control
group [16].
4.5 Rodent Model

4.2 Cell Culture Until recently, the protective effects of macular

carotenoids against bisretinoids had not been
The protective effects of retinal carotenoids on studied in small laboratory mammals because
photo-oxidation of A2E were studied in ARPE-­ non-primates do not accumulate substantial
19 cells grown in Dulbecco’s Modified Eagle amounts of carotenoids in ocular tissues due to
Medium (DMEM) medium with 10 μM A2E for the presence of very active carotenoid cleavage
10 days. The cells accumulated A2E and were enzymes (Bco1 and Bco2). This led us to cross
incubated with L or Z (10 μM), and they were our Bco2−/− “macular pigment mice” that accu-
then exposed to blue light (430 nm). Cells incu- mulate dietary MP carotenoids in their retinas
bated with retinal carotenoids completely attenu- with a mouse model of STGD that accumulates
ated A2E photo-oxidation and inhibited A2E with increasing age. Abca4−/−/Bco2−/− mice
proteasome inactivation [15]. fed with L or Z have lower levels of A2E and iso-­
A2E compared to the control group with no
carotenoid supplementation, and there was a sta-
4.3 Human Donor Eyes tistically significant inverse correlation between
retinal carotenoids and A2E and iso-A2E levels
A2E concentrations in human cadaver eyes in RPE/choroid (Fig. 3). Furthermore, L and Z
increase with age in both the macula and in the supplementation improved visual performance in
peripheral retina, and A2E levels are threefold Abca4−/−/Bco2−/− mice compared to the control
lower in the macula region compared to the group [13].
peripheral retina despite excess light exposure
and high metabolic activity. Moreover, A2E con-
centrations are inversely related to retinal carot- 5 Summary
enoid concentrations [16]. Lipofuscin and A2E
levels are significantly lower in the fovea region The macular pigment carotenoids are distinct
where retinal carotenoids are present in abun- from other nutrients due to their selective accu-
dance [17]. mulation and unique spatial distribution in the
fovea, the region most vulnerable to excess light
and high metabolic oxygen. While it is widely
4.4 Avian Model appreciated that the beneficial properties of MP
carotenoids are in part mediated by their blue
The association between retinal carotenoids light-absorbing and antioxidant properties, it is
and A2E was studied in Japanese quail, whose now becoming increasingly understood that
retinal carotenoids are present as fatty acid attenuation of A2E formation and oxidation by L,
esters in distinct photoreceptor oil drops. After Z, and MZ are important protective effects as
16 weeks of feeding, total carotenoids rose well, further emphasizing their valuable role as
1.6-fold in the lutein-supplemented group and safe and cost-effective nutritional interventions
20
Fig. 3 Distribution of RPE/choroid A2E + iso-A2E levels
in relation to retinal carotenoids in Abca4−/−/Bco2−/− mice.
There was a statistically significant inverse correlation
between retinal carotenoids and A2E and iso-A2E levels
in RPE/choroid (p values: *p < 0.05). Red line refers to L
with R2 = 0.815, blue line refers to Z with R2 = 0.825, and
the orange dotted line refers to combined regression plot
of L, Z, and placebo group with R2 = 0.904. [13]
against visual loss from age-related and inherited
macular diseases.
Conflict of Interest No authors have any conflicts of
interest.
Grant Support EY-11600 and EY-14800; Research to
Prevent Blindness.
References
1. Arunkumar R, Gorusupudi A, Bernstein PS. The
macular carotenoids: a biochemical overview.
Biochim Biophys Acta (BBA) Mol Cell Biol Lipids.
2020;1865(11):158617.
2. Krinsky NI, Landrum JT, Bone RA. Biologic mecha-
nisms of the protective role of lutein and zeaxanthin in
the eye. Annu Rev Nutr. 2003;23(1):171–201.
3. Bone RA, Landrum JT, Friedes LM, Gomez
CM, Kilburn MD, Menendez E, Vidal I, Wang
W. Distribution of lutein and zeaxanthin stereoisomers
in the human retina. Exp Eye Res. 1997;64(2):211–8.
4. Li B, George EW, Rognon GT, Gorusupudi A,
Ranganathan A, Chang FY, Shi L, Frederick JM,
Bernstein PS. Imaging lutein and zeaxanthin in the
human retina with confocal resonance Raman micros-
copy. Proc Natl Acad Sci. 2020;117(22):12352–8.
5. Bernstein PS, Ranganathan A. The emerging roles
of the macular pigment carotenoids throughout the
R. Arunkumar and P. S. Bernstein
lifespan and in prenatal supplementation. J Lipid Res.
2021;62:100038.
6. Kim HJ, Montenegro D, Zhao J, Sparrow
JR. Bisretinoids of the retina: photo-oxidation, iron-­
catalyzed oxidation, and disease consequences.
Antioxidants. 2021;10(9):1382.
7. Ueda K, Zhao J, Kim HJ, Sparrow
JR. Photodegradation of retinal bisretinoids in
mouse models and implications for macular degen-
eration. Proc Natl Acad Sci. 2016;113(25):6904–9.
8. Arunkumar R, Calvo CM, Conrady CD, Bernstein
PS. What do we know about the macular pigment
in AMD: the past, the present, and the future. Eye.
2018;32(5):992–1004.
9. Li B, Ahmed F, Bernstein PS. Studies on the singlet
oxygen scavenging mechanism of human macular
pigment. Arch Biochem Biophys. 2010;504(1):56–60.
10. Boehm F, Edge R, Truscott TG. Anti-and pro-­oxidative
mechanisms comparing the macular carotenoids zea-
xanthin and lutein with other dietary carotenoids–a
singlet oxygen, free-radical in vitro and ex vivo study.
Photochem Photobiol Sci. 2020;19(8):1001–8.
11. Widomska J, Gruszecki WI, Subczynski WK. Factors
differentiating the antioxidant activity of macular
xanthophylls in the human eye retina. Antioxidants.
2021;10(4):601.
12. Kim HJ, Sparrow JR. Bisretinoid phospholipid and
vitamin A aldehyde: shining a light. J Lipid Res.
2021;62:100042.
13. Arunkumar R, Gorusupudi A, Li B, Blount JD,
Nwagbo U, Kim HJ, Sparrow JR, Bernstein
PS. Lutein and zeaxanthin reduce A2E and iso-A2E
levels and improve visual performance in Abca4−/−/
bco2−/− double knockout mice. Exp Eye Res.
2021;209:108680.
14. Kim SR, Nakanishi K, Itagaki Y, Sparrow
JR. Photooxidation of A2-PE, a photoreceptor outer
segment fluorophore, and protection by lutein and
zeaxanthin. Exp Eye Res. 2006;82(5):828–39.
15. Bian Q, Gao S, Zhou J, Qin J, Taylor A, Johnson EJ,
Tang G, Sparrow JR, Gierhart D, Shang F. Lutein
and zeaxanthin supplementation reduces photo-
oxidative damage and modulates the expression of
inflammation-­related genes in retinal pigment epithe-
lial cells. Free Radic Biol Med. 2012;53(6):1298–307.
16. Bhosale P, Serban B, Bernstein PS. Retinal carot-
enoids can attenuate formation of A2E in the reti-
nal pigment epithelium. Arch Biochem Biophys.
2009;483(2):175–81.
17. Adler L, Boyer NP, Anderson DM, Spraggins JM,
Schey KL, Hanneken A, Ablonczy Z, Crouch RK,
Koutalos Y. Determination of N-retinylidene-N-­
retinylethanolamine (A2E) levels in central and
peripheral areas of human retinal pigment epithelium.
Photochem Photobiol Sci. 2015;14(11):1983–90.
 Disturbed Matrix
Metalloproteinases Activity
in Age-Related Macular
Degeneration

Beatriz Martins and Rosa Fernandes

Abstract ulation and TIMPs’ significant regulatory

Matrix metalloproteinases (MMPs) are a
tightly regulated family of proteolytic
enzymes that break down extracellular matrix
(ECM) and basement membrane components.
Because it is associated with development,
morphogenesis, tissue remodeling, and repair,
ECM remodeling is an important mechanism.
MMPs are thought to act as a double-edged
sword, as they contribute to maintaining pho-
toreceptors/retinal pigment epithelium (RPE)/
Bruch’s membrane (BM)/choroid complex
homeostasis and also contribute to the onset
and progression of age-related macular degen-
eration (AMD). Polymorphisms and/or altered
expression in MMPs and their tissue inhibitors
(TIMPs) are associated with age-related mac-
ular degeneration (AMD). Here, we review
the evidence for MMPs’ role in the onset and
progression of AMD via addressing their reg-
functions.
Keywords
Age-related macular degeneration · Matrix
metalloproteinases · Extracellular matrix ·
Bruch’s membrane · Geographic atrophy ·
Choroidal neovascularization
1 Introduction
Matrix metalloproteinases (MMPs), also known
as matrixins, belong to an important class of
zinc-dependent endopeptidases, the metzincins
superfamily [1]. This superfamily includes 21
human disintegrins and metalloproteinase
domain (ADAMs) and 19 secreted disintegrin
and metalloproteinase thrombospondin domain
(ADAMTSs), in addition to 23 MMPs expressed

B. Martins R. Fernandes (*)

Faculty of Medicine, Coimbra Institute for Clinical
and Biomedical Research (iCBR), University of
Coimbra, Coimbra, Portugal
Institute of Pharmacology and Experimental
Therapeutics, Faculty of Medicine, University of
Coimbra, Coimbra, Portugal
Faculty of Medicine, Coimbra Institute for Clinical
and Biomedical Research (iCBR), University of
Coimbra, Coimbra, Portugal
Institute of Pharmacology and Experimental
Therapeutics, Faculty of Medicine, University of
Coimbra, Coimbra, Portugal
Association for Innovation and Biomedical Research
on Light and Image (AIBILI), Coimbra, Portugal
e-mail: rcfernandes@fmed.uc.pt

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 21

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_4
22
in human tissue [2]. MMPs typically have an
80-amino acid propeptide, a 170-amino acid cat-
alytic metalloproteinase domain, a variable-­
length linker peptide (hinge region), and a
200-amino acid hemopexin (Hpx) domain. A
detailed description of MMPs structure and an
overview of their substrate preferences and their
association with extracellular matrix (ECM) com-
ponents and inhibitors can be found in other
excellent reports [2–4].
The MMPs are usually secreted as zymogens
by a variety of cells into the extracellular space
[3] or stay tethered to their plasma membrane [5].
In humans, there are six membrane-type (MT)-
MMPs [5]. In the generation of active MMPs,
enzymatic cleavages of the zymogens are needed.
Active MMP-2, for example, is made from pro-­
MMP-­2 by MMP-14 cleavage, while pro-MMP-9
is cleaved by MMP-3 [5, 6].
MMPs are mainly classified based on their
substrate preference and domain organization,
being grouped into gelatinases (MMP-2, MMP-­
9), collagenases (MMP-1, MMP-8, MMP-13),
stromelysins (MMP-3, MMP-10), MT-MMPs
(MMP-14, MMP-15, MMP-16, MMP-17), and
others [7]. Under normal conditions, both MMPs
and the tissue inhibitors of metalloproteinases
(TIMPs) have an important role in the regulation
of the turnover of ECM [2, 8]. A dysregulation of
these components can both contribute to patho-
logical ECM remodeling and serve as a nexus for
a variety of pathways involved in age-related
macular degeneration (AMD) pathogenesis.
2 MMPs Are Implicated in AMD
AMD is a retinal degenerative disease that is a
leading cause of central vision loss in the elderly.
This disease, in its early stages, is characterized
by the accumulation of drusen that causes pro-
gressive degeneration of the photoreceptors and
retinal pigment epithelium (RPE). The disease
can progress to geographic atrophy (GA), an
advanced form of dry AMD, and/or choroidal
neovascularization (CNV), also known as wet
AMD [9, 10].
B. Martins and R. Fernandes
The specific interplay of pathophysiological
events that converge to AMD and related degen-
eration mechanisms remain to be fully elucidated
[11]. Nevertheless, several studies have been
highlighting the alterations in the regulation of
ECM, by dysregulation of the activity of MMPs
and TIMPs, as one of the main mechanisms
involved in the development of AMD [12]. This
modulation of ECM turnover is associated with
the other molecular mechanisms involved in the
pathophysiology of the disease since some stud-
ies have shown that both oxidative stress and acti-
vation of the complement system can modulate
the activity of ECM components [13, 14].
Additionally, the formation of drusen, the hall-
mark of AMD, is also believed to be associated
with a dysregulation of the ECM components,
especially in the RPE and Bruch’s membrane
(BM) [15]. These alterations in ECM modulation
caused by dysregulation of MMP/TIMP complex
can also be influenced not only by environmental
but also by genetic factors. For example, poly-
morphisms in MMP-2 (rs243865) and in MMP-9
(rs3918424 and rs3918241) are associated with
increased risk of AMD, mainly in younger
patients (<65 years) [16–18]. Other MMP-2
polymorphisms (rs243865, rs243866, and
rs2287074) are associated with a lower likeli-
hood of AMD development [19, 20]. There are
also some TIMPs polymorphisms associated
with AMD. Despite some polymorphisms in
TIMP-2 (rs817909) and in TIMP-3 (rs5754227)
appear to have a protective effect, other polymor-
phisms in TIMP-3 (rs713685 and rs743751) are
more frequent in AMD patients [18, 21, 22]. As a
result, these findings highlight evidence that
changes in ECM turnover are essential mecha-
nisms implicated in the development of AMD
and may help explain the susceptibility to the dis-
ease’s late stages.
2.1 MMPs in Dry AMD
BM is a five-layered ECM located at the inter-
face of the retina and choriocapillaris. BM plays
an important role in cell-cell communication and
Disturbed Matrix Metalloproteinases Activity in Age-Related Macular Degeneration
regulates the exchange of oxygen and nutrients
between the choroid and the outer retina [23].
However, BM undergoes a number of age-related
alterations that may have a role in AMD patho-
genesis. Especially noteworthy, the accumulation
of cellular debris and ECM proteins leads BM to
thicken and to the formation of drusen [24].
Several studies have been demonstrated that
aging causes structural and functional changes in
the BM due to a decrease in the activity of the
gelatinase components of the MMP system. In
this case, increased levels of high molecular
weight components of the MMPs pathway
(HMW1 and HMW2) reduce the pool of the acti-
vated gelatinases MMP-2 and MMP-9 and con-
tribute to reduced matrix degradation and
thickness of BM [25–27]. Another study revealed
that higher TIMP-3 concentrations in the drusen
block MMPs activity, lowering proteolytic activ-
ity within the drusen [28]. Oxidative stress
reduces MMP-2 activity and leads to the forma-
tion of sub-RPE deposits that can be involved in
the formation of drusen during AMD develop-
ment [29].
Nevertheless, several other studies also
detected increased levels of other MMPs in
patients with GA. MMP-7 levels were found to
be lower in these patients, but MMP-9 and
TIMP-1 levels were higher [30, 31]. In vitro and
in vivo models of dry AMD led to increased
expression, secretion, and activation of MMP-1,
MMP-3, and MMP-9 and are associated with
decreased RPE cell viability [32–34]. Moreover,
MMP-9’s role in the breakdown of the RPE bar-
rier has been highlighted, as silencing of this
MMP can improve the barrier integrity [35, 36].
Regarding genetic alterations, only a few stud-
ies have related polymorphisms specifically with
dry AMD. Liutkeviciene et al. detected that a
polymorphism in the MMP-2 gene (rd243865) is
associated with the development of hard drusen
in AMD patients [37].
2.2 MMPs in Wet AMD
The choroid is a network of blood vessels, located
below the BM that is critical for nutrients and
23
oxygen supply to the outer retina. The oxidative
and inflammatory processes that occur in late
stages of AMD might promote a pro-angiogenic
environment, resulting in CNV, which is the hall-
mark of wet AMD. Neovessels from choroid,
also referred as CNV, develop beneath the RPE
or penetrate into the subretinal space in patients
with wet AMD [38, 39].
Similar to GA and BM thickness, in this case
also dysregulation of ECM turnover appears to
have a close relation with CNV. Increased activ-
ity of MMPs can degrade some components of
BM, essential to the growth of new vessels [40,
41]. Several studies have shown that patients with
wet AMD present increased levels of MMP-9 in
aqueous humor, vitreous, and plasma [42–44].
This increase in the levels of MMP-9 contributes
to CNV since this MMP can increase VEGF lev-
els (pro-angiogenic factor) by decreasing PEDF
levels (anti-angiogenic factor), both secreted by
the RPE [45]. MMP-2, MMP-7, and MMP-13
have likewise shown a rise in their expression and
levels in patients with CNV lesions [18, 46, 47].
Moreover, cellular and animal models of CNV
lesions reported increased expression of MMP-2
and MMP-9, which were involved in the forma-
tion of experimental CNV. Additionally, the inhi-
bition of these two gelatinases appears to be a
good strategy to treat CNV, since their elimina-
tion is associated with decreased CNV lesion size
[48–50]. Some studies have also been underlin-
ing the alterations in TIMPs activity as an impor-
tant mechanism underlying CNV. On both wet
AMD patients and animal models, decreased lev-
els of TIMPs (TIMP-2 and TIMP-3) contribute to
CNV susceptibility [18, 51].
Regarding genetic alterations, several studies
identified various polymorphisms on both MMPs
and TIMPs that are related to CNV and wet
AMD. Microsatellites in the promoter of MMP-­
9, along with other polymorphisms on the
MMP-9 gene (rs142450006, rs3918424), have
been associated with increased risk of CNV pro-
gression and wet AMD development [17, 52, 53].
Also polymorphisms on MMP-1 (rs1799750),
MMP-2 (rs243865), MMP-7 (rs11568818), and
MMP-20 (rs10895322) are associated with
increased CNV lesion size and development of
24
wet AMD [54–56]. Finally, a polymorphism in
the TIMP-3 gene (rs9621532) has a protective
effect and is associated with decreased risk of
wet AMD [57].
3 Concluding Remarks
Due to their ability to break down ECM constitu-
ents, MMPs are relevant components in many
pathological processes of AMD. Specifically,
they play an important role in the accumulation
of drusen and degeneration of photoreceptors/RPE
in dry AMD and pathological vessel growth in
wet AMD. TIMPs control changes in their
expression and activity. To better understand the
role of each MMP in AMD pathogenesis, further
research is needed.
Acknowledgments Funding provided by the Global
Ophthalmology Awards Program (GOAP), a Bayer spon-
sored initiative committed to supporting ophthalmic
research across the world. Thanks are also due to FCT
(Portugal) and Strategic Projects UIDB/04539/2020 and
UIDP/04539/2020 (CIBB), COMPETE-FEDER (POCI-
01-0145-FEDER-007440), and Centro 2020 Regional
Operational Program: BRAINHEALTH 2020
(CENTRO-01-0145- FEDER-­000008). The authors also
acknowledge FCT for the doctoral research grant
2020.04811.BD (to B.M.).
References
1. Goodwin L. A closer look at metalloproteinases.
Hauppauge: Nova Science Publisher Inc; 2019. 310 p
2. Laronha H, Caldeira J. Structure and function of human
matrix metalloproteinases. Cell. 2020;9(5):1076.
3. Cui N, Hu M, Khalil RA. Biochemical and biological
attributes of matrix metalloproteinases. Prog Mol Biol
Transl Sci. 2017;147:1–73.
4. Maskos K. Crystal structures of MMPs in complex
with physiological and pharmacological inhibitors.
Biochimie. 2005;87(3-4):249–63.
5. Itoh Y. Membrane-type matrix metalloprotein-
ases: their functions and regulations. Matrix Biol.
2015;44–46:207–23.
6. Wilcock DM, Morgan D, Gordon MN, et al. Activation
of matrix metalloproteinases following anti-Abeta
immunotherapy; implications for microhemorrhage
occurrence. J Neuroinflammation. 2011;8:115.
7. Nagase H, Visse R, Murphy G. Structure and function
of matrix metalloproteinases and TIMPs. Cardiovasc
Res. 2006;69(3):562–73.
B. Martins and R. Fernandes
8. Agren MS, Auf dem Keller U. Matrix metallo-
proteinases: how much can they do? Int J Mol Sci.
2020;21(8):2678.
9. Mitchell P, Liew G, Gopinath B, Wong
TY. Age-related macular degeneration. Lancet.
2018;392(10153):1147–59.
10. Al-Zamil WM, Yassin SA. Recent developments
in age-related macular degeneration: a review. Clin
Interv Aging. 2017;12:1313–30.
11. Ambati J, Fowler BJ. Mechanisms of age-related
macular degeneration. Neuron. 2012;75(1):26–39.
12. Peng H, Hulleman JD. Prospective application of
activity-based proteomic profiling in vision research-­
potential unique insights into ocular protease biology
and pathology. Int J Mol Sci. 2019;20(16):3855.
13. Klettner A. Oxidative stress induced cellular sig-
naling in RPE cells. Front Biosci (Schol Ed).
2012;4:392–411.
14. Fernandez-Godino R, Pierce EA. C3a triggers for-
mation of sub-retinal pigment epithelium depos-
its via the ubiquitin proteasome pathway. Sci Rep.
2018;8(1):9679.
15. Luibl V, Isas JM, Kayed R, Glabe CG, Langen R,
Chen J. Drusen deposits associated with aging and
age-related macular degeneration contain nonfibrillar
amyloid oligomers. J Clin Invest. 2006;116(2):378–85.
16. Liutkeviciene R, Lesauskaite V, Zaliaduonyte-­
Peksiene D, et al. Role of MMP-2 (-1306 C/T)
polymorphism in age-related macular degeneration.
Ophthalmic Genet. 2016;37(2):170–6.
17. Liutkeviciene R, Lesauskaite V, Sinkunaite-­
Marsalkiene G, et al. The role of matrix metallo-
proteinases polymorphisms in age-related macular
degeneration. Ophthalmic Genet. 2015;36(2):149–55.
18. Oszajca K, Szemraj M, Szemraj J, Jurowski
P. Association analysis of genetic polymorphisms and
expression levels of selected genes involved in extra-
cellular matrix turnover and angiogenesis with the
risk of age-related macular degeneration. Ophthalmic
Genet. 2018;39(6):684–98.
19. Cheng J, Hao X, Zhang Z. Risk of macular degen-
eration affected by polymorphisms in Matrix
metalloproteinase-2: a case-control study in
Chinese Han population. Medicine (Baltimore).
2017;96(47):e8190.
20. Seitzman RL, Mahajan VB, Mangione C, et al.
Estrogen receptor alpha and matrix metallo-
proteinase 2 polymorphisms and age-related
maculopathy in older women. Am J Epidemiol.
2008;167(10):1217–25.
21. Fritsche LG, Igl W, Bailey JN, et al. A large genome-­
wide association study of age-related macular degen-
eration highlights contributions of rare and common
variants. Nat Genet. 2016;48(2):134–43.
22. Kaur I, Rathi S, Chakrabarti S. Variations in TIMP3
are associated with age-related macular degeneration.
Proc Natl Acad Sci U S A. 2010;107(28):E112–3.
23. Booij JC, Baas DC, Beisekeeva J, Gorgels TG, Bergen
AA. The dynamic nature of Bruch’s membrane. Prog
Retin Eye Res. 2010;29(1):1–18.
Disturbed Matrix Metalloproteinases Activity in Age-Related Macular Degeneration
24. Murali A, Krishnakumar S, Subramanian A,
Parameswaran S. Bruch’s membrane pathol-
ogy: a mechanistic perspective. Eur J Ophthalmol.
2020;30(6):1195–206.
25. Hussain AA, Lee Y, Marshall J. Understanding the
complexity of the matrix metalloproteinase system
and its relevance to age-related diseases: age-related
macular degeneration and Alzheimer’s disease. Prog
Retin Eye Res. 2020;74:100775.
26. Hussain AA, Lee Y, Marshall J. High molecu-
lar-weight gelatinase species of human Bruch’s
membrane: compositional analyses and age-
related changes. Invest Ophthalmol Vis Sci.
2010;51(5):2363–71.
27. Hussain AA, Lee Y, Zhang JJ, Marshall J. Disturbed
matrix metalloproteinase activity of Bruch’s mem-
brane in age-related macular degeneration. Invest
Ophthalmol Vis Sci. 2011;52(7):4459–66.
28. Leu ST, Batni S, Radeke MJ, Johnson LV, Anderson
DH, Clegg DO. Drusen are cold spots for proteolysis:
expression of matrix metalloproteinases and their tis-
sue inhibitor proteins in age-related macular degen-
eration. Exp Eye Res. 2002;74(1):141–54.
29. Marin-Castano ME, Csaky KG, Cousins
SW. Nonlethal oxidant injury to human retinal pig-
ment epithelium cells causes cell membrane blebbing
but decreased MMP-2 activity. Invest Ophthalmol Vis
Sci. 2005;46(9):3331–40.
30. Lashkari K, Teague GC, Beattie U, et al. Plasma bio-
markers of the amyloid pathway are associated with
geographic atrophy secondary to age-related macular
degeneration. PLoS One. 2020;15(8):e0236283.
31. Krogh Nielsen M, Subhi Y, Rue Molbech C, Nilsson
LL, Nissen MH, Sorensen TL. Imbalances in tissue
inhibitors of metalloproteinases differentiate choroi-
dal neovascularization from geographic atrophy. Acta
Ophthalmol. 2019;97(1):84–90.
32. Di Marco S, Carnicelli V, Franceschini N, et al.
Saffron: a multitask neuroprotective agent for reti-
nal degenerative diseases. Antioxidants (Basel).
2019;8(7):224.
33. Kernt M, Walch A, Neubauer AS, et al. Filtering blue
light reduces light-induced oxidative stress, senes-
cence and accumulation of extracellular matrix pro-
teins in human retinal pigment epithelium cells. Clin
Exp Ophthalmol. 2012;40(1):e87–97.
34. Sanchez-Ramos C, Vega JA, del Valle ME, Fernandez-­
Balbuena A, Bonnin-Arias C, Benitez-del Castillo
JM. Role of metalloproteases in retinal degeneration
induced by violet and blue light. Adv Exp Med Biol.
2010;664:159–64.
35. Cao L, Wang H, Wang F, Xu D, Liu F, Liu
C. Abeta-­ induced senescent retinal pigment epi-
thelial cells create a proinflammatory microen-
vironment in AMD. Invest Ophthalmol Vis Sci.
2013;54(5):3738–50.
36. Cao L, Wang H, Wang F. Amyloid-beta-induced
matrix metalloproteinase-9 secretion is associated
with retinal pigment epithelial barrier disruption. Int
J Mol Med. 2013;31(5):1105–12.
25
37. Liutkeviciene R, Lesauskaite V, Sinkunaite-­
Marsalkiene G, et al. MMP-2 Rs24386 (C--
>T) gene polymorphism and the phenotype of
age-related macular degeneration. Int J Ophthalmol.
2017;10(9):1349–53.
38. Kur J, Newman EA, Chan-Ling T. Cellular and physi-
ological mechanisms underlying blood flow regula-
tion in the retina and choroid in health and disease.
Prog Retin Eye Res. 2012;31(5):377–406.
39. Grossniklaus HE, Green WR. Choroidal neovascular-
ization. Am J Ophthalmol. 2004;137(3):496–503.
40. Cabral T, Mello LGM, Lima LH, et al. Retinal and
choroidal angiogenesis: a review of new targets. Int J
Retina Vitreous. 2017;3:31.
41. Zeng J, Jiang D, Liu X, Zhu X, Tang L. Matrix metal-
loproteinases expression in choroidal neovascular
membranes. Yan Ke Xue Bao. 2004;20(3):191–3.
42. Kim J, Kim JH, Do JY, et al. Key role of microglial
matrix metalloproteinases in choroidal neovascular-
ization. Front Cell Neurosci. 2021;15:638098.
43. Ecker SM, Pfahler SM, Hines JC, Lovelace AS,
Glaser BM. Sequential in-office vitreous aspirates
demonstrate vitreous matrix metalloproteinase 9 lev-
els correlate with the amount of subretinal fluid in
eyes with wet age-related macular degeneration. Mol
Vis. 2012;18:1658–67.
44. Chau KY, Sivaprasad S, Patel N, Donaldson TA,
Luthert PJ, Chong NV. Plasma levels of matrix
metalloproteinase-2 and -9 (MMP-2 and MMP-9)
in age-related macular degeneration. Eye (Lond).
2008;22(6):855–9.
45. Pouw AE, Greiner MA, Coussa RG, et al. Cell-matrix
interactions in the eye: from cornea to choroid. Cell.
2021;10(3):687.
46. Lecomte J, Louis K, Detry B, et al. Bone marrow-­
derived mesenchymal cells and MMP13 contribute to
experimental choroidal neovascularization. Cell Mol
Life Sci. 2011;68(4):677–86.
47. Yazama F, Kadonosono K, Itoh N, Ohno S. Role of
matrix metalloproteinase-7 in angiogenesis associated
with age-related macular degeneration. J Electron
Microsc. 2002;51(2):127–31.
48. Lambert V, Wielockx B, Munaut C, et al. MMP-2 and
MMP-9 synergize in promoting choroidal neovascu-
larization. FASEB J. 2003;17(15):2290–2.
49. Berglin L, Sarman S, van der Ploeg I, et al. Reduced
choroidal neovascular membrane formation in
matrix metalloproteinase-2-deficient mice. Invest
Ophthalmol Vis Sci. 2003;44(1):403–8.
50. Lambert V, Munaut C, Jost M, et al. Matrix metallo-
proteinase-­9 contributes to choroidal neovasculariza-
tion. Am J Pathol. 2002;161(4):1247–53.
51. Ebrahem Q, Qi JH, Sugimoto M, et al. Increased
neovascularization in mice lacking tissue inhibitor
of metalloproteinases-3. Invest Ophthalmol Vis Sci.
2011;52(9):6117–23.
52. Fiotti N, Pedio M, Battaglia Parodi M, et al. MMP-9
microsatellite polymorphism and susceptibility to
exudative form of age-related macular degeneration.
Genet Med. 2005;7(4):272–7.
26 B. Martins and R. Fernandes

53. Lauwen S, Lefeber DJ, Fauser S, Hoyng CB, den neovascular lesion size in age-related macular
Hollander AI. Increased pro-MMP9 plasma levels degeneration. Ophthalmology. 2015;122(11):2295–
are associated with neovascular age-related macular 302 e2.
degeneration and with the risk allele of rs142450006 56. Liutkeviciene R, Vilkeviciute A, Borisovaite D,
near MMP9. Mol Vis. 2021;27:142–50. Miniauskiene G. Association of exudative age-related
54. Budiene B, Liutkeviciene R, Gustiene O, et al. The macular degeneration with matrix metalloproteinases-
association of matrix metalloproteinases poly- ­2 (-1306 C/T) rs243865 gene polymorphism. Indian J
morphisms and interleukins in advanced age-­ Ophthalmol. 2018;66(4):551–7.
related macular degeneration. Ophthalmic Genet. 57. Ardeljan D, Meyerle CB, Agron E, et al. Influence of
2018;39(4):463–72. TIMP3/SYN3 polymorphisms on the phenotypic pre-
55. Akagi-Kurashige Y, Yamashiro K, Gotoh N, et al. sentation of age-related macular degeneration. Eur J
MMP20 and ARMS2/HTRA1 are associated with Hum Genet. 2013;21(10):1152–7.
 Current Views on Chr10q26
Contribution to Age-Related
Macular Degeneration
Navdeep Gogna, Lillian F. Hyde, Gayle B. Collin,
Lisa Stone, Jurgen K. Naggert,
and Patsy M. Nishina
Abstract
Age-related macular degeneration (AMD) is
the leading cause of blindness in the global
aging population. Familial aggregation and
genome-wide association (GWA) studies have
identified gene variants associated with AMD,
implying a strong genetic contribution to
AMD development. Two loci, on human Chr
1q31 and 10q26, respectively, represent the
most influential of all genetic factors. While
the role of CFH at Chr 1q31 is well estab-
lished, uncertainty remains about the genes
ARMS2 and HTRA1, at the Chr 10q26 locus.
Since both genes are in strong linkage disequi-
librium, assigning individual gene effects is
difficult. In this chapter, we review current lit-
erature about ARMS2 and HTRA1 and their
relevance to AMD risk. Future studies will be
necessary to unravel the mechanisms by which
they contribute to AMD.
Keywords
AMD · ARMS2 · HTRA1 · Linkage disequi-
librium · Genetics
N. Gogna (*) · L. F. Hyde · G. B. Collin · L. Stone ·
J. K. Naggert · P. M. Nishina
The Jackson Laboratory, Bar Harbor, ME, USA
e-mail: navdeep.gogna@jax.org
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_5
1 Introduction
Age-related macular degeneration (AMD) is the
leading cause of irreversible central vision loss in
aging populations [1, 2]. By 2050, an estimated
22 million people in the USA [3], and, by 2040,
288 million people worldwide [4], will be
affected with AMD. Early stages of AMD are
characterized by the presence of few (<20)
medium-sized drusen and/or retinal pigment epi-
thelium (RPE) abnormalities [5–7]. Drusen,
lipid-rich, protein-containing deposits that accu-
mulate between the RPE and Bruch’s membrane,
are considered a “hallmark” of AMD [8].
Intermediate AMD exhibits at least one large
druse, multiple medium-size drusen, or geo-
graphic atrophy (GA) that does not extend to the
center of the macula [5]. Advanced or late AMD
is either non-neovascular (dry, atrophic, or non-
exudative) or neovascular (wet or exudative) [9].
Dry AMD, characterized by drusen and GA,
extends to macula’s center and affects the chorio-
capillaris, RPE cells, and photoreceptors (PRs)
without leakage of blood or serum into the retina
and macula [10]. In contrast, wet AMD is associ-
ated with RPE detachment and choroidal neovas-
cularization, leading to leakage and fibrovascular
scarring [11].
AMD is a complex, multifactorial disease
[12–24]. Risk factors identified from case-­
control, cross-sectional, and prospective cohort
studies [10, 25–34] include age [35], family his-
27
28
tory [28, 36], dietary choices [30, 37–40], race
and ethnicity [41–43], gender [21], and smoking
[25, 44–46]. In addition, genetic factors explain
46–71% of the variation in overall disease sever-
ity [47]. To date, a total of 52 independently asso-
ciated common and rare gene variants
(p < 5 × 10−8), distributed across 34 loci, have
been associated with AMD risk [48–51].
Genome-wide association (GWA) and family-­
based linkage studies identified genetic variants
in the complement factor H (CFH) gene on
Chr1q32 and two tightly linked genes—ARMS2
and HTRA1—on Chr10q26 as major contributors
to AMD risk [52–65]. Together, these increase
AMD predisposition by more than 40-fold [66].
While significant progress has been made toward
understanding the role of CFH in AMD risk [67–
70], uncertainty remains regarding the gene(s)
responsible at the Chr10q26 locus. Strong link-
age disequilibrium between ARMS2 and HTRA1
genes has made it difficult to distinguish individ-
ual gene effects by statistical methods [71].
Moreover, PLEKHA1 is also found in linkage
disequilibrium with ARMS2 [55]. Several studies
suggest that ARMS2/HTRA1 genetic variations
are more strongly associated with AMD risk than
PLEKHA1 [56, 72, 73]. In this chapter, we review
existing information about ARMS2 and HTRA1
and their association with AMD.
2 
ARMS2
The ARMS2 gene, age-related maculopathy sus-
ceptibility 2, is only present in higher primates
[74]. ARMS2 encodes an 11-kDa protein [75];
however the function, localization, and native
structure of the protein have not been firmly
established. An in silico approach to predict the
structure of ARMS2 concluded that it has 15
putative phosphorylation sites, four putative gly-
cation sites of ε-amino groups of lysine, two
putative O-linked glycation sites, and three
potential binding sites [76]. The alanine at posi-
tion 69 is predicted to be a functional residue for
protein binding.
N. Gogna et al.
2.1 Reported Tissue, Cellular
and Subcellular Expression
of ARMS2/ARMS2
The expression of ARMS2 was detected in pla-
cental tissue [55], at low levels in retinal samples
[56, 73] and later, ubiquitously, in human tissues
[77]. The Bgee gene expression database (v14.2)
currently lists 62 distinct human tissues with
varying ARMS2 mRNA levels [78].
Kanda et al. expressed human retinal ARMS2
mRNA in COS-1, ARPE-19, and JEG cells.
Subcellular fractionation, followed by co-­staining
with MitoTracker and cytochrome C oxidase
subunit IV, located ARMS2 to the mitochondrial
(Mt) outer membrane [73]. Subsequently, another
group co-stained ARMS2 with retinoschisin (an
extracellular protein that stains PR inner seg-
ments) and Mt cytochrome c oxidase subunit II in
human retinal sections. ARMS2 localized in the
Mt-enriched ellipsoid region of the inner seg-
ments of both rod and cone PR cells [79].
However, conflicting results were presented by
Wang et al. [80]. Using immunofluorescence
(IF), verified by immunoblotting, endogenous
ARMS2 in ARPE-19 cells and overexpressed
GFP-tagged and HIS-tagged exogenous ARMS2
in COS7 cells were found to localize in the cyto-
sol and not in Mt or any other organelle [80]. The
group further performed in silico analyses to
identify the protein features required for Mt tar-
geting and concluded that ARMS2 lacked canon-
ical mitochondrial targeting sequences [80].
Kortvely et al. transfected HEK293 cells with
plasmid constructs coding for normal or risk vari-
ant ARMS2. Immunostaining findings suggested
that ARMS2 is a secreted protein and a compo-
nent of the extracellular matrix (ECM), found
mainly in choroid pillars of human eye [81].
Using a yeast two-hybrid system, followed by
coprecipitation, ARMS2 was found to bind sev-
eral ECM proteins [81]. Further, ARMS2 colo-
calized with the endoplasmic reticulum (ER) in
transfected ARPE-19 cells expressing ARMS2.
Adding a small N-terminal tag to ARMS2 did not
have any effect, whereas the same tag at the
Current Views on Chr10q26 Contribution to Age-Related Macular Degeneration
C-terminus abolished ER colocalization, indicat-
ing that the C-terminus is integral to proper
­targeting [81]. A follow-up study concluded that
ARMS2 is secreted via an unconventional, Golgi-­
independent pathway. Blocking the canonical ER
to Golgi transport did not affect ARMS2 secre-
tion. Instead, ARMS2 was shown to colocalize
with calnexin-positive and protein disulfide
isomerase-negative vesicle-like structures and,
with GRASP65, a marker for unconventional
protein secretion. Exon 2 of ARMS2 codes for
eight amino acids (-SIIHTAAR) at the
C-terminus. By generating a set of mutants, the
two isoleucines were found to be indispensable
for correct targeting. The intracellular distribu-
tion of the A69S risk allele was similar to the
non-risk allele, with both protein variants secreted
into the culture medium [82].
Micklisch et al. found endogenous ARMS2
gene expression in human blood-derived mono-
cytes and in human-induced pluripotent stem
cell-derived microglia (iPSdM) by PCR and laser
scanning microscopy. Contrary to the study by
Kortvely et al. which showed translation of the
ARMS2 A69S variant, this study reported that
ARMS2 protein was absent in patients homozy-
gous for the ARMS2 AMD risk variant A69S or
the non-risk variant R38X [75].
2.2 
ARMS2 Risk Variants and Their
Putative Role in AMD
The missense variant, rs10490924 (G>T:A69S)
[73, 80, 82], encoding an alanine-to-serine sub-
stitution at position 69 (A69S) is the most fre-
quently observed ARMS2 risk allele in the human
population. Little is known about the effect of
this mutation on ARMS2 protein structure and
function. One study reports that the A69S varia-
tion in ARMS2 creates a new putative phosphory-
lation site that breaks a predicted α-helix [73]. It
has been suggested that the A69S change affects
ARMS2’s function in either Mt [73, 79] or its
role in the cytoskeleton in COS7cells [80]. A
recent study implicated ARMS2 as a surface com-
plement regulator [75]. Recombinant ARMS2,
expressed in Pichia pastoris, was shown to bind
29
to human apoptotic and necrotic cells and initiate
properdin-mediated complement activation and
C3b surface opsonization for phagocytosis [75].
Two additional variants of ARMS2 have been
reported: an insertion-deletion (indel) polymor-
phism (NM_001099667.1:c.*372_815del443
ins54) in the 3′untranslated region (3′-UTR) and
a coding nonsense polymorphism (R38X) [79].
The ARMS2 indel lies within the HTRA1 cis-­
regulatory region, upstream of its transcription
start site [83, 84], and is suggested to regulate
HTRA1 expression. In heterozygous retinal and
placental samples from human donors, Fritsche
et al. showed that this indel mutation destabilizes
the ARMS2 transcript by removing the polyade-
nylation signal and inserting a 54-bp element
known to mediate rapid mRNA turnover [79].
The group validated their findings by developing
recombinant ARMS2 isoforms, quantifying heter-
ologous ARMS2 expression in vitro and conclud-
ing that the indel polymorphism in ARMS2 leads
to reduced mRNA levels [83].
The ARMS2 variant identified by Fritsche
et al., rs2736911(C>T:R38X), is predicted to
result in a premature stop codon (R38X) and a
truncated protein [79]. Yang et al. observed a
50% decrease in mRNA in patients heterozygous
for R38X [85], presumably due to nonsense-­
mediated mRNA decay. They reasoned that the
loss of ARMS2 is insufficient to explain AMD
susceptibility as both the indel and R38X variants
result in a decrease in ARMS2, but only the for-
mer confers risk to AMD, while the latter is
mildly protective [85, 86]. This led to a hypothe-
sis of dual causality, in which concomitant down-
regulation of ARMS2 and upregulation of HTRA1
explains the disease [85]. Similar results were
obtained in another study that showed reduced
ARMS2 expression in human postmortem retinal
and RPE samples, heterozygous for R38X [83].
However, a subsequent investigation failed to
detect a rs2736911-dependent alteration in
ARMS2 expression [87].
Since ARMS2 is not found in mice, to gain a
better understanding of ARMS2 function, two
transgenic mouse models expressing human
ARMS2 and ARMS2 A69S were developed. The
constructs used a ubiquitous cytomegalovirus
30
(CMV) [88] or chicken actin (CAG) promoter
[89] and were either inserted into the ROSA
locus [88] or randomly in the mouse genome
[89].While mRNA and protein expression of
ARMS2 and the A69S variant were confirmed in
both models, no pathological changes were
observed in the mouse eye.
3 
HTRA1
HTRA1 is a member of the high temperature
requirement A family of four serine proteases.
While the exact role of these HTRAs is not well
understood, HTRA1 is known to be a ubiqui-
tously expressed, secreted protein with nonspe-
cific protease activity [90–92]. The 51-kDa
protein is composed of insulin-like growth factor
binding, Kazal-like protease inhibitor, conserved
serine protease, and PDZ domains [91, 92]. It has
been implicated in physiological processes such
as cell invasion and migration [93, 94], osteogen-
esis [95, 96], protein degradation [97, 98], and
TGF-β signaling [95, 99].
3.1 Reported Tissue and Cellular
Expression of HTRA1/HTRA1
In 2006, DeWan et al. and Yang et al. identified a
single-nucleotide polymorphism (SNP),
rs11200638, in the promoter region of HTRA1, as
a major genetic risk factor for AMD [53, 62].
Using a GWA mapping strategy, DeWan et al.
concluded that the presence of the risk-associated
HTRA1 genotype increased the likelihood for
development of wet AMD tenfold compared to
individuals with a wild-type genotype [53]. Using
human ARPE19 and HeLaS3 cells transfected
with luciferase reporter plasmids driven by either
wild-type or risk-associated HTRA1 promoter,
this study also demonstrated that the risk variant
caused an upregulation in HTRA1. Analyzing
mRNA expression and protein levels in primary
cultured human RPE cells revealed a two–three-
fold increase in HTRA1 expression in the pres-
ence of the HTRA1 risk haplotype [100]. In
contrast, Kanda et al. showed in ARPE-19, HEK-
N. Gogna et al.
293, and Y79 (human retinoblastoma) cells trans-
fected with an HTRA1 promoter driving luciferase
activity that rs11200638 SNP had no significant
impact on HTRA1 promoter activity, and HTRA1
mRNA expression was not significantly different
between control and AMD retinas [73].
Once the AMD risk-associated indel polymor-
phism in the 3’-UTR of ARMS2 was discovered,
many studies focused on identifying its impact on
HTRA1 expression. Using a luciferase reporter
assay on cultured human RPE cells and mouse
RPE in vivo, Yang et al. observed a twofold
increase in expression in constructs that modelled
the disease haplotype, containing both the ARMS2
indel and risk SNP rs11200638 in the HTRA1 pro-
moter [85]. No increase was observed with either
variant alone, suggesting that multiple risk vari-
ants within the Chr10q26 risk haplotype may be
necessary to induce heightened HTRA1 expression
[85]. Likewise, a subsequent study by Friedrich
et al. in the human ARPE-19 and rat Müller rMC-1
cell lines failed to detect an effect of the ARMS2
risk allele on HTRA1 promoter activity [83]. A
study by Iejima et al. demonstrated a cell type-
specific change in HTRA1 promoter activity [84].
While no differences in activity in ARPE-19 cells
were observed, a ~threefold and ~twofold increase
in luciferase activity was detected in the rat retinal
ganglion cell line RGC-5 and the mouse photore-
ceptor cell line 661W, respectively. Using con-
structs with and without ARMS2 indel mutation,
the authors showed that the indel alters the sup-
pressor and activator cis-elements of HTRA1 and
induces an upregulation of the HTRA1 in pluripo-
tent stem cells from AMD patients [84]. An in vivo
study was done in rhesus monkey (M. mulatta), a
primate model that is susceptible to age-related
maculopathy [74], and forms macular drusen
deposits [101]. In this model, polymorphisms in
orthologous ARMS2 and HTRA1 genes were asso-
ciated with drusen formation [102]. While one
study attributed the increased risk to the HTRA1
promoter variant [102], another study could not
replicate the results in a different rhesus popula-
tion [103].
Investigations using human tissue also yielded
variable results. Yang et al. reported an increase in
expression levels of HTRA1 mRNA and protein in
Current Views on Chr10q26 Contribution to Age-Related Macular Degeneration
lymphocytes and RPE cells [62]. Chan et al. also
reported HTRA1 upregulation specifically in mac-
ular regions with lower expression in the periph-
eral retina [104]. However, contrasting results
were obtained from independent studies that
showed no differences in expression between risk-
and non-risk-associated HTRA1 transcripts
obtained from human lymphocytes and retina [87,
105–107]. A recent study by Williams et al.
showed that HTRA1 mRNA is reduced specifically
in RPE and not in neural retina or choroid derived
from human donors homozygous for the risk vari-
ants that disrupt a cis-regulatory element within
the Chr10q26 locus [108]. Studies involving AMD
patient-derived induced pluripotent stem cells
(iPSCs) also report conflicting results, with some
studies reporting higher HTRA1 expression in
iPSCs from patients harboring the ARMS2 indel
polymorphism [84] whereas others showing no
change in HTRA1 expression levels [109].
3.2 Contribution of HTRA1 Gene
Variants to AMD
A large number of functional studies have been
undertaken to identify how the HTRA1 protein
might lead to AMD disease phenotypes. HTRA1,
for example, has been found to bind several ECM
proteins [90, 110–119], which could potentially
affect the posterior eye. For example, an altered
elastogenesis of Bruch’s membrane was reported
in transgenic mice overexpressing HTRA1 in the
RPE [115]. Using a differential stable isotope
labeling of amino acids in cell culture strategy,
RPE proteins selectively cleaved by HTRA1
were identified, and its involvement in comple-
ment regulation and amyloid deposition during
AMD pathogenesis was suggested [100]. In
another study, two ECM proteins were found to
be processed by HTRA1: EFEMP1, an ECM pro-
tein, known to be mutated in Doyne honeycomb
retinal dystrophy [120], a genetic eye disease
with similarities to AMD, and thrombospondin 1
(TSP1), an inhibitor of angiogenesis. Further­
more, HTRA1 may play a role in AMD by regu-
lating the ECM and potentially by playing a role
in neovascularization [118].
31
Another function suggested for HTRA1 has
been as a regulator of TGF-β, which has been
associated with AMD due to its role in angiogen-
esis, inflammation, vascular fibrosis, immune
responses, as well as cross-talk with other signal-
ing pathways [121–123]. Some studies suggest
that HTRA1 can inhibit TGF-β signaling through
a number of mechanisms [124–126], while others
report that HTRA1 activates it [99, 127–129]. A
study by Akhtar-Schaefer et al. reported no effect
of HTRA1 on enhancing or inhibiting TGF-β sig-
naling [130].
4 Conclusions
Both ARMS2 and HTRA1 have been extensively
studied for their roles in AMD. However, con-
flicting outcomes from previous investigations
make it difficult to draw conclusions. Thus far, no
consensus exists about where ARMS2 is
expressed or how it functions. Also, although the
function and localization of HTRA1 are better
understood, studies of its regulation and associa-
tion with AMD have also generated ambiguous
results.
The use of different tissues, cell types, pri-
mary cells or cell lines, and reagents makes com-
parisons difficult. Ideally, functional studies and
developing therapies would be performed in ani-
mal models. Working with primate models can be
challenging, since they present the same genetic
heterogeneity as humans and require large sam-
ple sizes. Mouse models, whose genetics and
environment can be easily controlled and manip-
ulated, offer a potential solution. Care should be
taken to select and interpret relevant phenotypes
because of the lack of a macula per se. In addi-
tion, because AMD is a complex disease, a sus-
ceptible genetic background has to be identified,
which may have to be specific for the AMD risk
variant to be studied.
Nevertheless, intriguing leads have resulted
from studies conducted thus far, and prospects
are good that we can progress in understanding
the functional relevance of these genes and help
to identify novel molecular targets and open new
therapeutic avenues for the treatment of AMD.
32 N. Gogna et al.

References 16. Handa JT, Cano M, Wang L, Datta S, Liu T. Lipids,

oxidized lipids, oxidation-specific epitopes, and Age-­
related Macular Degeneration. Biochim Biophys
1. VISION 2020 Global Initiative for the Elimination
Acta Mol Cell Biol Lipids. 2017;1862(4):430–40.
of Avoidable Blindness: Action plan 2006–2011.
17. Chen M, Xu H. Parainflammation, chronic inflam-
VISION 2020 Global Initiative for the Elimination
mation, and age-related macular degeneration. J
of Avoidable Blindness: Action plan 2006–2011;
Leukoc Biol. 2015;98(5):713–25.
2007.
18. Knickelbein JE, Chan CC, Sen HN, Ferris FL,
2. de Jong EK, Geerlings MJ, den Hollander
Nussenblatt RB. Inflammatory mechanisms of age-­
AI. Chapter 10 – Age-related macular degeneration.
related macular degeneration. Int Ophthalmol Clin.
In: Genetics and genomics of eye disease. London:
2015;55(3):63–78.
Academic; 2020. p. 155–80.
19. van Lookeren Campagne M, Strauss EC, Yaspan
3. Rein DB, Wittenborn JS, Zhang X, Honeycutt
BL. Age-related macular degeneration: Complement
AA, Lesesne SB, Saaddine J, et al. Forecasting
in action. Immunobiology. 2016;221(6):733–9.
age-related macular degeneration through the year
20. Kauppinen A, Paterno JJ, Blasiak J, Salminen A,
2050: the potential impact of new treatments. Arch
Kaarniranta K. Inflammation and its role in age-­
Ophthalmol. 2009;127(4):533–40.
related macular degeneration. Cell Mol Life Sci.
4. Wong WL, Su X, Li X, Cheung CM, Klein R, Cheng
2016;73(9):1765–86.
CY, et al. Global prevalence of age-related macular
21. Lambert NG, ElShelmani H, Singh MK, Mansergh
degeneration and disease burden projection for 2020
FC, Wride MA, Padilla M, et al. Risk factors and
and 2040: a systematic review and meta-analysis.
biomarkers of age-related macular degeneration.
Lancet Glob Health. 2014;2(2):e106–16.
Prog Retin Eye Res. 2016;54:64–102.
5. Jager RD, Mieler WF, Miller JW. Age-related macular
22. Tan PL, Bowes Rickman C, Katsanis N. AMD
degeneration. N Engl J Med. 2008;358(24):2606–17.
and the alternative complement pathway: genet-
6. Bird AC, Bressler NM, Bressler SB, Chisholm IH,
ics and functional implications. Hum Genomics.
Coscas G, Davis MD, et al. An international clas-
2016;10(1):23.
sification and grading system for age-related macu-
23. Gelfand BD, Ambati J. A revised hemodynamic
lopathy and age-related macular degeneration. The
theory of age-related macular degeneration. Trends
International ARM Epidemiological Study Group.
Mol Med. 2016;22(8):656–70.
Surv Ophthalmol. 1995;39(5):367–74.
24. Schwartz SG, Hampton BM, Kovach JL, Brantley
7. Bressler NM, Silva JC, Bressler SB, Fine SL, Green
MA Jr. Genetics and age-related macular degen-
WR. Clinicopathologic correlation of drusen and ret-
eration: a practical review for the clinician. Clin
inal pigment epithelial abnormalities in age-related
Ophthalmol. 2016;10:1229–35.
macular degeneration. Retina. 1994;14(2):130–42.
25. Smith W, Assink J, Klein R, Mitchell P, Klaver CC,
8. Crabb JW. The proteomics of drusen. Cold Spring
Klein BE, et al. Risk factors for age-related macular
Harb Perspect Med. 2014;4(7):a017194.
degeneration: pooled findings from three continents.
9. Ferris FL 3rd, Wilkinson CP, Bird A, Chakravarthy
Ophthalmology. 2001;108(4):697–704.
U, Chew E, Csaky K, et al. Clinical classification of
26. Chakravarthy U, Wong TY, Fletcher A, Piault E,
age-related macular degeneration. Ophthalmology.
Evans C, Zlateva G, et al. Clinical risk factors
2013;120(4):844–51.
for age-related macular degeneration: a system-
10. Klein R, Klein BE, Jensen SC, Meuer SM. The five-­
atic review and meta-analysis. BMC Ophthalmol.
year incidence and progression of age-related macu-
2010;10:31.
lopathy: the Beaver Dam Eye Study. Ophthalmology.
27. Ferris FL 3rd. Senile macular degeneration:
1997;104(1):7–21.
review of epidemiologic features. Am J Epidemiol.
11. Fine SL, Berger JW, Maguire MG, Ho AC. Age-­
1983;118(2):132–51.
related macular degeneration. N Engl J Med.
28. Hyman LG, Lilienfeld AM, Ferris FL 3rd, Fine
2000;342(7):483–92.
SL. Senile macular degeneration: a case-control
12. Pennington KL, DeAngelis MM. Epigenetic mecha-
study. Am J Epidemiol. 1983;118(2):213–27.
nisms of the aging human retina. J Exp Neurosci.
29. Goldberg J, Flowerdew G, Smith E, Brody JA, Tso
2015;9(Suppl 2):51–79.
MO. Factors associated with age-related macu-
13. Armstrong RA, Mousavi M. Overview of risk fac-
lar degeneration. An analysis of data from the first
tors for age-related macular degeneration (AMD). J
National Health and Nutrition Examination Survey.
Stem Cells. 2015;10(3):171–91.
Am J Epidemiol. 1988;128(4):700–10.
14. Gemenetzi M, Lotery AJ. The role of epigenetics
30. Risk factors for neovascular age-related macular
in age-related macular degeneration. Eye (Lond).
degeneration. The Eye Disease Case-Control Study
2014;28(12):1407–17.
Group. Arch Ophthalmol. 1992;110(12):1701–8.
15. Zhang QY, Tie LJ, Wu SS, Lv PL, Huang HW, Wang
31. Mitchell P, Smith W, Attebo K, Wang JJ. Prevalence
WQ, et al. Overweight, obesity, and risk of age-­
of age-related maculopathy in Australia. The
related macular degeneration. Invest Ophthalmol Vis
Blue Mountains Eye Study. Ophthalmology.
Sci. 2016;57(3):1276–83.
1995;102(10):1450–60.
Current Views on Chr10q26 Contribution to Age-Related Macular Degeneration
32. Vingerling JR, Dielemans I, Hofman A, Grobbee
DE, Hijmering M, Kramer CF, et al. The prevalence
of age-related maculopathy in the Rotterdam Study.
Ophthalmology. 1995;102(2):205–10.
33. Cruickshanks KJ, Klein R, Klein BE. Sunlight and
age-related macular degeneration. The Beaver Dam
Eye Study. Arch Ophthalmol. 1993;111(4):514–8.
34. Fletcher AE, Bentham GC, Agnew M, Young IS,
Augood C, Chakravarthy U, et al. Sunlight exposure,
antioxidants, and age-related macular degeneration.
Arch Ophthalmol. 2008;126(10):1396–403.
35. Klein R, Klein BE, Linton KL. Prevalence of age-­
related maculopathy. The Beaver Dam Eye Study.
Ophthalmology. 1992;99(6):933–43.
36. Seddon JM, Ajani UA, Mitchell BD. Familial
aggregation of age-related maculopathy. Am J
Ophthalmol. 1997;123(2):199–206.
37. van Leeuwen R, Klaver CC, Vingerling JR, Hofman
A, van Duijn CM, Stricker BH, et al. Cholesterol and
age-related macular degeneration: is there a link?
Am J Ophthalmol. 2004;137(4):750–2.
38. Edo A, Pertiwi YD, Hirooka K, Masuda S,
Kamaruddin MI, Yanagi M, et al. Association of
dietary nutrient intake with early age-related macular
degeneration in Japanese-Americans. Metabolites.
2021;11(10):673.
39. Newsome DA, Swartz M, Leone NC, Elston RC,
Miller E. Oral zinc in macular degeneration. Arch
Ophthalmol. 1988;106(2):192–8.
40. VandenLangenberg GM, Mares-Perlman JA, Klein
R, Klein BE, Brady WE, Palta M. Associations
between antioxidant and zinc intake and the
5-year incidence of early age-related maculopathy
in the Beaver Dam Eye Study. Am J Epidemiol.
1998;148(2):204–14.
41. Friedman DS, O'Colmain BJ, Munoz B, Tomany
SC, McCarty C, de Jong PT, et al. Prevalence of age-­
related macular degeneration in the United States.
Arch Ophthalmol. 2004;122(4):564–72.
42. Sommer A, Tielsch JM, Katz J, Quigley HA, Gottsch
JD, Javitt JC, et al. Racial differences in the cause-­
specific prevalence of blindness in east Baltimore. N
Engl J Med. 1991;325(20):1412–7.
43. Klein R, Rowland ML, Harris MI. Racial/eth-
nic differences in age-related maculopathy. Third
National Health and Nutrition Examination Survey.
Ophthalmology. 1995;102(3):371–81.
44. Seddon JM, Willett WC, Speizer FE, Hankinson
SE. A prospective study of cigarette smoking and
age-related macular degeneration in women. JAMA.
1996;276(14):1141–6.
45. Christen WG, Glynn RJ, Manson JE, Ajani UA,
Buring JE. A prospective study of cigarette smoking
and risk of age-related macular degeneration in men.
JAMA. 1996;276(14):1147–51.
46. Klein R, Klein BE, Moss SE. Relation of smok-
ing to the incidence of age-related maculopathy.
The Beaver Dam Eye Study. Am J Epidemiol.
1998;147(2):103–10.
33
47. Seddon JM, Cote J, Page WF, Aggen SH, Neale
MC. The US twin study of age-related macular degen-
eration: relative roles of genetic and environmental
influences. Arch Ophthalmol. 2005;123(3):321–7.
48. Gorin MB, Weeks DE, Baron RV, Conley YP,
Ortube MC, Nusinowitz S. Endophenotypes for age-­
related macular degeneration: extending our reach
into the preclinical stages of disease. J Clin Med.
2014;3(4):1335–56.
49. Fritsche LG, Igl W, Bailey JN, Grassmann F,
Sengupta S, Bragg-Gresham JL, et al. A large
genome-wide association study of age-related macu-
lar degeneration highlights contributions of rare and
common variants. Nat Genet. 2016;48(2):134–43.
50. den Hollander AI, de Jong EK. Highly penetrant
alleles in age-related macular degeneration. Cold
Spring Harb Perspect Med. 2014;5(3):a017202.
51. Black JR, Clark SJ. Age-related macular degenera-
tion: genome-wide association studies to translation.
Genet Med. 2016;18(4):283–9.
52. Zareparsi S, Branham KE, Li M, Shah S, Klein RJ,
Ott J, et al. Strong association of the Y402H variant
in complement factor H at 1q32 with susceptibil-
ity to age-related macular degeneration. Am J Hum
Genet. 2005;77(1):149–53.
53. Dewan A, Liu M, Hartman S, Zhang SS, Liu DT,
Zhao C, et al. HTRA1 promoter polymorphism in
wet age-related macular degeneration. Science.
2006;314(5801):989–92.
54. Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS,
Haynes C, et al. Complement factor H polymor-
phism in age-related macular degeneration. Science.
2005;308(5720):385–9.
55. Jakobsdottir J, Conley YP, Weeks DE, Mah TS,
Ferrell RE, Gorin MB. Susceptibility genes for age-­
related maculopathy on chromosome 10q26. Am J
Hum Genet. 2005;77(3):389–407.
56. Rivera A, Fisher SA, Fritsche LG, Keilhauer
CN, Lichtner P, Meitinger T, et al. Hypothetical
LOC387715 is a second major susceptibility gene
for age-related macular degeneration, contributing
independently of complement factor H to disease
risk. Hum Mol Genet. 2005;14(21):3227–36.
57. Liu X, Zhao P, Tang S, Lu F, Hu J, Lei C, et al.
Association study of complement factor H, C2,
CFB, and C3 and age-related macular degen-
eration in a Han Chinese population. Retina.
2010;30(8):1177–84.
58. Seddon JM, Francis PJ, George S, Schultz
DW, Rosner B, Klein ML. Association of CFH
Y402H and LOC387715 A69S with progres-
sion of age-related macular degeneration. JAMA.
2007;297(16):1793–800.
59. Edwards AO, Ritter R 3rd, Abel KJ, Manning A,
Panhuysen C, Farrer LA. Complement factor H
polymorphism and age-related macular degenera-
tion. Science. 2005;308(5720):421–4.
60. Hageman GS, Anderson DH, Johnson LV, Hancox
LS, Taiber AJ, Hardisty LI, et al. A common hap-
lotype in the complement regulatory gene factor H
34
(HF1/CFH) predisposes individuals to age-related
macular degeneration. Proc Natl Acad Sci U S A.
2005;102(20):7227–32.
61. Haines JL, Hauser MA, Schmidt S, Scott WK, Olson
LM, Gallins P, et al. Complement factor H variant
increases the risk of age-related macular degenera-
tion. Science. 2005;308(5720):419–21.
62. Yang Z, Camp NJ, Sun H, Tong Z, Gibbs D, Cameron
DJ, et al. A variant of the HTRA1 gene increases
susceptibility to age-related macular degeneration.
Science. 2006;314(5801):992–3.
63. Ryu E, Fridley BL, Tosakulwong N, Bailey KR,
Edwards AO. Genome-wide association analy-
ses of genetic, phenotypic, and environmental
risks in the age-related eye disease study. Mol Vis.
2010;16:2811–21.
64. Winkler TW, Grassmann F, Brandl C, Kiel C,
Gunther F, Strunz T, et al. Genome-wide association
meta-analysis for early age-related macular degener-
ation highlights novel loci and insights for advanced
disease. BMC Med Genet. 2020;13(1):120.
65. Horie-Inoue K, Inoue S. Genomic aspects of age-­
related macular degeneration. Biochem Biophys Res
Commun. 2014;452(2):263–75.
66. Cameron DJ, Yang Z, Gibbs D, Chen H, Kaminoh
Y, Jorgensen A, et al. HTRA1 variant confers
similar risks to geographic atrophy and neovascu-
lar age-related macular degeneration. Cell Cycle.
2007;6(9):1122–5.
67. Landowski M, Kelly U, Klingeborn M, Groelle M,
Ding JD, Grigsby D, et al. Human complement fac-
tor H Y402H polymorphism causes an age-related
macular degeneration phenotype and lipoprotein
dysregulation in mice. Proc Natl Acad Sci U S A.
2019;116(9):3703–11.
68. Toomey CB, Johnson LV, Bowes Rickman
C. Complement factor H in AMD: bridging genetic
associations and pathobiology. Prog Retin Eye Res.
2018;62:38–57.
69. Donoso LA, Vrabec T, Kuivaniemi H. The role
of complement Factor H in age-related macu-
lar degeneration: a review. Surv Ophthalmol.
2010;55(3):227–46.
70. McHarg S, Clark SJ, Day AJ, Bishop PN. Age-­
related macular degeneration and the role of the com-
plement system. Mol Immunol. 2015;67(1):43–50.
71. Wang G. Chromosome 10q26 locus and age-related
macular degeneration: a progress update. Exp Eye
Res. 2014;119:1–7.
72. Leveziel N, Souied EH, Richard F, Barbu V, Zourdani
A, Morineau G, et al. PLEKHA1-LOC387715-­
HTRA1 polymorphisms and exudative age-related
macular degeneration in the French population. Mol
Vis. 2007;13:2153–9.
73. Kanda A, Chen W, Othman M, Branham KE, Brooks
M, Khanna R, et al. A variant of mitochondrial pro-
tein LOC387715/ARMS2, not HTRA1, is strongly
associated with age-related macular degeneration.
Proc Natl Acad Sci U S A. 2007;104(41):16227–32.
N. Gogna et al.
74. Francis PJ, Appukuttan B, Simmons E, Landauer
N, Stoddard J, Hamon S, et al. Rhesus monkeys
and humans share common susceptibility genes
for age-related macular disease. Hum Mol Genet.
2008;17(17):2673–80.
75. Micklisch S, Lin Y, Jacob S, Karlstetter M,
Dannhausen K, Dasari P, et al. Age-related mac-
ular degeneration associated polymorphism
rs10490924 in ARMS2 results in deficiency of
a complement activator. J Neuroinflammation.
2017;14(1):4.
76. Jahanfar F, Hamishehkar H. Exploring the associa-
tion of rs10490924 polymorphism with age-related
macular degeneration: An in silico approach. J Mol
Graph Model. 2017;77:280–5.
77. Wang G, Spencer KL, Scott WK, Whitehead P,
Court BL, Ayala-Haedo J, et al. Analysis of the indel
at the ARMS2 3′UTR in age-related macular degen-
eration. Hum Genet. 2010;127(5):595–602.
78. Bastian FB, Roux J, Niknejad A, Comte A, Fonseca
Costa SS, de Farias TM, et al. The Bgee suite:
integrated curated expression atlas and compara-
tive transcriptomics in animals. Nucleic Acids Res.
2021;49(D1):D831–D47.
79. Fritsche LG, Loenhardt T, Janssen A, Fisher SA,
Rivera A, Keilhauer CN, et al. Age-related macular
degeneration is associated with an unstable ARMS2
(LOC387715) mRNA. Nat Genet. 2008;40(7):892–6.
80. Wang G, Spencer KL, Court BL, Olson LM, Scott
WK, Haines JL, et al. Localization of age-related
macular degeneration-associated ARMS2 in cyto-
sol, not mitochondria. Invest Ophthalmol Vis Sci.
2009;50(7):3084–90.
81. Kortvely E, Hauck SM, Duetsch G, Gloeckner CJ,
Kremmer E, Alge-Priglinger CS, et al. ARMS2 is
a constituent of the extracellular matrix providing
a link between familial and sporadic age-related
macular degenerations. Invest Ophthalmol Vis Sci.
2010;51(1):79–88.
82. Kortvely E, Hauck SM, Behler J, Ho N, Ueffing
M. The unconventional secretion of ARMS2. Hum
Mol Genet. 2016;25(15):3143–51.
83. Friedrich U, Myers CA, Fritsche LG, Milenkovich
A, Wolf A, Corbo JC, et al. Risk- and non-risk-­
associated variants at the 10q26 AMD locus influ-
ence ARMS2 mRNA expression but exclude
pathogenic effects due to protein deficiency. Hum
Mol Genet. 2011;20(7):1387–99.
84. Iejima D, Itabashi T, Kawamura Y, Noda T, Yuasa S,
Fukuda K, et al. HTRA1 (high temperature require-
ment A serine peptidase 1) gene is transcription-
ally regulated by insertion/deletion nucleotides
located at the 3′ end of the ARMS2 (age-related
maculopathy susceptibility 2) gene in patients with
age-related macular degeneration. J Biol Chem.
2015;290(5):2784–97.
85. Yang Z, Tong Z, Chen Y, Zeng J, Lu F, Sun X, et al.
Genetic and functional dissection of HTRA1 and
LOC387715 in age-related macular degeneration.
PLoS Genet. 2010;6(2):e1000836.
Current Views on Chr10q26 Contribution to Age-Related Macular Degeneration
86. Teper SJ, Nowinska A, Wylegala E. A69S and R38X
ARMS2 and Y402H CFH gene polymorphisms
as risk factors for neovascular age-related macular
degeneration in Poland – a brief report. Med Sci
Monit. 2012;18(2):PR1-3.
87. Kanda A, Stambolian D, Chen W, Curcio CA,
Abecasis GR, Swaroop A. Age-related macu-
lar degeneration-associated variants at chromo-
some 10q26 do not significantly alter ARMS2 and
HTRA1 transcript levels in the human retina. Mol
Vis. 2010;16:1317–23.
88. Liu J, Hoh J. Postnatal overexpression of the human
ARMS2 gene does not induce abnormalities in ret-
ina and choroid in transgenic mouse models. Invest
Ophthalmol Vis Sci. 2015;56(2):1387–8.
89. Nakayama M, Iejima D, Akahori M, Kamei J, Goto
A, Iwata T. Overexpression of HtrA1 and exposure to
mainstream cigarette smoke leads to choroidal neo-
vascularization and subretinal deposits in aged mice.
Invest Ophthalmol Vis Sci. 2014;55(10):6514–23.
90. Hu SI, Carozza M, Klein M, Nantermet P, Luk D,
Crowl RM. Human HtrA, an evolutionarily con-
served serine protease identified as a differentially
expressed gene product in osteoarthritic cartilage. J
Biol Chem. 1998;273(51):34406–12.
91. De Luca A, De Falco M, Severino A, Campioni
M, Santini D, Baldi F, et al. Distribution of the
serine protease HtrA1 in normal human tissues. J
Histochem Cytochem. 2003;51(10):1279–84.
92. Zumbrunn J, Trueb B. Primary structure of a puta-
tive serine protease specific for IGF-binding pro-
teins. FEBS Lett. 1996;398(2–3):187–92.
93. Ajayi F, Kongoasa N, Gaffey T, Asmann YW,
Watson WJ, Baldi A, et al. Elevated expression of
serine protease HtrA1 in preeclampsia and its role in
trophoblast cell migration and invasion. Am J Obstet
Gynecol. 2008;199(5):557e1–10.
94. Chien J, Ota T, Aletti G, Shridhar R, Boccellino M,
Quagliuolo L, et al. Serine protease HtrA1 associ-
ates with microtubules and inhibits cell migration.
Mol Cell Biol. 2009;29(15):4177–87.
95. Graham JR, Chamberland A, Lin Q, Li XJ, Dai D,
Zeng W, et al. Serine protease HTRA1 antagonizes
transforming growth factor-beta signaling by cleav-
ing its receptors and loss of HTRA1 in vivo enhances
bone formation. PLoS One. 2013;8(9):e74094.
96. Tiaden AN, Breiden M, Mirsaidi A, Weber FA,
Bahrenberg G, Glanz S, et al. Human serine protease
HTRA1 positively regulates osteogenesis of human
bone marrow-derived mesenchymal stem cells and
mineralization of differentiating bone-forming cells
through the modulation of extracellular matrix pro-
tein. Stem Cells. 2012;30(10):2271–82.
97. Chu Q, Diedrich JK, Vaughan JM, Donaldson
CJ, Nunn MF, Lee KF, et al. HtrA1 proteolysis of
ApoE in vitro is allele selective. J Am Chem Soc.
2016;138(30):9473–8.
98. Tennstaedt A, Popsel S, Truebestein L, Hauske P,
Brockmann A, Schmidt N, et al. Human high tem-
perature requirement serine protease A1 (HTRA1)
35
degrades tau protein aggregates. J Biol Chem.
2012;287(25):20931–41.
99. Beaufort N, Scharrer E, Kremmer E, Lux V,
Ehrmann M, Huber R, et al. Cerebral small ves-
sel disease-­ related protease HtrA1 processes
latent TGF-beta binding protein 1 and facilitates
TGF-beta signaling. Proc Natl Acad Sci U S A.
2014;111(46):16496–501.
100. An E, Sen S, Park SK, Gordish-Dressman H, Hathout
Y. Identification of novel substrates for the serine
protease HTRA1 in the human RPE secretome.
Invest Ophthalmol Vis Sci. 2010;51(7):3379–86.
101. Yiu G, Tieu E, Munevar C, Wong B, Cunefare D,
Farsiu S, et al. In vivo multimodal imaging of
drusenoid lesions in rhesus macaques. Sci Rep.
2017;7(1):15013.
102. Singh KK, Krawczak M, Dawson WW, Schmidtke
J. Association of HTRA1 and ARMS2 gene varia-
tion with drusen formation in rhesus macaques. Exp
Eye Res. 2009;88(3):479–82.
103. Pahl L, Spangenberg A, Schubert S, Schonmann
U, Schmidtke J, Stuhrmann M. Characterization of
the 10q26-orthologue in rhesus monkeys corrobo-
rates a functional connection between ARMS2 and
HTRA1. Exp Eye Res. 2012;98:75–8.
104. Chan CC, Shen D, Zhou M, Ross RJ, Ding X, Zhang
K, et al. Human HtrA1 in the archived eyes with age-­
related macular degeneration. Trans Am Ophthalmol
Soc. 2007;105:92–7; discussion 7–8.
105. Chowers I, Meir T, Lederman M, Goldenberg-Cohen
N, Cohen Y, Banin E, et al. Sequence variants in
HTRA1 and LOC387715/ARMS2 and phenotype
and response to photodynamic therapy in neovascu-
lar age-related macular degeneration in populations
from Israel. Mol Vis. 2008;14:2263–71.
106. Wang G, Scott WK, Haines JL, Pericak-Vance
MA. Genotype at polymorphism rs11200638
and HTRA1 expression level. Arch Ophthalmol.
2010;128(11):1491–3.
107. Wang G, Dubovy SR, Kovach JL, Schwartz SG,
Agarwal A, Scott WK, et al. Variants at chromosome
10q26 locus and the expression of HTRA1 in the
retina. Exp Eye Res. 2013;112:102–5.
108. Williams BL, Seager NA, Gardiner JD, Pappas
CM, Cronin MC, Amat di San Filippo C, et al.
Chromosome 10q26-driven age-related macular
degeneration is associated with reduced levels of
HTRA1 in human retinal pigment epithelium. Proc
Natl Acad Sci U S A. 2021;118(30):20210727.
109. Yang J, Li Y, Chan L, Tsai YT, Wu WH, Nguyen
HV, et al. Validation of genome-wide association
study (GWAS)-identified disease risk alleles with
patient-specific stem cell lines. Hum Mol Genet.
2014;23(13):3445–55.
110. Murwantoko YM, Ueta Y, Murasaki A, Kanda H,
Oka C, et al. Binding of proteins to the PDZ domain
regulates proteolytic activity of HtrA1 serine prote-
ase. Biochem J. 2004;381(Pt 3):895–904.
111. Hou J, Clemmons DR, Smeekens S. Expression
and characterization of a serine protease that pref-
36
erentially cleaves insulin-like growth factor binding
protein-­5. J Cell Biochem. 2005;94(3):470–84.
112. Grau S, Baldi A, Bussani R, Tian X, Stefanescu R,
Przybylski M, et al. Implications of the serine prote-
ase HtrA1 in amyloid precursor protein processing.
Proc Natl Acad Sci U S A. 2005;102(17):6021–6.
113. Hadfield KD, Rock CF, Inkson CA, Dallas SL, Sudre
L, Wallis GA, et al. HtrA1 inhibits mineral deposi-
tion by osteoblasts: requirement for the protease and
PDZ domains. J Biol Chem. 2008;283(9):5928–38.
114. Tsuchiya A, Yano M, Tocharus J, Kojima H,
Fukumoto M, Kawaichi M, et al. Expression of
mouse HtrA1 serine protease in normal bone and car-
tilage and its upregulation in joint cartilage damaged
by experimental arthritis. Bone. 2005;37(3):323–36.
115. Vierkotten S, Muether PS, Fauser S. Overexpression
of HTRA1 leads to ultrastructural changes in the
elastic layer of Bruch’s membrane via cleavage
of extracellular matrix components. PLoS One.
2011;6(8):e22959.
116. Kim GY, Kim HY, Kim HT, Moon JM, Kim CH,
Kang S, et al. HtrA1 is a novel antagonist controlling
fibroblast growth factor (FGF) signaling via cleav-
age of FGF8. Mol Cell Biol. 2012;32(21):4482–92.
117. Klose R, Adam MG, Weis EM, Moll I, Wustehube-­
Lausch J, Tetzlaff F, et al. Inactivation of the serine
protease HTRA1 inhibits tumor growth by deregulat-
ing angiogenesis. Oncogene. 2018;37(31):4260–72.
118. Lin MK, Yang J, Hsu CW, Gore A, Bassuk AG,
Brown LM, et al. HTRA1, an age-related macu-
lar degeneration protease, processes extracellular
matrix proteins EFEMP1 and TSP1. Aging Cell.
2018;17(4):e12710.
119. Chekuri A, Zientara-Rytter K, Soto-Hermida A,
Borooah S, Voronchikhina M, Biswas P, et al. Late-­
onset retinal degeneration pathology due to muta-
tions in CTRP5 is mediated through HTRA1. Aging
Cell. 2019;18(6):e13011.
120. Fu L, Garland D, Yang Z, Shukla D, Rajendran A,
Pearson E, et al. The R345W mutation in EFEMP1
N. Gogna et al.
is pathogenic and causes AMD-like deposits in mice.
Hum Mol Genet. 2007;16(20):2411–22.
121. Wang K, Li H, Sun R, Liu C, Luo Y, Fu S, et al.
Emerging roles of transforming growth factor
beta signaling in wet age-related macular degen-
eration. Acta Biochim Biophys Sin Shanghai.
2019;51(1):1–8.
122. Tosi GM, Orlandini M, Galvagni F. The contro-
versial role of TGF-beta in neovascular age-related
macular degeneration pathogenesis. Int J Mol Sci.
2018;19(11):E3363.
123. Moses HL, Roberts AB, Derynck R. The discovery
and early days of TGF-beta: a historical perspective.
Cold Spring Harb Perspect Biol. 2016;8(7) a021865.
124. Oka C, Tsujimoto R, Kajikawa M, Koshiba-Takeuchi
K, Ina J, Yano M, et al. HtrA1 serine protease inhib-
its signaling mediated by Tgfbeta family proteins.
Development. 2004;131(5):1041–53.
125. Launay S, Maubert E, Lebeurrier N, Tennstaedt A,
Campioni M, Docagne F, et al. HtrA1-dependent
proteolysis of TGF-beta controls both neuronal
maturation and developmental survival. Cell Death
Differ. 2008;15(9):1408–16.
126. Shiga A, Nozaki H, Yokoseki A, Nihonmatsu M,
Kawata H, Kato T, et al. Cerebral small-vessel dis-
ease protein HTRA1 controls the amount of TGF-­
beta1 via cleavage of proTGF-beta1. Hum Mol
Genet. 2011;20(9):1800–10.
127. Chang C. Agonists and antagonists of TGF-beta
family ligands. Cold Spring Harb Perspect Biol.
2016;8(8) a021923.
128. Derynck R, Budi EH. Specificity, versatility, and
control of TGF-beta family signaling. Sci Signal.
2019;12(570):eaav5183.
129. Robertson IB, Rifkin DB. Regulation of the bioavail-
ability of TGF-beta and TGF-beta-related proteins.
Cold Spring Harb Perspect Biol. 2016;8(6) a021907.
130. Akhtar-Schaefer I, Reuten R, Koch M, Pietsch M,
Langmann T. AMD-associated HTRA1 variants do
not influence TGF-beta signaling in microglia. Adv
Exp Med Biol. 2019;1185:3–7.
 Untargeted Lipidomic Profiling
of Aged Human Retina
With and Without Age-Related
Macular Degeneration (AMD)

Ankita Kotnala, David M. G. Anderson,

Jeffrey D. Messinger, Christine A. Curcio,
and Kevin L. Schey

Abstract and were analyzed by LC-MS/MS and

The molecular characterization of extracellu-
lar deposits is crucial to understanding the
clinical progression of AMD. Liquid
chromatography-­ tandem mass spectrometry
(LC-MS/MS) analysis is a powerful analytical
discovery tool capable of identifying lipids in
an untargeted manner. NanoLC-MS/MS is an
analytical tool capable of identifying lipids
with high sensitivity and minimum sample
usage. Hence, the purpose of this study was to
compare retina lipid identification from RPE-­
choroid samples using high flow LC-MS/MS
and nanoLC-MS/MS. Manually dissected
paraformaldehyde-fixed human donor tissues
sections were used for LC-MS/MS and
nanoLC-MS/MS analysis. Lipids were
extracted with MeOH/MTBE/CHCl3 (MMC)
A. Kotnala
Department of Biochemistry, Vanderbilt University,
Nashville, TN, USA
Department of Ophthalmology, University of
Alabama at Birmingham, Birmingham, AL, USA
D. M. G. Anderson · K. L. Schey (*)
Department of Biochemistry, Vanderbilt University,
Nashville, TN, USA
e-mail: k.schey@vanderbilt.edu
J. D. Messinger · C. A. Curcio
Department of Ophthalmology, University of
Alabama at Birmingham, Birmingham, AL, USA
nanoLC-MS/MS using negative and positive
ionization modes. Untargeted lipidomics
using LC-MS/MS identified 215 lipids from 4
lipid classes and 15 subclasses. We observed a
78% increase in lipid identifications using
nanoLC-MS/MS with lipid numbers totaling
384. The nanoLC-MS/MS method is expected
to provide extensive lipid identifications from
small retina samples, e.g., from drusen and
drusenoid deposits in aged and AMD eyes,
and could help elucidate how lipids are
involved in extracellular deposit formation in
AMD.
Keywords
Age-related macular degeneration · Retina ·
RPE · Fixed · Lipids · LC-MS/MS ·
NanoLC-MS/MS
1 Introduction
Age-related macular degeneration (AMD) is a
major cause of blindness in older adults world-
wide [1]. Extracellular deposits on basal and
apical sides of the retinal pigment epithelium
(RPE) are major risk factors for AMD.
Degeneration and death of photoreceptors

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 37

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_6
38
results in vision loss [2, 3]. Ample evidence
supports a role of lipids and associated path-
ways in extracellular deposit formation and
degeneration of vision-critical cells of neural
retina [2]. Molecular ­characterization of human
RPE and extracellular deposits will further our
understanding of how these deposits form and
confer risk for progression [4]. Liquid chroma-
tography-tandem mass spectrometry LC-MS/
MS analysis is a powerful analytical tool for
identifying lipids using accurate masses and
fragmentation patterns. LC-MS/MS provides
molecular identifications of many hundreds of
lipids in an untargeted fashion [5]. NanoLC-MS/
MS is a highly sensitive method for comprehen-
sive lipidomic coverage from limited samples.
The nanoLC-MS/MS method has not been
extensively explored for lipidomic analysis [6,
7]. This study, for the first time, evaluated its
utility in analyzing human retina. The goal of
this study was to investigate and compare the
lipidome coverage using high flow LC-MS/MS
and nanoLC-­MS/MS.
2 Material and Methods
2.1 Sample Procurement
and Preparation for LC-MS/MS
Analysis
Donor eyes were obtained from Advancing Sight
Network (formerly Alabama Eye Bank) <6 h
postmortem and immediately prepared for fixa-
tion and/or embedding. The anterior portion of
the eye was removed before placing in parafor-
maldehyde for 48 h at 4 °C. We recently com-
pared lipidomic analysis of fresh-frozen and
paraformaldehyde fixed human retina tissue sec-
tions and observed similar lipidome coverage [5].
Fifty μm sections of fixed human donor tissue
were cut and thaw-mounted on plain glass slides
for the high flow LC-MS/MS analysis. One bio-
logical replicate of above 80 years of age human
donor retina was used for the LC-MS/MS analy-
sis. Twelve-fourteen μm sections from a separate
fixed human donor tissue were cut and subjected
to nanoLC-MS/MS analysis.
A. Kotnala et al.
The RPE-choroid was removed from the glass
slide with a scalpel blade, under a dissecting
microscope. Sclera and neural retina were care-
fully removed before removing RPE-choroid tis-
sue. The dissected RPE-choroid samples from
each tissue section were placed in separate HPLC
glass vials, and the lipids were extracted using
MeOH:MTBE:CHCl3(1.2:1:1) (MMC) extrac-
tion mixture. The samples were spiked with
SPLASH LIPIDOMIX (Avanti Polar Lipids) as
internal standards, vortexed for 60 s and centri-
fuged at 3000 rpm for 10 min. The supernatant
was transferred to a separate HPLC vial and was
evaporated to dryness. The sample was then
reconstituted with 30 μL methanol, and 10 μL
was injected for high flow LC-MS/MS analysis.
For nanoLC-MS/MS analysis, samples were
reconstituted with 10 μL BuOH:IPA:H20
(8:23:69) with 5 mM phosphoric acid, and 1 μL
was subjected for nLC-MS/MS analysis.
2.2 High Flow LC-MS/MS
Procedure
Chromatographic separation was achieved using
an ACQUITY UPLC BEH C-18 column
(2.1 × 150 mm, 1.7 μm particle size) (Waters
Corporation, Milford, MA, USA) held at 50 °C
coupled to a Vanquish binary pump (Thermo
Fisher Scientific, San Jose, CA). A gradient
mobile phase was generated over 55 min with a
flow rate of 250 μL/min and was comprised of
10 mM ammonium formate in 40:60 (v/v) water,
acetonitrile with 0.1% formic acid and 10 mM
ammonium formate in 90:10 (v/v) isopropanol,
and acetonitrile with 0.1% formic acid. Ten μL of
sample was injected via the Vanquish autosam-
pler maintained at 4 °C. HPLC eluate flowed into
a HESI-heated ESI source, and ions were ana-
lyzed using a Q Exactive HF instrument (Thermo
Scientific). Data were acquired at both full (MS1)
and data-dependent MS2 (ddMS2) scan modes
using positive and negative modes, separately.
The full scan mode had a mass resolution of
60,000, mass range of m/z 400–1200 in positive
polarity and a mass range of m/z 240–1600 in
negative polarity, and a maximum trap fill time of
Untargeted Lipidomic Profiling of Aged Human Retina With and Without Age-Related Macular… 39

100 ms. ddMS2 data were acquired at 15,000 ion species, accurate m/z values for the precursor
resolution, with a maximum trap fill time of ions and subsequent ddMS2 spectra were
160 ms. The isolation window of selected MS1 acquired from the SPLASH® LIPIDOMIX® mix-
ions was ±1.4 m/z with a normalized collision ture of lipids. Lipid species were identified based
energy (NCE) of 20 and 25. LC-MS/MS data on their fragmentation pattern with a mass toler-
were acquired using Xcalibur version 4.0. ance of 0.2 ppm in negative and positive ioniza-
tion modes. Confirmed lipid identifications were
made by examination of tandem mass spectra for
2.3 NanoLC-MS/MS Procedure head group and fatty acyl chains, mass error mea-
surement, isotopic profile, extracted ion chro-
Custom reverse phase columns (20 cm × 75 μm) matogram, and the retention time for precursor
were packed with 1.9 μm BEH C18 material. ions. LC-MS/MS data were processed to separate
NanoLC-MS/MS was performed using an EASY-­ each lipid identification into its distinct lipid
nLC 1000 (Thermo Scientific) coupled to Q class.
Exactive HF instrument (Thermo Scientific). A
gradient mobile phase comprised of 10 mM
ammonium formate in 40:60 (v/v) water, acetoni- 3 Results
trile with 0.1% formic acid and 10 mM ammo-
nium formate in 90:10 (v/v) isopropanol, and 3.1 Elution Profile of Lipids
acetonitrile with 0.1% formic at 300 nl/min for Identified by High Flow
120 minutes, and the column compartment was LC-MS/MS
heated at 60 °C. One μL of sample was injected.
Data were acquired using both full (MS1) and The high flow LC-MS/MS elution profile of lip-
data-dependent MS2 (ddMS2) scan modes in ids extracted from human RPE is represented in
positive and negative modes, separately. The full Fig. 1. The lysophospholipids including lyso PC,
scan mode had a mass resolution of 60,000, mass lyso PE, and acylcarnitine eluted first from the
range of m/z 400–1200 in positive polarity, and a column with a retention time of 3–10 min.
mass range of m/z 240–1600 in negative polarity. Plasmalogen lipids including plasmanyl PC,
NanoLC-MS/MS data were acquired using plasmenyl PC, plasmanyl PE and plasmenyl PE,
Xcalibur version 4.0. glycerophospholipids (phosphatidylcholines
(PC), phosphatidylethanolamine (PE), phospha-
tidylinositol (PI), phosphatidylserine (PS), phos-
2.4 Data Analysis phatidyl glycerol (PG)), diacylglycerols
(triglyceride and diacylglycerol), and ceramides
Raw LC-MS/MS data files (Thermo .raw files) eluted at 10–30 min. Cardiolipins and cholesteryl
were converted to mgf, mzXML files using the esters eluted at 32–45 min.
MSConvert function of ProteoWizard [8]. Mgf,
mzXML input files were searched using the spec-
trum searcher feature of LipiDex [9] software 3.2 Untargeted Lipidomic
v1.0.2 for lipid identifications using LipiDex_ Analysis of Healthy Human
HCD_Formic and LipiDex_Splash_ISTD_ Donor RPE-Choroid Using
Formic libraries. Precursor mass-to-charge (m/z), High Flow LC-MS/MS
fragmentation spectra, chromatographic reten-
tion time, and identification were integrated using We identified 215 lipids comprised of 4 lipid
LipiDex. Fragmentation patterns of individual classes and 15 lipid subclasses from human donor
lipid standards were manually interpreted and RPE-choroid from paraformaldehyde-fixed tis-
then matched against LipiDex library results. To sue using positive and negative ionization modes
ensure correct annotation of individual molecular of LC-MS/MS as presented in Fig. 2. The 4
40 A. Kotnala et al.

Fig. 1 Base peak chromatogram representative of human donor RPE-choroid samples using LC-MS/MS

Fig. 2 Overall lipidome coverage from high flow LC-MS/MS in negative and positive ionization modes using human
donor RPE-choroid tissue (≥80 years)

classes included 123 glycerophospholipids, 48 prised of 22 sphingomyelin (SM), 11 acylcarnitine

triglycerides, 41 sphingomyelins, and 7 choles-
teryl esters. The maximum number of lipids were
identified from glycerophospholipids including
10 subclasses: 37 phosphatidylcholines (PC), 4
phosphatidylethanolamine (PE), 7 phosphati-
dylinositol (PI), 7 phosphatidylserine (PS), 20
phosphatidylglycerol (PG), 6 lysophosphatidyl-
choline (Lyso PC), 6 lysophosphatidylethanol-
amine (Lyso PE), and 9 plasmalogen PC
(plasmanyl PC and plasmenyl PC). Triglycerides
(TG) totaled 48 and included 44 TG and 4 diacyl-
glycerols (DG). Forty-one sphingomyelins com-
(AC), and 10 ceramides (Cer). A total of 7 cho-
lesteryl esters (CE) were identified.
3.3 Comparison of Lipid Profiling
from High Flow LC-MS/MS
and nLC-MS/MS
We identified 384 lipids using nanoLC-MS/MS
analysis and 215 lipids using high flow LC-MS/
MS, in separate paraformaldehyde-fixed samples
of human donor RPE-choroid. The lipid sub-
Untargeted Lipidomic Profiling of Aged Human Retina With and Without Age-Related Macular…
Fig. 3 Comparison of high flow LC-MS/MS vs. nanoLC-MS/MS of human RPE-choroid sample analysis in negative
and positive ionization modes
classes were compared from nanoLC-MS/MS
and high flow LC-MS/MS analysis as shown in
Fig. 3. Lipids from various lipid classes including
Cer, DG, lysophospholipids, PC, SP, TG, PE, PI,
PS, and HexCer were either absent or were fewer
in numbers for high flow LC-MS/MS as com-
pared to nanoLC-MS/MS. The major subclasses
of lipids identified by nanoLC-MS/MS include:
10 AC, 3 CE, 16 Cer, 11 DG, 21 lysoPC, 6 Lyso
PE, 1 lyso SM, 6 Lyso PG, 4 Lyso PI, 4 Lyso PS,
49 PC, 2 PI, 22 SM, 5 SP, 86 TG, 2 Cer, 18 PE,
11 PE-Nme, 10 PG, 24 PI, 13 PC-O/P, 13 PE-O/P,
16 PS, 9 HexCer, and 22 SM. nanoLC-MS/MS
outperformed high flow LC-MS/MS in the num-
ber of lipids identified in each class except for AC
and PG lipids. Note that roughly 30% of the high
flow LC-MS/MS sample volume was used for
nano-LC-MS/MS analysis, yet 78% more lipids
were identified using nano LC-MS/MS as com-
pared to high flow LC-MS/MS analysis.
4 Discussion
AMD is a leading cause of blindness among the
elderly population [1]. AMD is characterized by
the accumulation of extracellular deposits called
drusen located between the basal lamina of the
RPE and the inner collagenous layer of Bruch’s
membrane [10]. The pathophysiology behind
drusen formation is only partly understood.
41
However, lipid homeostasis, oxidative stress, and
chronic inflammation have been associated with
drusen formation [1] and disease progression.
Although there is a treatment available for the
neovascular form of AMD, there is no treatment
available to prevent disease progression at early
stages [11]. Interestingly, a newer understanding
of drusen composition has led to therapeutic tar-
geting of lipids, a major drusen component [12].
In-depth molecular characterization of retinal
extracellular deposits in aged retina is necessary
to understand their mechanism of formation and
role in AMD progression. Liquid chromatogra-
phy tandem mass spectrometry (LC-MS/MS)
provides specific molecular identifications of
hundreds of lipids in an untargeted fashion.
Overall, untargeted lipidomic analysis from
paraformaldehyde-­ fixed RPE-choroid tissue
identified 215 lipids from 4 lipid classes and 15
lipid subclasses using high flow LC-MS/MS. To
further increase the sensitivity of lipid analysis
and for analysis of limited tissue volumes, we
have developed nanoLC-MS/MS to examine dis-
sected human RPE-choroid samples. We
observed a 78% increase in lipid number while
going from high flow LC-MS/MS to nanoLC-
­MS/MS with total lipid identifications increasing
from 215 to 384 with 70% less sample injected.
The increase in the number of lipids identified
was observed for nearly all lipid classes detected.
Further identifications of lipids in aged and AMD
42
eyes could help elucidate the sources of lipids
involved in extracellular deposit formation in
AMD.
5 Conclusion
Molecular features of lipid signals were identi-
fied and compared using high flow LC-MS/MS
and nanoLC-MS/MS. The increased sensitivity
provided by nanoLC-MS/MS will provide exten-
sive lipidome coverage from small retinal depos-
its that are involved in AMD formation.
Acknowledgments The authors acknowledge the finan-
cial support from NIH grants R01EY027948 (CAC), P41
GM103391, S10 OD023514 (KLS), Heidelberg
Engineering, (UAB institutional support), Research to
Prevent Blindness (CAC & KLS), and EyeSight
Foundation of Alabama.
Financial Disclosures (CAC) research funding
from Heidelberg Engineering and Hoffman La
Roche
References
1. Fleckenstein M, Keenan TDL, Guymer RH,
Chakravarthy U, Schmitz-Valckenberg S, Klaver CC,
et al. Age-related macular degeneration. Nat Rev Dis
Primers. 2021;7(1):31.
2. Curcio CA. Soft drusen in age-related macu-
lar degeneration: biology and targeting via the
oil spill strategies. Invest Ophthalmol Vis Sci.
2018;59(4):Amd160-amd81.
A. Kotnala et al.
3. Curcio CA, Sloan KR, Kalina RE, Hendrickson
AE. Human photoreceptor topography. J Comp
Neurol. 1990;292(4):497–523.
4. Anderson DMG, Messinger JD, Patterson NH, Rivera
ES, Kotnala A, Spraggins JM, et al. Lipid landscape
of the human retina and supporting tissues revealed by
high-resolution imaging mass spectrometry. J Am Soc
Mass Spectrom. 2020;31:2426.
5. Kotnala A, Anderson DMG, Patterson NH, Cantrell
LS, Messinger JD, Curcio CA, et al. Tissue fixation
effects on human retinal lipid analysis by MALDI
imaging and LC-MS/MS technologies. J Mass
Spectrom. 2021;56(12):e4798.
6. Danne-Rasche N, Coman C, Ahrends R. Nano-LC/
NSI MS refines lipidomics by enhancing lipid cov-
erage, measurement sensitivity, and linear dynamic
range. Anal Chem. 2018;90(13):8093–101.
7. Vasilopoulou CG, Sulek K, Brunner A-D, Meitei NS,
Schweiger-Hufnagel U, Meyer SW, et al. Trapped
ion mobility spectrometry and PASEF enable in-­
depth lipidomics from minimal sample amounts. Nat
Commun. 2020;11(1):331.
8. Adusumilli R, Mallick P. Data conversion with
ProteoWizard msConvert. Methods Mol Biol (Clifton,
NJ). 2017;1550:339–68.
9. Hutchins PD, Russell JD, Coon JJ. LipiDex: an inte-
grated software package for high-confidence lipid
identification. Cell Syst. 2018;6(5):621–5.e5.
10. Chen L, Messinger JD, Kar D, Duncan JL, Curcio
CA. Biometrics, impact, and significance of basal
linear deposit and subretinal drusenoid deposit in age-­
related macular degeneration. Invest Ophthalmol Vis
Sci. 2021;62(1):33.
11. Cabral de Guimaraes TA, Daich Varela M, Georgiou
M, Michaelides M. Treatments for dry age-related
macular degeneration: therapeutic avenues, clini-
cal trials and future directions. Br J Ophthalmol.
2021:bjophthalmol-2020-318452.
12. Rudolf M, Curcio CA, Schlotzer-Schrehardt U, Sefat
AMM, Tura A, Aherrahrou Z, et al. Apolipoprotein
A-I mimetic peptide L-4F removes bruch’s membrane
lipids in aged nonhuman primates. Invest Ophthalmol
Vis Sci. 2019;60(2):461–72.
 Decoding Race and Age-Related
Macular Degeneration: GPR 143
Activity Is the Key
Dorothy Tung and Brian S. McKay
Abstract
Age-related macular degeneration (AMD) is a
leading cause of irreversible blindness in the
developed world. Caucasians are eightfold
more likely to develop AMD than any other
race, indicating a racial bias in AMD inci-
dence which is unexplained. We hypothesize
that pigmentation of the retinal pigment epi-
thelium (RPE) and choroid protects from
AMD and underlies this peculiar racial bias.
We investigated GPR143, a receptor in the
pigmentation pathway, which is activated by a
melanin synthesis by-product, l-dopa. In this
model, greater pigmentation leads to greater
l-dopa production and, in turn, greater
GPR143 signaling. GPR143 activity upregu-
lates PEDF and downregulates both VEGF
and exosomes; all of which reduce the angio-
genic potential in the retina. Moreover, we
demonstrate that GPR143 signaling enhances
the digestion of shed photoreceptor outer seg-
D. Tung
Department of Ophthalmology and Vision Science,
University of Arizona, Tucson, AZ, USA
e-mail: dorothytung@email.arizona.edu
B. S. McKay (*)
Department of Ophthalmology and Vision Science,
University of Arizona, Tucson, AZ, USA
Department of Physiology, University of Arizona,
Tucson, AZ, USA
e-mail: bsmckay@eyes.arizona.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_7
ments. Together, our data suggests a central
role for GPR143 signaling in RPE-­
photoreceptor interaction which is critical to
healthy vision.
Keywords
Age-related macular degeneration · Retinal
pigment epithelium · GPCR · GPR143 ·
L-dopa · Photoreceptor outer segments · Race
· Pigmentation · Melanin
Abbreviations
AMD Age-related macular degeneration
RPE Retinal pigment epithelium
l-dopa l-3,4-dihydroxyphenylalanine
PEDF Pigment epithelium derived factor
VEGF Vascular endothelial growth factor
POS Photoreceptor outer segments
1 Introduction
Age-related macular degeneration (AMD) is a
leading cause of irreversible blindness in devel-
oped nations [1–3]. Currently, greater than 10%
of the United States population over the age of
70 has AMD, and its prevalence will increase as
the population ages. Most AMD patients develop
43
44
geographic atrophy, which involves deteriora-
tion of the macula and gradually impairs vision.
The remaining 10–15% of AMD patients
develop neovascular AMD, which involves
growth of new blood vessels that cause bleed-
ing, swelling, and scarring of the macula [4–6].
While neovascular AMD only accounts for a
minority of AMD cases, it causes 85–90% of
vision loss from AMD. AMD incidence exhibits
a striking racial bias, with Caucasians affected
eight times more often than any other popula-
tion after the age of 80 [7–10]. We hypothesize
that RPE/choroidal pigmentation, is likely dif-
ferent among races, and plays a role in this bias
[11, 12]. Despite years of study, the etiology of
AMD is unknown, and we cannot prevent the
disease [6, 13, 14]. However, we do know that
being Caucasian is an even greater risk factor
for AMD than age is past 75 years of age
(Fig. 1).
To understand the racial bias of AMD, we
investigated the melanin synthesis pathway in the
RPE. This pathway includes a little studied
G-protein-coupled receptor (GPCR), GPR143.
We identified l-dopa as the ligand of GPR143,
which is itself a by-product of melanin synthesis
[15]. Defects in GPR143 cause ocular albinism,
resulting in low vision similar to all other forms
of albinism which are associated with reduced
pigment production [16–19]. Loss of RPE pig-
Fig. 1 AMD incidence 16%
by race and age. Graph
portrays the percentage 14%
of the identified
population by age and 12%
race that have AMD in
2010. (Adapted from the 10%
National Eye Institute)
8%
6%
4%
2%
0%
50-54 55-59
D. Tung and B. S. McKay
mentation results in a characteristic retinal phe-
notype, including reduced numbers of
photoreceptor and ganglion cells, misrouting of
the optic chiasm, and foveal hypoplasia [16, 20,
21]. Curiously, ocular albinism includes all of the
same retinal defects, despite the fact that the RPE
has normal pigmentation [22–24]. Thus, the reti-
nal albinism phenotype is not due to a lack of
RPE pigmentation but, rather, a lack of GPR143
signaling. Either there is a loss of melanin and
l-dopa production or a loss of the l-dopa receptor,
GPR143, both of which yield the same
phenotype.
2 GPR143
GPR143 expression is limited to melanin-­
containing cells [25]. The expression of GPR143
in cells that also produce melanin and l-dopa
indicates that GPR143 signals in an autocrine
manner. Mutations in the gene encoding GPR143
cause ocular albinism, a condition where pig-
mented cells accumulate melanin, but in mishap-
pen macromelanosomes [25, 26]. This
observation indicates GPR143 signaling has a
function in endosomal trafficking [26–28]. The
lack of effects on cutaneous or ocular pigmenta-
tion underscores the point that GPR143 signaling
does not control melanin production.
White
Black
Hispanic
Other
60-64 65-69 70-74 75-79 80+
Decoding Race and Age-Related Macular Degeneration: GPR 143 Activity Is the Key
Fig. 2 An overview of
two critical pathways in
the RPE: GPR143
activation and outer
segment degradation.
GPR143 signaling
increases expression of
PEDF, and decreases
both VEGF and
exosome release (blue
dots). GPR143 also
enhances POS digestion
3 GPR143 and Trophic Factors
GPR143 signaling increases expression of pig-
ment epithelium-derived factor (PEDF), the most
potent neurotrophic factor in the eye (Fig. 2)
[15]. GPR143 signaling and PEDF make an
attractive possibility to account for albinism
effects on retinal development and survival [12,
29]. Recently, Lee et al. demonstrated that sup-
plemental l-dopa rescues normal retinal develop-
ment in albino animals, directly showing that
GPR143 signaling supports proper retinal devel-
opment [27].
GPR143 signaling decreases RPE secretion
of vascular endothelial growth factor (VEGF),
a potent angiogenic factor [28]. Reducing ocu-
lar VEGF is likely to foster a reduced angio-
genic environment in the RPE. While these
changes in PEDF and VEGF were significant,
they were subtle. Thus, the robust eightfold
racial bias in AMD incidence seems unlikely to
be from the subtle alterations in PEDF and
VEGF.
45
4 L-Dopa Halts Extracellular
Vesicle Release
Exosomes are nanometer-size extracellular vesi-
cles secreted by almost all cells [30]. Exosomes
play a critical role in tissue angiogenesis and are
heavily secreted by most cancerous cells [31, 32].
Exosomes carry a variety of cargo—including
proteins, lipids, and nucleic acids—and also play
a role in inter-tissue communication. GPR143
activation immediately halts RPE exosome
release [33].
Like the racial bias of AMD, GPR143 effects
on RPE exosome release are not subtle. The sheer
magnitude of GPR143’s effect on exosome
release, compared to the modest effect on trophic
factors, suggests that exosome release better
matches GPR143 activity to the racial bias of
AMD [11, 12, 29, 34]. However, we lack any
information on the potential racial disparities in
GPR143 expression. There are multiple promoter
and gene polymorphisms in GPR143 that link to
race and ethnicity that could affect GPR143
46
expression and activity. Unfortunately, while
these changes have the potential to link GPR 143
activity to the racial bias of AMD, they have not
been studied.
5 GPR 143 Signaling
in Photoreceptor Outer
Segment Digestion
Photoreceptors undergo a daily renewal pro-
cess by shedding the distal 10% of their outer
segments [35]. The RPE plays a critical role in
the daily phagocytosis and degradation of the
shed photoreceptor outer segments (POS).
Often overlooked, this daily activity makes the
RPE the most phagocytic tissue in the body
[12, 36–38]. This digestive process involves a
series of temporal steps: recognition, binding,
intracellular signaling, internalization, and
digestion [36, 37]. Inefficient digestion of POS
leads to the aggregation of lipids and proteins
within the RPE, hence playing a role in the
pathogenesis of various retinopathies includ-
ing AMD.
We tested the effect of GPR143 on the POS
uptake and digestion process. We challenged pig-
mented RPE with fluorescently labeled POS with
and without l-dopa to stimulate GPR143 signal-
ing. L-dopa had no effect on the rate of POS
uptake by the RPE over 2 h. However, when
using a pH-sensitive dye that only fluoresces in
the acidic lysosomal compartment, l-dopa
increased the rate of POS degradation, as quanti-
fied by a more rapid decrease in the area of fluo-
rescence over time. Our results suggest that
GPR143 may have an effect on POS digestion,
perhaps by increasing the efficiency of endo-
somal trafficking.
6 Clinical Studies with L-Dopa
and AMD
To explore whether GPR143 signaling affects
AMD incidence, we conducted a retrospective
analysis of patients prescribed l-dopa [39]. We
found that AMD onset was both reduced and
D. Tung and B. S. McKay
delayed in patients prescribed l-dopa. L-dopa
delayed the age of onset from 71.4 years to
79.3 years in patients with geographic atrophy
and from 75.5 years to 80.8 years in patients with
neovascular AMD.
In a proof of principle prospective clinical
trial, l-dopa significantly increased the best cor-
rected visual acuity, decreased subretinal fluid,
and decreased the mean central retinal thickness
in patients with neovascular AMD [40].
7 Conclusion
Our findings suggest that GPR143 signaling in
response to l-dopa significantly delays or pre-
vents AMD pathogenesis. Potential mechanisms
underlying GPR143 activity include upregulating
PEDF, downregulating VEGF, halting RPE exo-
some release, and increasing the rate of POS deg-
radation. Since GPR143 is an important
component of the pigmentation pathway, these
observations may underlie the racial bias of the
disease. Taken as a whole, our results indicate
that GPR143 may be a promising target for future
research centered on novel drugs and therapies to
prevent AMD in those at greatest risk.
References
1. Klein R, Klein BEK. The prevalence of age-related
eye diseases and visual impairment in aging: cur-
rent estimates. Investig Ophthalmol Vis Sci. https://
doi.org/10.1167/iovs.13-­12789. Epub ahead of print
2013.
2. Resnikoff S, Pascolini D, Etya’ale D, et al. Global
data on visual impairment in the year 2002. Bull
World Health Organ. 2004;82:844–51.
3. Jager RD, Mieler WF, Miller JW. Age-related macular
degeneration. N Engl J Med. 2008;358:2606–17.
4. Mitchell P, Korobelnik JF, Lanzetta P, et al.
Ranibizumab (Lucentis) in neovascular age-related
macular degeneration: evidence from clinical tri-
als. Br J Ophthalmol. https://doi.org/10.1136/
bjo.2009.159160. Epub ahead of print 2010.
5. Kovach JL, Schwartz SG, Flynn HW, et al. Anti-VEGF
treatment strategies for wet AMD. J Ophthalmol.
2012;2012:786870.
6. Group TCR. Ranibizumab and bevacizumab for neo-
vascular age-related macular degeneration. N Engl J
Med. 2011;364:1897–908.
Decoding Race and Age-Related Macular Degeneration: GPR 143 Activity Is the Key
7. Frank RN, Puklin JE, Stock C, et al. Race, iris color,
and age-related macular degeneration. Trans Am
Ophthalmol Soc. 2000;98:109–17.
8. Chang MA, Bressler SB, Munoz B, et al. Racial differ-
ences and other risk factors for incidence and progres-
sion of age-related macular degeneration: Salisbury
Eye Evaluation (SEE) Project. Invest Ophthalmol Vis
Sci. 2008;49:2395–402.
9. Milton RC, Clemons TE, Klien R, et al. Risk factors
for the incidence of advanced age-related macular
degeneration in the Age-Related Eye Disease Study
(AREDS): AREDS report no. 19. Ophthalmology.
2005;112:533–9.
10. Fisher DE, Klein BEKK, Wong TY, et al. Incidence
of age-related macular degeneration in a multi-ethnic
United States population: the multi-ethnic study of
atherosclerosis. Ophthalmology. 2016;123:1297–308.
11. McKay BS, Schwartz SG. Pigmentation and macu-
lar degeneration: is there a role for GPR143? J Ocul
Pharmacol Ther. 2016;32:3–4.
12. Figueroa AG, McKay BS. A G-protein coupled recep-
tor and macular degeneration. Cell. 2020:1–13.
13. Chew EY, Clemons TE, Agrón E, et al. Long-term
effects of vitamins C and E, β-carotene, and zinc on
age-related macular degeneration: AREDS report
no. 35. Ophthalmology. 120:1604. https://doi.
org/10.1016/j.ophtha.2013.01.021. Epub ahead of
print 2013.
14. Rofagha S, Bhisitkul RB, Boyer DS, et al. Seven-­
year outcomes in ranibizumab-treated patients in
ANCHOR, MARINA, and HORIZON: a multi-
center cohort study (SEVEN-UP). Ophthalmology.
2013;120:2292–9.
15. Lopez VM, Decatur CL, Stamer WD, et al. L-DOPA
is an endogenous ligand for OA1. PLoS Biol.
2008;6:1861–9.
16. Hoffmann MB, Lorenz B, Morland AB, et al.
Misrouting of the optic nerves in albinism: estima-
tion of the extent with visual evoked potentials. Invest
Ophthalmol Vis Sci. 2005;46:3892–8.
17. d’Addio M, Pizzigoni A, Bassi MT, et al. Defective
intracellular transport and processing of OA1 is
a major cause of ocular albinism type 1. Hum Mol
Genet. 2000;9:3011–8.
18. Oetting WS, Summers CG, King RA. Albinism and
the associated ocular defects. Metab Pediatr Syst
Ophthalmol. 1994;17:5–9.
19. Summers CG. Albinism: classification, clinical
characteristics, and recent findings. Optom Vis Sci.
2009;86:659–62.
20. King RA, Pietsch J, Fryer JP, et al. Tyrosinase gene
mutations in oculocutaneous albinism 1 (OCA1): defi-
nition of the phenotype. Hum Genet. 2003;113:502–13.
21. Peters S, Kayatz P, Heimann K, et al. Subretinal injec-
tion of rod outer segments leads to an increase in the
number of early-stage melanosomes in retinal pig-
ment epithelial cells. Ophthalmic Res. 2000;32:52–6.
22. Lewen RM. Ocular albinism. Arch Ophthalmol.
1988;106:120–1.
23. Mártinez-García M, Montoliu LL. Albinism in
Europe. J Dermatol. 2013;40:319.
47
24. White D, Rabago-Smith M. Genotype-phenotype
associations and human eye color. J Hum Genet.
2011;56:5–7.
25. Schiaffino MV, Baschirotto C, Pellegrini G, et al. The
ocular albinism type 1 gene product is a membrane
glycoprotein localized to melanosomes. Proc Natl
Acad Sci U S A. 1996;93:9055–60.
26. Schiaffino MV, Tacchetti C. The ocular albinism type
1 (OA1) protein and the evidence for an intracellular
signal transduction system involved in melanosome
biogenesis. Pigment Cell Res. 2005;18:227–33.
27. Lee H, Scott J, Griffiths H, et al. Oral levodopa rescues
retinal morphology and visual function in a murine
model of human albinism. Pigment Cell Melanoma
Res. https://doi.org/10.1111/pcmr.12782. Epub ahead
of print 2019.
28. Falk T, Congrove NR, Zhang S, et al. PEDF and
VEGF-A output from human retinal pigment epi-
thelial cells grown on novel microcarriers. J Biomed
Biotechnol. 2012;2012:278932.
29. Figueroa AG, McKay BS. GPR143 signaling and reti-
nal degeneration. Adv Exp Med Biol. 2019;1185:15.
https://doi.org/10.1007/978-­3-­030-­27378-­1_3. Epub
ahead of print 2019
30. Ramirez SH, Andrews AM, Paul D, et al. Extracellular
vesicles: mediators and biomarkers of pathology
along CNS barriers. Fluids Barriers CNS. 2018;15:19.
31. Sahebi R, Langari H, Fathinezhad Z, et al. Exosomes:
new insights into cancer mechanisms. J Cell Biochem.
2020;121:7–16.
32. Todorova D, Simoncini S, Lacroix R, et al.
Extracellular vesicles in angiogenesis. Circ Res
https://doi.org/10.1161/CIRCRESAHA.117.309681.
Epub ahead of print 2017.
33. Locke CJ, Congrove NR, Dismuke WM, et al.
Controlled exosome release from the retinal pigment
epithelium insitu. Exp Eye Res. 2014;129:1–4.
34. McKay BS. Pigmentation and vision: is GPR143 in
control? J Neurosci Res. 97 https://doi.org/10.1002/
jnr.24246. Epub ahead of print 14 May 2018.
35. Guha S, Liu J, Baltazar G, et al. Rescue of compro-
mised lysosomes enhances degradation of photore-
ceptor outer segments and reduces lipofuscin-like
autofluorescence in retinal pigmented epithelial cells.
Adv Exp Med Biol. 2014;801:105–11.
36. Mazzoni R, Safa H, Finnemann SC. Understanding
photoreceptor outer segment phagocytosis: use
and utility of RPE cells in culture. Exp Eye Res.
2014;126:51–60.
37. Kevany BM, Kryzysztof. Phagocytosis of retinal rod
and cone photoreceptors. Physiology. 2010;25:8–15.
38. Young RW, Bok D. Participation of the retinal pig-
ment epithelium in the rod outer segment renewal pro-
cess. J Cell Biol. 1969;42:392–403.
39. Brilliant MH, Vaziri K, Connor TB, et al. Mining ret-
rospective data for virtual prospective drug repurpos-
ing: L-DOPA and age-related macular degeneration.
Am J Med. 2016;129:292–8.
40. Figueroa AG, Boyd BM, Christensen CA, et al.
Levodopa positively affects neovascular age-related
macular degeneration. Am J Med. 2021;134:122.
 Peroxisome Proliferator-Activated
Receptor Gamma
Coactivator-­1Alpha (PGC-1α):
A Transcriptional Regulator
at the Interface of Aging
and Age-Related Macular
Degeneration?
Freya M. Mowat
Abstract
Human age-related macular degeneration
(AMD) is a prevalent age-related disease
which causes retinal dysfunction and disabil-
ity. Genetic and cell culture studies from AMD
patients have implicated impaired activity of
peroxisome proliferator-activated receptor
gamma coactivator-1alpha (PGC-1α). PGC-1α
is a transcriptional co-regulator that acts to
control a plethora of metabolic processes rel-
evant to AMD pathophysiology including glu-
coneogenesis, oxidative phosphorylation, and
response to oxidative injury. Perturbation of
PGC-1α activity in mice causes AMD-like
RPE and retinal pathology. There is potential
for therapeutic modulation of the PGC-1α
pathway in AMD treatment.
F. M. Mowat (*)
Department of Ophthalmology and Visual Sciences
(School of Medicine and Public Health), Department
of Surgical Sciences (School of Veterinary Medicine),
Medical Sciences Center, University of Wisconsin-­
Madison, Madison, WI, USA
e-mail: mowat@wisc.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_8
Keywords
PGC-1alpha · PPARGC-1alpha · Retina ·
Metabolism · Aging · Age-related macular
degeneration
1 Introduction
Peroxisome proliferator-activated receptor
gamma coactivator-1alpha (PGC-1α) is a tran-
scriptional co-regulator. It mediates the activity
of a broad range of metabolic pathways including
gluconeogenesis, glucose transport, fatty acid
oxidation, mitochondrial biogenesis, and peroxi-
somal remodeling and is important in the detoxi-
fication of reactive oxygen species.
The effects of PGC-1α are mediated through
transcription factors including nuclear receptors
such as peroxisome proliferator-activated recep-
tors (PPARs) and nuclear respiratory factors
(NRFs), hormones (thyroid hormone, estrogen),
and glucocorticoids among others. It is highly
expressed in tissues with large energy needs such
as neurologic tissues. Ocular tissues, including
retinal photoreceptors and retinal pigmented epi-
thelium (RPE) cells, express high levels of
PGC-1α [1, 2]. PGC-1α-related pathways are
strongly implicated in the pathogenesis of human
49
50
age-related macular degeneration (AMD), a
prevalent age-related retinal neurodegenerative
disorder [3].
2 Regulation of Tissue Activity
of PGC-1α
Because PGC-1α is pivotal in control of cellular
metabolic function, its activity is controlled by
multiple stimuli; many of which change during
the aging process. These stimuli include nutrient
availability, temperature, calcium signaling, reac-
tive oxygen species, circadian rhythm, hormone
activity, cytokines, energetic need, and oxygen
concentration (for a review see [4]). Activity of
PGC-1α is regulated at multiple levels, including
control of expression by alterations in promoter
activity [5], changes in subcellular localization
[6], protein stability, and a plethora of posttrans-
lational modifications.
Transcriptional control of PGC-1α expression
is an important mechanism to regulate PGC-1α
activity in health and disease. Healthy muscle
and brown fat have transcriptional regulatory sys-
tems that fine-tune metabolic activity in response
to exercise and temperature [5]. In disease,
increased methylation of the PGC-1α promoter
region occurs in obesity, type 2 diabetes, nonal-
coholic fatty liver disease, and Parkinson’s dis-
ease [5]. Human AMD shares many risk factors
with these diseases, although epigenetic modifi-
cations affecting PGC-1α expression in human
AMD patients have not been determined.
Examples of posttranslational modifications
that increase PGC-1α activity include deacety-
lation of PGC-1α by the action of sirtuins during
fasting or oxidative stress and phosphorylation of
PGC-1α by the activity of AMP-activated protein
kinase (AMPK) and glycogen synthase kinase 3
beta (GSK3β) during energy deficiency or stress
[4]. Regulation of PGC-1α activity is highly tis-
sue specific.
In the outer retina, PGC-1α expression is reg-
ulated at least in part by melatonin signaling via
MT1 receptors in the retina [7], which are highly
expressed in photoreceptors [8]. Retinal PGC-1α
F. M. Mowat
activity is regulated at the posttranslational level
by the activity of sirtuins [9]. Expression of sirtu-
ins is greater in the retina than in other tissues in
mice, and most sirtuins are modulated by light-­
dark cycle, with higher expression in the dark,
indicating a role for PGC-1α in dark adaptation
or maintenance of the dark current [9]. Light
damage to the retinal photoreceptors is extensive
in mice lacking PGC-1α [1]. It seems likely that
PGC-1α has an important role in the maintenance
of photoreceptors and visual function, particu-
larly rod photoreceptors.
In the RPE, PGC-1α expression is enhanced
by binding to photoreceptor outer segments [10].
PGC-1α activity in the RPE facilitates lysosomal
degradation and lipid metabolism in the process-
ing of outer segments following phagocytosis.
Based on these studies, there may be divergent
functions for PGC-1α between the photorecep-
tors and RPE cells of the retina. Photoreceptor
PGC-1α is more active in the dark-adapted state,
mediating visual function and dark current,
whereas RPE PGC-1α is more active during the
daytime (at the time when rod photoreceptor
outer segments are shed), mediating cellular pro-
cessing and degradation of the lipid-rich rod
outer segments.
3 Retinal Effects
of Perturbation of PGC-1α
Activity
Mice lacking PGC-1α are hyperactive. This
hyperactivity is associated with lesions in the
striatal region of the brain that controls move-
ment [11]. PGC-1α null mice are paradoxically
lean and have low fasting blood glucose concen-
trations, although heterozygous mice are normo-
glycemic. Dopaminergic signaling pathways are
strongly implicated in the brain pathology identi-
fied in these mice [12].
Most studies disrupting PGC-1α activity in
the eye have focused on the retinal pigmented
epithelium, as this is the primary tissue affected
by the dry (atrophic) form of human AMD. In
mice, conditional knockout of RPE PGC-1α and
Peroxisome Proliferator-Activated Receptor Gamma Coactivator-1Alpha (PGC-1α): A Transcriptional…
PGC-1β using subretinally delivered viral vec-
tors with cre/lox-mediated excision causes disor-
ganization and degeneration of RPE cells and
retinal degeneration [13]. Similarly, global
double-­knockout of PGC1α and one of two
PGC-1α nuclear receptor targets, NRF2 [14] or
NFE2L2 [15], also induces RPE disorganization,
senescence, and degeneration. Mice lacking
PGC-1α and NRF2 possess other multisystemic
abnormalities including features of dwarfism,
grey coat color, and microphthalmia [14]. Young
heterozygous PGC-1α null mice fed a high fat
diet develop AMD-like RPE features including
basal laminar deposits, thickening of Bruch’s
membrane, in addition to RPE and photoreceptor
degeneration [16]. These changes are associated
with reduced mitochondrial activity, increased
reactive oxygen species, decreased autophagy,
and increased inflammation.
PGC-1α may also play a role in pathologic
vascularization, which is a feature of the wet
(neovascular) form of AMD. PGC-1α-deficient
mice have increased expression of vascular endo-
thelial growth factor (VEGF) in the inner retina
[17] and outer retina [16]. In one study, PGC-1α
null mice had a blunted neovascular response to
hypoxia in oxygen-induced retinopathy [2],
although this finding was not corroborated in a
separate study [18].
Although retinal structure and function is
unaffected in young (13-week-old) mice lacking
PGC-1α [1], the effect of natural aging of
PGC-1α knockout mice on RPE or retinal struc-
ture and function has not been reported. There is
strong supporting evidence for PGC-1α dysfunc-
tion in the pathogenesis of age-related neurode-
generative diseases [4] [19, 20]. It is important to
note that the PGC-1α knockout mouse line is on
a C57Bl/6 J mouse genetic background; the
median lifespan of this inbred strain is 29 months
[21]. In the USA, median human life expectancy
is 78.8 years,1 and onset of clinically significant
dry AMD typically occurs at ages over 65 years,
which is at >80% of anticipated median lifespan.
Therefore, natural aging in potential mouse mod-
1
https://www.cdc.gov/nchs/fastats/life-expectancy.htm
51
els of human AMD based on a C57Bl/6 J back-
ground requires aging to approximately
22–24 months of age (>80% of anticipated
median lifespan). It is also important to note that
interbreeding of different strains of mice may
alter the anticipated lifespan and modify the age-­
related phenotype, as has been shown in other
neurodegenerative mouse models [22].
4 Role of PGC-1α in Human
AMD
There is growing evidence that PGC-1α is impor-
tant in the pathophysiology of human AMD. The
major risk factor for development of human
AMD is aging, with prevalence of early AMD
increasing over the age of 45 years and preva-
lence of late AMD increasing over the age of
75 years [23]. Other risk factors include cigarette
smoking, obesity, serum cholesterol concentra-
tion [24], and variants in genes related to the
complement pathway, lipid transport, angiogen-
esis, and extracellular matrix remodeling [25].
Sequence variants in a DNA coding region of
PGC-1α and a 3′-UTR region upstream of
PGC-1α are each independently associated with
increased risk of developing the wet (neovascu-
lar) form of AMD [26]. No studies have exam-
ined the association between sequence variants in
PGC-1α and risk of developing the more com-
mon dry (atrophic) form of AMD.
Cultured cells from AMD patients have been
used to examine pathways relevant to disease.
RPE fate-directed induced pluripotent stem cells
(iPSC) derived from AMD patients have reduced
PGC-1α expression [27]. The expression of a key
activator of PGC-1α (Sirtuin1) is also reduced
[27]. The effect of this is a detected increase in
PGC-1α acetylation in primary RPE cells iso-
lated from AMD patients [28], which is predicted
to inhibit PGC-1α activity. Paradoxically, one
study found increased levels of PGC-1α protein
in expanded RPE cultures from AMD patients,
despite a reduction in metabolic function [29],
although neither PGC-1α posttranslational modi-
fication nor activity was reported.
52
5 Potential Modulation
of the PGC-1α Pathway
in AMD Treatment
Considering the relevance of the PGC-1α path-
way to AMD pathophysiology, therapeutic tar-
geting of PGC-1α activity may provide
neuroprotection [30]. Upregulation of PGC-1α in
primary fetal human RPE cells increases
­oxidative metabolism [31]. However, the nuances
of differential tissue effects of increased PGC-1α
activity must be considered, as overexpression of
PGC-1α accelerated cone photoreceptor death in
rd1 mutant mice [32], and overexpression in
dopaminergic neurons in the brain also causes
neurodegeneration [33].
There are numerous candidate therapeutics
that target the PGC-1α pathway. The dyslipid-
emia drug PU-19 is proposed to upregulate
PGC-1α and, when administered in vitro,
increases mitochondrial copy number and mito-
chondrial function [34]. Similarly, upregulation
of RPE cell PGC-1α occurs after in vitro admin-
istration of a novel compound ZLN005 [35], the
mitochondrial-derived peptide SHLP2 [36], or
the phytochemical sulforaphane when RPE cells
are exposed to toxic blue light [37].
Although not specifically studied in AMD
models, there are several drugs that act on the
PGC-1α pathway that may be promising as thera-
peutics for AMD. Resveratrol, a natural polyphe-
nol compound, activates PGC-1α via Sirtuin1
[38]. 5-Aminoimidazole-4-carboxamide ribonu-
cleoside (AICAR) does so by generating inosine
monophosphate, which acts as an AMPK agonist
[39]. Pyrroloquinoline quinone [40] and adipo-
nectin receptor agonists [41] also hold promise as
other potential modifiers of the PGC-1α
pathway.
References
1. Egger A, Samardzija M, Sothilingam V, Tanimoto N,
Lange C, Salatino S, et al. PGC-1alpha determines
light damage susceptibility of the murine retina. PLoS
One. 2012;7(2):e31272.
2. Saint-Geniez M, Jiang A, Abend S, Liu L, Sweigard
H, Connor KM, et al. PGC-1alpha regulates normal
F. M. Mowat
and pathological angiogenesis in the retina. Am J
Pathol. 2013;182(1):255–65.
3. Blasiak J, Pawlowska E, Sobczuk A, Szczepanska
J, Kaarniranta K. The aging stress response and its
implication for AMD pathogenesis. Int J Mol Sci.
2020;21(22):8840.
4. Anderson R, Prolla T. PGC-1alpha in aging and
anti-aging interventions. Biochim Biophys Acta.
2009;1790(10):1059–66.
5. Kramer AI, Handschin C. How epigenetic modifica-
tions drive the expression and mediate the action of
PGC-1alpha in the regulation of metabolism. Int J
Mol Sci. 2019;20(21):5449.
6. Anderson RM, Barger JL, Edwards MG, Braun KH,
O’Connor CE, Prolla TA, et al. Dynamic regulation
of PGC-1alpha localization and turnover implicates
mitochondrial adaptation in calorie restriction and the
stress response. Aging Cell. 2008;7(1):101–11.
7. Kunst S, Wolloscheck T, Kelleher DK, Wolfrum U,
Sargsyan SA, Iuvone PM, et al. Pgc-1alpha and Nr4a1
are target genes of circadian melatonin and dopamine
release in murine retina. Invest Ophthalmol Vis Sci.
2015;56(10):6084–94.
8. Baba K, Pozdeyev N, Mazzoni F, Contreras-Alcantara
S, Liu C, Kasamatsu M, et al. Melatonin modulates
visual function and cell viability in the mouse retina
via the MT1 melatonin receptor. Proc Natl Acad Sci U
S A. 2009;106(35):15043–8.
9. Ban N, Ozawa Y, Inaba T, Miyake S, Watanabe M,
Shinmura K, et al. Light-dark condition regulates
sirtuin mRNA levels in the retina. Exp Gerontol.
2013;48(11):1212–7.
10. Roggia MF, Ueta T. alphavbeta5 Integrin/FAK/PGC-­
1alpha pathway confers protective effects on retinal
pigment epithelium. PloS One. 2015;10(8):e0134870.
11. Lin J, Wu PH, Tarr PT, Lindenberg KS, St-Pierre J,
Zhang CY, et al. Defects in adaptive energy metabo-
lism with CNS-linked hyperactivity in PGC-1alpha
null mice. Cell. 2004;119(1):121–35.
12. Jiang H, Kang SU, Zhang S, Karuppagounder S,
Xu J, Lee YK, et al. Adult conditional knockout of
PGC-1α leads to loss of dopamine neurons. eNeuro.
2016;3(4):ENEURO.0183-16.2016.
13. Rosales MAB, Shu DY, Iacovelli J, Saint-Geniez
M. Loss of PGC-1α in RPE induces mesenchymal
transition and promotes retinal degeneration. Life Sci
Alliance. 2019;2(3):e201800212.
14. Felszeghy S, Viiri J, Paterno JJ, Hyttinen JMT,
Koskela A, Chen M, et al. Loss of NRF-2 and PGC-­
1alpha genes leads to retinal pigment epithelium dam-
age resembling dry age-related macular degeneration.
Redox Biol. 2019;20:1–12.
15. Blasiak J, Koskela A, Pawlowska E, Liukkonen M,
Ruuth J, Toropainen E, et al. Epithelial-mesenchymal
transition and senescence in the retinal pigment epi-
thelium of NFE2L2/PGC-1α double knock-out mice.
Int J Mol Sci. 2021;22(4):1684.
16. Zhang M, Chu Y, Mowery J, Konkel B, Galli S,
Theos AC, et al. Pgc-1alpha repression and high-­
fat diet induce age-related macular degeneration-­
Peroxisome Proliferator-Activated Receptor Gamma Coactivator-1Alpha (PGC-1α): A Transcriptional…
like phenotypes in mice. Dis Model Mech.
2018;11(9):dmm032698.
17. Guo X, Dason ES, Zanon-Moreno V, Jiang Q, Nahirnyj
A, Chan D, et al. PGC-1alpha signaling coordinates
susceptibility to metabolic and oxidative injury in the
inner retina. Am J Pathol. 2014;184(4):1017–29.
18. Chen J, Michan S, Juan AM, Hurst CG, Hatton CJ,
Pei DT, et al. Neuronal sirtuin1 mediates retinal vas-
cular regeneration in oxygen-induced ischemic reti-
nopathy. Angiogenesis. 2013;16(4):985–92.
19. Austin S, St-Pierre J. PGC1α and mitochondrial
metabolism–emerging concepts and relevance in
ageing and neurodegenerative disorders. J Cell Sci.
2012;125(Pt 21):4963–71.
20. Róna-Vörös K, Weydt P. The role of PGC-1α in the
pathogenesis of neurodegenerative disorders. Curr
Drug Targets. 2010;11(10):1262–9.
21. Yuan R, Tsaih SW, Petkova SB, Marin de Evsikova
C, Xing S, Marion MA, et al. Aging in inbred strains
of mice: study design and interim report on median
lifespans and circulating IGF1 levels. Aging Cell.
2009;8(3):277–87.
22. Rodriguez-Gil JL, Watkins-Chow DE, Baxter
LL, Elliot G, Harper UL, Wincovitch SM, et al.
Genetic background modifies phenotypic severity
and longevity in a mouse model of Niemann-Pick
disease type C1. Disease models & mechanisms.
2020;13(3):dmm042614.
23. Wong WL, Su X, Li X, Cheung CM, Klein R, Cheng
CY, et al. Global prevalence of age-related macular
degeneration and disease burden projection for 2020
and 2040: a systematic review and meta-analysis.
Lancet Glob Health. 2014;2(2):e106–16.
24. Schultz NM, Bhardwaj S, Barclay C, Gaspar L,
Schwartz J. Global burden of dry age-related macular
degeneration: a targeted literature review. Clin Ther.
2021;43(10):1792–818.
25. Singh N, Swaroop A, Ratnapriya R. Making biologi-
cal sense of genetic studies of age-related macular
degeneration. Adv Exp Med Biol. 2021;1256:201–19.
26. SanGiovanni JP, Chen J, Sapieha P, Aderman CM,
Stahl A, Clemons TE, et al. DNA sequence variants
in PPARGC1A, a gene encoding a coactivator of the
omega-3 LCPUFA sensing PPAR-RXR transcription
complex, are associated with NV AMD and AMD-­
associated loci in genes of complement and VEGF
signaling pathways. PLoS One. 2013;8(1):e53155.
27. Golestaneh N, Chu Y, Cheng SK, Cao H, Poliakov E,
Berinstein DM. Repressed SIRT1/PGC-1alpha path-
way and mitochondrial disintegration in iPSC-derived
RPE disease model of age-related macular degenera-
tion. J Transl Med. 2016;14(1):344.
28. Zhang M, Jiang N, Chu Y, Postnikova O, Varghese
R, Horvath A, et al. Dysregulated metabolic path-
ways in age-related macular degeneration. Sci Rep.
2020;10(1):2464.
29. Ferrington DA, Ebeling MC, Kapphahn RJ, Terluk
MR, Fisher CR, Polanco JR, et al. Altered bioener-
53
getics and enhanced resistance to oxidative stress in
human retinal pigment epithelial cells from donors
with age-related macular degeneration. Redox Biol.
2017;13:255–65.
30. Abrahan C, Ash JD. The potential use of PGC-1α and
PGC-1β to protect the retina by stimulating mitochon-
drial repair. Adv Exp Med Biol. 2016;854:403–9.
31. Iacovelli J, Rowe GC, Khadka A, Diaz-Aguilar D,
Spencer C, Arany Z, et al. PGC-1alpha induces human
RPE oxidative metabolism and antioxidant capacity.
Invest Ophthalmol Vis Sci. 2016;57(3):1038–51.
32. Xiong W, MacColl Garfinkel AE, Li Y, Benowitz LI,
Cepko CL. NRF2 promotes neuronal survival in neu-
rodegeneration and acute nerve damage. J Clin Invest.
2015;125(4):1433–45.
33. Ciron C, Lengacher S, Dusonchet J, Aebischer
P, Schneider BL. Sustained expression of PGC-­
1alpha in the rat nigrostriatal system selectively
impairs dopaminergic function. Hum Mol Genet.
2012;21(8):1861–76.
34. Nashine S, Subramaniam SR, Chwa M, Nesburn A,
Kuppermann BD, Federoff H, et al. PU-91 drug res-
cues human age-related macular degeneration RPE
cells; implications for AMD therapeutics. Aging
(Albany NY). 2019;11(17):6691–713.
35. Zhang LN, Zhou HY, Fu YY, Li YY, Wu F, Gu M,
et al. Novel small-molecule PGC-1alpha transcrip-
tional regulator with beneficial effects on diabetic db/
db mice. Diabetes. 2013;62(4):1297–307.
36. Nashine S, Cohen P, Nesburn AB, Kuppermann BD,
Kenney MC. Characterizing the protective effects of
SHLP2, a mitochondrial-derived peptide, in macular
degeneration. Sci Rep. 2018;8(1):15175.
37. Yang PM, Cheng KC, Huang JY, Wang SY, Lin YN,
Tseng YT, et al. Sulforaphane inhibits blue light-­
induced inflammation and apoptosis by upregulat-
ing the SIRT1/PGC-1α/Nrf2 pathway and autophagy
in retinal pigment epithelial cells. Toxicol Appl
Pharmacol. 2021;421:115545.
38. Lagouge M, Argmann C, Gerhart-Hines Z, Meziane
H, Lerin C, Daussin F, et al. Resveratrol improves
mitochondrial function and protects against metabolic
disease by activating SIRT1 and PGC-1alpha. Cell.
2006;127(6):1109–22.
39. Viscomi C, Bottani E, Civiletto G, Cerutti R, Moggio
M, Fagiolari G, et al. In vivo correction of COX defi-
ciency by activation of the AMPK/PGC-1alpha axis.
Cell Metab. 2011;14(1):80–90.
40. Chowanadisai W, Bauerly KA, Tchaparian E, Wong
A, Cortopassi GA, Rucker RB. Pyrroloquinoline qui-
none stimulates mitochondrial biogenesis through
cAMP response element-binding protein phosphory-
lation and increased PGC-1alpha expression. J Biol
Chem. 2010;285(1):142–52.
41. Okada-Iwabu M, Yamauchi T, Iwabu M, Honma T,
Hamagami K, Matsuda K, et al. A small-molecule
AdipoR agonist for type 2 diabetes and short life in
obesity. Nature. 2013;503(7477):493–9.
 Regulation of ABCA1 by miR-33
and miR-34a in the Aging Eye

Florian Peters and Christian Grimm

Abstract Abbreviations

Many age-related diseases, including age-­ ABCA1 ATP-binding cassette transporter,

related macular degeneration (AMD), go along family A, member 1
with local lipid accumulation and dysregulated AMD Age-related macular degeneration
lipid metabolism. Several genes involved in Apo Apolipoprotein
lipid metabolism, including ATP-­binding cas- ASOs Antisense oligonucleotides
sette transporter A1 (ABCA1), were associated CNV Choroidal neovascularization
with AMD through genome-­wide association HDL High-density lipoprotein
studies. Recent studies have shown that loss of LDL Low-density lipoprotein
ABCA1 in the retinal pigment epithelium (RPE) LXR Liver X receptor
leads to lipid accumulation and RPE atrophy, a miRNA microRNA
hallmark of AMD, and that antagonizing RCT Reverse cholesterol transport
ABCA1-targeting microRNAs (miRNAs) atten- RPE Retinal pigment epithelium
uated pathological changes to the RPE or to
macrophages. Here, we focus on two lipid
metabolism-­modulating miRNAs, miR-33 and 1 Introduction
miR-34a, which show increased expression in
aging RPE cells, and on their potential to regu- Age-related macular degeneration (AMD) is a
late ABCA1 levels, cholesterol efflux, and lipid complex and multifactorial disease and the lead-
accumulation in AMD pathogenesis. ing cause of blindness in the elderly in the Western
countries with an estimated 288 million people
Keywords affected by the year 2040 [38]. Although the exact
causes of AMD remain incompletely understood,
ABCA1 · AMD · Cholesterol · HDL · Lipids ·
emerging genetic, epidemiological, and mecha-
Lipid accumulation · LXR · miRNA · Reverse
nistic evidence suggests that dysregulated lipid
cholesterol transport · RPE
metabolism and associated RPE dysfunction
might play a key role in AMD pathogenesis. A
F. Peters (*) · C. Grimm major function of the RPE is the daily phagocyto-
Laboratory for Retinal Cell Biology, Department of sis of lipid-rich photoreceptor outer segments and
Ophthalmology, University Hospital Zurich, the recycling of unmetabolized lipids to photore-
University of Zurich, Schlieren, Switzerland ceptors or into the choroidal vasculature [1].
e-mail: florian.peters@usz.ch

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 55

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_9
56
Moreover, cholesterol-rich drusen and accumu-
lated lipoproteins in the sub-­RPE and sub-retinal
space are hallmarks of AMD [23], which indicates
diminished reverse cholesterol transport (RCT)
and impaired removal of lipids from the retina for
their degradation in the liver [7]. A key choles-
terol transport protein is ATP-binding cassette
transporter A1 (ABCA1), which is expressed in
the RPE and transfers intracellular cholesterol and
other lipids to extracellular lipid-binding proteins
like ApoA1 or ApoE to generate HDL [26, 36].
Polymorphisms in ABCA1 and other genes con-
nected to the lipid metabolism were associated
with an increased risk for AMD development [9],
and loss of Abca1 in mouse RPE led to lipid accu-
mulation and RPE atrophy with subsequent pho-
toreceptor degeneration resembling AMD
pathogenesis [37]. Thus, it is of great interest to
investigate what factors influence the expression
of ABCA1 and therefore contribute to a dysregu-
lated lipid metabolism.
2 miRNA
Expression of genes can be regulated on the RNA
level, e.g., by RNA stability, splicing efficiency,
and interaction with microRNAs. miRNA are
small, ~22 nucleotide-spanning non-coding RNA
molecules that bind to 3′ untranslated regions of
target genes, thereby inhibiting translation of
(large) sets of genes which in further conse-
quence affects entire cellular pathways. On one
hand, modulation of gene expression by miRNAs
is essential for normal retinal function and tissue
integrity as shown for miRNAs 182 and 183 that
are necessary for proper cone outer segment
maintenance [6]. On the other hand, they are also
considered to play a role in the pathology of com-
plex retinal diseases, including AMD [3] and reti-
nitis pigmentosa [21] due to their high gene
regulatory potency. Therefore, miRNAs might
serve as potential biomarkers or therapeutic tar-
gets [2, 29].
F. Peters and C. Grimm
3 Regulation of ABCA1 by
miR-33
The most extensively studied ABCA1-regulating
miRNA is miR-33, which is well-known to con-
trol the lipid metabolism [8]. The miR-33 family
was first described in 2010 by several groups and
in different species as it is highly conserved [24,
25, 27]. In humans, two isoforms of miR-33 have
been identified, located in different genes on dif-
ferent chromosomes. While miR-33a localizes to
intron 16 of the sterol regulatory element-binding
protein (SREBP)-2 gene on chromosome 22,
miR-33b is located in intron 17 of SREBP-1.
Only one isoform of miR-33 exists in mouse,
which corresponds to human miR-33a and is
located in intron 15 of the Srebp-2 gene. SREBPs
are key transcription regulators of genes involved
in cholesterol biosynthesis and uptake such as
fatty acid synthase and low-density lipoprotein
(LDL) receptor [5, 17]. Depletion of cholesterol
results in the upregulation of both SREBPs and
miR-33 and subsequent downregulation of
ABCA1 in a classic feedback loop [25]. To date,
elevated levels of miR-33 have not been described
in studies of large miRNA screens with AMD
patients. However, there are two publications
showing elevated levels of miR-33 and reduced
ABCA1 expression in peritoneal and retinal mac-
rophages [34] and RPE of old mice and nonhu-
man primates [11]. Sene and colleagues described
an abnormal polarization of senescent macro-
phages due to high intracellular cholesterol in
Abca1-deficient or diet-induced obesity mice
[34]. This abnormal polarization resulted in a
diminished ability to regulate vascular prolifera-
tion potentially promoting choroidal neovascu-
larization (CNV), a hallmark of wet AMD. In
turn, in vivo silencing of miR-33 by anti-miR-33
treatment prevented the abnormal macrophage
polarization and inhibited CNV in old mice. A
more recent study investigated the regulation of
miR-33 and ABCA1 in human RPE cells and RPE
of Western type diet-fed aging mice and nonhu-
Regulation of ABCA1 by miR-33 and miR-34a in the Aging Eye
man primates [11]. Subcutaneous delivery of
anti-miR-33 antisense oligonucleotides (ASOs)
during the high cholesterol diet prevented lipid
accumulation, immune cell infiltration, and path-
ological changes of the RPE. Therefore, the
authors suggested that clearance of accumulated
cholesterol in the RPE by targeting miR-33 might
attenuate these pathological changes leading to
dry AMD. Analogous observations were made in
Ldlr–/– mice, a mouse model to study atheroscle-
rosis. Antagonizing miR-33 increased Abca1
expression and circulating HDL, which reduced
atherosclerotic plaque size, lipid content, and
inflammation [28, 31], making it an interesting
target for atherosclerosis treatment. However,
long-term deficiency of miR-33 in high-fat diet-­
treated mice causes adverse effects like obesity,
dyslipidemia, and steatosis [12, 14] that might be
prevented by local rather than systemic miR-33
inhibition e.g. by direct delivery of anti-miRs
into the aging eye.
4 Regulation of ABCA1 by
miR-34a
A second miRNA that connects to ABCA1 regu-
lation and atherosclerosis is miR-34a, which is
encoded by its own transcript and increased dur-
ing aging [4, 19] and obesity [10, 18]. A study by
Xu et al. identified miR-34a as a regulator of
ABCA1 and cholesterol efflux in macrophages
and achived regression of atherosclerosis by ther-
apeutic inhibition of miR-34a in a diet-­induced
mouse model for atherosclerosis [39]. Of note,
systemic inhibition or genetic ablation of miR-
34a did not result in side effects as dyslipidemia
and obesity in Ldlr−/− or Apoe−/− mice as seen
with systemic miR-33 inhibition, making miR-
34a a more promising therapeutic target for ath-
erosclerosis. Besides the direct targeting by
miR-34a, ABCA1 is additionally regulated by an
upstream pathway including NAD-dependent
protein deacetylase sirtuin-1 (SIRT1), a key sen-
sor and regulator of lipid metabolism (exten-
sively reviewed in [33]). Downregulation of
SIRT1 reduces activation of liver X receptor
(LXR), the major transcription factor for ABCA1,
57
and subsequent cholesterol efflux [20, 32].
Interestingly, elevated levels of miR-34a have
been found in serum of neovascular AMD
patients [30] as well as in aging mouse retina and
RPE [35]. However, so far, this observation was
more connected to DNA damage, cell prolifera-
tion, and oxidative stress in RPE cells than to the
lipid metabolism, as miR-34a is induced by p53
and alters expression of target genes that inhibit
cell proliferation eventually leading to senes-
cence or apoptosis [13, 15].
5 Concluding Remarks
and Future Therapeutic
Perspectives
Age-related diseases often go along with a dys-
regulated lipid metabolism in cells and accu-
mulated lipid deposits such as drusen in AMD
or atherosclerotic plaques in atherosclerosis.
The removal of such deposits can be dimin-
ished by a disturbed RCT from peripheral tis-
sues. ABCA1, as one of the major lipid export
proteins for RCT, and ABCA1-regulatory miR-
NAs gained attention as potential therapeutic
candidates in atherosclerosis [16, 22]. Since
expression of ABCA1-targeting miRNAs miR-
33 and miR-34a increases with age in RPE
cells, they may have a high potency to diminish
RCT from retinal tissues. This can lead to
intracellular lipid accumulation, RPE atrophy,
and photoreceptor degeneration [37].
Therefore, therapeutic targeting those miRNAs
that modulate lipid efflux by local application
of ASOs is a promising attempt to attenuate
lipid accumulation in the aging eye and AMD
pathogenesis [11].
References
1. Anderson DH, Fisher SK, Steinberg RH. Mammalian
cones: disc shedding, phagocytosis, and renewal.
Invest Ophthalmol Vis Sci. 1978;17:117–33.
2. Askou AL, Alsing S, Holmgaard A, et al. Dissecting
microRNA dysregulation in age-related macular
degeneration: new targets for eye gene therapy. Acta
Ophthalmol. 2018;96:9–23.
58
3. Berber P, Grassmann F, Kiel C, et al. An eye on
age-­related macular degeneration: the role of
microRNAs in disease pathology. Mol Diagn Ther.
2017;21:31–43.
4. Boon RA, Iekushi K, Lechner S, et al. MicroRNA-­
34a regulates cardiac ageing and function. Nature.
2013;495:107–10.
5. Brown MS, Goldstein JL. Cholesterol feedback: from
Schoenheimer’s bottle to Scap’s MELADL. J Lipid
Res. 2009;50(Suppl):S15–27.
6. Busskamp V, Krol J, Nelidova D, et al. miRNAs 182
and 183 are necessary to maintain adult cone photo-
receptor outer segments and visual function. Neuron.
2014;83:586–600.
7. Favari E, Chroni A, Tietge UJ, et al. Cholesterol
efflux and reverse cholesterol transport. Handb Exp
Pharmacol. 2015;224:181–206.
8. Fernandez-Tussy P, Ruz-Maldonado I, Fernandez-­
Hernando C. MicroRNAs and circular RNAs in
lipoprotein metabolism. Curr Atheroscler Rep.
2021;23:33.
9. Fritsche LG, Igl W, Bailey JN, et al. A large genome-­
wide association study of age-related macular degen-
eration highlights contributions of rare and common
variants. Nat Genet. 2016;48:134–43.
10. Fu T, Choi SE, Kim DH, et al. Aberrantly ele-
vated microRNA-34a in obesity attenuates hepatic
responses to FGF19 by targeting a membrane core-
ceptor beta-Klotho. Proc Natl Acad Sci U S A.
2012;109:16137–42.
11. Gnanaguru G, Wagschal A, Oh J, et al. Targeting of
miR-33 ameliorates phenotypes linked to age-related
macular degeneration. Mol Ther. 2021;29:2281.
12. Goedeke L, Salerno A, Ramirez CM, et al. Long-term
therapeutic silencing of miR-33 increases circulating
triglyceride levels and hepatic lipid accumulation in
mice. EMBO Mol Med. 2014;6:1133–41.
13. Hermeking H. The miR-34 family in cancer and apop-
tosis. Cell Death Differ. 2010;17:193–9.
14. Horie T, Nishino T, Baba O, et al. MicroRNA-33
regulates sterol regulatory element-binding protein 1
expression in mice. Nat Commun. 2013;4:2883.
15. Hou Q, Tang J, Wang Z, et al. Inhibitory effect of
microRNA-34a on retinal pigment epithelial cell pro-
liferation and migration. Invest Ophthalmol Vis Sci.
2013;54:6481–8.
16. Javadifar A, Rastgoo S, Banach M, et al. Foam cells as
therapeutic targets in atherosclerosis with a focus on
the regulatory roles of non-coding RNAs. Int J Mol
Sci. 2021;22:2529.
17. Kawabe Y, Sato R, Matsumoto A, et al. Regulation of
fatty acid synthase expression by cholesterol in human
cultured cells. Biochem Biophys Res Commun.
1996;219:515–20.
18. Lee J, Padhye A, Sharma A, et al. A pathway involv-
ing farnesoid X receptor and small heterodimer
partner positively regulates hepatic sirtuin 1 lev-
els via microRNA-34a inhibition. J Biol Chem.
2010;285:12604–11.
F. Peters and C. Grimm
19. Li X, Khanna A, Li N, et al. Circulatory miR34a as
an RNAbased, noninvasive biomarker for brain aging.
Aging (Albany NY). 2011;3:985–1002.
20. Li X, Zhang S, Blander G, et al. SIRT1 deacety-
lates and positively regulates the nuclear receptor
LXR. Mol Cell. 2007;28:91–106.
21. Loscher CJ, Hokamp K, Kenna PF, et al. Altered reti-
nal microRNA expression profile in a mouse model
of retinitis pigmentosa. Genome Biol. 2007;8:R248.
22. Maguire EM, Pearce SWA, Xiao Q. Foam cell for-
mation: A new target for fighting atherosclero-
sis and cardiovascular disease. Vasc Pharmacol.
2019;112:54–71.
23. Malek G, Li CM, Guidry C, et al. Apolipoprotein B
in cholesterol-containing drusen and basal deposits
of human eyes with age-related maculopathy. Am J
Pathol. 2003;162:413–25.
24. Marquart TJ, Allen RM, Ory DS, et al. miR-33 links
SREBP-2 induction to repression of sterol transport-
ers. Proc Natl Acad Sci U S A. 2010;107:12228–32.
25. Najafi-Shoushtari SH, Kristo F, Li Y, et al.
MicroRNA-33 and the SREBP host genes cooper-
ate to control cholesterol homeostasis. Science.
2010;328:1566–9.
26. Quazi F, Molday RS. Lipid transport by mammalian
ABC proteins. Essays Biochem. 2011;50:265–90.
27. Rayner KJ, Suarez Y, Davalos A, et al. MiR-33 con-
tributes to the regulation of cholesterol homeostasis.
Science. 2010;328:1570–3.
28. Rayner KJ, Sheedy FJ, Esau CC, et al. Antagonism of
miR-33 in mice promotes reverse cholesterol trans-
port and regression of atherosclerosis. J Clin Invest.
2011;121:2921–31.
29. Ren C, Liu Q, Wei Q, et al. Circulating miRNAs as
potential biomarkers of age-related macular degen-
eration. Cell Physiol Biochem. 2017;41:1413–23.
30. Romano GL, Platania CBM, Drago F, et al. Retinal
and circulating miRNAs in age-related macular
degeneration: an in vivo animal and human study.
Front Pharmacol. 2017;8:168.
31. Rotllan N, Ramirez CM, Aryal B, et al. Therapeutic
silencing of microRNA-33 inhibits the progres-
sion of atherosclerosis in Ldlr−/− mice – brief report.
Arterioscler Thromb Vasc Biol. 2013;33:1973–7.
32. Rottiers V, Naar AM. MicroRNAs in metabolism
and metabolic disorders. Nat Rev Mol Cell Biol.
2012;13:239–50.
33. Schug TT, Li X. Sirtuin 1 in lipid metabolism and
obesity. Ann Med. 2011;43:198–211.
34. Sene A, Khan AA, Cox D, et al. Impaired cholesterol
efflux in senescent macrophages promotes age-related
macular degeneration. Cell Metab. 2013;17:549–61.
35. Smit-McBride Z, Forward KI, Nguyen AT, et al.
Age-dependent increase in miRNA-34a expression
in the posterior pole of the mouse eye. Mol Vis.
2014;20:1569–78.
36. Storti F, Raphael G, Griesser V, et al. Regulated efflux
of photoreceptor outer segment-derived cholesterol
by human RPE cells. Exp Eye Res. 2017;165:65–77.
Regulation of ABCA1 by miR-33 and miR-34a in the Aging Eye 59

37. Storti F, Klee K, Todorova V, et al. Impaired ABCA1/
ABCG1-mediated lipid efflux in the mouse retinal
pigment epithelium (RPE) leads to retinal degenera-
tion. elife. 2019;8:e45100.
38. Wong WL, Su X, Li X, et al. Global prevalence of
age-related macular degeneration and disease bur-
den projection for 2020 and 2040: a systematic
review and meta-analysis. Lancet Glob Health.
2014;2:e106–16.
39. Xu Y, Xu Y, Zhu Y, et al. Macrophage miR-34a is a
key regulator of cholesterol efflux and atherosclerosis.
Mol Ther. 2019;28:202.
 The Role of Gene Expression
Regulation on Genetic Risk
of Age-­Related Macular
Degeneration

Rinki Ratnapriya

Abstract directions to bridge the gap between genetic

predisposition and biological mechanisms to
Age-related macular degeneration (AMD) is a reap the full benefits of GWAS findings.
major cause of irreversible vision loss in the
elderly. It is a complex multifactorial disease Keywords
that is caused by the cumulative impact of
genetic predisposition, environmental stress, Age-related macular degeneration · GWAS ·
and advanced aging. Knowledge of genetic Transcriptome · Gene expression regulation ·
risk factors underlying AMD susceptibility eQTL · Gene regulatory networks ·
has advanced rapidly in the past decade that Biomarkers
can be largely credited to genome-wide asso-
ciation studies (GWAS) and next-generation
sequencing (NGS) efforts. GWAS have identi-
fied 34 genetic risk loci for AMD; the majority
1 Introduction
of which are in the noncoding genome. Several
Age-related macular degeneration (AMD) is a
lines of evidence suggest that a complex trait-­
common, age-related disease that leads to severe
associated variant is likely to regulate the gene
central visual impairment because of degenera-
expression (acting as expression quantitative
tion of retinal pigment epithelium (RPE) and
trait loci (eQTLs)), and there is a significant
photoreceptors in the central region of the retina
enrichment of GWAS-associated variants
called macula. The burden of AMD on healthcare
within eQTLs. In the last two years, eQTL
is massive, as it afflicts almost 10 million indi-
studies in AMD-relevant tissues have pro-
viduals in the United States and 150 million peo-
vided functional interpretation of several
ple worldwide [17]. It is a chronic, progressive
AMD-GWAS loci. This review highlights the
disease that is caused by dysfunction in photore-
knowledge gained to date and discusses future
ceptors, RPE, Bruch’s membrane (BrM), or cho-
riocapillaris (CC) [11]. Over the last 15 years,
R. Ratnapriya (*) genome-wide association studies (GWAS) have
Department of Ophthalmology, Baylor College of contributed substantially in our understanding of
Medicine, genetic risk factors associated with AMD. The
Houston, TX, USA most recent GWAS analysis of 16,144 AMD
e-mail: rpriya@bcm.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 61

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_10
62
cases and 17,832 controls identified 52 variants
across 34 loci that account for over 50% of heri-
tability [5]. These findings have implicated com-
plement pathways, lipid transport, and
extracellular matrix (ECM) organizations in its
pathogenesis. Additionally, whole exome and
genome sequencing have advocated the signifi-
cant role of rare coding variants in AMD. Rare
variants discoveries have helped in identifying
the target genes at several AMD loci and pro-
vided insights into the disease mechanism [4,
13]. Thus, the genetic architecture of AMD
includes common genetic variants with relatively
small effect sizes and rare genetic variants and
few common variants with large effect sizes.
However, for a large number of AMD loci, the
causal variants and genes have remained elusive.
Thus, there is an unmet need to identify genes
and mechanisms underlying AMD as it could
lead to possibilities of novel drug targets as well
as a better prediction for disease onset and
progression.
2 Connecting AMD-GWAS
Discoveries to Biology
The functional studies of GWAS loci in search of
causal variants, genes, and disease mechanisms
have not matched the pace with GWAS because
of several reasons. Firstly, the majority of AMD-­
risk factors reside in nonprotein-coding regions
of the genome whose function is not well studied.
Secondly, GWAS point to the most significant
associated SNP in the region, and the presence of
linkage disequilibrium (LD) between the associ-
ated variants makes it difficult to point to the
causal variant. Within the LD, the associated
region could harbor multiple genes or no genes at
all. Additionally, a large number of associated
variants and their small effect sizes represent sig-
nificant hurdles in translating GWAS discoveries
to disease biology.
Connecting GWAS findings with intermediate
molecular phenotypes such as transcriptome,
epigenome, and proteome can provide functional
evidence to map disease associations and trans-
late them into clinical applications. The majority
R. Ratnapriya
(∼93%) of trait-associated SNPs are located in
noncoding regions of the genome [9], and a com-
plex trait-associated variant is more likely to be
associated with gene expression, i.e., expression
quantitative trait loci (eQTL) [2]. These observa-
tions suggest a major role of gene expression
regulation in mediating the disease risk. As gene
expression and its regulation often varies across
cell and tissue types, analysis of disease-relevant
tissues remains central to the functional interpre-
tation of GWAS findings. Genotype-Tissue
Expression (GTEx) project represents the largest
resource that includes 15,201 samples from 838
donors across 49 tissues types [1]. However, the
exclusion of retina, RPE, or BrM from GTEx has
been partly responsible for slow progress on
post-GWAS functional studies in the field of ocu-
lar diseases/traits.
A general framework for the functional dis-
section of a genetic risk locus involves the fol-
lowing key approaches: (1) prioritizing the
variants within the LD through statistical fine-­
mapping, (2) incorporation of functional epig-
enomic data to annotate the variant and genomic
region, and (3) testing the function of putative
causal variant and determining the molecular
function of the regulatory variant. Here, we focus
on methods of connecting the noncoding variant
to gene expression regulation using the eQTL
approach in the context of AMD.
3 Variant to Function by
Studying eQTLs
eQTL analysis is performed to identify the effect
of a genetic variant on the expression of one or
more genes. It can be divided into those that have
local effects (cis-eQTLs) and those with distant
effects (trans-eQTLs). A generic pipeline for
eQTL discovery is summarized in Fig. 1. Briefly,
eQTL analysis begins with measuring gene
expression across a cohort using methods such as
RNAseq. RNAseq reads are evaluated for quality
controls, and normalization and batch corrections
are applied. Simultaneously, hundreds of thou-
sands of SNPs are also genotyped, usually
through genotyping array or genome sequencing.
The Role of Gene Expression Regulation on Genetic Risk of Age-Related Macular Degeneration
Fig. 1 A generic pipeline for eQTL discovery
To increase the power of eQTL discovery, geno-
typed SNPs are subjected to haplotype phasing
and genotype imputation. Finally, the association
between genotype and gene expression is mea-
sured using linear regression. A number of com-
putation tools have been developed to perform
eQTL analysis, such as Matrix eQTL [14] and
QTLTools [3]. Among these, Matrix eQTL has
been quite popular because of its fast computing
efficiency.
4 eQTL Studies in AMD-­
Relevant Human Tissues
Cis-eQTL analysis is the most commonly used
approach for the identification of candidate sus-
ceptibility genes at the risk loci. In the last two
years, eQTL studies in AMD-relevant ocular tis-
sues have been utilized to aid in the interpretation
of AMD-GWAS results with moderate success.
In most analyses, co-localization of eQTL and
GWAS variants was performed to identify the tar-
63
get gene. The first reference eQTL map of over
500 postmortem human donor retinas reported
14,565 genetic variants (eVariants) that regulate
the expression of 10,474 genes (eGenes) [12].
Co-localization studies using eCAVIAR identi-
fied the target genes at six AMD loci [12]. In
another study, analysis of the gene expression in
healthy retinas (n = 311) identified 65 unique
ocular GWAS variants, including AMD, to be
regulating gene expression in retinal tissue [15].
eQTL analysis in human RPE/choroid and retina
in bulk tissue samples from the macula and non-
macular regions in ~120 donors (98 control and
23 AMD) identified 15 putative causal genes at
13 known AMD loci [10]. Finally, eQTL analysis
of 23 primary human fetal RPE lines implicated
four genes [6]. These results are summarized in
Table 1.
However, interpretations of these results are
not always straightforward as shown by the asso-
ciation PILRA/PILRB and RDH5/CD63 loci.
More than one target gene emerges depending on
the tissues investigated. For example, the associ-
64 R. Ratnapriya

Table 1 Target genes identified through eQTL studies in human ocular tissues
AMD locus Putative causal gene Target tissues eQTL variant (s) References
B3GALTL B3GLCT Macular and peripheral retina rs9564692, [10, 12]
rs4381465
RDH5/CD63 BLOC1S1 Peripheral retina rs56108400, [10, 12]
rs3138141
RDH5 Peripheral RPE, human fetal RPE rs3138142, [6, 10]
lines rs3138141
AC009779.3 Peripheral retina rs3138141 [15]
ACAD10 SH2B3 Peripheral retina rs61941274 [12]
CFI CFI Macular RPE rs141098594 [10]
PLA2G12A Peripheral retina rs10033900 [12]
PILRB/PILRA PILRA, PILRB Macular and peripheral retina rs6965458, [6, 10, 12]
rs7803454
TMEM97/VTN TMEM199 Macular and peripheral retina rs7212510, [10, 12]
rs11080055
SLC16A8 BAIAP2L2 Nonmacular RPE rs760975 [10]
NPLOC4-­ TSPAN10 Nonmacular RPE rs7405790 [10]
TSPAN10
TRPM1 TRPM1 Nonmacular RPE rs12440880 [10]
MMP9 SLC12A5-AS1 Nonmacular retina rs3761159 [10]
CTRB2-CTRB1 BCAR1 macular retina rs9928736 [10]
COL4A3 COL4A3 Nonmacular retina rs7559693 [10]
TNFRSF10A TNFRSF10A Nonmacular RPE rs11777697 [10]
ARMS2-HTRA1 HTRA1 Macular retina rs11528744 [10]
C2/CFB/SKIV2L HLA-DQB1, Peripheral retina rs204993 [15]
TSBP1-AS1

ated variant, rs3138141, regulates BLOC1S1 in
the retina and RDH5 in the RPE. In a different
study, low-frequency variants in CFHR2 and
CFHR5 at the CFH locus lead to reduced or
absent FHR-2 and FHR-5 concentrations, indi-
cating the role of these genes at CFH locus [7].
These findings suggest that multiple genes within
a GWAS locus can contribute to the overall dis-
ease variance. Thus, the “best-fit” candidate gene
interpretations of GWAS loci might be a simpli-
fied view of the complex genetic architecture
underlying individual associated loci, and fol-
low-­up functional studies need to investigate all
candidates identified through eQTL studies for
their role in AMD pathology.
The HTRA1/ARMS2 Locus 10q26 region, con-
taining two tightly linked genes, age-related mac-
ulopathy susceptibility 2 (ARMS2), and
high-temperature requirement A serine peptidase
1 (HTRA1), has been subjected to intense investi-
gation with conflicting results. A recent study
used human donor ocular tissues to estimate
mRNA expression of the ARMS2 and HTRA1
genes in human ocular tissues. By comparing
age-matched donors with risk and no-risk geno-
types, they observed reduced HTRA1 expression
in RPE of donors with risk variants, whereas the
HTRA1 expression did not change in the neural
retina or choroid [16]. They further show that risk
variant disrupts a cis-regulatory element within
the locus that overlaps with the ARMS2 intron,
which contains a potential Lhx2 transcription
factor binding site.
5 Future Experimental
Approaches
AMD has been at the forefront of GWAS studies
and has achieved substantial success. While
genome and exome sequencing-based approaches
can continue to identify new variants ge and loci
associated with AMD, it is also time to focus on
The Role of Gene Expression Regulation on Genetic Risk of Age-Related Macular Degeneration 65

downstream functional dissection of already-­ ing the molecular function of the regulatory vari-
identified AMD-GWAS loci as these efforts can ants and disease mechanisms.
help in providing key insights into the disease
pathophysiology. eQTL studies in the context of Acknowledgment RR is supported by Career
AMD have demonstrated the key role of gene Development Award from Research to Prevent
expression regulation in AMD pathology. Blindness (RPB) and New Investigator Grant from
BrightFocus Foundation. This study was also sup-
However, this area of research is still in its ported by an unrestricted grant from RPB to Baylor
infancy, and the full potential of eQTL studies to College of Medicine.
access and interpret the molecular link between
genetic variant and phenotype has not been real-
ized. Future studies of building bigger reference
data sets for retina, RPE, and choroid will pro- References
vide a valuable framework toward a broad, long-­
1. Consortium GT. The GTEx Consortium atlas of
term goal to bridge the gap between genetic genetic regulatory effects across human tissues.
predispositions and biological mechanisms in Science. 2020;369:1318–30.
AMD. Additionally, most studies have been per- 2. Cookson W, Liang L, Abecasis G, et al. Mapping
formed at the tissues level that cannot define the complex disease traits with global gene expression.
Nat Rev Genet. 2009;10:184–94.
cellular contexts in which disease risk-SNPs 3. Delaneau O, Ongen H, Brown AA, et al. A complete
affect gene expression levels. GTEx consortium tool set for molecular QTL discovery and analysis.
studies have revealed that many eQTLs effects Nat Commun. 2017;8:15452.
are cell-type specific (Consortium, 2020). Thus, 4. den Hollander AI, de Jong EK. Highly penetrant
alleles in age-related macular degeneration. Cold
future studies also necessitate the generation of Spring Harb Perspect Med. 2014;5:a017202.
single-cell eQTL resources to identify the cell 5. Fritsche LG, Igl W, Bailey JN, et al. A large genome-­
type-specific consequences of AMD variants. wide association study of age-related macular degen-
Regulatory variants (eQTLs) are ubiquitous eration highlights contributions of rare and common
variants. Nat Genet. 2016;48:134–43.
across the genome. Thus, relying on co-­ 6. Liu B, Calton MA, Abell NS, et al. Genetic analyses of
localization of eQTL with GWAS alone is not human fetal retinal pigment epithelium gene expres-
sufficient as they can occur as a chance event. sion suggest ocular disease mechanisms. Commun
These signals need to be followed up with inde- Biol. 2019;2:186.
7. Lores-Motta L, van Beek AE, Willems E, et al.
pendent experiments. The establishment and Common haplotypes at the CFH locus and low-­
maintenance of a cell’s transcriptional identity frequency variants in CFHR2 and CFHR5 asso-
are largely driven by the specific activity of cis-­ ciate with systemic FHR concentrations and
regulatory elements (CREs) such as promoter, age-related macular degeneration. Am J Hum Genet.
2021;108:1367–84.
enhancer, and silencer elements [8, 9]. 8. Manolio TA, Collins FS, Cox NJ, et al. Finding the
Additionally, trait and disease-associated vari- missing heritability of complex diseases. Nature.
ants are enriched in the CREs and possibly can 2009;461:747–53.
influence gene transcription via a co-localized 9. Maurano MT, Humbert R, Rynes E, et al. Systematic
localization of common disease-associated variation
genomic regulatory element, such as a transcrip- in regulatory DNA. Science. 2012;337:1190–5.
tion factor binding site within an open chromatin 10. Orozco LD, Chen HH, Cox C, et al. Integration of
region. Thus, characterization and integration of eQTL and a single-cell atlas in the human eye iden-
CREs in ocular tissues is the next step in the pri- tifies causal genes for age-related macular degenera-
tion. Cell Rep. 2020;30:1246–1259 e1246.
oritization of eQTL variants. These findings can 11. Ratnapriya R, Chew EY. Age-related macular
be then validated in cell culture using reporter degeneration-­ clinical review and genetics update.
assay such as massively parallel reporter assays Clin Genet. 2013;84:160–6.
(MPRA) to test the transcriptional activities of 12. Ratnapriya R, Sosina OA, Starostik MR, et al. Retinal
transcriptome and eQTL analyses identify genes asso-
DNA elements. Finally, induced pluripotent stem ciated with age-related macular degeneration. Nat
cell lines or animal models will help in elucidat- Genet. 2019;51:606–10.
66 R. Ratnapriya

13. Ratnapriya R, Acar IE, Geerlings MJ, et al. Family-­ 16. Williams BL, Seager NA, Gardiner JD, et al.
based exome sequencing identifies rare coding vari- Chromosome 10q26-driven age-related macular
ants in age-related macular degeneration. Hum Mol degeneration is associated with reduced levels of
Genet. 2020;29:2022–34. HTRA1 in human retinal pigment epithelium. Proc
14. Shabalin AA. Matrix eQTL: ultra fast eQTL analy- Natl Acad Sci U S A. 2021;118:20210727.
sis via large matrix operations. Bioinformatics. 17. Wong WL, Su X, Li X, et al. Global prevalence of
2012;28:1353–8. age-related macular degeneration and disease bur-
15. Strunz T, Kiel C, Grassmann F, et al. A mega-analysis den projection for 2020 and 2040: a systematic
of expression quantitative trait loci in retinal tissue. review and meta-analysis. Lancet Glob Health.
PLoS Genet. 2020;16:e1008934. 2014;2:e106–16.
 Elastin Layer in Bruch’s Membrane
as a Target for Immunization
or Tolerization to Modulate
Pathology in the Mouse Model
of Smoke-Induced Ocular Injury
Bärbel Rohrer, Nathaniel Parsons,
Balasubramaniam Annamalai, Crystal Nicholson,
Elisabeth Obert, Bryan Jones, and Andrew D. Dick
Abstract
Age-related macular degeneration (AMD) is
associated with an overactive complement
system and an increase in circulating antibod-
ies. Our search for potential neoantigens that
can trigger complement activation in disease
has led us to investigate elastin. A loss of the
elastin layer (EL) of Bruch’s membrane (BrM)
has been reported in aging and AMD together
with an increase of serum elastin-derived pep-
tides and α-elastin antibodies. In the mouse
model of cigarette smoke exposure (CSE),
damage in BrM, loss of the EL, and vision loss
are dependent on complement activation. We
have examined the hypothesis that CSE gener-
B. Rohrer (*)
Department of Ophthalmology, Medical University of
South Carolina, Charleston, SC, USA
Ralph H. Johnson VA Medical Center, Charleston,
SC, USA
e-mail: rohrer@musc.edu
N. Parsons · B. Annamalai · C. Nicholson · E. Obert
Department of Ophthalmology, Medical University of
South Carolina, Charleston, SC, USA
B. Jones
Department of Ophthalmology, University of Utah,
Salt Lake City, UT, USA
A. D. Dick
University of Bristol, Bristol, UK
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_11
ates immunogenic elastin neoepitopes that
trigger an increase in α-elastin IgG and IgM
antibodies, which can then bind to the neoepi-
topes in the target cells or membranes, trigger-
ing complement activation. Specifically, we
showed that immunization with elastin pep-
tide oxidatively modified by cigarette smoke
(ox-elastin) exacerbated ocular pathology and
vision loss in CSE mice. In contrast, mice
receiving peptide immunotherapy (PIT) with
ox-elastin did not lose vision over the smok-
ing period and exhibited a more preserved
BrM. Immunization and PIT correlated with
humoral immunity and complement activation
and IgG/IgM deposition in the RPE/BrM/cho-
roid. Finally, PIT modulated immune markers
IFNγ and IL-4. The data further support the
hypothesis that complement activation, trig-
gered by immune complex formation in target
tissues, plays a role in ocular damage in the
CSE model. As PIT with ox-elastin peptides
reduces damage, we discuss the possibility
that AMD progression might be preventable.
Keywords
Age-related macular degeneration · Elastin ·
Immunization · Tolerance · Complement ·
Smoking
67
68
1 Introduction
AMD is a multifactorial, complex disease, which
occurs in two forms, wet and dry. Patients experi-
ence a loss of central vision, and clinical under-
pinnings include drusen and retinal pigment
epithelium (RPE) disturbances, damage to macu-
lar photoreceptors, and pathology at the
RPE/choroid interface. Among the risk factors
associated with disease, we wish to highlight fac-
tors relevant for the hypothesis presented here,
which include aging [1], cigarette smoking [2],
increased susceptibility of elastic fibers to photic
degenerative stimuli [3], and genetic variants in
genes regulating the complement cascade [4] and
extracellular matrix turnover [5].
The complement system is the humoral back-
bone of the innate immune system. Its main role
is to participate in antimicrobial defense, clear-
ance of immune complexes, and tissue regenera-
tion, but excessive complement activation can be
involved in the pathogenesis of disease states,
including AMD [6]. The complement system can
be activated by three distinct pathways: the clas-
sical (CP), lectin (LP), and alternative pathway
(AP), with IgG and natural IgM antibodies bind-
ing to ligands generated by injury, immunity, and
infection participating in CP and LP activation.
This begs the question as to what might be their
ligands.
The potential role of BrM in initiation and
progression of disease has been investigated
based on its changes with aging and disease [7],
including lipid buildup and calcifications [8],
changes in diffusion characteristics [9], and a
reduction of the cross-linked linear elastin fibers
of the EL [7]. Additional alterations in elastin
metabolism in aging and AMD have been
reported. Blumenkranz et al. published on a gen-
eralized increased susceptibility of elastic fibers
to photic or other degenerative stimuli and sug-
gested that this might be a new and important risk
factor for choroidal neovascularization [3].
Serum-elastin-derived peptides (s-EDPs) were
found to be significantly higher in AMD patients
than in controls [10], and serum IgG and IgM
antibodies against elastin are elevated in AMD
[11]. However, for both the s-EDPs and the elas-
tin epitopes the antibodies recognize, their modi-
B. Rohrer et al.
fication status is unknown. Finally, elevating
serum elastin fragments in mouse increased
expression and deposition of collagen IV in the
RPE/choroid complex [12]. Based on these
observations, we have previously postulated that
abnormalities in elastin homeostasis together
with antibody production may contribute to an
inflammatory feedback loop, ultimately leading
to AMD pathology [13].
2 Cigarette Smoke Exposure
(CSE) as a Model for Dry
AMD
We consider CSE, which is a passive inhalation
model lasting for 6 months, a model for dry
AMD, as it shows structural alteration and com-
plement deposition in the RPE/BrM/choriocapil-
laris (CC) complex similar to that seen in patients
[14]. Smoke exposure leads to the formation of
deposits in the RPE/BrM that contain proteins
also found in human drusen and basal laminar
deposits such as C3a, C5, MAC, and CFH [15].
Also, we have shown that long-term smoke in
C57BL/6J mice reduces scotopic and photopic
ERG amplitudes, in addition to contrast sensitiv-
ity. Structural changes include mitochondrial
swelling in the RPE, a loss of CC fenestrations,
and thickening of BrM due to the deposition of
material in the outer collagenous layer. These
structural alterations were not observed in CFB−/−
mice, in which the AP is eliminated [14] or can
be repaired by treatment with an AP inhibitor
[16].
3 Neoepitopes Trigger Chronic
Inflammation in Smoke-­
Induced Pathology
Based on our premise that breakdown of the EL
in the presence of aging or oxidative stress gener-
ates elastin neoepitopes, triggering an immune
response that leads to complement activation and
pathology, we tested the hypothesis that immuni-
zation with smoke elastin neoepitopes augments
pathology. Mice were immunized with 10 μg of
mouse lung elastin peptides or 10 μg of cigarette
Elastin Layer in Bruch’s Membrane as a Target for Immunization or Tolerization to Modulate Pathology…
smoke-modified elastin peptides mixed with
adjuvant followed by a booster shot and exposed
to 6 months of smoke. After 6 months, mice were
examined for anti-elastin antibody production,
contrast sensitivity, structural changes in BrM, as
well as IgG and IgM deposition and the presence
of complement activation fragments in the
RPE/choroid [13]. The amount of antibody gen-
erated was analyzed in ELISA assays, using the
corresponding mouse serum as the antibody
source, and demonstrated that ox-elastin (neo-­
epitope) immunization generated more IgM and
IgG antibodies when compared to control elastin
(self-epitope). While room air-raised mice exhib-
ited stable contrast sensitivity over the 6-month
analysis period, smoke-exposed mice immunized
with ox-elastin exhibited a greater loss in contrast
sensitivity than the elastin-immunized mice. This
loss in vision was correlated with a thicker BrM
and more damaged RPE mitochondria when
compared to nonimmunized mice or those immu-
nized with a control elastin peptide. Finally,
structural and functional alterations were corre-
lated with increased levels of IgM, IgG3, and
IgG2b in the RPE/choroid fraction, and the
increase in antibody binding was correlated with
an increase in complement activation as assayed
by Western blotting, probing for C3 breakdown
products. Based on these results, we would like
to propose that, in CSE, antibodies, generated
either de novo against ox-elastin (IgG) or natural
antibodies amplified and selected (IgM), bind to
ox-elastin generated by smoke in BrM or other
extracellular matrices containing elastin, to trig-
ger complement activation. Antibodies might be
activating complement via either the CP or LP,
which is then amplified by the AP [14] leading to
the observed pathology.
4 Is Pathology in the CSE
Model Preventable
with Peptide
Immunotherapy?
Given this data on immunization, albeit with only
indirect evidence of ox-elastin-induced pathol-
ogy, we argued that if pathology can be increased
by increasing antibody production, pathology
69
should be decreased by immunotherapy. PIT has
been studied for the treatment of various autoim-
mune diseases, allergy, and cancer (e.g., [17]).
Overall, in laboratory animals, peripheral toler-
ance toward a particular antigen is generated by
repeated exposure, and while the exact mecha-
nism of action has not yet been fully defined [18],
it is thought to involve deletion of reactive T
cells, the generation of a regulatory T (Treg)-cell
response, or an altered macrophage response
[19]. Hence, if the generation of modified s-EDPs
and their corresponding antibodies were to trig-
ger pathology in eyes of CSE mice, this vicious
cycle of inflammation should be preventable by
PIT or tolerization. This hypothesis was tested by
providing PIT consisting of 1 or 10 μg of ciga-
rette smoke-modified mouse lung elastin pep-
tides weekly during the smoking period. After
6 months, the mice were examined for anti-­elastin
antibody production, contrast sensitivity, struc-
tural changes in BrM, as well as IgG/IgM and
complement activation in the RPE/choroid. PIT
at the 1 μg dose was efficacious in reducing the
humoral immune response, resulting in the sup-
pression of ox-elastin-specific IgG and IgM anti-
bodies when compared to control smoke-exposed
mice, almost reducing levels to those seen in ani-
mals raised in room air. Low dose PIT reduced
the amount of IgG and IgM deposited in the
RPE/choroid, and this decrease in IgG/IgM depo-
sition was correlated with reduced complement
activation. Finally, structurally, low dose PIT
resulted in preservation of BrM, and, function-
ally, improved contrast could be observed.
Finally, we asked whether low dose PIT induces
tolerance. Tolerance to antigen (neo-antigen or
against self-antigen) engages both central and
peripheral mechanisms. Central clonal deletion
providing tolerance to self-antigen occurs fol-
lowing negative selection and deletion during
thymic development, and peripheral tolerance is
a constant surveillance to prevent immune activa-
tion of T cells escaping clonal deletion and to
potentially neoantigens. Peripheral tolerance is
mediated largely via natural and inducible Trgs,
T helper 3 cells, and T regulatory type 1 cells that
orchestrate regulation via immunoregulatory
cytokines such as TGFβ, IL-10, and IL-4 [20]. As
an induction of tolerance requires, in part,
70
decreasing Th1/Th17 activation and increasing
Th2 activation or enhancing Treg activity (either
antigen or non-antigen specific), we examined
Th1 versus Th2 activation by performing a partial
representative cytokine analysis. Cytokine analy-
sis in the RPE/choroid fraction in response to
smoke suggests an induction of tolerance in PIT
animals, as a decrease IFN-y expression (surro-
gate of reduction of non-self-activation) and an
increase in IL-4 expression (promotion of self-­
tolerance) were observed. Overall, these data
support the hypothesis by Nussenblatt et al. that
AMD might be suitable for tolerance therapy
[21]. It would be of great interest to determine the
presence of ox-elastin versus control elastin anti-
bodies in AMD, as the modification status of the
s-EDPs and the epitope recognition sites of the
anti-elastin antibodies are unknown. Other neo-
epitopes that might also be involved in the
immune response identified here might include
malondialdehyde (MDA) or carboxyethylpyrrole
(CEP) adducts. Antibodies against MDA have
been shown to be involved in complement-­
dependent mouse choroidal neovascularization
and to recognize neoepitopes on RPE cells
exposed to smoke extract [22], and immunization
of mice with CEP-modified mouse serum albu-
min results in complement deposition in BrM,
the accumulation of drusen-like deposits with
aging, and decreased retinal function [23].
We acknowledge that our studies have a num-
ber of limitations, which have been addressed in
primary publications [13, 24], and include, among
others, that the effects of smoke exposure and
treatment on the eye cannot be distinguished from
those of the effects of the two on other organs, as
long-term smoke exposure leads to emphysema
and other organ damage in mice [25]. In addition,
we recognize that the gold standard to test the
hypothesis of the role of T cells, their role in tol-
erance, and thereby elucidate pathogenic path-
ways is the use of adoptive and passive transfer of
T cells as well as specific ox-elastin antibodies.
However, as our model requires 4–6 months to
propagate pathology, systemic T-cell responses
were not established. Also, the sources of the
cytokines identified would further illuminate
B. Rohrer et al.
mechanisms. Nevertheless, as AMD pathogenesis
has been linked to smoking, complement activa-
tion, and pathogenic T- and B-cell immunity, our
hypothesis that AMD pathology is increased in
the presence of neoantigens and decreased by
peptide or antigen immunotherapy to suppress
immunity appears justified. Our results may open
a novel avenue for immunotherapies in dry AMD.
Acknowledgments Funding was provided in part by the
National Institutes of Health R01EY019320 (BR),
R01EY015128, R01EY028927 and P30EY014800 (BJ),
the Department of Veterans Affairs RX000444 and
BX003050 (BR), the South Carolina SmartState
Endowment (BR), and Research to Prevent Blindness
(Department of Ophthalmology, University of Utah).
ADD is supported in part through the National
Institute for Health Research Biomedical Research
Centre at Moorfields Eye Hospital and University
College London Institute of Ophthalmology. We would
like to thank Carl Atkinson (MUSC) for the room air
and smoke-exposed FcγRΙΙΙ−/− mice.
References
1. Al-Zamil WM, Yassin SA. Recent developments
in age-related macular degeneration: a review. Clin
Interv Aging. 2017;12:1313–30.
2. Seddon JM, et al. A prospective study of cigarette
smoking and age-related macular degeneration in
women. JAMA. 1996;276(14):1141–6.
3. Blumenkranz MS, et al. Risk factors in age-related
maculopathy complicated by choroidal neovascular-
ization. Ophthalmology. 1986;93(5):552–8.
4. Degn SE, Jensenius JC, Thiel S. Disease-causing
mutations in genes of the complement system. Am J
Hum Genet. 2011;88(6):689–705.
5. Nita M, et al. Age-related macular degeneration and
changes in the extracellular matrix. Med Sci Monit.
2014;20:1003–16.
6. Holers VM. The complement system as a thera-
peutic target in autoimmunity. Clin Immunol.
2003;107(3):140–51.
7. Curcio CA, Johnson M. Structure, function, and
pathology of Bruch’s membrane. London: Elsevier;
2013. p. 465–81.
8. Thompson RB, et al. Identification of hydroxyapatite
spherules provides new insight into subretinal pig-
ment epithelial deposit formation in the aging eye.
Proc Natl Acad Sci U S A. 2015;112(5):1565–70.
9. Hussain AA, et al. Macromolecular diffusion char-
acteristics of ageing human Bruch’s membrane:
implications for age-related macular degeneration
­
(AMD). Exp Eye Res. 2010;90(6):703–10.
Elastin Layer in Bruch’s Membrane as a Target for Immunization or Tolerization to Modulate Pathology…
10. Sivaprasad S, Chong NV, Bailey TA. Serum
elastin-­derived peptides in age-related macu-
lar degeneration. Invest Ophthalmol Vis Sci.
2005;46(9):3046–51.
11. Morohoshi K, et al. Identification of anti-retinal anti-
bodies in patients with age-related macular degenera-
tion. Exp Mol Pathol. 2012;93:193–9.
12. Skeie JM, et al. Molecular responses of choroidal
endothelial cells to elastin derived peptides through
the elastin-binding protein (GLB1). Matrix Biol.
2012;31(2):113–9.
13. Annamalai B, et al. Immunization against oxidized
elastin exacerbates structural and functional dam-
age in mouse model of smoke-induced ocular injury.
Invest Ophthalmol Vis Sci. 2020;61(3):45.
14. Woodell A, et al. Alternative complement pathway
deficiency ameliorates chronic smoke-induced func-
tional and morphological ocular injury. PLoS ONE.
2013;8(6):e67894.
15. Wang AL, et al. Autophagy and exosomes in the aged
retinal pigment epithelium: possible relevance to dru-
sen formation and age-related macular degeneration.
PLoS ONE. 2009;4(1):e4160.
16. Woodell A, et al. A targeted inhibitor of the alterna-
tive complement pathway accelerates recovery from
smoke-induced ocular injury. Invest Ophthalmol Vis
Sci. 2016;57(4):1728–37.
17. Larche M, Wraith DC. Peptide-based therapeutic vac-
cines for allergic and autoimmune diseases. Nat Med.
2005;11(4 Suppl):S69–76.
71
18. Sabatos-Peyton CA, Verhagen J, Wraith DC. Antigen-­
specific immunotherapy of autoimmune and allergic
diseases. Curr Opin Immunol. 2010;22(5):609–15.
19. Butcher SK, et al. Toll-like receptors drive specific
patterns of tolerance and training on restimulation of
macrophages. Front Immunol. 2018;9:933.
20. Li L, Boussiotis V. Control and regulation of periph-
eral tolerance in allergic inflammatory disease:
therapeutic consequences. Chem Immunol Allergy.
2008;94:178–88.
21. Nussenblatt RB, et al. Immune responses in age-­
related macular degeneration and a possible long-term
therapeutic strategy for prevention. Am J Ophthalmol.
2014;158(1):5–11 e2.
22. Joseph K, et al. Oxidative stress sensitizes RPE cells
to complement-mediated injury in a natural antibody-,
lectin pathway- and phospholipid epitope-dependent
manner. J Biol Chem. 2013;288:12753.
23. Hollyfield JG, Perez VL, Salomon RG. A hapten gen-
erated from an oxidation fragment of docosahexae-
noic acid is sufficient to initiate age-related macular
degeneration. Mol Neurobiol. 2010;41(2–3):290–8.
24. Rohrer B, et al. Peptide-based immunotherapy against
oxidized elastin ameliorates pathology in mouse
model of smoke-induced ocular injury. Exp Eye Res.
2021;212:108755.
25. Vandivier RW, Ghosh M. Understanding the relevance
of the mouse cigarette smoke model of COPD: peer-
ing through the smoke. Am J Respir Cell Mol Biol.
2017;57(1):3–4.
 Repurposing Drugs for Treatment
of Age-Related Macular
Degeneration

Sarah G. Francisco and Sheldon Rowan

Abstract Keywords

Age-related macular degeneration · Drug

The need for new drugs to treat dry forms of
age-related macular degeneration remains
high. A promising approach is repurposing of
FDA-approved medications to treat
AMD. Databases containing medical and drug
records allow for retroactive identification of
drugs whose use correlates with reduced AMD
diagnosis. This short review summarizes
progress in several classes of drugs considered
for repurposing: GPR-143 agonists (L-DOPA),
anti-diabetic drugs (metformin, acarbose,
empagliflozin, fenofibrate), mitochondrial
activators (PU-91), and serotonin pathway
drugs (fluoxetine, flibanserin, xaliproden, bus-
pirone). The promises and caveats of repur-
posing are discussed herein.
S. G. Francisco
JM-USDA Human Nutrition Research Center on
Aging, Tufts University, Boston, MA, USA
S. Rowan (*)
JM-USDA Human Nutrition Research Center on
Aging, Tufts University, Boston, MA, USA
Department of Ophthalmology, Tufts University
School of Medicine, Boston, MA, USA
Friedman School of Nutrition Science and Policy,
Tufts University, Boston, MA, USA
e-mail: sheldon.rowan@tufts.edu
repurposing · Medical records database ·
Propensity matching · L-DOPA · Metformin ·
Mitochondria · Fluoxetine · Serotonin
receptor agonist · Anti-diabetic drugs
1 Introduction
Age-related macular degeneration affects
approximately 196 million individuals worldwide
and is a leading cause of blindness in older adults.
Advanced forms of the disease come in a dry,
atrophic form or wet, neovascular form. Wet
AMD can be treated, in part, through inhibitors
of the VEGF pathway. Dry AMD, which accounts
for 70–90% of reported AMD cases, remains
mostly without effective pharmaceutical
intervention.
Most new drugs for dry AMD target the
complement pathway, but, to date, phase 3
clinical trials for dry AMD treatments are not
encouraging [1]. An alternative approach to drug
discovery is to repurpose FDA-approved drugs
with established safety that may have efficacy in
treating AMD due to shared pathoetiological
mechanisms or beneficial off-target effects. It is
now possible to mine medical records for
hundreds of thousands of individuals and

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 73

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_12
74 S. G. Francisco and S. Rowan

determine whether medication history affects
AMD incidence.
Here, we summarize studies that have
evaluated different classes of medications and
suggest that many FDA-approved, widely used,
and safe drugs potentially reduce AMD diagnosis.
(4.7–4.8 letters compared to sham injection).
Patients taking L-DOPA were also 50% less
likely to initiate anti-VEGF treatments than those
with sham injection [4]. These findings suggest
that L-DOPA may be an attractive option for indi-
viduals who wish to avoid intravitreal injection.

2 L-DOPA 3 Metformin

One of the first documented examples of Metformin is one of the most effective antidiabetic
electronic medical record mining to identify medications. Metformin has several
widely used medications for AMD treatments antihyperglycemic properties, such as decreasing
was an evaluation of L-DOPA. In RPE cells, hepatic glucose production, decreasing intestinal
L-DOPA binds to and activates the GPR143 glucose absorption, and improving insulin sensi-
G-protein-­ coupled receptor, which upregulates tivity and is now being tested as a candidate anti-
production of PEDF and downregulates aging treatment [5]. One function of metformin
production of VEGF-A, thus potentially suggests it may be an effective anti-AMD medi-
mediating homeostatic RPE health [2]. cation: the activation of AMPK signaling and the
These relationships prompted an evaluation of stimulation of glucose metabolism in the retina
whether individuals that took L-DOPA for treat- [6].
ment of movement disorders such as Parkinson’s Five studies have analyzed medical records to
disease had reduced incidence of AMD. McKay determine whether metformin use was associated
and colleagues queried Marshfield Clinic Cohorts with protection against AMD. Brown et al. used
(n = 17,500), the Truven MarketScan database records from the University of Florida in a retro-
(n = 15,215,458), and the Personalized Medicine spective case-control study where controls were
Research Product (n = 20,000) to assess AMD compared to AMD cases using propensity score
incidence in individuals prescribed L-DOPA [3]. matching [7]. From a multivariable logistic
AMD diagnosis was delayed in individuals tak- regression analysis comparing the relative ratios
ing L-DOPA relative to those not taking L-DOPA. of those prescribed with metformin with those
In the massive Truven database, they reported an not (n = 7788), they determined metformin use
odds ratio (OR) for developing AMD when pre- was associated with decreased likelihood of
scribed L-DOPA to be 0.78 (confidence interval developing AMD (OR = 0.58, 95% CI: 0.43–
(CI) of 0.76–0.80) in a logistic regression model 0.79) [7].
controlled for age and sex [3]. One study using a smaller medical record
GPR143 functions as a potential anti-­ database (University of San Francisco, n = 3120)
angiogenesis factor, and L-DOPA prescription indicated a significant protective relationship
was similarly associated with reduced neovascu- (OR = 0.70, 95% CI: 0.55–0.88) [8]. A second
lar AMD (OR = 0.65, 95% CI:0.65–0.69) [3]. In study of the much larger IBM MarketScan
order to prospectively evaluate L-DOPA as treat- Commercial and Medicare Supplemental
ment for neovascular AMD, a small cohort of Databases (n = 624,780; OR = 0.94, 95% CI:
patients newly diagnosed with neovascular AMD 0.92–0.96) revealed a dose relationship where
were randomized to receive a sham intravitreal low-to-moderate doses of metformin had greatest
injection, anti-VEGF treatment (ranibizumab), or potency, but metformin use was a risk factor for
L-DOPA in the form of oral carbidopa-levodopa AMD in patients with coexisting diabetic reti-
combined therapy [4]. The L-DOPA group nopathy [9]. A third study of over a million dia-
showed improvements in best-corrected visual betic enrollees (n = 1,007,213) found decreased
acuity comparable to those taking Ranibizumab risk of AMD among prior users of metformin
Repurposing Drugs for Treatment of Age-Related Macular Degeneration
(OR = 0.95, 95% CI:0.92–0.98), but increased
hazard in those with active metformin use, and a
positive correlation between risk and cumulative
metformin dose [10].
Two Asian cohorts also evaluated AMD
relationships with metformin use. A Taiwanese
cohort (n = 68,205) reproduced findings from
American cohorts (OR = 0.54, 95% CI: 0.50–
0.58) [11], whereas a smaller South Korean
cohort (n = showed no association between AMD
and metformin use (OR = 1.15, 95% CI: 0.91–
1.45) [12]. Metformin is now being studied as an
anti-AMD treatment in nondiabetics in the
Metformin for the Minimization of Geographic
Atrophy Progression in Patients with AMD
(METforMIN) phase 2 clinical trial
(ClinicalTrials.gov Identifier: NCT02684578).
4 Fluoxetine
Fluoxetine, a specific serotonin reuptake
inhibitor, is one of the most prescribed
medications to treat depression and anxiety.
Gelfand and colleagues determined through
structural analyses that fluoxetine resembles
CY-09, a small molecule that binds to NLRP3
and inhibits inflammasome activation, an
important pathway in AMD progression [13]. In
vitro and in vivo experiments demonstrated that
fluoxetine inhibited NLRP3 assembly and
activation in cells in response to Alu RNA
transfection and inhibited RPE degeneration
in vivo in a dry AMD model. The authors utilized
the Truven MarketScan Commercial Claims
database and PearlDiver Mariner database, which
contains data on over 100 million Americans.
The combined multivariable-­ corrected model
(n = 196,010) indicated significant protection by
fluoxetine use (OR = 0.85, 95% CI: 0.73–0.99).
5 Drugs Being Evaluated
in Preclinical Models
Drug testing for AMD is an ongoing challenge
since there are few validated preclinical models
of AMD, and many require years to assess phe-
75
notypes. Nevertheless, for drugs that do not have
a long history in accessible medical databases,
preclinical models are necessary for identifying
potential medications to repurpose.
5.1 Mitochondrial Activation
Drugs
Activation of mitochondrial function is a target
for drugs to treat AMD since RPE cells from
AMD patients show clear mitochondrial defects
[14–16]. Furthermore, compounds that improve
mitochondrial function improve the health of
AMD-derived RPE cells or cells containing
AMD-derived mitochondrial DNA [14, 16].
Kenney and colleagues reported a drug-­
repurposing approach using PU-91 to enhance
mitochondrial function in RPE cells containing
mitochondria from AMD patients [17]. PU-91 is
an FDA-approved drug that upregulates PGC-1α,
a transcriptional activator of mitochondrial bio-
genesis and a key cellular energy integrator. In
cell-based assays, PU-91 enhanced mitochon-
drial function, limited apoptotic cell death, and
reduced inflammation and complement activa-
tion [17, 18].
5.2 Serotonin Receptor Agonists
A significant body of preclinical research
indicated that serotonin receptor agonists,
originally used to treat psychiatric conditions,
were capable of rescuing retinal degeneration
in several rodent disease models [19–21]. At
least three orally available drugs are currently
in preclinical testing. Flibanserin has shown
neuroprotection against light-induced retinal
degeneration when delivered intraperitoneally
[22]. Oral administration of xaliproden
improved retinal degeneration and visual func-
tion decline in Sod2-deficient mice [23]. In a
sodium iodate mouse model of RPE oxidative
damage, intraperitoneal delivery of buspirone
activated key antioxidant enzyme pathways
and helped preserve retinal tissues from dam-
age [24]. Future studies should assess whether
76 S. G. Francisco and S. Rowan

AMD incidence was altered in patients pre- vary across populations, countries, and health-
scribed these drugs. care systems making it difficult to compare stud-
ies in diverse populations. Statistical
methodologies used in propensity matching
5.3 Antidiabetic Drugs require caution as well. Medical databases are
not randomized, contain residual confounders,
Our work and others have implicated glycemia-­ and may have selection biases. Finally, even if
related stress as a pathoetiologic factor in AMD excellent candidate drugs are identified, they may
in human populations and mouse studies [25]. need to be optimized for safe ocular delivery.
We have developed a preclinical AMD model Drug repurposing is not a replacement for new
where wild-type mice fed high glycemic diets drug discovery but can be added to the physi-
develop AMD-like disease, while those fed low cian’s toolkit to customize medical treatment to a
glycemic diets, or are switched from a high-to-­ patient’s existing conditions, genetics, and
low glycemic diet late in life, maintain retinal physiology.
health [26]. The protective effect of the low
glycemic diet in other AMD-prone mice like Acknowledgments Funding was provided by NIH
­
Nrf2-­deficient mice [27] suggested that pharma- RO1EY028559, NIH RO1EY026979, USDA NIFA 2016-
ceutical agents that mimic properties of the low 08885, USDA 8050-51000-089-01S, Thome Memorial
Foundation, and BrightFocus Foundation. This material is
glycemic diet (like metformin) have potential to based upon work supported by the USDA-Agricultural
treat AMD. Research Service (ARS), under Agreement No.
We are now undergoing experiments using 58-8050-9-004.
high glycemic fed aged wild-type mice to test
three antidiabetic drugs: acarbose, empagliflozin,
and fenofibrate. Acarbose is an alpha-glucosidase References
inhibitor used to treat type 2 diabetes mellitus,
1. Kim J-B, Lad EM. Therapeutic options under
operating to control post-prandial glucose levels development for Nonneovascular age-related macular
[28]. Empagliflozin is an SGLT2 inhibitor that degeneration and geographic atrophy. Drugs Aging.
promotes glucose excretion via the kidney [29]. 2021;38(1):17–27.
Fenofibrate is not used to treat hyperglycemia but 2. Falk T, Congrove NR, Zhang S, McCourt AD,
Sherman SJ, McKay BS. PEDF and VEGF-A
is an effective treatment for diabetic retinopathy output from human retinal pigment epithelial cells
[30]. Fenofibrate works as an agonist of PPARα; grown on novel microcarriers. J Biomed Biotechnol.
it enhances lipid efflux and reduces ocular inflam- 2012;2012:e278932.
mation [31]. None of these drugs are currently 3. Brilliant MH, Vaziri K, Connor TB, Schwartz SG,
Carroll JJ, McCarty CA, et al. Mining retrospective
under consideration as an AMD treatment; thus, data for virtual prospective drug repurposing:
preclinical data is essential. L-DOPA and age-related macular degeneration. Am
J Med. 2016;129(3):292–8.
4. Figueroa AG, Boyd BM, Christensen CA, Javid CG,
McKay BS, Fagan TC, et al. Levodopa positively
6 Conclusions and Outlook affects neovascular age-related macular degeneration.
Am J Med. 2021;134(1):122–128.e3.
There remains potential for repurposed drugs to 5. Barzilai N, Crandall JP, Kritchevsky SB, Espeland
treat AMD, but well-controlled randomized clini- MA. Metformin as a tool to target aging. Cell Metab.
2016;23(6):1060–5.
cal trials are still required. Retrospective analyses 6. Xu L, Kong L, Wang J, Ash JD. Stimulation of AMPK
of medical record databases are fraught with prevents degeneration of photoreceptors and the
challenges as most databases rely on diagnosis retinal pigment epithelium. Proc Natl Acad Sci U S A.
codes for diseases rather than relevant medical 2018;115(41):10475–80.
7. Brown EE, Ball JD, Chen Z, Khurshid GS,
data like fundus imaging. Thus, patients with Prosperi M, Ash JD. The common antidiabetic drug
AMD but without proper diagnosis or coding will metformin reduces odds of developing age-related
resemble controls. In addition, diagnosis codes
Repurposing Drugs for Treatment of Age-Related Macular Degeneration
macular degeneration. Invest Ophthalmol Vis Sci.
2019;60(5):1470–7.
8. Stewart JM, Lamy R, Wu F, Keenan JD. Relationship 20.
between oral metformin use and age-related
macular degeneration. Ophthalmol Retina.
2020;4(11):1118–9.
9. Blitzer AL, Ham SA, Colby KA, Skondra
D. Association of metformin use with age-related 21.
macular degeneration: a case-control study. JAMA
Ophthalmol. 2021;139(3):302–9.
10. Eton EA, Wubben TJ, Besirli CG, Hua P, McGeehan
B, VanderBeek BL. Association of metformin and
development of dry age-related macular degeneration 22.
in a U.S. insurance claims database. Eur J Ophthalmol.
2021;32(1):417–23.
11. Chen Y-Y, Shen Y-C, Lai Y-J, Wang C-Y, Lin K-H, Feng
S-C, et al. Association between metformin and a lower 23.
risk of age-related macular degeneration in patients with
type 2 diabetes. J Ophthalmol. 2019;2019:1649156.
12. Lee H, Jeon HL, Park SJ, Shin JY. Effect of
statins, metformin, angiotensin-converting enzyme 24.
inhibitors, and angiotensin II receptor blockers on
age-related macular degeneration. Yonsei Med J.
2019;60(7):679–86.
13. Ambati M, Apicella I, Wang S, Narendran
S, Leung H, Pereira F, et al. Identification of 25.
fluoxetine as a direct NLRP3 inhibitor to treat
atrophic macular degeneration. Proc Natl Acad Sci.
2021;118(41):e2102975118. 26.
14. Ebeling MC, Polanco JR, Qu J, Tu C, Montezuma
SR, Ferrington DA. Improving retinal mitochondrial
function as a treatment for age-related macular
degeneration. Redox Biol. 2020;34:101552.
15. Terluk MR, Kapphahn RJ, Soukup LM, Gong H, 27.
Gallardo C, Montezuma SR, et al. Investigating
mitochondria as a target for treating age-related macular
degeneration. J Neurosci. 2015;35(18):7304–11.
16. Nashine S, Cohen P, Chwa M, Lu S, Nesburn
AB, Kuppermann BD, et al. Humanin G (HNG) 28.
protects age-related macular degeneration (AMD)
transmitochondrial ARPE-19 cybrids from
mitochondrial and cellular damage. Cell Death Dis.
2017;8(7):e2951–1.
17. Nashine S, Subramaniam SR, Chwa M, Nesburn 29.
A, Kuppermann BD, Federoff H, et al. PU-91 drug
rescues human age-related macular degeneration RPE
cells; implications for AMD therapeutics. Aging.
2019;11(17):6691–713.
18. Bao A, Nashine S, Atilano S, Chwa M, Federoff 30.
H, Kenney MC. Differential responses of AMD
mitochondrial DNA haplogroups to PU-91, a
mitochondria-­ targeting drug. Mitochondrion.
2021;60:189–200.
19. Biswal MR, Ahmed CM, Ildefonso CJ, Han P, Li H, 31.
Jivanji H, et al. Systemic treatment with a 5HT1a
agonist induces anti-oxidant protection and preserves
77
the retina from mitochondrial oxidative stress. Exp
Eye Res. 2015;140:94–105.
Collier RJ, Patel Y, Martin EA, Dembinska O,
Hellberg M, Krueger DS, et al. Agonists at the
serotonin receptor (5-HT(1A)) protect the retina from
severe photo-oxidative stress. Invest Ophthalmol Vis
Sci. 2011;52(5):2118–26.
Tullis BE, Ryals RC, Coyner AS, Gale MJ,
Nicholson A, Ku C, et al. Sarpogrelate, a 5-HT2A
receptor antagonist, protects the retina from light-
induced retinopathy. Invest Ophthalmol Vis Sci.
2015;56(8):4560–9.
Coyner AS, Ryals RC, Ku CA, Fischer CM, Patel
RC, Datta S, et al. Retinal neuroprotective effects of
Flibanserin, an FDA-approved dual serotonin receptor
agonist-antagonist. PLoS One. 2016;11(7):e0159776.
Ahmed CM, Biswal MR, Li H, Han P, Ildefonso
CJ, Lewin AS. Repurposing an orally available drug
for the treatment of geographic atrophy. Mol Vis.
2016;22:294–310.
Biswal MR, Paulson RJ, Vichare R, Lewin
AS. Buspirone is protective against oxidative stress
induced changes in cell culture and animal models
of RPE oxidative injury. Invest Ophthalmol Vis Sci.
2021;62(8):3277.
Whitcomb EA, Chiu C-J, Taylor A. Dietary glycemia
as a determinant of health and longevity. Mol Asp
Med. 2015;46:14–20.
Rowan S, Jiang S, Korem T, Szymanski J, Chang
M-L, Szelog J, et al. Involvement of a gut-retina axis
in protection against dietary glycemia-induced age-­
related macular degeneration. Proc Natl Acad Sci U S
A. 2017;114(22):E4472–81.
Rowan S, Jiang S, Chang M-L, Volkin J, Cassalman
C, Smith KM, et al. A low glycemic diet protects
disease-prone Nrf2-deficient mice against age-­
related macular degeneration. Free Radic Biol Med.
2020;150:75–86.
Alssema M, Ruijgrok C, Blaak EE, Egli L, Dussort P,
Vinoy S, et al. Effects of alpha-glucosidase-­inhibiting
drugs on acute postprandial glucose and insulin
responses: a systematic review and meta-analysis.
Nutr Diabetes. 2021;11(1):11.
Wu Q, Liu M, Fang Z, Li C, Zou F, Hu L, et al.
Efficacy and safety of empagliflozin at different doses
in patients with type 2 diabetes mellitus: a network
meta-analysis based on randomized controlled trials.
J Clin Pharm Ther. 2021;47(3):270–86.
Keech AC, Mitchell P, Summanen PA, O’Day J,
Davis TME, Moffitt MS, et al. Effect of fenofibrate on
the need for laser treatment for diabetic retinopathy
(FIELD study): a randomised controlled trial. Lancet
(Lond Engl). 2007;370(9600):1687–97.
Tomita Y, Lee D, Tsubota K, Kurihara T. PPARα
agonist Oral therapy in diabetic retinopathy.
Biomedicine. 2020;8(10):433.
 Part II
Extracellular Vesicles
 Extracellular Vesicle RNA Contents
as Biomarkers for Ocular Diseases

Heran Getachew and Eric Pierce

Abstract 1 Introduction

Extracellular vesicles (EVs) are small vesicles
secreted from cells into extracellular space.
EVs contain proteins, lipids, and nucleic acids
of the cells from which they originate. For this
reason, EVs are being studied for use as bio-
markers as they can be surrogates for the sta-
tus of the cell from which they are secreted.
Moreover, EVs are found in numerous bioflu-
ids and can be taken up by other cells, which
allows for transfer of functional cargo, like
RNAs, and changes in gene regulation in the
recipient cell. Several potential RNA biomark-
ers have been identified in many diseases, and
there is great potential in the vision field for
extracellular RNA biomarkers as a diagnostic
tool as well as a measure for treatment
efficacy.
Keywords
Extracellular vesicles · Biomarkers · RNA ·
miRNA · Inherited retinal degenerations ·
Ocular diseases
H. Getachew · E. Pierce (*)
Ocular Genomics Institute, Department of
Ophthalmology, Massachusetts Eye and Ear
Infirmary, Harvard Medical School, Boston, MA,
USA
e-mail: eric_pierce@meei.harvard.edu
Extracellular vesicles (EVs) are nanometer-sized,
lipid membrane-enclosed vesicles secreted by
cells. These vesicles contain lipids, proteins, and
various nucleic acid species of the source cell.
EVs are a heterogeneous population of vesicles
including exosomes, microvesicles, and apop-
totic bodies that are categorized based on biogen-
esis and range in size from less than 50 nm to
micrometers. The biogenesis of exosomes has
been previously extensively reviewed [1–4]
(Fig. 1). Briefly, exosomes originate from late
endosomes, which are formed by the inward bud-
ding of endosomal membrane during maturation.
Late endosomes are also referred to as multive-
sicular bodies due to their morphology and invag-
inations in the multivesicular bodies form
intraluminal vesicles. The formation of the multi-
vesicular bodies and intraluminal vesicles
depends on the endosomal sorting complex
required for transport (ESCRT). This complex is
comprised of four complexes (ESCRT 0-III) and
associated proteins (VPS4, VTA1, and ALIX)
that coordinate membrane formation and vesicle
budding and facilitate protein cargo sorting.
Additionally, tetraspanins, CD9, CD63, and
CD81, play a role in EV development and are
typically used as markers. The biogenesis of
microvesicles differs as these are formed as a
result of outward budding and pinching off of the
plasma membrane [6]. Cargos are selectively

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 81

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_13
82
Fig. 1 Extracellular vesicle biogenesis. Exosomes origi-
nate from multivesicular bodies and are formed in an
ESCRT-dependent manner and are secreted through exo-
cytosis. Microvesicles bud directly from the plasma mem-
recruited into microvesicles by proteins such as
the small GTPase, ARF6, and are also regulated
by ESCRT proteins [7, 8]. The largest EVs, apop-
totic bodies, are formed as a cell undergoes apop-
tosis, and blebbing from the plasma membrane
occurs.
EVs contain proteins, lipids, and nucleic
acids, as well as organelles, histones, and chro-
matin, which are found in apoptotic bodies [9,
10]. The proteins and lipids found in EVs typi-
cally arise from their biogenesis mechanisms.
For example, exosomes are enriched with ESCRT
proteins and tetraspanins, microvesicles are
enriched with ß-1 integrin and ARF6, and apop-
totic bodies are enriched with annexin V; how-
ever, they can also express CD9, CD63, and
CD81. Therefore, the International Society for
Extracellular Vesicles suggests using multiple
H. Getachew and E. Pierce
brane, also relying on ESCRT proteins and GTPases, such
as ARF6. Apoptotic bodies are formed in cells undergoing
apoptosis, and these vesicles bleb from the plasma mem-
brane. (Figure adapted from Dang et al. [5])
techniques and markers for characterizing EVs
[11]. Many of the lipids found within EVs are
derived from lipids found in the cellular plasma
membrane, such as sphingolipids and phosphati-
dylcholine [12]. Single- and double-stranded
DNA and mitochondrial DNA have been detected
in EVs [13, 14]. Moreover, several RNA species
have been identified in EVs, including mRNAs,
miRNAs, piRNAs, and long and short noncoding
RNA; however, the majority of RNAs thought to
be present within EVs are small RNAs [15–18].
RNAs are protected by the lipid bilayer of EVs,
which provides protection for enzymes and other
proteins as well [19].
The physiological role of EVs was initially
believed to be a cellular waste removal mecha-
nism; however, mounting evidence suggests a
role in intercellular communication [20–23]. One
Extracellular Vesicle RNA Contents as Biomarkers for Ocular Diseases
mechanism for EV-mediated intercellular com-
munication is through transfer and uptake of
RNA, which can alter gene regulation in the
recipient cells [24]. Furthermore, EVs can carry
gRNA or Cas9 proteins of the CRISPR/Cas sys-
tem expressed in cells following transfection,
thereby transferring the gene editing activity of
this system between donor and recipient cells,
providing further evidence for EVs-mediated
gene expression alteration [25].
Given the information contained within EVs,
it has been suggested and demonstrated that they
can provide valuable information about the status
of their parent cells and have been studied as bio-
markers in several diseases including cancers,
and similar studies are emerging in the vision
field.
2 EV RNAs as Biomarkers
in Ocular Disorders
The FDA/NIH Biomarker Working Group defines
a biomarker as “a defined characteristic that is
measured as an indicator of normal biological
processes, pathogenic processes, or responses to
an exposure or intervention, including therapeu-
tic interventions” [26]. Because EVs can be
found within numerous biological specimens,
including plasma, serum, urine, saliva, aqueous
humor, vitreous humor, tears, and cerebrospinal
fluid, they are an excellent candidate to be used
as biomarkers. The cancer and neurodegenera-
tion fields have reported success in identifying
RNA biomarkers from EVs, demonstrating their
promising potential in the vision field [27–29].
One potential application in the vision field is for
inherited retinal degenerations (IRDs), which are
a heterogeneous group of diseases with muta-
tions in 280 genes that cause vison loss and blind-
ness [30]. While gene therapies, such as the
FDA-approved therapy for RPE65-associated
retinal degenerations, are promising treatments
for IRDs, the clinical measures to assess improve-
ment in vison following application of therapies
takes time, highlighting the need for additional
measures of clinical efficacy. One study found
that, in mice with Pde6b-associated retinal
83
degeneration, there was increased secretion of
EVs by the retina; however, to date, no RNA bio-
markers have been defined for retinitis pigmen-
tosa or other IRDs [31]. Identification of
biomarkers for IRDs would be of great benefit in
assessing efficacy of therapies for IRDs as well
as additional diagnostic tool in other ocular
disorders.
Tear fluid is a noninvasively available biofluid,
and while volume may be a limiting factor, a few
studies have identified potential biomarkers in
tear fluid [32]. There are currently two FDA-­
approved tests using tear fluid, InflammaDry,
which measures levels of MMP-9, and Advanced
Tear Diagnostics, which measures lactoferrin, as
diagnostic tools for dry eye disease [32, 33]. EVs
from tears contain RNAs, and one study found
that the total miRNA was higher in tears from
Alzheimer disease patients compared to healthy
controls [34]. Moreover, miRNA-200b-5p was
elevated in tears from individuals with
Alzheimer’s disease [34]. Pucker et al. collected
tear fluid from healthy individuals and using
RNA-seq were able to identify miRNAs con-
tained in tear EVs which can be used as a refer-
ence in future studies examining the RNA from
tears of individuals with ocular diseases [35].
Several small RNAs have been identified in
the vitreous including miR-9, miR-9*, miR-­
125a-­3p, miR-184, miR-211, miR-214, miR-­
302c, miR-452, miR-628, and miR-639, which
are either under expressed or not detectable in
serum [36]. A study examined the vitreous sam-
ples of patients with primary vitreoretinal lym-
phoma (PVRL) or chronic vitritis as they are
often difficult to distinguish clinically [37]. The
results showed that miR-92, miR-19b, and miR-­
21 were present at significantly higher levels in
the vitreous of patients with PVRL than in vitritis
samples, suggesting that these miRNAs biomark-
ers can be used in addition to morphological,
immunological, and genetic evaluations to make
diagnoses and monitor patient progress [37].
Tanaka et al. found 11 significantly upregulated
and 18 significantly downregulated miRNAs in
the aqueous humor of individuals with glaucoma
compared to healthy controls [38]. Another study
identified a long noncoding RNA
84
(ENST00000607393) in aqueous humor as a
potential biomarker and therapeutic target for
glaucoma [39]. While more invasive than collect-
ing blood, aqueous and vitreous humors provide
a way to isolate and characterize locally secreted
EVs, from which specific markers and cargo can
be defined and potentially identified in blood
circulation.
Identifying biomarkers in circulation is
appealing as it is an available biofluid and is rich
with EVs [40]. Some circulating RNA biomark-
ers have been identified in circulation, such as
miR146a which was upregulated in the serum of
patients with uveal melanoma [41]. Additionally,
miR-126, miR-410, and miR-19a were upregu-
lated in the serum of patients with atrophic age-­
related macular degeneration, and another study
identified five other circulating miRNAs as
potential biomarkers for neovascular age-related
macular degeneration [42, 43]. Since tissues like
the retina and retinal pigment epithelium (RPE)
are not able to be biopsied, it would be of great
benefit to characterize EV-derived RNAs from
the retina, RPE, and other cells in the visual sys-
tem in order to: (1) determine if they are detect-
able in circulation and (2) change during disease
progression in order to be used as a surrogate
measure of retinal health status.
In vitro studies can also be helpful in charac-
tering ocular EVs, especially given the flexibil-
ity compared to studies using limited patient
sample such as tears or aqueous and vitreous
humors. In a 2017 study, Klingeborn et al. iden-
tified 631 proteins in EVs secreted from cul-
tured polarized RPE cells [44]. Of these proteins,
299 were uniquely released apically and 94
uniquely released basolaterally, indicating that
EVs can reflect polarity-specific functions of
RPE cells. This study provides key information
on the proteome of the RPE and can be used a
reference for future studies aimed at identifying
protein biomarkers of the other cell types of the
visual system. Future studies defining the RNA
contents of EVs secreted from specific cell types
of the visual system will allow for the identifica-
tion of additional RNA biomarkers and thera-
peutic targets.
H. Getachew and E. Pierce
3 Concluding Remarks
In order to use EVs as biomarkers for ocular dis-
eases, ocular-specific EV markers and contents
need to be fully defined in health and disease
states [45]. Thus, a potential focus of future stud-
ies is characterization of the contents of EVs, like
RNAs, secreted from the visual system. Defining
the EVs secreted from the various cell types of
the visual system will allow for evaluation of EV
contents as ocular biomarkers in various bioflu-
ids, which can be assessed for changes during
disease, which will provide a method to monitor
disease progression, additional endpoints in clin-
ical trials, and therapeutic targets.
References
1. Zhang Y, Liu Y, Liu H, Tang WH. Exosomes: bio-
genesis, biologic function and clinical potential. Cell
Biosci. 2019;9(1):19.
2. Patil AA, Rhee WJ. Exosomes: biogenesis, com-
position, functions, and their role in pre-metastatic
niche formation. Biotechnol Bioprocess Eng.
2019;24(5):689–701.
3. Hessvik NP, Llorente A. Current knowledge on exo-
some biogenesis and release. Cell Mol Life Sci.
2018;75(2):193–208.
4. Colombo M, Raposo G, Théry C. Biogenesis, secre-
tion, and intercellular interactions of exosomes and
other extracellular vesicles. Annu Rev Cell Dev Biol.
2014;30(1):255–89.
5. Dang XTT, Kavishka JM, Zhang DX, Pirisinu M, Le
MTN. Extracellular vesicles as an efficient and versa-
tile system for drug delivery. Cell. 2020;9(10):2191.
6. D’Souza-Schorey C, Clancy JW. Tumor-derived
microvesicles: shedding light on novel microenviron-
ment modulators and prospective cancer biomarkers.
Genes Dev. 2012;26(12):1287–99.
7. Taylor J, Bebawy M. Proteins regulating microves-
icle biogenesis and multidrug resistance in cancer.
Proteomics. 2019;19(1–2):e1800165.
8. Muralidharan-Chari V, Clancy J, Plou C, Romao M,
Chavrier P, Raposo G, et al. ARF6-regulated shedding
of tumor cell-derived plasma membrane microvesi-
cles. Curr Biol. 2009;19(22):1875–85.
9. Battistelli M, Falcieri E. Apoptotic bodies: particular
extracellular vesicles involved in intercellular com-
munication. Biology (Basel). 2020;9(1):21.
10. Emlen W, Niebur J, Kadera R. Accelerated
in vitro apoptosis of lymphocytes from patients
with systemic lupus erythematosus. J Immunol.
1994;152(7):3685–92.
Extracellular Vesicle RNA Contents as Biomarkers for Ocular Diseases
11. Thery C, Witwer KW, Aikawa E, Alcaraz MJ,
Anderson JD, Andriantsitohaina R, et al. Minimal
information for studies of extracellular vesicles
2018 (MISEV2018): a position statement of the
International Society for Extracellular Vesicles and
update of the MISEV2014 guidelines. J Extracell
Vesicles. 2018;7(1):1535750.
12. Subra C, Laulagnier K, Perret B, Record M. Exosome
lipidomics unravels lipid sorting at the level of multi-
vesicular bodies. Biochimie. 2007;89(2):205–12.
13. Thakur BK, Zhang H, Becker A, Matei I, Huang Y,
Costa-Silva B, et al. Double-stranded DNA in exo-
somes: a novel biomarker in cancer detection. Cell
Res. 2014;24(6):766–9.
14. Guescini M, Genedani S, Stocchi V, Agnati
LF. Astrocytes and glioblastoma cells release exo-
somes carrying mtDNA. J Neural Transm (Vienna).
2010;117(1):1–4.
15. Arroyo JD, Chevillet JR, Kroh EM, Ruf IK, Pritchard
CC, Gibson DF, et al. Argonaute2 complexes carry a
population of circulating microRNAs independent of
vesicles in human plasma. Proc Natl Acad Sci U S A.
2011;108(12):5003–8.
16. Ni H, Capodici J, Cannon G, Communi D, Boeynaems
JM, Karikó K, et al. Extracellular mRNA induces
dendritic cell activation by stimulating tumor necrosis
factor-alpha secretion and signaling through a nucleo-
tide receptor. J Biol Chem. 2002;277(15):12689–96.
17. Skog J, Würdinger T, van Rijn S, Meijer DH, Gainche
L, Sena-Esteves M, et al. Glioblastoma microvesicles
transport RNA and proteins that promote tumour
growth and provide diagnostic biomarkers. Nat Cell
Biol. 2008;10(12):1470–6.
18. Hoy AM, Buck AH. Extracellular small RNAs: what,
where, why? Biochem Soc Trans. 2012;40(4):886–90.
19. Momen-Heravi F, Getting SJ, Moschos
SA. Extracellular vesicles and their nucleic
acids for biomarker discovery. Pharmacol Ther.
2018;192:170–87.
20. Pitt JM, Kroemer G, Zitvogel L. Extracellular
vesicles: masters of intercellular communication
and potential clinical interventions. J Clin Invest.
2016;126(4):1139–43.
21. Maacha S, Bhat AA, Jimenez L, Raza A, Haris M,
Uddin S, et al. Extracellular vesicles-mediated inter-
cellular communication: roles in the tumor microenvi-
ronment and anti-cancer drug resistance. Mol Cancer.
2019;18(1):55.
22. Berumen Sánchez G, Bunn KE, Pua HH, Rafat
M. Extracellular vesicles: mediators of intercellu-
lar communication in tissue injury and disease. Cell
Commun Signal. 2021;19(1):104.
23. Yoon YJ, Kim OY, Gho YS. Extracellular vesicles as
emerging intercellular communicasomes. BMB Rep.
2014;47(10):531–9.
24. Valadi H, Ekstrom K, Bossios A, Sjostrand M,
Lee JJ, Lotvall JO. Exosome-mediated transfer of
mRNAs and microRNAs is a novel mechanism
of genetic exchange between cells. Nat Cell Biol.
2007;9(6):654–9.
85
25. Chen R, Huang H, Liu H, Xi J, Ning J, Zeng W, et al.
Friend or foe? Evidence indicates endogenous exo-
somes can deliver functional gRNA and Cas9 protein.
Small. 2019;15(38):e1902686.
26. Cagney DN, Sul J, Huang RY, Ligon KL, Wen
PY, Alexander BM. The FDA NIH Biomarkers,
EndpointS, and other Tools (BEST) resource in neuro-­
oncology. Neuro-Oncology. 2018;20(9):1162–72.
27. Kim KM, Meng Q, Perez de Acha O, Mustapic
M, Cheng A, Eren E, et al. Mitochondrial RNA in
Alzheimer’s disease circulating extracellular vesicles.
Front Cell Dev Biol. 2020;8:581882.
28. Akin D, Wang SK, Habibzadegah-Tari P, Law B,
Ostrov D, Li M, et al. A novel ATG4B antagonist
inhibits autophagy and has a negative impact on osteo-
sarcoma tumors. Autophagy. 2014;10(11):2021–35.
29. Happel C, Ganguly A, Tagle DA. Extracellular
RNAs as potential biomarkers for cancer. J Cancer
Metastasis Treat. 2020;6:32.
30. RetNet. Available at: https://sph.uth.edu/retnet/home.
htm
31. Sahaboglu A, Vidal-Gil L, Sancho-Pelluz J. Release
of retinal extracellular vesicles in a model of retinitis
Pigmentosa. Adv Exp Med Biol. 2019;1185:431–6.
32. Tamhane M, Cabrera-Ghayouri S, Abelian G,
Viswanath V. Review of biomarkers in ocular matri-
ces: challenges and opportunities. Pharm Res.
2019;36(3):40.
33. Roy NS, Wei Y, Kuklinski E, Asbell PA. The grow-
ing need for validated biomarkers and endpoints for
dry eye clinical research. Invest Ophthalmol Vis Sci.
2017;58(6):BIO1–BIO19.
34. Kenny A, Jiménez-Mateos EM, Zea-Sevilla MA,
Rábano A, Gili-Manzanaro P, Prehn JHM, et al.
Proteins and microRNAs are differentially expressed
in tear fluid from patients with Alzheimer’s disease.
Sci Rep. 2019;9(1):15437.
35. Pucker AD, Fortinberry H, Ngo W, Postnikoff CK,
Nichols JJ. Differential expression of extracellular
vesicles and microRNAs in normal human tear sam-
ples. ARVO Annu Meet. 2020;61:1393.
36. Ragusa M, Caltabiano R, Russo A, Puzzo L,
Avitabile T, Longo A, et al. MicroRNAs in vitreus
humor from patients with ocular diseases. Mol Vis.
2013;19:430–40.
37. Kakkassery V, Schroers R, Coupland SE, Wunderlich
MI, Schargus M, Heinz C, et al. Vitreous microRNA
levels as diagnostic biomarkers for vitreoretinal lym-
phoma. Blood. 2017;129(23):3130–3.
38. Tanaka Y, Tsuda S, Kunikata H, Sato J, Kokubun T,
Yasuda M, et al. Profiles of extracellular miRNAs
in the aqueous humor of glaucoma patients assessed
with a microarray system. Sci Rep. 2014;4:5089.
39. Xie L, Mao M, Wang C, Zhang L, Pan Z, Shi J, et al.
Potential biomarkers for primary open-angle glau-
coma identified by long noncoding RNA profiling in
the aqueous humor. Am J Pathol. 2019;189(4):739–52.
40. Palviainen M, Saraswat M, Varga Z, Kitka D,
Neuvonen M, Puhka M, et al. Extracellular ves-
icles from human plasma and serum are carriers of
86
e­ xtravesicular cargo—implications for biomarker dis-
covery. PLoS One. 2020;15(8):e0236439.
41. Ragusa M, Barbagallo C, Statello L, Caltabiano R,
Russo A, Puzzo L, et al. miRNA profiling in vitreous
humor, vitreal exosomes and serum from uveal mel-
anoma patients: pathological and diagnostic implica-
tions. Cancer Biol Ther. 2015;16(9):1387–96.
42. ElShelmani H, Wride MA, Saad T, Rani S, Kelly DJ,
Keegan D. Identification of novel serum MicroRNAs
in age-related macular degeneration. Translational
vision. Sci Technol. 2020;9(4):28.
H. Getachew and E. Pierce
43. Ertekin S, Yıldırım O, Dinç E, Ayaz L, Fidancı
SB, Tamer L. Evaluation of circulating miRNAs
in wet age-related macular degeneration. Mol Vis.
2014;20:1057–66.
44. Klingeborn M, Dismuke WM, Skiba NP, Kelly U,
Stamer WD, Bowes Rickman C. Directional exo-
some proteomes reflect polarity-specific functions in
retinal pigmented epithelium monolayers. Sci Rep.
2017;7(1):4901.
45. Klingeborn M, Dismuke WM, Bowes Rickman C,
Stamer WD. Roles of exosomes in the normal and
diseased eye. Prog Retin Eye Res. 2017;59:158–77.
 Proteomics of Retinal Extracellular
Vesicles: A Review into
an Unexplored Mechanism
in Retinal Health and AMD
Pathogenesis

Adrian V. Cioanca, Riccardo Natoli,

and Yvette Wooff

Abstract and RPE-derived EV largely reflect the func-

Extracellular vesicles (EV) are nanosized
delivery vehicles that participate in cell-to-cell
communication through the selective transfer
of molecular materials including RNA, DNA,
lipids, and proteins. In the retina, the role of
EV proteins is largely unclear, in part due to
the lack of studies and the depth of proteomic
analyses of EV cargo. This review summa-
rizes the existing knowledge on retinal EV
proteins and provides a comparative reanaly-
sis of existing retinal EV proteomic datasets.
Collective findings highlight that in homeosta-
sis, the protein components of neural retinal
tion of the host cells, while in disease RPE-EV
protein composition becomes altered, favor-
ing inflammatory modulation and potentially
contributing to drusen formation. While these
studies shed light on the potential roles of EV
proteins in the neural retina and RPE, it is
clear that comprehensive proteomic and
molecular studies are required, in particular
using in vivo models of retinal degenerations.
Keywords
Proteomics · Extracellular vesicles · Retinal
degeneration · Retinal pigmented epithelium ·
Age-related macular degeneration · Exosome

A. V. Cioanca · R. Natoli · Y. Wooff (*)

John Curtin School of Medical Research, The
Abbreviations
Australian National University, Canberra, ACT,
Australia AMD Age-related macular degeneration
The School of Medicine and Psychology, The BRB Blood retinal barrier
Australian National University, Canberra, ACT, EV Extracellular vesicles
Australia miRNA microRNA
e-mail: valerin.cioanca@anu.edu.au;
Riccardo.natoli@anu.edu.au;
RPC Retinal progenitor cells
Yvette.wooff@anu.edu.au RPE Retinal pigmented epithelium

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 87

J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_14
88
1 Introduction
Extracellular vesicles (EV) are naturally occur-
ring endogenous membrane-enclosed delivery
vehicles [1] that are released by nearly all cell
types and function to transfer essential molecu-
lar cargo, including DNA, mRNA, noncoding
RNA (including microRNA (miRNA)), lipids,
and proteins. EV selectively encapsulates and
transports this cargo to target cells to induce a
range of biological responses, including in
immune modulation [2–4]. EV comprise vari-
ous subclasses of vesicle fractions which differ
in size, cellular origin, composition, and cargo
[3, 5]; however, the most widely studied sub-
class of EV are exosomes, which range in size
from ~30 to 150 nm and are derived from the
endocytic pathway.
Cell-to-cell communication is critical for tis-
sue survival, with dysregulation in EV communi-
cation linked to the development of inflammatory
and neurodegenerative diseases [2]. In the retina,
EV have been shown to function to maintain
homeostasis and immune modulation [1, 6–8]
through the selective incorporation and transfer
of molecular cargo between cells, including small
gene regulators called miRNA [1, 6, 9]. However,
while investigations have focused on the role and
transfer of EV miRNA [1, 6, 9] or individual pro-
teins [10–13], little has been done in characteriz-
ing or understanding the entire proteomic
contribution of retinal EV in health or
degeneration.
This review therefore collates and reanalyzes
the available literature and data on retinal EV
proteomics, comparing the role of retinal EV
proteins in retinal homeostasis and disease,
including in the pathogenesis of age-related
macular degeneration (AMD). With limited
studies available, it is apparent that, in order to
further unravel the role of the EV proteome in
retinal health, additional standardized studies
need to be conducted and the available pro-
teomic datasets queried in more depth than is
currently reported. This review therefore addi-
tionally attempts to further delve into each pro-
teomic dataset in retinal health and degeneration
and highlights key areas where additional
research could be focused in the future.
A. V. Cioanca et al.
2 Part I: Retinal EV Proteome
in Normal Health
2.1 Part I.I: Retinal EV Proteins
Have Distinct Roles
in the Neural Retina and RPE
to Support Host-Cell Function
in Retinal Homeostasis
There have only been a few studies investigating
the retinal EV proteome; however, collectively,
these studies show that the EV proteome from the
neural retina and RPE are distinct (Fig. 1a), with
each regulating different pathways involved in
maintaining retinal homeostasis. In a recent study
by Mighty et al. [18], the EV proteome of the
adult neural retina was explored using retinal
explants from C57Bl/6J mice [18]. 957 proteins
were found to be shared between the retinal
explants and isolated EV; 82 of which were
uniquely found in the EV [18]. Protein ontology
analysis of these 82 EV proteins identified bio-
logical terms such as “response to DNA damage,”
“phosphorylation,” “mRNA processing,” and
“DNA-dependent transcription regulation,” while
molecular functions were related to gene regula-
tion, and phosphorylation were highly significant.
Specifically, these pathways involved protein,
RNA, DNA, nucleotide, and ATP binding, as well
as transferase and kinase activity [18]. A limita-
tion of this study was that no further bioinformatic
analyses were conducted on either the unique EV
proteins or the EV/retinal proteins. However, the
results available suggest that retinal EV protein
transfer is required for nucleic acid processing,
surveillance of DNA damage, and transcriptional
regulation. As this is the only study to date inves-
tigating the retinal EV proteome, it is apparent
that additional studies, in particular in vivo and in
diseased models and human tissue, are required to
truly understand the biological role that retinal
EV proteins may play in the retina in health and
in degeneration. Further, elucidating the surface
membrane protein composition could provide
insight into the cell-specific origin of EV in the
retina and which cells they are targeted for,
enabling the mapping of EV-communication
pathways in the retina. While brief, Mighty et al.
[18] reported that key photoreceptor and neuronal
Proteomics of Retinal Extracellular Vesicles: A Review into an Unexplored Mechanism in Retinal Health…
Fig. 1 Reanalysis of retinal EV proteomic databases. (a)
Venn diagram comparing overlapping and unique proteins
in each retinal cell type EV. (b) Hierarchical cluster shows
cell type specific proteomes, with RPE-EV and neural
retinal proteins also present in drusen. (c) Pathway analy-
sis of retinal EV proteins found in drusen. (d) Diagram
showing EV deposition in drusen. Venn diagrams, hierar-
proteins (Rhodopsin and NeuN, respectively)
were present in the EV, suggesting a photorecep-
tor origin or potentially from amacrine and gan-
glion cells. Previous findings from our lab group
support this result, with a depletion in retinal EV
concentration correlated to decreased photorecep-
tor survivability in vivo [19].
The majority of the available literature has
been focused on understanding the RPE-EV pro-
teome in health (Sect. 2.1) and disease (Sect. 3).
Functioning not only as a physical barrier that
89
chical clustering and alluvial plots were created with
ggVennDiagram [14], RVenn [15] and ggalluvial R pack-
ages [16]. EV markers found in drusen as listed on
Vesiclepedia [17] shown in red. BL basolateral, EMT epi-
thelial mesenchymal transition, IS inner segments, OLM
outer limiting membrane, OS outer segments
allows the retina to exist in an immune privileged
and closed environment, the RPE also plays key
roles in regulating retinal health, in particular
maintaining photoreceptor function [20, 21].
Proteomic studies exploring the role of RPE-EV
have largely been conducted in vitro using mono-
layer cultures of a commonly used non-­
transformed human RPE cell line called aRPE-19.
However, the use of aRPE19 monolayer cultures
poses issues when understanding the polarized
roles of the RPE at each of the respective apical
90
(retinal) and basolateral (systemic) faces. In fact,
Klingeborn et al. [22] showed using immunocap-
ture of CD81-expressing EV from the plasma and
from EV collected from aRPE-19 monolayer cul-
ture media that the proteome of aRPE-19 EV [22]
was more similar to the apically derived RPE EV
population in their earlier study than from the
basolateral EV population [23]. As the polarity of
secretions from the RPE dictates separate impor-
tant interactions with the systemic circulation and
the retina, the proteomic profile of EV from each
side of the RPE may play unique and mutually
distinct roles in retinal health and disease mani-
festation. Importantly, as basolateral RPE-EV can
enter the systemic circulation, they represent
potential biomarkers of retinal disease [22].
Earlier work by Klingeborn et al. [23]
explored this polarized nature by isolating and
characterizing the proteomic composition of EV
derived from mature polarized primary porcine
RPE cells. These cells were grown on perme-
able support scaffolds allowing for EV release
from the apical as well as basolateral faces of
the RPE to be collected in the media [23]. Both
exosomes and dense EV fractions from each
compartment were isolated and compared [23,
24]. 631 proteins were identified in total from
this study, with 299 unique to the apical and 94
to the basolateral fractions, respectively.
In-depth analyses demonstrated that the unique
proteins isolated in exosomes from either side
of the RPE reflected the polar-specific functions
of the RPE, while both apical and basolateral
dense-EV were found to contain extracellular
matrix proteins including COL18A1 which is
essential for RPE function and Bruch’s mem-
brane structure [23]. Interestingly, proteins such
as complement component C3 and amyloid beta
were found uniquely in the basolateral dense-
EV population but not the apical [23]. As these
proteins are associated with AMD [25–27] and
have been isolated in drusen [28, 29], this result
suggests that basolateral RPE-EV specifically
may contribute to disease pathogenesis, or
potentially drusen formation as proposed by
Curcio et al. [22, 30] and briefly discussed in
Sect. 3.2, therefore making them potential diag-
nostic biomarkers. A limitation of this study
A. V. Cioanca et al.
however is that the cells were grown in culture
for 6 weeks which is likely to affect cellular
behavior through responses to their artificial
environment, potentially changing EV profiles
and cargo [31]. In fact, in this study, it was dem-
onstrated that significantly different numbers of
EV were released between the apical and baso-
lateral faces dependent on the addition of FBS
or B27 as culture media supplements [23].
Another limitation of this study was that, while
proteomics were conducted on the RPE cells
themselves, there was no comparative analysis
between the EV populations and the RPE host
cell [23] nor in-depth pathway or network anal-
yses to elucidate potential pathways regulated
by these EV.
The results of these studies support a mecha-
nism by which retinal EV modulate key functions
of their host cell and drive homeostatic mainte-
nance in the retina. However, understanding the
role of retinal EV in disease models is important
to elucidate pathogenic consequences of dysreg-
ulated EV communication and the role that EV
proteins may play in disease pathogenesis.
3 Part II: Retinal EV Proteome
in Disease
3.1 Part II.I: RPE EV Proteins
Modulate Cell Death,
Oxidative Stress,
and Inflammatory Pathways
in Retinal Degeneration
AMD is the leading cause of vision loss in the
Western World, characterized by the progressive
death of the light-sensing photoreceptor cells and
underlying RPE, resulting in irreversible blind-
ness [32]. Oxidative stress and inflammation are
widely accepted as key pathological features
implicated in the development and progression of
AMD [27, 33]. Given the essential role that the
RPE plays in regulating oxidative stress and the
associations between RPE dysfunction and AMD
[34], the majority of the literature has been
focused on understanding the RPE-EV proteome
to decipher if secretions of EV and their protein
Proteomics of Retinal Extracellular Vesicles: A Review into an Unexplored Mechanism in Retinal Health…
cargo may contribute to the onset and pathogenic
features of AMD and be used as disease
biomarkers.
Using reverse phase protein arrays, Biasutto
et al. [35] explored the effects of oxidative
stress on the RPE-EV proteome to determine
how cell-­ free phosphorylated signaling pro-
teins could arise in the vitreous of patients with
AMD [36]. Thirteen phosphoproteins involved
in pathways regulating cell survival, prolifera-
tion, metabolism, and apoptosis were found to
be differentially expressed in aRPE-19 exo-
somes following exposure to oxidative stress
using either 2.5 μM rotenone or 62.5 μM
methyl viologen. Notably, phosphorylated
VEGFR2 and PDGFRβ have also been previ-
ously identified in the vitreous of human AMD
patients [37]. The authors concluded from this
work that the phosphoprotein content of RPE
exosomes following oxidative stress may
reflect a change in signaling pathway activa-
tion and suggest that RPE-exosomes phospho-
proteins modulate or alter signaling pathways
in recipient cells during disease. As phosphor-
ylated signaling proteins can be detected in the
vitreous of AMD patients, this study supports
the potential use of EV proteins as a biomarker
for disease state.
Further evidence for the use of RPE-EV pro-
teins as disease biomarkers comes from a study
by Kang et al. [38], in which proteins identified
in the exosomes of aRPE-19 cells subjected to
400 μM paraquat, an inducer of oxidative stress,
were also detected in the aqueous humor of wet-­
AMD patients [38]. Using liquid chromatography-­
tandem mass spectrometry, 37 proteins were
identified both in exosomes from aRPE-19 and in
the aqueous humor of wet-AMD patients along
with 18 proteins identified in exosomes from
Müller glia (used as a control) that had under-
gone oxidative stress [38]. Pathway analysis of
the 37 aRPE-19/aqueous humor exosome pro-
teins identified roles in metabolic and immune
system processes [38]. Of note cathepsin D was
found to be enriched in these groups compared to
the respective control groups, which the authors
suggest may be a mechanism to resist oxidative
stress. Cathepsin D along with cytokeratin 8 and
91
4 other proteins were verified and confirmed as
putative diagnostic biomarkers using a receiver
operating characteristic curve analysis, with
cytokeratin 8 having an area under the curve
score of 0.929 [38]. While this study suggests
that RPE contributes the major source of EV in
the aqueous humor, they did not analyze the data
from Müller EV except for a comparison of the
number of EV proteins shared between both
groups. Further, the contribution of EV from
other retinal cell types such as photoreceptors
was not investigated at all.
3.2 Part II.II: RPE-EV Contributes
to Drusen Formation
Drusen formation is a key facet of AMD patho-
genesis [29, 39, 40]. A growing body of evidence
exists for the formation of drusen to be caused, in
part, by an accumulation of EV. EV markers such
as CD63 and Lamp2 have all been identified in
drusen deposits of AMD patients [38, 41–44] and
were suggested by Wang et al. [42] to be released
from the RPE [42, 43]. In a currently unpublished
study by Flores-Bellver et al. [41], drusen and
AMD-associated proteins were reported in EV
collected from human-induced pluripotent stem
cell-derived RPE following cigarette-­ smoke
stimulation to induce oxidative stress [41].
Enriched EV proteins were further shown to reg-
ulate pathways involved in oxidative stress and
inflammation. While the authors suggest that
RPE-EV may contribute to drusen formation
[41], unfortunately, as this dataset has not yet
been made available, limited conclusions can be
drawn. In support of this hypothesis, however,
fibulin-3 (FIB3), a secreted glycoprotein
expressed in the retina and associated with dru-
sen formation was detected on the apical surface
of RPE, photoreceptor outer segments, and in
drusen deposits in human AMD retinas,
co-­
­ localizing with ALIX/PDCD6IP, an EV
marker [45, 46].
In an attempt to investigate this hypothesis,
the available datasets reviewed in this paper
(termed “Healthy retinal EV,” [18] “Stressed
Müller EV,” [38] “Healthy RPE EV,” [23] and
92
“Stressed RPE EV” [35, 38]) were reanalyzed
and compared with comprehensive proteomic
datasets from human drusen [28, 39]. It was
found that retinal EV populations from each cell
type contained distinct proteomes with only nine
proteins shared between the datasets (Fig. 1a, b).
When compared to drusen, over half of the
reported drusen proteins could be found within
the EV databases analyzed, unsurprisingly, with
the majority coming from the RPE (Fig. 1b).
Interestingly, a slightly larger proportion was
derived from the healthy RPE EV than in the
stressed EV; however, it is difficult to directly
compare given the variation induced by study
design, including cell line, culture media, and
adherent vs. permeable membrane conditions as
highlighted by Klingeborn et al. [23]. Key EV
marker proteins taken from the “Top 100 EV
markers; Vesiclepedia” [17] such as Annexin
family members 1, 2 5 and 6 (ANXA) were also
identified in the drusen database (Fig. 1b, red
text). It is noteworthy to mention that these EV
markers were only found within the proportion of
drusen proteins that were also expressed in one
the retinal EV datasets, i.e., within the dashed
box in Fig. 1b, strengthening the hypothesis that
retinal EV may contribute to drusen formation.
Finally, pathway analysis was conducted on the
proteins shared between at least one of the
reviewed EV datasets and also identified in dru-
sen, using EnrichR against MSigDB Hallmark
2020 database [47, 48], as previously described
[49]. Results from this analysis showed that these
proteins had significant associations with roles in
epithelial-to-mesenchymal transition (EMT), cell
death, and immune processes, all known to be
highly important pathological processes in AMD
[26, 27, 50] (Fig. 1c, d). Although this analysis is
largely superficial, it demonstrates the capacity
of largely unused proteomics datasets to be repur-
posed in a meaningful way and gives further evi-
dence for retinal/RPE-EV contribution to drusen
formation. A systems biology approach integrat-
ing in vivo animal models of retinal degenera-
tion, high-throughput proteomic characterization,
bioinformatic analyses of existing and novel
datasets, and computational modelling is required
to elucidate the biological importance of retinal
A. V. Cioanca et al.
EV proteomes in retinal health and degeneration
and provide needed avenues for understanding
and possibly treating retinal degenerations.
4 Conclusion
This review summarizes the brief knowledge on
retinal EV proteomics, finding that, while lim-
ited studies are available, the collective data
supports a role for retinal EV in maintaining
retinal homeostasis through cell-to-cell signal-
ing of host-cell proteins and regulation of
important biological processes such as inflam-
mation. Furthered understanding of the pro-
teomic signature of retinal EV, both surface
membrane proteins and internal contents, will
expand the current knowledge base and shed
light on homeostatic communication pathways
within the retina including EV uptake and
release mechanisms. In addition, proteomic
assessment of EV in retinal disease states may
elucidate novel roles for retinal EV in retinal
degenerations such as drusen formation and
AMD pathogenesis or development. Finally,
proteomic characterization of retinal EV may
provide opportunities for EV manipulation and
therapeutic targeting as well as for use as diag-
nostic biomarkers.
References
1. Hessvik NP, Llorente A. Current knowledge on exo-
some biogenesis and release. Cell Mol Life Sci.
2018;75:193–208.
2. Jan AT, et al. Perspective insights of exosomes in
neurodegenerative diseases: a critical appraisal. Front
Aging Neurosci. 2017;9:317. https://doi.org/10.3389/
fnagi.2017.00317.
3. Théry C, et al. Minimal information for studies of
extracellular vesicles 2018 (MISEV2018): a position
statement of the International Society for Extracellular
Vesicles and update of the MISEV2014 guidelines. J
Extracell Vesicles. 2018;7:1535750. https://doi.org/10
.1080/20013078.2018.1535750.
4. Veziroglu EM, Mias GI. Characterizing extracel-
lular vesicles and their diverse RNA contents.
Front Genet. 2020;11:700. https://doi.org/10.3389/
fgene.2020.00700.
5. Doyle LM, Wang MZ. Overview of extracellular ves-
icles, their origin, composition, purpose, and methods
Proteomics of Retinal Extracellular Vesicles: A Review into an Unexplored Mechanism in Retinal Health…
for exosome isolation and analysis. Cell. 2019;8:727.
https://doi.org/10.3390/cells8070727.
6. Morris DR, et al. Exosomal MiRNA transfer
between retinal microglia and RPE. Int J Mol Sci.
2020;21:3541.
7. Knickelbein JE, et al. Modulation of immune
responses by extracellular vesicles from retinal
pigment epithelium. Invest Ophthalmol Vis Sci.
2016;57:4101–7.
8. Mead B, Tomarev S. Extracellular vesicle therapy for
retinal diseases. Prog Retin Eye Res. 2020;79:100849.
9. Ahn JY, et al. Release of extracellular vesicle miR-­
494-­3p by ARPE-19 cells with impaired mitochondria.
Biochim Biophys Acta Gen Subj. 2020;1865:129598.
https://doi.org/10.1016/j.bbagen.2020.129598.
10. Zhang W, et al. Photo-oxidative blue-light stimulation
in retinal pigment epithelium cells promotes exosome
secretion and increases the activity of the NLRP3
Inflammasome. Curr Eye Res. 2019;44:67–75.
11. Nicholson C, et al. J or H mtDNA haplogroups in reti-
nal pigment epithelial cells: effects on cell physiology,
cargo in extracellular vesicles, and differential uptake
of such vesicles by naïve recipient cells. Biochim
Biophys Acta (BBA)-Gen Subj. 2021;1865:129798.
12. Gangalum RK, Atanasov IC, Zhou ZH, Bhat SP.
αB-crystallin is found in detergent-resistant mem-
brane microdomains and is secreted via exosomes
from human retinal pigment epithelial cells. J Biol
Chem. 2011;286:3261–9.
13. Sreekumar PG, et al. αB crystallin is apically secreted
within exosomes by polarized human retinal pigment
epithelium and provides neuroprotection to adjacent
cells. PLoS One. 2010;5:e12578.
14. Gao C-H, Yu G, Cai P. ggVennDiagram: an intuitive,
easy-to-use, and highly customizable R package to
generate venn diagram. Front Genet. 2021;12:706907.
https://doi.org/10.3389/fgene.2021.706907.
15. Team RC. R: a language and environment for statisti-
cal computing. http://www.R-­project.org/. 2019.
16. Brunson JC. Ggalluvial: layered grammar for alluvial
plots. J Open Source Softw. 2020;5:2017.
17. Pathan M, et al. Vesiclepedia 2019: a compendium of
RNA, proteins, lipids and metabolites in extracellu-
lar vesicles. Nucleic Acids Res. 2019;47:D516–d519.
https://doi.org/10.1093/nar/gky1029.
18. Mighty J, et al. Analysis of adult neural retina extra-
cellular vesicle release, RNA transport and proteomic
cargo. Invest Ophthalmol Vis Sci. 2020;61:30.
19. Wooff Y, et al. Small-medium extracellular vesicles
and their miRNA cargo in retinal health and degenera-
tion: mediators of homeostasis, and vehicles for tar-
geted gene therapy. Front Cell Neurosci. 2020;14:160.
https://doi.org/10.3389/fncel.2020.00160.
20. Boulton M, Dayhaw-Barker P. The role of the reti-
nal pigment epithelium: topographical variation and
ageing changes. Eye. 2001;15:384–9. https://doi.
org/10.1038/eye.2001.141.
21. Strauss O. The retinal pigment epithelium in visual
function. Physiol Rev. 2005;85:845–81.
22. Klingeborn M, Skiba NP, Stamer WD, Bowes
Rickman C. In: Rickman CB, et al., editors. Retinal
93
degenerative diseases. Cham: Springer International
Publishing; 2020. p. 21–5.
23. Klingeborn M, et al. Directional exosome proteomes
reflect polarity-specific functions in retinal pigmented
epithelium monolayers. Sci Rep. 2017;7:4901. https://
doi.org/10.1038/s41598-­017-­05102-­9.
24. Andersen JS, et al. Proteomic characterization of the
human centrosome by protein correlation profiling.
Nature. 2003;426:570–4. https://doi.org/10.1038/
nature02166.
25. Wang M, Su S, Jiang S, Sun X, Wang J. Role of
amyloid β-peptide in the pathogenesis of age-related
macular degeneration. BMJ Open Ophthalmol.
2021;6:e000774. https://doi.org/10.1136/
bmjophth-­2021-­000774.
26. Bora NS, Matta B, Lyzogubov VV, Bora PS.
Relationship between the complement system, risk
factors and prediction models in age-related macular
degeneration. Mol Immunol. 2015;63:176–83.
27. Kauppinen A, Paterno JJ, Blasiak J, Salminen
A, Kaarniranta K. Inflammation and its role in
age-related macular degeneration. Cell Mol Life
Sci. 2016;73:1765–86. https://doi.org/10.1007/
s00018-­016-­2147-­8.
28. Crabb JW. The proteomics of drusen. Cold Spring
Harb Perspect Med. 2014;4:a017194. https://doi.
org/10.1101/cshperspect.a017194.
29. Crabb JW, et al. Drusen proteome analysis: an
approach to the etiology of age-related macular
degeneration. Proc Natl Acad Sci. 2002;99:14682–7.
30. Curcio CA, Johnson M. Structure, function,
and pathology of Bruch’s membrane. Retina.
2013;1:466–81.
31. Palviainen M, et al. Metabolic signature of extracel-
lular vesicles depends on the cell culture conditions. J
Extracell Vesicles. 2019;8:1596669. https://doi.org/10
.1080/20013078.2019.1596669.
32. Mitchell, P. (2011). Eyes on the future: a clear out-
look on age-related macular degeneration. Deloitte/
Macular degeneration foundation Australia.
33. Ambati J, Atkinson JP, Gelfand BD. Immunology of
age-related macular degeneration. Nat Rev Immunol.
2013;13:438.
34. Beranova-Giorgianni S, Giorgianni F. Proteomics
of human retinal pigment epithelium (RPE) cells.
Proteomes. 2018;6:22.
35. Biasutto L, Chiechi A, Couch R, Liotta LA, Espina
V. Retinal pigment epithelium (RPE) exosomes con-
tain signaling phosphoproteins affected by oxidative
stress. Exp Cell Res. 2013;319:2113–23. https://doi.
org/10.1016/j.yexcr.2013.05.005.
36. Boellner S, Becker K-F. Reverse phase protein
arrays-quantitative assessment of multiple biomarkers
in biopsies for clinical use. Microarrays (Basel).
2015;4:98–114. https://doi.org/10.3390/microarrays
4020098.
37. Davuluri G, et al. Activated VEGF receptor shed into
the vitreous in eyes with wet AMD: a new class of
biomarkers in the vitreous with potential for predict-
ing the treatment timing and monitoring response.
Arch Ophthalmol. 2009;127:613–21.
94
38. Kang G-Y, et al. Exosomal proteins in the aqueous
humor as novel biomarkers in patients with neovascu-
lar age-related macular degeneration. J Proteome Res.
2014;13:581–95.
39. Bergen AA, et al. On the origin of proteins in
human drusen: the meet, greet and stick hypothesis.
Prog Retin Eye Res. 2019;70:55–84. https://doi.
org/10.1016/j.preteyeres.2018.12.003.
40. Buschini E, Piras A, Nuzzi R, Vercelli A. Age related
macular degeneration and drusen: neuroinflammation
in the retina. Prog Neurobiol. 2011;95:14–25.
41. Flores-Bellver M, et al. Drusen proteins are released
in association with exosomes. Invest Ophthalmol Vis
Sci. 2021;62:2225.
42. Wang AL, et al. Autophagy, exosomes and dru-
sen formation in age-related macular degeneration.
Autophagy. 2009;5:563–4. https://doi.org/10.4161/
auto.5.4.8163.
43. Wang AL, et al. Autophagy and exosomes in the aged
retinal pigment epithelium: possible relevance to dru-
sen formation and age-related macular degeneration.
PLoS One. 2009;4:e4160.
44. Zhang Z, et al. Emerging role of exosomes in retinal
diseases. Front Cell Dev Biol. 2021;9:643680. https://
doi.org/10.3389/fcell.2021.643680.
A. V. Cioanca et al.
45. Grillo SL, et al. The extracellular vesicle marker,
Alix, co-localizes with Fibulin-3 puncta located in
human drusen deposits. Invest Ophthalmol Vis Sci.
2020;61:–2265.
46. Grillo SL, et al. Descriptive analysis of Fibulin-3
and the extracellular vesicle marker, Alix, in drusen
from a small cohort of postmortem human eyes. Exp
Eye Res. 2021;203:108422. https://doi.org/10.1016/j.
exer.2020.108422.
47. Liberzon A, et al. Molecular signatures database
(MSigDB) 3.0. Bioinformatics. 2011;27:1739–40.
https://doi.org/10.1093/bioinformatics/btr260.
48. Chen EY, et al. Enrichr: interactive and col-
laborative HTML5 gene list enrichment analy-
sis tool. BMC Bioinf. 2013;14:128. https://doi.
org/10.1186/1471-­2105-­14-­128.
49. Cioanca AV, et al. The role of melanocytes in the
human choroidal microenvironment and inflam-
mation: insights from the transcriptome. Pigment
Cell Melanoma Res. 2021;34:928–45. https://doi.
org/10.1111/pcmr.12972.
50. Zhou M, et al. Role of epithelial-mesenchymal transi-
tion in retinal pigment epithelium dysfunction. Front
Cell Dev Biol. 2020;8:501. https://doi.org/10.3389/
fcell.2020.00501.
 Part III
Gene Editing
 Prime Editing Strategy to Install
the PRPH2 c.828+1G>A Mutation

Salvatore Marco Caruso, Yi-Ting Tsai,

Bruna Lopes da Costa, Masha Kolesnikova,
Laura A. Jenny, Stephen H. Tsang,
and Peter M. J. Quinn

Abstract or absence of photoreceptor outer segments.

Mutations in peripherin 2 (PRPH2) are asso-
ciated with a spectrum of inherited retinal dis-
eases (IRDs) including retinitis pigmentosa
(RP) and macular degeneration. As PRPH2 is
localized to cone and rod outer segments,
mutations in PRPH2 lead the disorganization
Authors Salvatore Marco Caruso, Yi-Ting Tsai and Bruna
Lopes da Costa have equally contributed to this chapter.
Here, we report on a patient with PRPH2-­
linked RP who exhibited widespread RPE
atrophy with a central area of macular atrophy
sparing the fovea. In future studies, we plan to
model the pathobiology of PRPH2-based RP
using induced pluripotent stem cell (iPSC)-
derived retinal organoids. To effectively model
rare mutations using iPSC-derived retinal
organoids, we first require a strategy that can
install the desired mutation in healthy wild-­

Jonas Children’s Vision Care, and Bernard

S. M. Caruso · B. L. da Costa
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University,
New York, NY, USA
Y.-T. Tsai
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
M. Kolesnikova · L. A. Jenny · P. M. J. Quinn (*)
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
New York, NY, USA
& Shirlee Brown Glaucoma Laboratory,
Department of Ophthalmology,
Columbia University,
New York, NY, USA
e-mail: pq2138@cumc.columbia.edu
S. H. Tsang
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University,
New York, NY, USA
Columbia Stem Cell Initiative, Columbia University,
New York, NY, USA
Department of Pathology & Cell Biology, Columbia
University, New York, NY, USA
Institute of Human Nutrition, Columbia University,
New York, NY, USA

97
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_15
98
type iPSC, which can efficiently generate
well-laminated retinal organoids. In this study,
we developed an efficient prime editing strat-
egy for the installation of the pathogenic
PRPH2 c.828+1 G>A splice-site mutation
underlying our patient’s disease.
Keywords
Prime editing · iPSC · Disease modeling ·
PRPH2 · RDS
1 Introduction
Mutations in peripherin 2 (PRPH2), alternatively
known as RDS (retinal degeneration slow), lead
to a several inherited retinal diseases (IRDs)
including retinitis pigmentosa (RP) and macular
degeneration. PRPH2 is a membrane glycopro-
tein that localizes to cone and rod outer segments.
As such, mutations in PRPH2 lead the disorgani-
zation or absence of photoreceptor outer seg-
ments [2].
Prime editing is a novel double-strand break
(DSB)-independent clustered- regularly inter-
spaced short palindromic repeats (CRISPR)/
CRISPR-associated (Cas) system that can ame-
liorate both transition and transversion mutations
in addition to small deletions and insertions [1].
A prime editing guide RNA (pegRNA) is used in
conjunction with a prime editor consisting of the
H840A Streptococcus pyogenes Cas9 (spCas9)
nickase linked to an optimized Moloney murine
leukemia virus (MMLV) reverse transcriptase
(RT). The pegRNA contains a spacer, primer
binding sequence (PBS), and a RT template
(RTT) containing the desired edit. Together, the
engineered prime editor and the pegRNA form
the prime editing 2 strategy (PE2). In the PE3
strategy, an additional nicking single guide RNA
(nsgRNA) is used to nick the non-edited strand,
directing DNA repair to use the edited strand as a
template [1, 4].
In this study, we report the clinical evaluation
of a RP patient with a novel PRPH2 mutation
within the splicing donor of intron 2. Furthermore,
we develop an installation strategy for this muta-
tion using prime editing that paves the way for
S. M. Caruso et al.
our future work in modeling the pathobiology of
PRPH2-based RP using induced pluripotent stem
cell (iPSC)-derived retinal organoids.
2 Materials and Methods
2.1 Clinical Evaluation
One patient with a confirmed mutation in the
PRPH2 gene was examined at the Edward
S. Harkness Eye Institute at Columbia University
Medical Center (New York, NY). The study was
conducted under Columbia University
Institutional Review Board approval (protocol
IRB AAAF1849), and all procedures were per-
formed according to the tenets of the Declaration
of Helsinki. Informed consent was gathered
according to IRB AAAF1849. The patient’s best
corrected visual acuity was measured before
administration of topical tropicamide (1%) and
phenylephrine hydrochloride (2.5%) for dilation.
Near-infrared autofluorescence (NIR-AF)
(787 nm excitation, 830 nm emission, 30° × 30°)
was performed using a Spectralis HRA2
(Heidelberg Engineering, Heidelberg, Germany),
and wide-angle color fundus photography was
performed using an Optos 200Tx unit (Optos;
PLC, Dunfermline, United Kingdom). Lidocaine
was administered to a small region of the skin on
the lower back, and a biopsy punch (McKesson,
Virginia) was used to perform the skin biopsy.
2.2 Cloning and Plasmid
Constructs
A modified version of the Cas9 nickase-reverse
transcriptase plasmid (pCMV-PE2, Addgene
#132775) was used, pCMV-PE(V4), as previously
described [7]. The pegRNA was cloned into the
pU6-pegRNA-GG-Vector (Addgene, # 132777),
and nicking single guide RNA (nsgRNA) was
cloned into the pU6-spacer-­acceptor, both using
BsaI Golden Gate assembly (NEB), as described
previously [1, 6]. Oligos were ordered from
Integrated DNA Technologies (IDT): pU6-Sp-
pegRNA-PRPH2-828+1G>A-­sub. pegRNA
spacer; top strand oligonucleotide, 5′˗
Prime Editing Strategy to Install the PRPH2 c.828+1G>A Mutation
C A C C G C T C C T C AT T T G G C T C T-
TCGGTTTC˗3′; bottom strand oligonucleotide,
5 ′ ˗ C T C T G A A A C C -
GAAGAGCCAAATGAGGAGC˗3′; Installation,
3′-extenion; top strand oligonucleotide, 5′˗GTCC
AGGGCCTATCTCGAAGA-GCCAAATG˗3′;
bottom strand oligo-nucleotide, 5′˗AAAACA-
TTTGGCTCTTCGAGATAGGCCCT˗3′; pU6-
n s g R N A - P R P H 2 - 8 2 8 + 1 G > A -­s u b :
nsgRNA spacer, top strand oligonucleotide, 5′˗
CACCGCTGCTGT-AGTAGCTCAGCA˗3′; and
bottom strand oligonucleotide, 5′˗AAACTGC
TGAGCT-ACTACAGCAGC˗3′.
2.3 Cell Culture and Transfection
To test editing efficiency of the prime editing, the
plasmids were transfected into HEK293 cells.
The HEK293 cells were seeded 1 day before at
50000 cells/well in 24-well plates. On the next
day, the medium was refreshed with 500 ul com-
plete medium. For the transfection of PE3, the
plasmid constitution is 750 ng:250 ng:83 ng of
CMV-PE-V4: U6-pegRNA: U6-ngRNA. For
PE2, only CMV-PE-V4 and U6-pegRNA were
added. Lipofectamine 2000 (Thermo Fisher) was
mixed at 1:1 mass ratio with plasmid DNA. The
cells were then collected after 72 h post transfec-
tion for DNA extraction and analysis. To deter-
mine the time course of prime editing, the same
number of cells was seeded in 6-well plate
instead, and the same amount of plasmid DNA/
lipofectamine mixture was used to transfect the
cells. The cells were collected at 72 h, 168 h, and
240 h post transfection.
2.4 DNA Extraction
The cells were detached from the wells by tryp-
sin. The cells from each well were washed with
DPBS (without Ca2+ and Mg2+) and resuspended
with 50ul DPBS. The cells were then incubated
at 95 °C for 20 mins. Subsequently, after cooling,
4ul of 20 mg/ml proteinase K (Promega) was
added to each sample. The samples were then
99
incubated at 56 °C for 1 h followed by a 30 min
incubation at 95 °C to stop the proteinase K
digestion. This crude extract of DNA is then
ready for PCR purpose.
2.5 Analysis of Prime Editing
Efficiency
For the determination of editing efficiency, the
PRPH2 c.828+1 locus (Forward Primer, 5′-cac-
cagacggaggagctca-­3′; Reverse Primer,
5′-gagggaggcatgctctcca-3′) were amplified using
primers with Illumina adapters. The amplicon
was submitted to Genewiz for the Amplicon EZ
service. The analysis of the sequencing data was
determined using CRISPResso2 https://cris-
presso.pinellolab.partners.org/submission
(Fig. 2) or RGEN tools http://www.rgenome.net/
pe-­analyzer/#! (Fig. 3). The reads of the ampli-
cons less than 0.1% of the total frequency were
excluded for analysis.
3 Results and Discussion
Mutations in PRPH2 lead to a spectrum of IRDs
[2]. In this study, we identified a 67-year-old RP
patient with the splice site mutation c.828+1
G>A in PRPH2. Color fundus photographs of the
right and left eye demonstrated widespread RPE
atrophy with a central area of macular atrophy
sparing the fovea. There is sparse intraretinal pig-
ment migration OS > OD in the inferotemporal
periphery (Fig. 1a, b). Fundus autofluorescence
imaging of the right and left eye, respectively,
reveal scattered hypoautofluorescence atrophic
lesions OS > OD extending throughout the
periphery with relative sparing of the superior
retina (Fig. 1c, d).
Induced pluripotent stem cell (iPSC)-derived
retinal organoids are sensitive, quantitative, and
scalable phenotypic assays and have been used
to model several IRDs [5]. Prime editing, a
novel DSB-independent gene editing method
now affords us the flexibility to model rare
mutations using iPSC-derived retinal organoids
100
Fig. 1 Photoreceptor and RPE death in a 67-year-old RP
patient with PRPH2, c.828+1 G>A. Color fundus and
autofluorescence imaging of a patient with a single patho-
genic variant in PRPH2. (a, b) Color fundus photographs
of the right and left eye, respectively, demonstrate wide-
spread RPE atrophy with a central area of macular atrophy
Fig. 2 Prime editing strategy and next generation
sequencing results for PRPH2 c.828+1 G>A installation.
(a) Schematic detailing the native, healthy wild-type
genomic sequence and the prime editing strategy respon-
sible for generating the PRPH2 c.828+1 G>A disease
model in HEK293 cells. Directional protospacer
sequences, respective cut sites, and intended mutation are
annotated. Image from: “SnapGene software (from
Insightful Science; available at snapgene.com).” (b) NGS
S. M. Caruso et al.
sparing the fovea. There is sparse intraretinal pigment
migration OS > OD in the inferotemporal periphery. (c, d)
Fundus autofluorescence imaging of the right and left eye,
respectively, reveal scattered hypoautofluorescence atro-
phic lesions OS > OD extending throughout the periphery
with relative sparing of the superior retina
results generated from triple plasmid transfection of
HEK293 cells with PegRNA, PE machinery, and nsgRNA
plasmids. Reference sequence is the wild-type sequence,
green arrow points to the precise edited sequence; bold
lettering indicates substitution, red boxes indicate random
insertions. Results indicate successful installation, which
was then selected for to establish isolated disease model.
Images from CRISPResso2 analysis [3]
Prime Editing Strategy to Install the PRPH2 c.828+1G>A Mutation
Fig. 3 Evaluation of PE2 VS PE3 systems for PRPH2
c.828+1 G>A installation. To evaluate the long-term edit-
ing efficiency for the PRPH2 c.828+1 G>A installation,
we performed two transfections in parallel on health
HEK293 cells: a PE2 strategy using only the PE machin-
for all types of point mutations and has already
been used to develop installation and correction
strategies for IRD-related mutations [1, 4, 6, 7].
We developed a PE3 strategy for the installa-
tion of the c.828+1 G>A in PRPH2 mutation,
finding efficient editing of 45.96% in HEK293
cells (Fig. 2a, b). Further, we compared a PE2
vs PE3 strategy for the installation of the
c.828+1 G>A in PRPH2 mutation over 10 days
(Fig. 3a, b). We hypothesized that a PE2 strat-
egy may produce a comparable editing effi-
ciency to a PE3 strategy if expressed long
enough. However, over the three time points
analyzed, the PE3 strategy was always more
efficient than PE2.
101
ery and pegRNA, a PE3 strategy using identical plasmids
to PE2, and an additional nsgRNA plasmid. Time course
results are shown below on days 3, 7, and 10 (a). Results
and calculations are summarized in adjacent table (b)
This study forms the basis of our future work
to investigate the pathobiology of PRPH2-based
RP using induced pluripotent stem cell (iPSC)-
derived retinal organoids and to develop
prime editing-based therapeutics for their
amelioration.
Acknowledgments SHT and The Jonas Children’s
Vision Care and Bernard & Shirlee Brown Glaucoma
Laboratory are supported by the National Institutes of
Health [P30EY019007, R01EY018213, R01EY024698,
R01EY026682, R24EY027285, U01EY030580],
National Cancer Institute Core [5P30CA013696],
Foundation Fighting Blindness [TA-NMT-0116-0692-
COLU], the Research to Prevent Blindness (RPB)
Physician-Scientist Award. BLD is a recipient of the
102
Capes PhD scholarship. PMJQ is the current recipient of a
Curing Retinal Blindness Foundation (CRBF) grant, a
Knights Templar Eye Foundation (KTEF) Career Starter
grant, an Uplifting Athletes Young Investigator grant, and
a New York Stem Cell Foundation (NYSCF) –
Druckenmiller Fellowship.
Conflict of Interest Stephen H. Tsang receives finan-
cial support from Abeona Therapeutics, Inc. and Emendo.
He is also the founder of Rejuvitas and is on the scientific
and clinical advisory board for Nanoscope Therapeutics.
References
1. Anzalone AV, Randolph PB, Davis JR, Sousa AA,
Koblan LW, Levy JM, Chen PJ, Wilson C, Newby
GA, Raguram A, Liu DR. Search-and-replace genome
editing without double-strand breaks or donor
DNA. Nature. 2019;576:149–57.
2. Boon CJF, den Hollander AI, Hoyng CB, Cremers
FPM, Klevering BJ, Keunen JEE. The spectrum of
S. M. Caruso et al.
retinal dystrophies caused by mutations in the periph-
erin/RDS gene. Prog Retin Eye Res. 2008;27:213–35.
3. Clement K, Rees H, Canver MC, Gehrke JM, Farouni
R, Hsu JY, Cole MA, Liu DR, Joung JK, Bauer DE,
Pinello L. CRISPResso2 provides accurate and rapid
genome editing sequence analysis. Nat Biotechnol.
2019;37:224–6.
4. Costa BLD, Levi SR, Eulau E, Tsai YT, Quinn
PMJ. Prime editing for inherited retinal diseases.
Front Genome Ed. 2021;3:775330.
5. Manafi N, Shokri F, Achberger K, Hirayama M,
Mohammadi MH, Noorizadeh F, Hong J, Liebau S,
Tsuji T, Quinn PMJ, Mashaghi A. Organoids and
organ chips in ophthalmology. Ocul Surf. 2020;19:1–
15. Available at: http://www.ncbi.nlm.nih.gov/
pubmed/33220469
6. Tsai YT, Costa BLD, Nolan ND, Caruso SM, Tsang
SH, Quinn PMJ. Prime editing for the installation
and correction of mutations causing inherited reti-
nal disease: a brief methodology. Methods Mol Biol.
2021;2560:313–31.
7. Tsai YT, Costa BLD, Caruso SM, Nolan ND, Levi
SR, Tsang SH, Quinn PMJ. Generation of an Avian
Myeloblastosis Virus (AMV) reverse transcriptase
prime editor. Adv Exp Med Biol. 2022;
 Analysis of CRB1 Pathogenic
Variants Correctable with CRISPR
Base and Prime Editing

Bruna Lopes da Costa, Laura A. Jenny,

Irene H. Maumenee, Stephen H. Tsang,
and Peter M. J. Quinn

Abstract we carried out an analysis of the Leiden Open

The mouse and human retina contain three
major Crumbs homologue-1 (CRB1) iso-
forms. CRB1-A and CRB1-B have cell-type-
specific expression patterns making the choice
of gene augmentation strategy unclear. Gene
editing may be a viable alternative for the
amelioration of CRB1-associated retinal
degenerations. To assess the prevalence and
spectrum of CRB1-associated pathogenic
variants amenable to base and prime editing,
Variation Database. Editable variants
accounted for 54.5% for base editing and
99.8% for prime editing of all CRB1 patho-
genic variants in the Leiden Open Variation
Database. The 10 most common editable
pathogenic variants for CRB1 accounted for
34.95% of all pathogenic variants, with the
c.2843G>A, p.(Cys948Tyr) being the most
common editable CRB1 variant. These find-
ings outline the next step toward developing
base and prime editing therapeutics as an

B. L. da Costa
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital, New York,
NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University, New York, NY,
USA
L. A. Jenny · I. H. Maumenee · P. M. J. Quinn (*)
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital, New York,
NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University, New York, NY,
USA
e-mail: pq2138@cumc.columbia.edu
S. H. Tsang
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital, New York,
NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University, New York, NY,
USA
Columbia Stem Cell Initiative, Columbia University,
New York, NY, USA
Department of Pathology & Cell Biology, Columbia
University, New York, NY, USA
Institute of Human Nutrition, Columbia University,
New York, NY, USA

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 103
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_16
104
alternative to gene augmentation for the ame-
lioration of CRB1-associated retinal
degenerations.
Keywords
Crumbs-homologue-1 (CRB1) · Prime editing
· Base editing · Retinitis pigmentosa (RP) ·
Leber congenital amaurosis (LCA)
1 Introduction
Mutations in the Crumbs homologue-1 (CRB1)
gene lead to a diverse spectrum of autosomal
recessive retinal diseases including retinitis pig-
mentosa type 12 (RP12) and leber congenital
amaurosis type 8 (LCA8), as well as an increas-
ing number of juvenile macular dystrophy cases
[16, 17]. LCA8 leads to blindness from near
birth, and RP12 leads to progressive loss of visual
field in early childhood [16]. Approximately
80,000 CRB1 patients are affected worldwide,
with a prevalence in the United States of 1 in
86,500 [15, 16]. At present, there is no treatment
for CRB1-mediated retinal degenerations; how-
ever, recent developments have identified a gene
augmentation approach using CRB2 that have
successfully demonstrated proof of concept for
AAV-mediated gene augmentation in mice [10].
Similar studies packaging the CRB1 isoform,
CRB1-A, for gene augmentation in mice pro-
vides some morphological but no functional ben-
efits in addition to a number of adverse effects
potentially due to ectopic or overexpression and
immunogenic properties of human CRB1 pro-
teins in Crb mouse models [2, 10]. Additionally,
no rescue has been found when delivering either
CRB1-A or CRB2 AAV-mediated gene therapy
to CRB1 mutant rats which have a severe early-
onset retinal phenotype [1].
Until recently, the role of CRB1 in retinal
development and disease was focused on the
canonical CRB1 isoform, CRB1-A. However,
new research from the Kay lab has identified
three abundantly expressed CRB1 isoforms in
mouse and human retina: CRB1-A, CRB1-C, and
B. L. da Costa et al.
the newly identified CRB1-B, which has dis-
played disease-relevant functions in mice [14].
Canonically, CRB proteins localize adjacent to
adherens junctions and are essential in maintain-
ing their stability in photoreceptors (PRC) and
Müller glial cells (MGC) [9, 11–13]. While
CRB1-B and CRB1-C isoforms share significant
extracellular domain overlap with CRB1-A,
CRB1-B has unique 5′ and 3′ domains, and
CRB1-C has a unique 3′ domain and is predicted
to be a secreted protein. In the mouse, CRB1-A
and CRB1-B predominately operate in different
cell types (MGC and PRC, respectively) [14].
Recently, Fry et al. highlighted the applicabil-
ity of base editing for the correction of patho-
genic mutations in large genes which cause
inherited retinal dystrophies (IRDs) that are not
amenable to a conventional AAV-mediated gene
augmentation strategy [6]. In particular, double-
strand break-independent clustered-regularly
interspaced short palindromic repeats (CRISPR)/
CRISPR-associated (Cas) systems are a promis-
ing avenue for the treatment of IRDs [5]. In this
study, due to the evolving complexity of CRB1
retinal isoform diversity [14], we sought to
ascertain the potential therapeutic potential of
base and prime editing strategies for CRB1
patients.
2 Materials and Methods
CRB1 variants included in the publicly available
LOVD database, 3.0, were downloaded on March
7, 2021. As such, research ethics committee
review was not required for this study. The CRB1
LOVD records were cleaned and coded for patho-
genicity and variational consequence. Variants
that were benign and likely benign were excluded.
For instances in which variant pathogenicity was
not annotated, was annotated as a variant of
unknown significance, or was obviously misla-
beled (silent mutation listed as likely pathogenic),
we reviewed the variant using the ClinVar data-
base, Poly Phen2 web tool, and literature sources,
and we excluded the variant from analysis if its
pathogenicity could not be determined to yield a
Analysis of CRB1 Pathogenic Variants Correctable with CRISPR Base and Prime Editing
final data set of pathogenic and likely pathogenic
variants. Each variant was categorized by
expected variant consequence into termination,
missense, synonymous, intronic, splice, inser-
tion/duplication/deletion/complex, or unknown.
Termination was defined as a single-nucleotide
variant (SNV) generating a stop codon. Splice
was defined as a variant disrupting a canonical
splice donor (+1 and +2) or acceptor (−2 and −1)
site. Intronic was defined as a variant occurring
between the intronic +3 to −3 positions. Complex
mutations comprised deletion/insertions. Data
were analyzed using Excel (Microsoft Corp) and
Prism, version 8 (GraphPad). Data were reported
as descriptive statistics.
3 Results and Discussion
To determine the prevalence of alleles with edit-
able CRB1 pathogenic variants, we analyzed data
from the LOVD database. Of the 1335 alleles,
1259 pathogenic or likely pathogenic alleles
remained after excluding those which were
benign, likely benign or variants of uncertain sig-
nificance (Fig. 1). We then determined the edit-
ability of these variants based on the limitations
of base editing (only transition mutations) and
Fig. 1 Distribution of CRB1 pathogenic alleles from the
CRB1 Leiden open Variation Database. Analysis of 1259
individual pathogenic or likely pathogenic CRB1 alleles
in the Leiden Open Variation Database. The most preva-
lent mutation types include G>A (28.4%), C>T(12.6%),
T>C (11.5%), and deletions (12.2%)
105
prime editing (transitions, transversions, small
insertions (1–40 bp) and deletions (1–80 bp)).
Editable transition and transversion mutations
made up 54.5% and 29.6% of alleles with patho-
genic variants, respectively. The remaining
15.9% consisted of insertions, deletions, duplica-
tions, and complex mutations comprising dele-
tion/insertions. Of these, prime editing is
theoretically capable of correcting all but 0.2% of
pathogenic alleles, which consisted of large dele-
tions or duplications. This allows prime editing to
correct 99.8% and base editing 54.5% of all
pathogenic CRB1 alleles in this study. Editable
variants G>A (28.4%), C>T (12.6%), T>C
(11.5%), and deletions (12.2%) were the most
prevalent types (Fig. 1).
The c.2843G>A, p.(Cys948Tyr) was the most
common editable CRB1 variant accounting for
13.7% of all pathogenic alleles (Table 1). This
concurs with previous studies which also high-
lighted c.2843G>A, p.(Cys948Tyr) as the most
frequent CRB1 variant [3, 7]. The 10 most com-
mon CRB1 variants accounted for 34.9% of all
pathogenic alleles (Table 1). Missense variants
were the predominant editable variants observed
in the CRB1 gene (64.8%) followed by termina-
tion (define as SNVs that are associated with in-
frame codons being altered to stop codons)
(16.5%) and deletion variants (12.2%) (Fig. 2).
Duplication, splice, intronic, insertion, and com-
plex variants made up the remaining 6.5%.
This study highlights that both base and prime
editing are potential alternatives to gene augmen-
tation for the treatment of CRB1-inherited retinal
diseases, particularly to circumvent the evolving
complexity of CRB1 retinal isoform diversity
[14]. Recent developments that further improve
prime editing efficiency by incorporating struc-
tured RNA motifs to the 3′ terminus of pegRNAs,
preventing degradation of the 3′ extension, or by
modifying the 3′ extension to install silent muta-
tions in addition to the target mutation at the tar-
get site that help evade mismatch repair
mechanisms will only further advance progress
[4, 8]. Lastly, this study shows that the
c.2843G>A, p.(Cys948Tyr) mutation is the most
common editable CRB1 variant and should be the
focus of future therapy development.
106 B. L. da Costa et al.

Table 1 The 10 most frequent CRB1 pathogenic variants in the Leiden Open Variation Database
cDNA change Protein change Alleles (n) Proportion of pathogenic alleles (%)
LOVD 1 c.2843G>A p.(Cys948Tyr) 172 13.66
2 c.2401A>T p.(Lys801*) 50 3.97
3 c.2234C>T p.(Thr745Met) 47 3.73
4 c.2290C>T p.(Arg764Cys) 39 3.10
5 c.2688T>A p.(Cys896*) 29 2.30
6 c.613_619del p.(Ile205Aspfs*13) 27 2.14
7 c.498_506del p.(Ile167_Gly169del) 22 1.75
8 c.3307G>A p.(Gly1103Arg) 20 1.59
9 c.4121_4130del p.(Ala1374Glufs*20) 17 1.35
10 c.1148G>A p.(Cys383Tyr) 17 1.35
Total 440 34.95

Fig. 2 CRB1 editable alleles by variation consequence
from the CRB1 Leiden Open Variation Database.
Missense, termination, and deletion represent the predom-
inant editable CRB1 variants
Acknowledgments SHT and The Jonas Children’s
Vision Care and Bernard & Shirlee Brown Glaucoma
Laboratory are supported by the National Institutes of
Health [P30EY019007, R01EY018213, R01EY024698,
R01EY026682, R24EY027285, U01EY030580],
National Cancer Institute Core [5P30CA013696],
Foundation Fighting Blindness [TA-NMT-0116-0692-
COLU], the Research to Prevent Blindness (RPB)
Physician-Scientist Award. BLD is a recipient of the
Capes PhD scholarship. PMJQ is the current recipient of a
Curing Retinal Blindness Foundation (CRBF) grant, a
Knights Templar Eye Foundation (KTEF) Career Starter
grant, an Uplifting Athletes Young Investigator grant, and
a New York Stem Cell Foundation (NYSCF) –
Druckenmiller Fellowship.
Conflict of Interest Stephen H. Tsang receives financial
support from Abeona Therapeutics, Inc. and Emendo. He
is also the founder of Rejuvitas and is on the scientific and
clinical advisory board for Nanoscope Therapeutics.
References
1. Boon N, Alves CH, Mulder AA, Andriessen CA,
Buck TM, Quinn PMJ, Vos RM, Koster AJ, Jost
CR, Wijnholds J. Defining phenotype, tropism, and
retinal gene therapy using Adeno-Associated Viral
Vectors (AAVs) in new-born brown Norway rats
with a spontaneous mutation in Crb1. Int J Mol Sci.
2021;22:1–27.
2. Buck TM, Vos RM, Alves CH, Wijnholds J. AAV-
CRB2 protects against vision loss in an inducible
CRB1 retinitis pigmentosa mouse model. Mol Ther –
Methods Clin Dev, vol. 20; 2020. p. 423.
3. Bujakowska K, Audo I, Mohand-Säid S, Lancelot
ME, Antonio A, Germain A, Eveillard TĹ, Ḿelanie
L, Saraiva JP, Lonjou C, Carpentier W, Sahel JA,
Bhattacharya SS, Zeitz C. CRB1 mutations in inher-
ited retinal dystrophies. Hum Mutat. 2012;33:306–15.
4. Chen PJ, Hussmann JA, Yan J, Knipping F, Ravisankar
P, Chen P-F, Chen C, Nelson JW, Newby GA, Sahin
M, Osborn MJ, Weissman JS, Adamson B, Liu
DR. Enhanced prime editing systems by manipulat-
ing cellular determinants of editing outcomes. Cell.
2021;184:1–18.
5. Costa BLD, Levi SR, Eulau E, Tsai YT, Quinn
PMJ. Prime editing for inherited retinal diseases.
Front Genome Ed. 2021;3:775330.
6. Fry LE, McClements ME, Maclaren RE. Analysis of
pathogenic variants correctable with CRISPR Base
editing among patients with recessive inherited retinal
degeneration. JAMA Ophthalmol. 2021;139:319–28.
7. Motta FL, Salles MV, Costa KA, Filippelli-Silva R,
Martin RP, Sallum JMF. The correlation between
CRB1 variants and the clinical severity of Brazilian
patients with different inherited retinal dystrophy phe-
notypes. Sci Rep. 2017;7:8654.
8. Nelson JW, Randolph PB, Shen SP, Everette KA, Chen
PJ, Anzalone AV, An M, Newby GA, Chen JC, Hsu A,
Liu DR. Engineered pegRNAs improve prime editing
efficiency. Nat Biotechnol. 2021;40(3):402–10.
9. Pellissier LP, Alves CH, Quinn PM, Vos RM,
Tanimoto N, Lundvig DMS, Dudok JJ, Hooibrink B,
Analysis of CRB1 Pathogenic Variants Correctable with CRISPR Base and Prime Editing
Richard F, Beck SC, Huber G, Sothilingam V, Garcia
Garrido M, Le Bivic A, Seeliger MW, Wijnholds
J. Targeted ablation of CRB1 and CRB2 in retinal
progenitor cells mimics Leber congenital amaurosis.
PLoS Genet. 2013;9:e1003976.
10. Pellissier LP, Quinn PM, Alves CH, Vos RM,
Klooster J, Flannery JG, Heimel JA, Wijnholds
J. Gene therapy into photoreceptors and Müller glial
cells restores retinal structure and function in CRB1
retinitis pigmentosa mouse models. Hum Mol Genet.
2015;24:3104–18.
11. Quinn PM, Alves CH, Klooster J, Wijnholds
J. CRB2 in immature photoreceptors determines the
superior-inferior symmetry of the developing retina
to maintain retinal structure and function. Hum Mol
Genet. 2018;27:3137–53.
12. Quinn PM, Buck TM, Mulder AA, Ohonin C, Alves
CH, Vos RM, Bialecka M, van Herwaarden T, van
Dijk EHC, Talib M, Freund C, Mikkers HMM,
Hoeben RC, Goumans M-J, Boon CJF, Koster AJ,
Chuva de Sousa Lopes SM, Jost CR, Wijnholds
J. Human iPSC-derived retinas recapitulate the fetal
CRB1 CRB2 complex formation and demonstrate that
photoreceptors and Müller Glia are targets of AAV5.
Stem Cell Rep. 2019a;12:906–19.
13. Quinn PM, Mulder AA, Henrique Alves C,
Desrosiers M, de Vries SI, Klooster J, Dalkara D,
107
Koster AJ, Jost CR, Wijnholds J. Loss of CRB2 in
Müller glial cells modifies a CRB1-associated
retinitis pigmentosa phenotype into a Leber con-
genital amaurosis phenotype. Hum Mol Genet.
2019b;28:105–23.
14. Ray TA, et al. Comprehensive identification of mRNA
isoforms reveals the diversity of neural cell-surface
molecules with roles in retinal development and dis-
ease. Nat Commun. 2020;11:3328.
15. Stone EM, Andorf JL, Whitmore SS, DeLuca AP,
Giacalone JC, Streb LM, Braun TA, Mullins RF,
Scheetz TE, Sheffield VC, Tucker BA. Clinically
focused molecular investigation of 1000 con-
secutive families with inherited retinal disease.
Ophthalmology. 2017;124:1314–31.
16. Talib M, van Schooneveld MJ, van Genderen MM,
Wijnholds J, Florijn RJ, ten Brink JB, Schalij-
Delfos NE, Dagnelie G, Cremers FPM, Wolterbeek
R, Fiocco M, Thiadens AA, Hoyng CB, Klaver CC,
Bergen AA, Boon CJF. Genotypic and phenotypic
characteristics of CRB1-associated retinal dystro-
phies: a long-term follow-up study. Ophthalmology.
2017;124:884–95.
17. Tsang SH, Burke T, Oll M, Yzer S, Lee W, Xie YA,
Allikmets R. Whole exome sequencing identifies
CRB1 defect in an unusual maculopathy phenotype.
Ophthalmology. 2014;121:1773–82.
 Generation of an Avian
Myeloblastosis Virus (AMV)
Reverse Transcriptase Prime Editor

Yi-Ting Tsai, Bruna Lopes da Costa,

Salvatore Marco Caruso, Nicolas D. Nolan,
Sarah R. Levi, Stephen H. Tsang,
and Peter M. J. Quinn

Abstract nology that represents an exciting avenue for

the treatment of inherited retinal diseases
Prime editing (PE) is a novel, double-strand (IRDs). Given the extensive and heterogenous
break (DSB)-independent gene editing tech- nature of the 280 genes associated with IRDs,

Authors Bruna Lopes da Costa, Salvatore Caruso and

Nicolas D Nolan have equally contributed to this chapter.

Y.-T. Tsai S. R. Levi · P. M. J. Quinn (*)

Department of Biomedical Engineering, Columbia Edward S. Harkness Eye Institute, Department of
University, New York, NY, USA Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
B. L. da Costa
New York, NY, USA
Department of Biomedical Engineering, Columbia
University, New York, NY, USA Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University,
Ophthalmology, Columbia University Irving Medical
New York, NY, USA
Center/New York-Presbyterian Hospital,
e-mail: pq2138@cumc.columbia.edu
New York, NY, USA
S. H. Tsang
Jonas Children’s Vision Care, and Bernard & Shirlee
Department of Biomedical Engineering, Columbia
Brown Glaucoma Laboratory, Department of
University, New York, NY, USA
Ophthalmology, Columbia University,
New York, NY, USA Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
S. M. Caruso · N. D. Nolan
Center/New York-Presbyterian Hospital,
Department of Biomedical Engineering, Columbia
New York, NY, USA
University, New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Edward S. Harkness Eye Institute, Department of
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University Irving Medical
Ophthalmology, Columbia University,
Center/New York-Presbyterian Hospital,
New York, NY, USA
New York, NY, USA
Columbia Stem Cell Initiative, Columbia University,
Jonas Children’s Vision Care, and Bernard & Shirlee
New York, NY, USA
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University, Department of Pathology & Cell Biology, Columbia
New York, NY, USA University, New York, NY, USA
Columbia Stem Cell Initiative, Columbia University, Institute of Human Nutrition, Columbia University,
New York, NY, USA New York, NY, USA

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 109
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_17
110
genome editing has presented countless com-
plications. However, recent advances in
genome editing technologies have identified
PE to have tremendous potential, with the
capability to ameliorate small deletions and
insertions in addition to all twelve possible
transition and transversion mutations. The
current PE system is based on the fusion of the
Streptococcus pyogenes Cas9 (SpCas9) nick-
ase H840A mutant and an optimized Moloney
murine leukemia virus (MMLV) reverse-­
transcriptase (RT) in conjunction with a PE
guide RNA (pegRNA). In this study, we devel-
oped a prime editor based on the avian myelo-
blastosis virus (AMV)-RT and showed its
applicability for the installation of the PRPH2
c.828+1G>A mutation in HEK293 cells.
Keywords
Prime editing · Avian myeloblastosis virus
(AMV) · PRPH2 · Retinitis pigmentosa (RP)
· AMV-RT prime editors
1 Introduction
Prime editing (PE), a double-strand break (DSB)-
independent, “search-and-replace” gene editing
approach, has the unique capacity to install all
types of transition and transversion mutations in
addition to amelioration of small insertions and
deletions (indels) [1]. The process of PE requires
a prime editor, a fusion of the Streptococcus pyo-
Fig. 1 Schematic of AMV-RT prime editors. The
AMV-RT is a heterodimer consisting of a α- and β- sub-
units, unlike the MMLV-RT, which is a monomer. In this
study, we fused the SpCas9 nickase H840A to either the
α- or β-subunit of the wild-type AMV-RT using a flexible
Y.-T. Tsai et al.
genes Cas9 (SpCas9) nickase H840A mutant and
an optimized Moloney murine leukemia virus
(MMLV) reverse-transcriptase (RT), in conjuga-
tion with a PE guide RNA (pegRNA). The
pegRNA is comprised of a spacer, scaffold,
primer binding sequence (PBS) and a RT tem-
plate (RTT) which includes the chosen edit [1].
The flexibility, specificity, and efficacy of PE
makes it an exciting tool for the treatment of the
280 gene mutations associated with inherited
retinal diseases (IRDs) [5, 8].
To date, no other RT has been used to facilitate
PE in mammalian cells besides the
MMLV-RT. The avian myeloblastosis virus
(AMV)-RT is a heterodimer consisting of a
63-kDa α-subunit and 95-kDa β-subunit unlike
MMLV-RT, which is a 75 kDa monomer. The α-
subunit and β-subunit both comprise of poly-
merase and RNase H domains, but the β-subunit
additionally contains a C-terminal integrase
domain. However, MMLV-RT only contains the
same domains as the α-subunit of the
AMV-RT. Additionally, AMV-RT retains more
DNA synthetic activity at elevated temperatures,
possess a higher intrinsic RNase H activity, and is
more processive than MMLV-RT [2, 6, 9].
In this study, we fused the SpCas9 nickase
H840A to either the α- or β-subunit and expressed
the complementary subunit in tandem using a
P2A linker, forming Cas9(H840A)–AMV-RT(α-­
P2A-­β) or Cas9(H840A)–AMV-RT(β-P2A-α)
prime editors, respectively (Fig. 1). Similar edit-
ing efficiencies were found in HEK293 cells
using both editors for the +1 CTT insertion at
linker, and we also expressed the complementary subunit
in tandem using a P2A linker. We compare our version 1
AMV-RT-based prime editors Cas9(H840A)–AMV-­
RT(α-P2A-β) and Cas9(H840A)–AMV-RT(β-P2A-α) to
the current state-of-the-art Cas9(H840A)-MMLV-RT
Generation of an Avian Myeloblastosis Virus (AMV) Reverse Transcriptase Prime Editor 111

HEK3 and for the installation the PRPH2
c.828+1G>A mutation. Together, our results
highlight the applicability of AMV-RT-based
prime editors, setting a platform for improving
their efficiency by incorporating mutations that
may increase their thermostability, processivity,
and DNA-RNA substrate affinity.
plete medium. For the transfection of PE3, the
plasmid constitution is 750ng:250ng:83ng of
C M V - P E - V 4 : U 6 - p e g R N A : U 6 -­
ngRNA. Lipofectamine 2000 (Thermo Fisher)
was mixed at 1:1 ratio to the plasmid DNA. The
cells were then collected after 72 h post transfec-
tion for DNA extraction and analysis.

2 Materials and Methods 2.3 DNA Extraction

2.1 Cloning and Plasmid To extract DNA from cells, the cells were
Constructs detached from the wells by trypsin. The cells
from each well were washed with DPBS (without
The original optimized Cas9 nickase-reverse Ca2+ and Mg2+) and resuspended with 50 μl
transcriptase plasmid (pCMV-PE2, Addgene DPBS. The cells were then incubated at 95 °C for
#132775) was modified to create pCMV-PE(V4) 20 mins. Subsequently, after cooling, 4 μl of
using In-Fusion (Takara Bio) cloning by adding 20 mg/ml proteinase K (Promega) was added to
SwaI and SmaI restriction enzyme sites, eGFP each sample. The samples were then incubated at
driven by PGK promoter, and a modified GSSG 56 °C for 1 h followed by a 30-min incubation at
flexible linker sequence between the MMLV-RT 95 °C to stop the proteinase K digestion. This
and the Cas9(H840A) nickase. Subsequently, we crude extract of DNA is then ready for poly-
ordered by gBlock Gene Fragments (Integrated merase chain reaction (PCR) purpose.
DNA Technologies (IDT)) the Alpha and Beta
domains of the AMV-RT and used In-Fusion
cloning (Takara Bio) to replace the MMLV-RT 2.4 Analysis of Prime Editing
from pCMV-PE(V4) to create CMVp-­ Efficiency
Cas9(H840A)–AMV-RT(α-P2A-β) and CMVp-­
Cas9(H840A)–AMV-RT(β-P2A-α) version 1 For the determination of editing efficiency, the
prime editors. We used the previously published PRPH2 c.828+1 locus (Forward Primer, 5′-cac-
pU6-Sp-pegRNA-HEK3_CTT_ins (Addgene, # cagacggaggagctca-­3′; Reverse Primer,
132778) [1], with 5′- ggcccagactgagcacgtga-3′ as 5′-gagggaggcatgctctcca-3′) or +1 CTT insertion
the spacer and 5′-tctgccatcaaagcgtgctcagtctg-3′ at HEK3 locus (Forward Primer, 5′-atgtgggct-
as the 3′-extension sequence) and the pU6- gcctagaaagg-­3′; Reverse Primer, 5′-gcccagc-
Sp-­pegRNA-PRPH2-828+1G>A-sub [3]. caaacttgtcaacc-­3′) were amplified using primers
Corresponding nsgRNA (e.g., for HEK3, with Illumina adaptors. The amplicon was sub-
5′-gtcaaccagtatcccggtgc-3′ as the spacer) were mitted to Genewiz for the Amplicon EZ service.
cloned into the pU6-spacer-acceptor, using BsaI The analysis of the sequencing data was deter-
Golden Gate assembly (NEB), as previously mined using CRISPResso2 https://crispresso.
described [1, 3, 8]. pinellolab.partners.org/submission. The reads of
the amplicons less than 1% of the total frequency
were excluded for visualization.
2.2 Cell Culture and Transfection

To test editing efficiency of the PE system, the 3 Results

plasmids were transfected into HEK293 cells.
The HEK293 cells were seeded 1 day before at In this study, we fused the SpCas9 nickase
50,000 cells/well in 24-well plates. On the next H840A to either the α- or β-subunit of the wild-­
day, the medium was refreshed with 500 μl com- type AMV-RT using a flexible linker and
112
expressed the complementary subunit in tandem
using a P2A linker. We first compared our version
1 wild-type AMV-RT-based prime editors
Cas9(H840A)–AMV-RT(α-P2A-β) and
Cas9(H840A)–AMV-RT(β-P2A-α) to the current
state of the art Cas9(H840A)-MMLV-RT for
incorporating the +1 CTT insertion at the HEK3
locus in HEK293 cells (Fig. 2). All experiments
were done using a PE3 methodology, whereby an
additional nicking single-guide RNA (nsgRNA)
is incorporated to nick the non-edited strand,
directing DNA repair to use the edited strand as a
template [1]. PE efficiency was highest using the
MMLV-RT-based prime editor, 37.15%, com-
pared to 8.03% and 3.66% for the version 1 wild-­
type AMV-RT(α-P2A-β) and AMV-RT(β-P2A-α)
prime editors, respectively. We recently also
designed a PE strategy for the installation of the
PRPH2 c.828+1G>A mutation [3]. To further
test the applicability of our version 1 AMV-RT-­
Fig. 2 Installation of +1 CTT insertion at HEK3 using an
AMV-RT prime editor. Next-generation sequencing
results comparing the +1 CTT insertion at HEK3 locus in
bulk HEK293 cells with the optimized Cas9(H840A)-
MMLV-RT (a) against the version 1 AMV-based prime
Y.-T. Tsai et al.
based prime editors, we again compared them to
the MMLV-RT-based prime editor. PE efficiency
was highest using the MMLV-RT-based prime
editor, 43.66%, compared to 2.02% and 1.62%
for the version 1 wild-type AMV-RT(α-P2A-β)
and AMV-RT(β-P2A-α) prime editors, respec-
tively (Fig. 3). Together, this data demonstrates
the potential of using an alternative reverse tran-
scriptase for PE and sets a platform for improv-
ing AMV-RT-based prime editors.
4 Discussion
In this study, we showed that both of our version
1 wild-type AMV-RT-based prime editors could
successfully introduce the specified edits but
with limited efficiency compared to the engi-
neered MMLV-RT-based prime editor 2 (PE2)
[1]. Previously, with PE1, Anzalone et al. used
editors Cas9(H840A)–AMV-RT(α-P2A-β) (b) and
CMVp-Cas9(H840A)–AMV-RT(β-P2A-α) (c). Green
arrows point to the precise edited sequence, and the red
box indicates CTT insertion. (Images from CRISPResso2
analysis [4])
Generation of an Avian Myeloblastosis Virus (AMV) Reverse Transcriptase Prime Editor
Fig. 3 Installation of PRPH2 c.828+1G>A mutations
using an AMV-RT prime editor. Next-generation sequenc-
ing results comparing the installation of the PRPH2
c.828+1G>A mutation in bulk HEK293 cells with the
optimized Cas9(H840A)-MMLV-RT (a) against the ver-
sion 1 AMV-based prime editors Cas9(H840A)–AMV-­
the wild-type MMLV-RT but, subsequently,
after proof-of-concept, engineered the wild-
type MMLV-RT to make PE2 by introducing
mutations that would increase the thermostabil-
ity, processivity, and DNA-RNA substrate affin-
ity of the RT. This led to substantial
improvements in prime editing efficiency at the
five genomic sites analyzed. For the +1 CTT
insertion at the HEK3 locus, this caused an
improvement from approximately 16% with
PE1 to 28% with PE2 in Hek293 cells. All the
experiments we carried out in this study were
done using a prime editing 3 methodology,
where an additional nsgRNA is incorporated to
nick the non-edited strand, directing DNA repair
to use the edited strand as a template [1]. For the
+1 CTT insertion at the HEK3 locus using PE3,
Anzalone et al. could get upwards of approxi-
mately 70% editing efficiency; we got a more
modest 37.15% under the conditions we used
with our slightly modified PE2 vector. By con-
trast, we got editing efficiencies of 8.03% and
3.66% for the version 1 wild-type AMV-RT(α-
P2A-β) and AMV-RT(β-­P2A-­α) prime editors,
respectively. Although no clear and direct com-
parison was carried out, the presumed reduced
editing efficiency from our version 1 wild-type
113
RT(α-P2A-β) (b)
and CMVp-Cas9(H840A)–AMV-RT(β-P2A-α) (c). Green
arrows point to the precise edited sequence; bold lettering
indicates substitution. (Images from CRISPResso2 analy-
sis [4])
AMV-RT-based prime editors to PE1 may be
due to the higher RNase H activity exhibited by
AMV-RT than MMLV-RT [2]. Future studies,
which directly compare the MMLV-RT-
engineered PE2 alongside an engineered
AMV-RT based prime editor, are required to see
the true potential of AMV-RT-based prime edi-
tors. Similarly to MMLV-RT, mutations for
AMV-RT have been identified to increase its
thermostability and to inactivate its RNase H
activity [6, 7]. Further, due to the intrinsic dif-
ferences between MMLV-RT and AMV-RT,
prime editors, based on the latter, may have dif-
ferent constraints to be optimized and explored
(i.e., the editing window possible for indels may
be different).
Acknowledgments SHT and the Jonas Children’s Vision
Care and Bernard & Shirlee Brown Glaucoma Laboratory
are supported by the National Institutes of Health
[P30EY019007, R01EY018213, R01EY024698,
R01EY026682, R24EY027285, U01EY030580],
National Cancer Institute Core [5P30CA013696],
Foundation Fighting Blindness [TA-NMT-0116-0692-
COLU], the Research to Prevent Blindness (RPB)
Physician-Scientist Award. BLD is a recipient of the
Capes PhD scholarship. PMJQ is the current recipient of a
Curing Retinal Blindness Foundation (CRBF) grant, a
Knights Templar Eye Foundation (KTEF) Career Starter
114
grant, an Uplifting Athletes Young Investigator grant, and
a New York Stem Cell Foundation (NYSCF) –
Druckenmiller Fellowship.
References
1. Anzalone AV, Randolph PB, Davis JR, Sousa AA,
Koblan LW, Levy JM, Chen PJ, Wilson C, Newby
GA, Raguram A, Liu DR. Search-and-replace genome
editing without double-strand breaks or donor
DNA. Nature. 2019;576:149–57.
2. Bustin SA. Absolute quantification of mrna using real-­
time reverse transcription polymerase chain reaction
assays. J Mol Endocrinol. 2000;25:169–93.
3. Caruso SM, Tsai YT, Costa BLD, Tsang SH, Quinn
PMJ. Prime editing strategy to knock-in the PRPH2
c.828+1G>A mutation. Adv Exp Med Biol. 2022;
4. Clement K, Rees H, Canver MC, Gehrke JM, Farouni
R, Hsu JY, Cole MA, Liu DR, Joung JK, Bauer DE,
Pinello L. CRISPResso2 provides accurate and rapid
Y.-T. Tsai et al.
genome editing sequence analysis. Nat Biotechnol.
2019;37:224–6.
5. Costa BLD, Levi SR, Eulau E, Tsai YT, Quinn
PMJ. Prime editing for inherited retinal diseases.
Front Genome Ed. 2021;3:775330.
6. Gerard GF, Potter RJ, Smith MD, Rosenthal K,
Dhariwal G, Lee J, Chatterjee DK. The role of
template-primer in protection of reverse transcrip-
tase from thermal inactivation. Nucleic Acids Res.
2002;30:3118–29.
7. Konishi A, Yasukawa K, Inouye K. Improving the
thermal stability of avian myeloblastosis virus reverse
transcriptase α-subunit by site-directed mutagenesis.
Biotechnol Lett. 2012;34:1209–15.
8. Tsai YT, Costa BLD, Nolan ND, Caruso SM, Tsang
SH, Quinn PMJ. Prime editing for the installation
and correction of mutations causing inherited reti-
nal disease: a brief methodology. Methods Mol Biol.
2022;2560:313–31.
9. Yasukawa K, Nemoto D, Inouye K. Comparison of the
thermal stabilities of reverse transcriptases from avian
myeloblastosis virus and moloney murine leukaemia
virus. J Biochem. 2008;143:261–8.
 Part IV
Gene Therapy
 Preexisting Neutralizing
Antibodies against Different
Adeno-Associated Virus Serotypes
in Humans and Large Animal
Models for Gene Therapy
Divya Ail and Deniz Dalkara
Abstract
Gene therapy is a potential cure for several
inherited retinal dystrophies, and adeno-­
associated virus (AAV) has emerged as a
vector of choice for therapeutic gene deliv-
ery to the retina. However, prior exposure to
AAVs can cause a humoral immune response
resulting in the presence of antibodies in the
serum, which can subsequently interfere
with the AAV-mediated gene therapy. The
antibodies bind specifically to a serotype but
often display broad cross-reactivity. A sub-
set of these antibodies called neutralizing
antibodies (NABs) can render the AAV inac-
tive, thereby reducing the efficacy of the
therapy. The preexisting NAB levels against
different serotypes vary by species, and
these variations need to be considered while
designing studies. Since large animals often
serve as preclinical models to test gene ther-
apies, in this review we compile studies
reporting preexisting NABs against com-
monly used AAV serotypes in humans and
large animal models and discuss strategies to
deal with NABs.
D. Ail (*) · D. Dalkara
Sorbonne Université, INSERM, CNRS, Institut de la
Vision, Paris, France
e-mail: divya.ail@inserm.fr
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_18
Keywords
Adeno-associated virus · AAV serotypes ·
Neutralizing antibodies · Large animal
models · Retinal gene therapy · Anti-AAV
immune response
1 Introduction
Adeno-associated virus (AAV) has emerged as a
vector of choice for gene therapy due to their
small size, good transduction profiles across dif-
ferent tissue types, and relatively low immunoge-
nicity [5]. AAV is a small non-enveloped virus
that contains a single-stranded DNA and depends
on adenovirus for its replication. It is 25 nm in
size and has a packaging capacity of approxi-
mately 4.5 kb. Minor differences in the capsid
structure determine the cellular receptors it can
bind and determine its cell and tissue specificity.
These different AAV variants are considered
serotypes when distinguished by a common set
of antigens [31].
There are several hundred known naturally
occurring variants, and millions of laboratory
generated AAVs that were screened to perform
specific biological tasks [15]. Of the naturally
occurring and most used serotypes, AAV1–AAV9
are well characterized. AAV1, AAV2, AAV3,
AAV4, and AAV6 were first isolated as contami-
nants in adenovirus preparations. AAV5 was iso-
117
118
Exposure
to AAV
Total anti-AAV
antibodies
People exposed to AAV
develop anti-AAV antibodies
Fig. 1 Schematic representation of the production of serotype-specific anti-AAV binding antibodies (BABs) and neu-
tralizing antibodies (NABs) in human population that is exposed to AAVs
lated from human condylomatous wart. A
high-throughput functional screen of 474 nonhu-
man primates and 259 human tissues resulted in
the identification of the variants AAV7, AAV8,
and AAV9 [11].
Most research to develop, optimize, and test
AAV-mediated gene therapies is conducted in
rodents. However, rodent models have certain
drawbacks such as the differences in the structure
of the retina compared to humans. The rodent
vision is rod dominated; they lack a macula and
fovea and hence do not recapitulate all the essen-
tial features of most diseases or give complete
information of the efficacy of therapy in the
human context. Hence, large animal models are
preferred for preclinical studies. Among the large
animals, the nonhuman primate retinas are the
closest to human retinas as they rely on high acu-
ity cone vision and have a macula and fovea. On
the other hand, animals such as pigs, dogs, cats,
sheep, and even horses have been used in some
studies [30]. Most of these animals have a cone-­
rich retina as they are diurnal animals like
humans. They do not possess a macula and fovea,
but some of these like the dogs and pigs have a
cone-enriched region in the retina known as the
visual streak [14].
AAVs are preferred for their low immunoge-
nicity and excellent safety profile, especially for
use in the retina as it is believed to be an immune-­
privileged tissue. However, several studies have
shown that AAVs can elicit both innate and adap-
tive immune responses. As part of adaptive
D. Ail and D. Dalkara
Binding Enhanced immune
antibodies response/
BABs Inflammation
Neutralizing
antibodies
NABs Virus neutralization/
Reduction in efficacy
immune responses, humoral immune response
produces antibodies against surface antigens of
AAVs. Of the total repertoire of antibodies pro-
duced in the hosts, all antibodies that specifically
bind to AAVs are known as binding antibodies
(BABs), and a subclass of these binding antibod-
ies that not only bind but also neutralize AAV
activity are known as neutralizing antibodies
(NABs). Hence, exposure to AAVs results in the
development of anti-AAV antibodies (BABs and
NABs) that are serotype specific (Fig. 1). When
hosts that possess preexisting antibodies due to
prior exposure receive AAV-based gene thera-
pies, they can have a stronger immune response,
resulting in the elimination of the AAV contain-
ing the therapy, thereby reducing the efficacy of
the treatment or increasing the risk of developing
ocular inflammation [5].
2 Preexistence of Antibodies
Against Different Serotypes
in Humans
Several studies have reported the prevalence of
preexisting antibodies to WT AAV [4, 7, 8]. An
analysis of the total anti-AAV IgG antibodies
revealed that prevalence of anti-AAV1 (67% of
the population tested possessed anti-AAV1 anti-
bodies) and anti-AAV2 (72%) was higher than
those of anti-AAV5 (40%), anti-AAV6 (46%),
anti-AAV8 (38%), and anti-AAV9 (47%) [4].
Another study reported the prevalence of neutral-
Preexisting Neutralizing Antibodies against Different Adeno-Associated Virus Serotypes in Humans…
izing antibodies in serum samples collected from
10 countries and 4 continents. NABs against
AAV2 were the highest (30–60% of the popula-
tion), whereas anti-AAV7, AAV8, and AAV9 had
lower prevalence (15–30%). Anti-AAV1 NABs
prevalence was lower than that of anti-AAV2 but
higher than AAV7, AAV8, and AAV9 in most
regions [7]. There is an interest in studying
cohorts of patients with specific diseases to check
the prevalence of anti-AAV antibodies and check
if they can benefit from gene therapies. A study
involving 1552 patients with heart condition
showed close to 60% of the cohort were seroposi-
tive for NABs against AAV1 [3]. Interestingly, a
study comparing the preexisting antibodies
against AAV2, AAV5, and AAV6 in patients with
cystic fibrosis against a control population
revealed that the Nab levels were lower in the
patients for each of the serotype compared to the
control population, with the lowest levels being
for the NABs against AAV5 [12]. Another study
involving HIV1-infected patients in China
showed no difference in the seroprevalence com-
pared to healthy controls, and that prevalence
was higher for AAV2 (96.6%) and AAV8 (82.0%)
than for AAV5 (40.2%) [29]. Another study in
Japanese population comparing hemophilia
patients with healthy population revealed a prev-
alence of NABs in approximately 30–40% of the
population for all the serotypes tested (AAV1,
AAV2, AAV5, AAV8, and AAV9), and the levels
did not differ significantly between the patients
and healthy controls [20]. All these human stud-
ies reveal that antibodies against the common
AAV serotypes are prevalent in the human
population, and the geographic location most
­ whereas there were NABs present albeit at low
likely determines the possibility of exposure and
development of the antibodies. Interestingly,
other disease conditions do not necessarily have
an impact on prevalence of NABs.
3 Preexistence of Antibodies
Against Different Serotypes
in Large Animal Models
The most comprehensive reporting of NAB
­prevalence in nonhuman primates was conducted
on 1632 rhesus macaques, 790 cynomolgus
119
macaques, 20 marmosets, and 20 chimpanzees.
All marmosets were seropositive for AAV9, and
60% of the chimpanzees were seropositive for
anti-AAV1 NABs. AAV8 and AAV2 NABs were
most prevalent in the rhesus macaque cohort with
close to 100% of the samples being seropositive,
whereas the seroprevalence was approximately
45% for AAV1 and AAV5. Prevalence levels of
NABs against AAV1 were similar in the cyno-
molgus macaques (43%), whereas they were
higher for AAV8 (75%) and AAV9 (68%) [28].
We recently reported the BABs against AAV8
and AAV9 were significantly higher than AAV5
BABs in a cohort of 41 cynomolgus macaques
[2]. A 10-year study on a cohort of 25 chimpan-
zees tested for NABs against AAV8 reported
three distinct groups – a group that remained
naïve for NABs, another one that had chronically
high levels throughout the study period, and a
group that seroconverted from high to low levels
over the span of 10 years [9]. A study involving
23 rhesus macaques showed that 70% of the sam-
ples were seropositive for NABs against AAV8
[24]. Overall, in the diverse nonhuman primate
studies, antibodies against AAV8 and AAV9
appear more predominantly, whereas anti-AAV1
and AAV5 antibodies are the least prevalent.
In a study involving 70 dogs, all were positive
for NABs against AAV1 and AAV6 with a higher
prevalence of AAV1, and they were negative for
all other serotypes tested (AAV2, AAV5, and
AAV8), irrespective of the colony or genetic
background of the animal [6]. Another study also
confirmed prevalence of high titers of NABs
against AAV6 in their cohort of dog samples,
titers against AAV1 and AAV2, but no NABs
against AAV9 were detected [22]. Contrary to
this, a study involving 16 dogs reported all of
them seropositive for AAV9, but these were not
tested for AAV6 [28]. A study in dogs tested 72
naïve dogs for NABs against AAV6, AAV8, and
AAV9 and found that the NABs against AAV6
were the highest and most prevalent irrespective
of the age, gender, and disease status. The other
two serotypes tested were below detection limit
in most animals tested, except a few young pups
that had low titers of NABs against AAV8 or
AAV9 [23].
120
In pigs, AAV5 was the most prevalent with all
the animals tested being seropositive, but unlike
other large animals pigs were also seropositive
for all other tested serotypes (AAV1, AAV2,
AAV6, and AAV8), with the lowest prevalence
being against AAV6 [6]. Another study tested
NABs against AAV1, AAV2, AAV6, and AAV9
and showed the presence of antibodies against all
tested serotypes in the pig samples at high titers
[22].
In a study conducted on 230 client-owned and
20 specific pathogen-free (SPF) cats in
Switzerland that were tested for NABs, it was
revealed that 53% had NABs against at least one
of the serotypes tested. The lowest prevalence
was against AAV6 (5%), followed by AAV1 and
AAV5 (7% each), AAV2 (17%), AAV9 (20%),
and AAV8 (26%), and the highest prevalence and
the highest titers were observed against AAV7
(28%) [17]. In another study conducted with 85
cats living in the Northeastern United States (35
client-owned, 20 feral, and 30 SPF cats), BABs
tested against 11 AAV serotypes (AAV1–AAV11)
showed the presence of antibodies against the
different serotypes to varying extents, including
the SPF animals. However, upon testing NABs
against AAV2, AAV6, and AAV9, no significant
neutralizing activity was detected, indicating that
even though the animals had anti-AAV antibod-
ies, the levels of NABs were low [1].
A small study with 3 sheep serum samples
showed low titers against AAV2 and AAV6, while
the serums were seronegative for AAV1 and
AAV9 [22]. On the other hand, a study involving
a cohort of 41 sheep reported all of them sero-
positive for AAV9, which was the only serotype
tested [28]. Another study involving 6 animals
showed varying levels of BABs against all sero-
types tested (AAV1, AAV2, AAV5, AAV6, AAV8,
and AAV9), and some of the animals tested
showed NABs against AAV2 and at lower titers
against AAV8 [25].
Horse is not a model commonly used for eye
diseases but serves as a good preclinical model
for osteoarthritis, and it is interesting to note that
a study testing NABs against different AAV sero-
types found that all the horses in the study were
seropositive for NABs against AAV5, whereas
D. Ail and D. Dalkara
they had very low antibodies or were seronega-
tive for all other tested serotypes [6].
Rodents are often used for gene therapy stud-
ies but rarely tested for anti-AAV antibodies. One
study revealed that naïve mice acquired from
commercial vendors harbored anti-AAV antibod-
ies, with highest prevalence against AAV1 and
AAV6 and low prevalence against AAV2 and
AAV9. The rats tested in this study had the lowest
NABs among all the animal species tested. They
possessed some NABs against AAV6 and very
low NAB titers against AAV2 and were seronega-
tive for AAV1 and AAV9 [22].
4 Strategies to Deal
with the Anti-AAV
Antibodies
Most preclinical and clinical studies use some
form of immunosuppression, but direct evidence
of the efficacy of such treatments is rarely
explored. Also, these treatments vary consider-
ably from one study to another. In fact, a study
points toward the adverse effect of using an
immunosuppressive regimen [27]. Hence,
researchers are actively exploring other methods
to evade the AAV-directed immune responses,
some of which are as follows:
Designing Novel AAV Variants A strategy using
structural information acquired from cryo-­
electron microscopy of antigen-binding domains
on AAVs and generating AAV variants by mutat-
ing these domains resulted in a neutralization
evading variant [26]. One strategy to avoid recog-
nition and binding by preexisting antibodies is to
generate novel AAV variants. This can be done
by using directed evolution of the capsids and
screening them by their ability to evade neutral-
ization by antibodies. First, a library of sequences
is generated by making changes to the coding
sequence of the AAV capsid using error-prone
PCR, and then this is tested and screened for anti-
body resistance. One such approach resulted in
AAV vectors with an approximately 10- and 100-­
fold resistance to neutralizing antibodies [19].
Capsid shuffling is another technique used to
Preexisting Neutralizing Antibodies against Different Adeno-Associated Virus Serotypes in Humans…
generate AAV variant libraries, wherein the cap-
sid sequences of known AAVs are fragmented
and reassembled to generate variant sequences,
which are then tested and screened for antibody
resistance [18].
AAV Capsid Decoys In this strategy, empty cap-
sids are injected along with the therapeutic gene
carrying AAVs so that the empty capsids bind the
NABs. Further, the empty capsids have their
receptor binding sites mutated, so they cannot
enter the cell and hence only serve to bind anti-
bodies. This approach was shown to successfully
overcome the inhibitory effect of NABs and
increase gene transfer efficacy in both mice and
nonhuman primates [21]. However, to overcome
high titers of NABs, high doses of empty capsids
are required that will significantly increase the
total viral load used, which is likely to aggravate
the immune response in an AAV dose-dependent
manner [2]. This strategy is thus questionable in
the context of retinal gene therapy.
Endopeptidase Digestion A recent study dem-
onstrated that circulating IgGs could be elimi-
nated by the enzymatic degradation using an
endopeptidase called imlifidase (IdeS). In this
study, mice were passively immunized with
serum IgGs, followed by IdeS treatment and
AAV injection. They reported decreased anti-­
AAV antibodies and more efficient gene transfer.
They were able to show that IdeS administration References
was safe and efficient in nonhuman primates.
Further, in vitro testing of human plasma samples
collected from gene therapy trial patients resulted
in reduced anti-AAV antibody levels [16].
Cytosine-Phosphate-Guanine (CpG)
Depletion Many unmethylated CpG motifs
present in clusters known as CpG islands are
common in AAV vector sequences. These CpG
motifs interact with Tlr9 receptors and contribute
toward eliciting an immune response. In a study,
the authors used an immunogenic variant of AAV
to induce an immune response in WT mice and
121
showed that this effect was abolished in Tlr9 KO
mice. Further, they depleted CpG sequences in
the viral genome and showed that these modified
AAVs were evading immune responses [10].
Tlr9 Inhibition Immune cells display a family
of surface receptors called TLRs, and TLR9 nor-
mally senses DNA from pathogenic viruses that
contain unmethylated CpG motifs. CpG binding
to TLR9 promotes its dimerization and activates
TLR9 signaling. This results in innate immune
responses eventually recruiting other immune
cells to the site of infection and primes adaptive
immune responses [13]. A study showed that
short TLR9 inhibitory sequences (approximately
12–24 nucleotides) could be incorporated into
the viral genome for blocking TLR9 activation.
The TLRi containing vectors elicited reduced
immune responses and enhanced gene expression
in mouse and pig models [10].
Taking into account all these animal studies, it
is evident that the levels of antibodies against dif-
ferent AAV serotypes show interspecies differ-
ences, which need to be considered before
selecting a suitable serotype for each animal
model. Furthermore, the host can be pretested for
antibodies against the serotype to be used, and
strategies can be put in place to evade immune
responses and ensure efficient gene transfer.
1. Adachi K, Dissen GA, Lomniczi A, Xie Q, Ojeda SR,
Nakai H. Adeno-associated virus-binding antibodies
detected in cats living in the Northeastern United States
lack neutralizing activity. Sci Rep. 2020;10(1):1–13.
https://doi.org/10.1038/s41598-­020-­66596-­4.
2. Ail D, Ren D, Brazhnikova E, Nouvel-Jaillard C,
Bertin S, Mirashrafi SB, Fisson S, Dalkara D. Systemic
and local immune responses to intraocular AAV vec-
tor administration in non-human primates. Mol Ther
Methods Clin Dev. 2022;24(March):306–16. https://
doi.org/10.1016/j.omtm.2022.01.011.
3. Greenberg B, Butler J, Felker GM, Felker GM,
Ponikowsk P, Zsebo KM. Prevalence of AAV1 neu-
tralizing antibodies and consequences for a clinical
trial of gene transfer for advanced heart failure. Gene
Ther. 2016;23:313–9.
122
4. Boutin S, Monteilhet V, Veron P, Leborgne C,
Benveniste O, Montus MF, Masurier C. Prevalence
of serum IgG and neutralizing factors against adeno-­
associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in
the healthy population: implications for gene therapy
using AAV vectors. Hum Gene Ther. 2010;21(6):704–
12. https://doi.org/10.1089/hum.2009.182.
5. Bucher K, Rodríguez-Bocanegra E, Dauletbekov D,
Dominik Fischer M. Immune responses to retinal
gene therapy using adeno-associated viral vectors –
implications for treatment success and safety. Prog
Retin Eye Res. 2020;83(August):100915. https://doi.
org/10.1016/j.preteyeres.2020.100915.
6. Calcedo R, Franco J, Qin Q, Richardson DW,
Mason JB, Boyd S, Wilson JM. Preexisting neutral-
izing antibodies to adeno-associated virus capsids
in large animals other than monkeys may confound
in vivo gene therapy studies. Hum Gene Ther
Methods. 2015;26(3):103–5. https://doi.org/10.1089/
hgtb.2015.082.
7. Calcedo R, Vandenberghe LH, Gao G, Lin J, Wilson
JM. Worldwide epidemiology of neutralizing anti-
bodies to adeno-associated viruses. J Infect Dis.
2009;199(3):381–90. https://doi.org/10.1086/595830.
8. Calcedo R, Wilson JM. Humoral immune response to
AAV. Front Immunol. 2013;4(October):1–7. https://
doi.org/10.3389/fimmu.2013.00341.
9. Calcedo R, Wilson JM. AAV natural infection induces
broad cross-neutralizing antibody responses to mul-
tiple AAV serotypes in chimpanzees. Hum Gene Ther
Clin Dev. 2016;27(2):79–82. https://doi.org/10.1089/
humc.2016.048.
10. Faust SM, Bell P, Cutler BJ, Ashley SN, Zhu Y,
Rabinowitz JE, Wilson JM. CpG-depleted adeno-­
associated virus vectors evade immune detection. J
Clin Investig. 2013;123(7):2994–3001. https://doi.
org/10.1172/JCI68205.
11. Gao G, Vandenberghe L, Wilson J. New
recombinant serotypes of AAV vectors. Curr
Gene Ther. 2005;5(3):285–97. https://doi.
org/10.2174/1566523054065057.
12. Halbert CL, Miller D, Mcnamara S, Emerson J,
Ronald L, Ramsey B, Aitken ML. Populations:
implications for gene therapy using AAV vectors.
Hum Gene Ther. 2015;17(4):440–7. https://doi.
org/10.1089/hum.2006.17.440.Prevalence.
13. Hamilton BA, Fraser Wright J. Challenges posed by
immune responses to AAV vectors: addressing root
causes. Front Immunol. 2021;12(May):1–8. https://
doi.org/10.3389/fimmu.2021.675897.
14. Kostic C, Arsenijevic Y. Animal modelling for inher-
ited central vision loss. J Pathol. 2016;238(2):300–10.
https://doi.org/10.1002/path.4641.
15. Kotterman MA, Schaffer DV. Engineering adeno-­
associated viruses for clinical gene therapy. Nat Rev
Genet. 2014;15(7):445–51. https://doi.org/10.1038/
nrg3742.
16. Leborgne C, Barbon E, Alexander JM, Hanby H,
Delignat S, Cohen DM, Collaud F, et al. IgG-cleaving
endopeptidase enables in vivo gene therapy in the
D. Ail and D. Dalkara
presence of anti-AAV neutralizing antibodies. Nat
Med. 2020;26(7):1096–101. https://doi.org/10.1038/
s41591-­020-­0911-­7.
17. Li P, Boenzli E, Hofmann-Lehmann R, Katrin Helfer-­
Hungerbuehler A. Pre-existing antibodies to candidate
gene therapy vectors (adeno-associated vector sero-
types) in domestic cats. PLoS One. 2019;14(3):1–19.
https://doi.org/10.1371/journal.pone.0212811.
18. Li W, Asokan A, Zhijian W, Van Dyke T, DiPrimio N,
Jarrod JS, Govindaswamy L, et al. Engineering and
selection of shuffled AAV genomes: a new strategy
for producing targeted biological nanoparticles. Mol
Ther. 2008;16(7):1252–60. https://doi.org/10.1038/
mt.2008.100.
19. Maheshri N, Koerber JT, Kaspar BK, Schaffer
DV. Directed evolution of adeno-associated
virus yields enhanced gene delivery vectors. Nat
Biotechnol. 2006;24(2):198–204. https://doi.
org/10.1038/nbt1182.
20. Mimuro J, Mizukami H, Shima M, Matsushita T, Taki
M, Muto S, Higasa S, et al. The prevalence of neutral-
izing antibodies against adeno-associated virus cap-
sids is reduced in young Japanese individuals. J Med
Virol. 2014;86(11):1990–7. https://doi.org/10.1002/
jmv.23818.
21. Mingozzi F, Hui DJ, Yazicioglu M, Elkouby L,
Hinderer CJ, Basner-tschakarjan E, Wright JF,
High KA. Overcoming pre-existing humoral
immunity to AAV using capsid decoys. Mol
Ther. 2013;21(61):S45. https://doi.org/10.1016/
s1525-­0016(16)34445-­8.
22. Rapti K, Louis-Jeune V, Kohlbrenner E, Ishikawa
K, Ladage D, Zolotukhin S, Hajjar RJ, Weber
T. Neutralizing antibodies against AAV serotypes 1,
2, 6, and 9 in sera of commonly used animal models.
Mol Ther. 2012;20(1):73–83. https://doi.org/10.1038/
mt.2011.177.
23. Shin JH, Yue Y, Smith B, Duan D. Humoral immunity
to AAV-6, 8, and 9 in normal and dystrophic dogs.
Hum Gene Ther. 2012;23(3):287–94. https://doi.
org/10.1089/hum.2011.125.
24. Sun L, Lingli T, Gao G, Sun X, Duan J, You
L. Assessment of a passive immunity mouse model
to quantitatively analyze the impact of neutralizing
antibodies on adeno-associated virus-mediated gene
transfer. J Immunol Methods. 2013;387(1–2):114–20.
https://doi.org/10.1016/j.jim.2012.10.003.
25. Tellez J, Van Vliet K, Tseng YS, Finn JD, Tschernia N,
Almeida-Porada G, Arruda VR, Agbandje-­McKenna
M, Porada CD. Characterization of naturally-­
occurring humoral immunity to AAV in sheep. PLoS
One. 2013;8(9):1–11. https://doi.org/10.1371/journal.
pone.0075142.
26. Tse LV, Klinc KA, Madigan VJ, Castellanos RM,
Rivera LF, Wells LP, Havlik JK, Smith MA-MK,
Asokan A. Structure-guided evolution of anti-
genically distinct adeno-associated virus variants
for immune evasion. Proc Natl Acad Sci U S A.
2017;114(24):E4812–21. https://doi.org/10.1073/
pnas.1704766114.
Preexisting Neutralizing Antibodies against Different Adeno-Associated Virus Serotypes in Humans…
27. Unzu C, Hervás-Stubbs S, Sampedro A, Mauleón
I, Mancheño U, Alfaro C, de Salamanca RE, et al.
Transient and intensive pharmacological immunosup-
pression fails to improve AAV-based liver gene transfer
in non-human primates. J Transl Med. 2012;10:122.
https://doi.org/10.1186/1479-­5876-­10-­122.
28. Wang D, Zhong L, Li M, Li J, Tran K, Ren L, He R,
et al. Adeno-associated virus neutralizing antibodies
in large animals and their impact on brain intraparen-
chymal gene transfer. Mol Ther Methods Clin Dev.
2018;11(December):65–72. https://doi.org/10.1016/j.
omtm.2018.09.003.
29. Wang Y, Liu Q, Huang W, Zhang H, Wang Y, Zhao
J, Song A, Xie H, Zhao C, Gao D. Neutralizing anti-
123
bodies against AAV2, AAV5 and AAV8 in healthy
and HIV-1-infected subjects in China: implica-
tions for gene therapy using AAV vectors. Gene
Ther. 2014;21(8):732–8. https://doi.org/10.1038/
gt.2014.47.
30. Winkler PA, Occelli LM, Petersen-Jones SM. Large
animal models of inherited retinal degenerations: a
review. Cell. 2020;9(4):882. https://doi.org/10.3390/
cells9040882.
31. Wu Z, Asokan A, Jude Samulski R. Adeno-associated
virus serotypes: vector toolkit for human gene
therapy. Mol Ther. 2006;14(3):316–27. https://doi.
org/10.1016/j.ymthe.2006.05.009.
 Optimization of Capillary-Based
Western Blotting for MYO7A

Kaitlyn R. Calabro, Sanford L. Boye,

and Shannon E. Boye

Abstract 1 Introduction

Myosin VIIA (MYO7A)-associated Usher syn-
drome type 1B (USH1B) is a severe disorder
that impacts the auditory, vestibular, and
visual systems of affected patients. Due to the
large size (~7.5 kb) of the MYO7A coding
sequence, we have designed a dual adeno-­
associated virus (AAV) vector-based approach
for the treatment of USH1B-related vision
loss. Due to the added complexity of dual-­
AAV gene therapy, careful attention must be
paid to the protein products expressed follow-
ing vector recombination. In order to improve
the sensitivity and quantifiability of our immu-
noassays, we adapted our traditional western
blot protocol for use with the Jess™ Simple
Western System. Following several rounds of
testing, we optimized our protocol for the
detection of MYO7A in two of our most fre-
quently used sample types, mouse eyes, and
infected HEK293 cell lysates.
Keywords
MYO7A · Usher syndrome · USH1B · Gene
therapy
K. R. Calabro · S. L. Boye · S. E. Boye (*)
Department of Pediatrics, University of Florida,
Gainesville, FL, USA
e-mail: shaire@ufl.edu
Usher syndrome (USH) is a complex disease that
affects the visual, auditory, and vestibular sys-
tems of patients. Usher syndrome type 1B
(USH1B) is the most severe form of the disease
as well as one of the most common, accounting
for 40–50% of all USH cases [1–3]. Affected
patients are born deaf, with vestibular dysfunc-
tion, and begin losing vision within the first
decade of life [4–7].
Our lab is developing an adeno-associated
virus (AAV)-based gene therapy for the treatment
of USH1B-related retinal degeneration. However,
this comes with challenges. USH1B is caused by
mutations in MYO7A, a relatively large gene of
approximately 7.5 kb, whose coding sequence is
too large to fit into a single AAV vector (packag-
ing capacity ~4.8 kb). To overcome this obstacle,
we developed dual-AAV vector systems that split
MYO7A into two halves that can be co-delivered
[8]. When the dual vectors enter a target cell,
recombination of the full-length gene is pro-
moted via the presence of shared, identical
sequences within the vectors [8–11].
The added complexity of dual AAV vectors
relative to traditional single-AAV gene therapies
demands additional scrutiny to ensure safety. For
instance, ensuring proper expression of full-­
length protein and determining whether expres-
sion of truncated protein emanating from
individual vectors is an important safety consid-

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 125
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_19
126
eration are crucial. We previously found that our
first-generation “hybrid” dual vectors produced a
truncated protein from non-recombined front half
vectors and that this front half vector led to par-
tial declination of retinal function following
­subretinal injection in mice [8]. However, the
expression of this truncated protein was relatively
low compared to full-length expression, which
made its characterization and quantification dif-
ficult via traditional western blotting.
Our lab previously developed a traditional
western blotting protocol for the detection of
MYO7A [8, 12]. This procedure uses 8–12%
Tris-Acetate gels to separate denatured protein
samples followed by a transfer to PVDF (polyvi-
nylidene fluoride) membranes. The membranes
are incubated overnight with α-MYO7A and
imaged the following day after secondary anti-
body incubation. The membrane is then incu-
bated with α-VCL (vinculin) as a loading control
and reimaged. Developments over recent years
have led to advances in immunoblotting technol-
ogy. The Jess™ Simple Western System
(ProteinSimple, San Jose, CA, USA) is an auto-
mated, capillary-based, size separation, and
immunoassay system. In addition to the reduc-
tion in hands-on time required for a Jess™ assay
compared to traditional western blot, the auto-
mated system also allows for reduced variability
and increased sensitivity, leading to more repro-
ducible results and more accurate quantification.
In this chapter, we will detail the process of opti-
mizing our MYO7A immunoassay for use with
Jess™.
2 Materials and Methods
2.1 AAV Production
All vectors used in this study were packaged in
AAV2. Vector packaging was performed using
standard plasmid-based transfection methods
in adherent Human Embryonic Kidney (HEK)
293 cells and purified by iodixanol density gra-
dient centrifugation [13]. Following produc-
tion, all viruses were titered using PicoGreen
(ThermoFisher, P7589), as previously
described [14].
K. R. Calabro et al.
2.2 Use of Animals and Eye
Collections
All animal procedures were performed according
to the guidelines of the ARVO statement for the
“Use of Animals in Ophthalmic and Vision
Research” and were approved by the Institutional
Animal Care and Use Committees at the
University of Florida. Generation and character-
ization of Myo7a−/− mice has been previously
described [12]. Eyes from C57BL/6J (WT) and
Myo7a−/− (KO) mice were enucleated and flash
frozen in protease inhibitors (ThermoFisher,
87,786). Whole eyes were homogenized in RIPA
(radioimmunoprecipitation assay) lysis buffer
(ThermoFisher, PI89901) using a Sonic
Dismembrator (Fisher Scientific, FB50A220).
2.3 In Vitro Infections and Cell
Harvesting
HEK293 cells were maintained in Dulbecco’s
Modified Eagle Media (DMEM) containing 10%
fetal bovine serum and 50 mg/mL gentamicin
(complete media) and were incubated at 37 °C in
5% CO2. Cell morphology and growth rates were
closely monitored throughout passages to main-
tain near-identical conditions across infection
experiments.
Cells were infected with each virus at a multi-
plicity of infection (MOI) of 10,000 as previously
described [8]. Twenty-four hours post-infection,
virus containing media was removed and replaced
with complete media. Cells were harvested 72 h
post-infection. Following collection, RIPA buffer
was added to each sample. Cells were homoge-
nized by vortexing for 30 s.
2.4 Jess™ Simple Western
Optimization
Prior to use, the total protein concentration of each
sample was determined using bicinchoninic assays
(BCAs, Thermo Scientific, 23,225). To determine
the optimal conditions for MYO7A detection in
mouse eyes and in vitro infection samples, the
standard protocol was followed for the 66-440 kDa
Optimization of Capillary-Based Western Blotting for MYO7A
Jess™ separation module (ProteinSimple,
SM-W008). To optimize protein concentrations,
samples were used at a range from 0.1 to 2.0 μg/
μL. Primary MYO7A antibody dilutions were
tested from 1:5 to 1:125 (Santa Cruz, sc-74,516).
Loading control optimization was performed with
vinculin (VCL; Cell Signaling Technologies,
13,901) for samples loaded at 2.0 μg/μL with anti-
body dilutions ranging from 1:10 to 1:1000. After
preliminary runs, it was determined that the
RePlex™ module (ProteinSimple, RP-001) was
required to avoid cross-reactivity between anti-
bodies. All Jess™ data was analyzed using
Compass for SW (ProteinSimple, version 5.0.1).
3 Results
3.1 Optimizing Sample
and Antibody Concentrations
for MYO7A and VCL
The MYO7A Jess™ optimization was per-
formed using two main samples: (1) Wild-type
Fig. 1 Optimizing α-MYO7A and α-VCL for Jess™. (a)
Lane view of α-MYO7A optimization run with sample
concentrations of 0.1–2.0 μg/μL and antibody dilutions of
1:10 or 1:25. (b) Lane view of α-MYO7A optimization
run with sample concentrations of 2.0 μg/μL and antibody
dilutions of 1:5, 1:10, or 1:15. (c) Graph view of WT and
KO eyes from (b). α-MYO7A dilution of 1:5 is at saturat-
127
(WT, C57BL/6 J) mouse eyes and (2) HEK293
cells infected with AAV2-smCBA-hybrid (first-­
generation) dual vectors (hybrid lysate).
Negative controls included Myo7a knockout
(KO) mouse eyes and noninfected HEK293 cell
lysate (NI lysate). First, we determined the sam-
ple protein concentration and α-MYO7A anti-
body dilution that would result in saturating
conditions. Working at the point of saturation is
ideal because it allows for the most consistent/
replicable results and the most accurate level of
quantification.
For the first optimization run, WT eyes and
hybrid lysate samples were used at 0.1, 0.5, or
2.0 μg/μL with an α-MYO7A dilution of either 1:10
or 1:25 (Fig. 1a). We determined that 2.0 μg/μL
resulted in prominent ~230 kDa MYO7A signal
and appeared ideal for both the in vivo eye samples
and the in vitro cell lysate. The expected ~120 kDa
band corresponding to truncated MYO7A (TR
MYO7A) was also visible in the hybrid lysate.
While the 1:10 antibody dilution looked promising,
further testing was conducted to confirm that this
dilution resulted in saturating conditions.
ing conditions because halving of antibody concentration
to 1:10 does not halve signal height. (d) Lane view of
α-VCL optimization runs with sample concentrations of
2.0 μg/μL and antibody dilutions of 1:10, 1:50, 1:250, or
1:100. WT wild-type (C57BL/6J), KO Myo7a−/−, TR
MYO7A Truncated MYO7A, S/N signal to noise ratio
128
Next, the positive controls were run with a
smaller range of α-MYO7A to confirm saturating
conditions, and negative controls (KO eye and NI
lysate) were used to ensure MYO7A signal speci-
ficity. All samples were used at the previously
identified 2.0 μg/μL concentration, and
α-MYO7A was used at a 1:5, 1:10, or 1:15 dilu-
tion (Fig. 1b). The positive controls produced
full-length MYO7A signal at all antibody dilu-
tions tested, and hybrid lysate samples also had
detectable TR MYO7A signal. The graphical
analysis of this data (Fig. 1c, hybrid lysate data
not shown) revealed that the 1:5 α-MYO7A anti-
body dilution resulted in saturating conditions
(halving the antibody concentration from 1:5 to
1:10 did not result in a halving of signal height/
intensity). This dilution also produced an ade-
quate signal-to-noise ratio (S/N, ≥10). In con-
trast, no signal was detected in the KO eye or the
NI lysate.
With the ideal settings for MYO7A detection
established, we next determined the optimal con-
ditions for detecting the loading control, vinculin
(VCL). Because the α-MYO7A is a mouse mono-
clonal antibody, a rabbit monoclonal antibody
was selected for α-VCL to avoid interference.
The optimal MYO7A sample protein concentra-
tion of 2.0 μg/μL was used for the VCL optimiza-
tion to ensure both antibodies could be used
simultaneously. Antibody dilutions ranged from
1:10 to 1:1000 (Fig. 1d). Results showed that all
antibody concentrations resulted in the ~120 kDa
VCL band. However, due to the similar sizes of
VCL and TR MYO7A, it was determined that
VCL would need to be run in a separate imaging
channel instead of multiplexed (i.e., MYO7A in
chemiluminescent channel; VCL in near infrared,
NIR).
3.2 Determining Final Run
Conditions for MYO7A Jess™
Assays
To confirm the optimized antibody dilution for
VCL in the NIR channel, samples were run at
2.0 μg/μL with either a 1:50 or 1:100 α-VCL
dilution (Fig. 2a). When viewing the signal inten-
K. R. Calabro et al.
sity data from these samples, we determined that
the 1:50 antibody dilution was at saturation since
the halving of the antibody concentration from
1:50 to 1:100 did not result in a halving of signal
height/intensity (Fig. 2b). However, when both
antibodies were run simultaneously (MYO7A in
the chemiluminescent channel; VCL in the NIR
channel) in the sample capillary, it was found that
there was cross-reactivity of VCL with the
mouse-HRP (Horseradish Peroxidase) second-
ary. This cross-reactivity can clearly be seen in a
NI lysate sample (Fig. 2c) in which the VCL sig-
nal is present in both the chemiluminescent and
NIR channels.
Due to this cross-reactivity, it was determined
that the ProteinSimple RePlex™ module would
be necessary to image MYO7A and VCL in the
same capillary. The RePlex™ reagents are a
stripping buffer that removes all reagents (pri-
mary/secondary antibodies, etc.) from the capil-
laries so a second immunoassay can be run
without interference. In other words, once the
MYO7A immunoassay has been completed, the
RePlex™ module removes the antibodies/
reagents from the capillaries, and a second,
sequential, immunoassay with VCL can then be
performed.
For the final run, in which optimized condi-
tions were used, HEK293 samples were run at a
concentration of 2.0 μg/μL, and α-MYO7A was
used at a 1:5 dilution. Once the MYO7A immu-
noassay was completed, the RePlex reagents
were introduced to strip the capillaries. α-VCL
was then introduced to the capillaries at 1:50
(Fig. 2d). The results from these immunoassays
provide clear, quantifiable readouts for MYO7A,
TR MYO7A, and VCL expression without inter-
ference or cross-reactivity between antibodies.
4 Discussion
Following several rounds of testing, we success-
fully optimized the Jess™ Simple Western proto-
col for the detection of MYO7A in mouse eyes
and infected HEK293 samples. With these opti-
mized conditions, we can generate highly sensi-
tive and quantifiable immunoassay results to
Optimization of Capillary-Based Western Blotting for MYO7A
Fig. 2 Determining final run conditions for Jess™. (a)
Lane view of α-VCL optimization run with sample con-
centrations of 2.0 μg/μL and antibody dilutions of 1:50 or
1:100. (b) Graph view of hybrid lysate from A. α-VCL
dilution of 1:50 in the near-IR channel (NIR) is at saturat-
ing conditions because halving of antibody concentration
to 1:100 does not halve signal height. (c) Graph view of
cross-reactivity of α-VCL with mouse-HRP secondary in
characterize and improve our dual AAV vector-­
based approach for the treatment of USH1B.
Acknowledgments We thank Dr. Angel Simpson (UF
ICBR Monoclonal Antibody Core Facility) and Dr. Greg
Kunkel (ProteinSimple) for their technical assistance and
training.
References
1. Ouyang XM, Yan D, Du LL, Hejtmancik JF, Jacobson
SG, Nance WE, et al. Characterization of Usher syn-
drome type I gene mutations in an Usher syndrome
patient population. Hum Genet. 2005;116(4):292–9.
https://doi.org/10.1007/s00439-­004-­1227-­2.
2. Jaijo T, Aller E, Beneyto M, Najera C, Graziano C,
Turchetti D, et al. MYO7A mutation screening in
Usher syndrome type I patients from diverse origins. J
Med Genet. 2007;44(3):e71. https://doi.org/10.1136/
jmg.2006.045377.
129
NI Lysate. (d) Lane view of final run conditions.
α-MYO7A is run in the chemiluminescent channel, and
α-VCL is run in the NIR channel after RePlex™ stripping.
(Data from chemiluminescent channel = black; data from
NIR channel = red). S/N signal to noise ratio, TR MYO7A
truncated MYO7A, CH chemiluminescent channel, NIR
near-infrared channel
3. Stabej PL, Saihan Z, Rangesh N, Steele-Stallard
HB, Ambrose J, Coffey A, et al. Comprehensive
sequence analysis of nine Usher syndrome genes in
the UK National Collaborative Usher Study. J Med
Genet. 2012;49(1):27–36. https://doi.org/10.1136/
jmedgenet-­2011-­100468.
4. Jacobson SG, Cideciyan AV, Aleman TS, Sumaroka A,
Roman AJ, Gardner LM, et al. Usher syndromes due
to MYO7A, PCDH15, USH2A or GPR98 mutations
share retinal disease mechanism. Hum Mol Genet.
2008;17(15):2405–15. https://doi.org/10.1093/hmg/
ddn140.
5. Jacobson SG, Aleman TS, Sumaroka A, Cideciyan
AV, Roman AJ, Windsor EA, et al. Disease boundaries
in the retina of patients with usher syndrome caused
by MYO7A gene mutations. Invest Ophthalmol Vis
Sci. 2009;50(4):1886–94. https://doi.org/10.1167/
iovs.08-­3122.
6. Jacobson SG, Cideciyan AV, Gibbs D, Sumaroka A,
Roman AJ, Aleman TS, et al. Retinal disease course in
usher syndrome 1B due to MYO7A mutations. Invest
Ophthalmol Vis Sci. 2011;52(11):7924–36. https://
doi.org/10.1167/iovs.11-­8313.
130
7. Sumaroka A, Matsui R, Cideciyan AV, McGuigan
DB III, Sheplock R, Schwartz SB, et al. Outer reti-
nal changes including the ellipsoid zone band in
usher syndrome 1B due to MYO7A mutations. Invest
Ophthalmol Vis Sci. 2016;57(9):OCT253–OCT61.
https://doi.org/10.1167/iovs.15-­18860.
8. Dyka FM, Boye SL, Chiodo VA, Hauswirth WW,
Boye SE. Dual adeno-associated virus vectors result
in efficient in vitro and in vivo expression of an
oversized gene, MYO7A. Hum Gene Ther Methods.
2014;25(2):166–77. https://doi.org/10.1089/
hgtb.2013.212.
9. Duan DS, Yue YP, Engelhardt JF. Expanding AAV
packaging capacity with trans-splicing or over-
lapping vectors: a quantitative comparison. Mol
Ther. 2001;4(4):383–91. https://doi.org/10.1006/
mthe.2001.0456.
10. Ghosh A, Yue Y, Lai Y, Duan D. A hybrid vector sys-
tem expands adeno-associated viral vector packaging
capacity in a transgene-independent manner. Mol
Ther. 2008;16(1):124–30. https://doi.org/10.1038/
sj.mt.6300322.
K. R. Calabro et al.
11. Ghosh A, Yue Y, Duan D. Efficient transgene recon-
stitution with hybrid dual AAV vectors carrying
the minimized bridging sequences. Hum Gene
Ther. 2011;22(1):77–83. https://doi.org/10.1089/
hum.2010.122.
12. Calabro KR, Boye SL, Choudhury S, Fajardo D,
Peterson JJ, Li W, et al. A novel mouse model of
MYO7A USH1B reveals auditory and visual system
Haploinsufficiencies. Front Neurosci. 2019;13 https://
doi.org/10.3389/fnins.2019.01255.
13. Zolotukhin S, Potter M, Zolotukhin I, Sakai Y, Loiler
S, Fraites TJ, et al. Production and purification of
serotype 1, 2, and 5 recombinant adeno-associated
viral vectors. Methods. 2002;28(2):158–67. https://
doi.org/10.1016/s1046-­2023(02)00220-­7.
14. Piedra J, Ontiveros M, Miravet S, Penalva C,
Monfar M, Chillon M. Development of a rapid,
robust, and universal PicoGreen-based method to
titer adeno-associated vectors. Hum Gene Ther
Methods. 2015;26(1):35–42. https://doi.org/10.1089/
hgtb.2014.120.
 AAV Serotypes and Their
Suitability for Retinal Gene
Therapy

Lynn J. A. Ebner and Christian Grimm

Abstract promotors which play a critical role for cell

targeting.
Throughout the last 25 years, exceptional
progress in retinal gene therapy was achieved. Keywords
The major breakthrough was realized in 2017
Gene therapy · Adeno-associated virus ·
when the FDA approved the adeno-associated
Serotype · Tropism · Photoreceptor transduc-
virus (AAV)-based gene therapy for treatment
tion · Capsid
of the monogenetic disorder Leber congenital
amaurosis type 2 (LCA2). Since then, many
therapies for inherited retinal diseases (IRD)
reached phase I/II clinical trials, targeting dis-
Abbreviations
eases like achromatopsia, choroideremia, reti-
nitis pigmentosa, Stargardt disease, and many
AAP Assembly-activating protein
more (reviewed in (Trapani and Auricchio,
AAV Adeno-associated virus
Trends Mol Med 24:669–681, 2018)).
c-Met Hepatocyte growth factor receptor
Advanced vector and capsid design technolo-
FGFR1 Fibroblast growth factor receptor 1
gies as well as improved gene transfer and
HSPG Heparan sulfate proteoglycan
gene editing methods may lead to refined ther-
IRD Inherited retinal diseases
apies for various eye diseases. Many research
ITR Inverted terminal repeats
departments worldwide focus on optimizing
LCA2 Leber congenital amaurosis type 2
transgene expression by designing novel AAV
rAAV Recombinant AAV
serotypes. Besides serotype tropism, the
RPE Retinal pigment epithelium
method of injection (intravitreal, subretinal, or
suprachoroidal) (Han et al., Hum Gene Ther
31:1288–1299, 2020) defines the efficiency
outcome along with the use of tissue-specific 1 Introduction – Adeno-­
Associated Viral Gene
Therapy
L. J. A. Ebner (*) · C. Grimm
Lab for Retinal Cell Biology, Department of AAVs are single-stranded DNA viruses and
Ophthalmology, University Hospital Zurich, belong to the Parvovirus family (Parvoviridae).
University of Zurich, Schlieren, Switzerland With only 20 nm in diameter, they are small
e-mail: Lynn.Jenny.Alix.Ebner@uzh.ch

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 131
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_20
132
viruses with a genome of approximately 4.8 kb.
Inverted terminal repeats (ITRs) of 145 bp flank
the DNA strand on both sides. They are respon-
sible for efficient multiplication of the genome
[4], integration into the host genome, and
encapsidation [21]. Three Cap (Capsid) pro-
teins (VP1, VP2, and VP3) encode for the ico-
sahedral capsid structure which protects the
genome and encodes cell binding activity. Four
Rep (Replication) proteins (Rep78, Rep68,
Rep52, and Rep40) regulate AAV replication
and packaging (reviewed in [15]). In 2010 one
additional protein coding region has been
described, the aap, which codes for an assem-
bly-activating protein (AAP) responsible for
proper capsid assembly [12, 16]. However, sub-
nuclear localization of AAP varies among dif-
ferent serotypes, and AAP was described as
being nonessential in AAV4, AAV5, and AAV11
[16].
In total 13 AAV serotypes have been described
so far. While serotypes 2, 3, 5, and 6 were iso-
lated from humans, serotypes 1, 4, and 7–11 were
discovered in nonhuman primates [7, 20].
Serotypes share 65–99% sequence and 95–99%
structural identity (reviewed in [7]).
During their lysogenic cycle, 0.1–0.5% of
wildtype AAVs integrate into the host genome at
the AAVS1 site of chromosome 19, which con-
tains a Rep binding element. At a much lower
frequency, random genome integration is also
possible (reviewed in [6, 11]).
Gene therapeutic approaches design recombi-
nant AAVs (rAAV), which only contain ITR
flanked transgenes and no viral DNA to ensure
low immunogenicity and cytotoxicity. To pro-
duce virus particles for injection, the required
Rep protein is supplied in trans to exclude
genome integration at the AAVS1 site in vivo.
Thus, transduced cells usually keep the genome
of the injected rAAVs as a double-stranded circu-
lar episome. However, the ability of the delivered
DNA to integrate at nonhomologous sites is
given with a frequency of about 0.1% (reviewed
in [11]).
L. J. A. Ebner and C. Grimm
2 Serotype Tropism Defines
Cell- Tissue- and
Host-Infection
Throughout infection, the capsid represents the
primary contact to the host cell. This interaction
is defined by tissue and cellular tropism and
needs to be optimized for each experimental
approach. rAAVs enter cells through the interac-
tion with specific carbohydrates presented on the
surface of target cells, including sialic acid,
galactose, and heparin sulfate. Differences in the
binding preferences, determined by the capsid
structure, influence target cell-type specificity
and transduction efficiency. For example, sero-
type 2 cell receptors include heparan sulfate pro-
teoglycan (HSPG) as a primary receptor [17].
The wide expression of HSPG on the surface of
many cell types explains the wide tropism of
AAV2. In the eye, only rAAVs of serotype 2 can
efficiently transduce the retina after intravitreal
injections, mainly because its binding receptor
HSPG is part of the inner limiting membrane
allowing the virus particles to accumulate at the
vitreoretinal junction. In contrast, AAV5, which
has a sialic acid binding site fails to transduce the
retina upon vitreal injections [5].
Post attachment, additional receptors such as
αVβ5 and α5β1 integrins [2, 18], fibroblast growth
factor receptor 1 (FGFR1) [14], and hepatocyte
growth factor receptor (c-Met) [10] mediate cel-
lular entry and function as co-receptors.
3 The Eye as a Therapeutic
Target
The eye and the retina specifically feature a
structural environment suitable for AAV deliv-
ery. Not only does the accessible, enclosed
structure make the eye suitable for treatment,
but the high compartmentalization also allows a
precise delivery of vectors to the vicinity of tar-
get cells. Systemic side effects are minimized
by the blood-retina barrier, and the immune-
AAV Serotypes and Their Suitability for Retinal Gene Therapy
privileged site reduces immunogenic clearance.
Defects in photoreceptors represent the majority
of causes for IRDs. Thus, the identification of a
photoreceptor transducing serotype is highly
requested. Such a serotype has been identified in
AAV2 that can mediate expression in photore-
ceptors and in the retinal pigment epithelium
(RPE) through binding to HSPG (neural retina),
FGFR1 co-receptor (Müller- and RPE cells),
and αVβ5 integrin (apical surface of RPE) [1].
To further expand the repertoire of AAV vectors
and achieve a more cell-type-specific transduc-
tion in the retina, hybrid vectors were generated.
They contain the same therapeutic gene packed
between serotype 2 ITRs but are combined with
a capsid from a different AAV serotype such as
AAV8 (named AAV2/8). These pseudotype
AAVs can circumvent preexisting immunity to
one serotype and improve retinal transduction
kinetics (reviewed in [3]). AAV2/5, for example,
is more efficient in targeting neurons than
AAV2/2 and shows a greater area of transduc-
tion. Additional recombinant techniques like
direct evolution or random peptide library inser-
tions are used to create AAVs with unique and
suited characteristics. Even exchanges of single
surface residues such as tyrosine-­ to-
phenylalanin (Y-F) mutations in AAV2 are used,
for example, to prevent proteasomal degrada-
tion and increase transduction efficiency in the
retina [13].
4 Concluding Remarks
and Future Directions
Efficient treatment for IRDs by gene therapy is
highly dependent on efficient transduction of
specific retinal cell types. Thus, precise under-
standing of capsid tropism is necessary, and engi-
neered capsids are beneficial to reach this goal.
Additional techniques are employed to reduce
sensitivity to neutralizing antibodies which influ-
ence transduction efficiency [8]. Large screen-
ings identifying efficient serotypes in nonhuman
primates or human-­derived tissues are necessary
for a safe and effective translation into the clinics.
Thus, also improved techniques in human derived
133
induced-­pluripotent stem cells, and retinal organ-
oid systems are likely to lead to a more precise
design of serotypes. A major drawback of AAV
therapy is the limited size of the expression cas-
sette. Thus, lentivirus or nanoparticles display
alternative options for delivering large expression
cassettes. Especially, multifactorial diseases like
age-­related macular degeneration will depend on
gene-independent therapies that target common
disease pathways to reach a broad spectrum of
patients, independently from underlying
mutations.
References
1. Ali RR, Reichel MB, Thrasher AJ, Levinsky RJ,
Kinnon C, Kanuga N, Hunt DM, Bhattacharya
SS. Gene transfer into the mouse retina mediated by
an adeno-associated viral vector. Hum Mol Genet.
1996;5:591–4.
2. Asokan A, Hamra JB, Govindasamy L, Agbandje-­
McKenna M, Samulski RJ. Adeno-associated
virus type 2 contains an integrin alpha5beta1 bind-
ing domain essential for viral cell entry. J Virol.
2006;80:8961–9.
3. Auricchio A. Pseudotyped AAV vectors for constitu-
tive and regulated gene expression in the eye. Vis Res.
2003;43:913–8.
4. Bohenzky RA, Lefebvre RB, Berns KI. Sequence
and symmetry requirements within the internal pal-
indromic sequences of the adeno-associated virus ter-
minal repeat. Virology. 1988;166:316–27.
5. Dalkara D, Kolstad KD, Caporale N, Visel M,
Klimczak RR, Schaffer DV, Flannery JG. Inner
limiting membrane barriers to AAV-mediated
retinal transduction from the vitreous. Mol Ther.
2009;17:2096–102.
6. Deyle DR, Russell DW. Adeno-associated virus vec-
tor integration. Curr Opin Mol Ther. 2009;11:442–7.
7. Drouin LM, Agbandje-McKenna M. Adeno-­
associated virus structural biology as a tool in vector
development. Futur Virol. 2013;8:1183–99.
8. Fitzpatrick Z, Leborgne C, Barbon E, Masat E,
Ronzitti G, van Wittenberghe L, Vignaud A, Collaud
F, Charles S, Simon Sola M, Jouen F, Boyer O,
Mingozzi F. Influence of pre-existing anti-capsid neu-
tralizing and binding antibodies on AAV vector trans-
duction. Mol Ther Methods Clin Dev. 2018;9:119–29.
9. Han IC, Cheng JL, Burnight ER, Ralston CL, Fick
JL, Thomsen GJ, Tovar EF, Russell SR, Sohn EH,
Mullins RF, Stone EM, Tucker BA, Wiley LA. Retinal
tropism and transduction of adeno-associated virus
varies by serotype and route of delivery (intravitreal,
subretinal, or suprachoroidal) in rats. Hum Gene Ther.
2020;31:1288–99.
134
10. Kashiwakura Y, Tamayose K, Iwabuchi K, Hirai Y,
Shimada T, Matsumoto K, Nakamura T, Watanabe M,
Oshimi K, Daida H. Hepatocyte growth factor recep-
tor is a coreceptor for adeno-associated virus type 2
infection. J Virol. 2005;79:609–14.
11. McCarty DM, Young SM, Samulski RJ. Integration of
adeno-associated virus (AAV) and recombinant AAV
vectors. Annu Rev Genet. 2004;38:819–45.
12. Naumer M, Sonntag F, Schmidt K, Nieto K, Panke
C, Davey NE, Popa-Wagner R, Kleinschmidt
JA. Properties of the adeno-associated virus assembly-­
activating protein. J Virol. 2012;86:13038–48.
13. Petrs-Silva H, Dinculescu A, Li Q, Min S-H, Chiodo
V, Pang J, Zhong L, Zolotukhin S, Srivastava A, Lewin
AS, Hauswirth WW. High-efficiency t­ransduction of
the mouse retina by tyrosine-mutant AAV serotype
vectors. Mol Ther. 2009;17:463–71.
14. Qing K, Mah C, Hansen J, Zhou S, Dwarki V,
Srivastava A. Human fibroblast growth factor receptor
1 is a co-receptor for infection by adeno-associated
virus 2. Nat Med. 1999;5:71–7.
L. J. A. Ebner and C. Grimm
15. Samulski RJ, Muzyczka N. AAV-mediated gene ther-
apy for research and therapeutic purposes. Annu Rev
Virol. 2014;1:427–51.
16. Sonntag F, Schmidt K, Kleinschmidt JA. A viral
assembly factor promotes AAV2 capsid formation in
the nucleolus. Proc Natl Acad Sci. 2010;107:10220–5.
17. Summerford C, Samulski RJ. Membrane-associated
heparan sulfate proteoglycan is a receptor for adeno-
associated virus type 2 virions. J Virol. 1998;72:1438–45.
18. Summerford C, Bartlett JS, Samulski RJ. AlphaVbeta5
integrin: a co-receptor for adeno-associated virus type
2 infection. Nat Med. 1999;5:78–82.
19. Trapani I, Auricchio A. Seeing the light after 25
years of retinal gene therapy. Trends Mol Med.
2018;24:669–81.
20. Weitzman MD, Linden RM. Adeno-associated virus
biology. In: Snyder RO, Moullier P, editors. Adeno-­
associated virus. Methods and protocols. New York:
Humana Press; 2011. p. 1–23.
21. Zhou X, Muzyczka N. In vitro packaging of adeno-­
associated virus DNA. J Virol. 1998;72:3241–7.
 Gene Augmentation for Autosomal
Dominant CRX-Associated
Retinopathies
Chi Sun and Shiming Chen
Abstract
The cone-rod homeobox (CRX) protein is a
key transcription factor essential for photore-
ceptor function and survival. Mutations in
human CRX gene are linked to a wide spec-
trum of blinding diseases ranging from mild
macular dystrophy to severe Leber congenital
amaurosis (LCA), cone-rod dystrophy (CRD),
and retinitis pigmentosa (RP). These diseases
are still incurable and mostly inherited in an
autosomal dominant form. Dysfunctional
mutant CRX protein interferes with the func-
tion of wild-type CRX protein, demonstrating
the dominant negative effect. At present, gene
augmentation is the most promising treatment
strategy for hereditary diseases. This study
aims to review the pathogenic mechanisms of
various CRX mutations and propose two ther-
apeutic strategies to rescue sick photorecep-
tors in CRX-associated retinopathies, namely,
C. Sun (*)
Department of Ophthalmology and Visual Sciences,
Washington University, St. Louis, MO, USA
e-mail: sunchi@wustl.edu
S. Chen
Department of Ophthalmology and Visual Sciences,
Washington University, St. Louis, MO, USA
Department of Developmental Biology, Washington
University, St. Louis, MO, USA
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_21
Tet-On-hCRX system and adeno-associated
virus (AAV)-mediated gene augmentation. The
outcome of proposed studies will guide future
translational research and suggest guidelines
for therapy evaluation in terms of treatment
safety and efficacy.
Keywords
CRX mutations · Dominant negative effects ·
Gene augmentation · Tet-On · AAV gene
therapy
1 Pathogenic Mechanisms
of CRX Mutations
The human cone-rod homeobox gene CRX
(OMIM #602225) is located on chromosome
19q13.33. There are four exons in CRX, specifi-
cally, the first noncoding and three coding exons.
CRX codes for a 299 amino acid transcription
factor which is predominantly expressed in pho-
toreceptors and the pineal gland, regulating pho-
toreceptor development and maintenance [1, 2].
The protein consists of three major domains: the
homeodomain at residues 39–99 facilitates the
DNA binding; the activation domain at residues
113–284, including a WSP motif at residues
158–170, contains binding sites for other tran-
scription coregulators; a conserved carboxyl ter-
135
136
minus motif, also known as the OTX tail, is found
at resides 284–295 [1, 3].
To date, 93 disease-causing CRX mutations
have been identified in human patients (www.
hgmd.cf.ac.uk). Pathogenic CRX variants are
associated with a complex group of inherited reti-
nal diseases (IRDs) such as macular dystrophy
[4], cone-rod dystrophy (CRD) [1], retinitis pig-
mentosa (RP) [5], and Leber congenital amauro-
sis (LCA) [6, 7]. Mutations within CRX are
known to occur de novo or to be inherited mostly
in an autosomal dominant pattern, consisting of
substitution (nonsense and missense mutations)
and frameshift mutations (deletions and inser-
tions) [8]. Our understanding of these mutations
has significantly expanded, as a great variety are
being analyzed with the advent of cutting-edge
tools from the sequencing and analytic technolo-
gies. However, a tremendous challenge for the
pathogenic analysis of CRX-associated retinopa-
thies, particularly of the autosomal dominant dis-
orders, is to explore the phenotype-genotype
correlations between disease severity and CRX
mutations.
CRX mutations could cause dominant disor-
ders by two possible mechanisms, namely, the
haploinsufficiency of the functional CRX and/or
various dominant negative or gain-of-function
effects of the mutant CRX. To the extent of data
published, haploinsufficiency may not cause
severe phenotypes. The study on Crx+/− mice cor-
roborates this claim, as they do not develop any
detectable functional defects up to 6 months [9].
A rare case of human patients with the heterozy-
gosity of CRX also supports these observations,
as only the patients with the nullizygosity of CRX
develop LCA [10]. However, in the autosomal
dominant disorders, it remains unknown if the
mutant CRX allele could partially abrogate the
production of a functional CRX from the normal
allele. Further studies are needed to address this
question in detail. Alternatively, dominant nega-
tive activities of various CRX mutant proteins
have been demonstrated in animal models [9,
11]. The reported dominant-negative mutations
that arise in the homeodomain are mostly mis-
sense mutations, and those identified in the acti-
vation domain are largely frameshifts [7, 9].
C. Sun and S. Chen
Pathogenic mechanisms thus are constituted by
altered DNA binding properties and/or transacti-
vation activities of CRX mutant proteins.
CRX R90W mutation presents a hypomorphic
missense mutation located in the homeodomain
[3, 12] and is associated with a dominant late-­
onset mild CRD and recessive LCA. The mutant
protein has reduced DNA binding activity and
thus malfunctions to transactivate CRX-­
downstream target genes such as Rhodopsin [3,
12]. The transactivation activity of wild-type
(WT) CRX seems normal in the heterozygous
model [3], which proves the limited dominant
negative effect of the CRX R90W mutation
through the process of retinal development. On
the other hand, CRX E80A and K88N mutations
represent distinct antimorphic missense muta-
tions located in the homeodomain [13–15]. Both
mutations manifest LCA in human patients [1,
14]. Interestingly, some LCA-associated CRX
homeodomain mutations are located at non-­
conserved residues in human homeodomain par-
alogues [4]. These mutant proteins are predicted
to bind discrete DNA sequences and show differ-
ent transactivation activities from the WT pro-
tein, although this has not yet been studied in
mammalian models. Hence, the dominant nega-
tive effects of the mutant proteins, if any, remain
to be proven.
The frameshift deletion CRX E168d2 presents
an antimorphic mutation located in the activation
domain [3] and is associated with dominant LCA
in human patients [6, 16]. This mutation results
in the early truncation of the activation domain,
producing a protein that retains the ability to bind
target DNA but fails to transactivate CRX-­
downstream target genes [3]. In addition, CRX
E168d2 allele overproduces the mutant protein at
about 4 times more than the WT protein in het-
erozygous mice, which exacerbates the dominant-­
negative effect on the binding competition [3]. As
a result, the heterozygous mice have impaired
visual functions at 1 month-old (MO) [3] and
limited electroretinography (ERG) response at
3MO (data not shown). Cone degeneration occurs
prior to rod degeneration in the heterozygous
mice. As compared to the WT samples, the het-
erozygous mice have only about 30% survived
Gene Augmentation for Autosomal Dominant CRX-Associated Retinopathies
cones at 1 month-old (MO) and no detectable
cones at 3MO (data not shown); mutant rods are
functional with shorter outer segments (OS) at
1MO but undergo progressive degeneration till
complete lost at 6MO [3]. Interestingly, the ratio
of mutant to WT CRX proteins directly correlates
with the disease phenotype severity and age of
onset [3]. In addition, truncation at the last exon
by frameshift results in premature terminations
[7, 8], hence the production of shortened but sta-
ble mutant mRNA that can avoid nonsense-­
mediated decay [17], which partially contributes
to the dominant negative effect. On the other
hand, CrxRip presents the c.763del1 mutation
located in the last exon, which results in a skip-
ping of the OTX tail and a non-homologous
extension of 133 residues [18]. The mutant pro-
tein does not transactivate CRX-downstream tar-
get genes, suggesting its antimorphic activity
[18]. More notably, the mutant protein does not
bind target DNA [18]. Similar to the retinal mani-
festation in patients, CrxRip/+ mice show a LCA-­
like phenotype [18]. Photoreceptors in CrxRip/+
mice do not form outer segments, due to impaired
photoreceptor gene expression and incomplete
differentiation at early development [18]. In addi-
tion, the mutant protein is not overexpressed in
CrxRip/+ mice. Taken together, the dominant nega-
tive effect of CrxRip mutation does not signify a
competition between the mutant and WT proteins
but likely arises from the disruption of the photo-
receptor transcription factor network.
2 Gene Augmentation
as a Strategy to Treat CRX-­
Associated Retinopathies
There are currently limited therapeutic options
for CRX-associated retinopathies. Fortunately,
retinal gene therapy recently shines promise for
treatment of various inherited blindness [19]. In
particular, the gene augmentation approach has
been developed to deliver a healthy gene to a dis-
eased retina to rescue the defective phenotypes
and visual functions without replacing the mutant
allele. At present, successes of gene augmenta-
tion are largely restricted to recessive mutations
137
[20]. Five important questions need to be
answered in order to apply gene augmentation to
treat CRX-associated autosomal dominant disor-
ders. Firstly, how much of augmented CRX is
needed to overcome the dominant negative effect
of a given mutation? If a mutant protein competes
with WT CRX proteins for binding sites, how
much is augmented CRX needed to balance the
ratio of mutant to WT CRX proteins in each pho-
toreceptor? Can altering this ratio rescue the
mutant phenotypes? Secondly, considering CRX
is an early photoreceptor transcription factor that
activates the downstream gene regulatory net-
work in the retinal development, could gene aug-
mentation impose overexpression toxicity in a
treated retina? Thirdly, when is augmented CRX
needed in the treatment? Fourthly, as human
patients with CRX-associated retinopathies are
often diagnosed at different stages of disease pro-
gression, what are the windows of opportunities
for gene augmentation to a given disease? Do dis-
eased photoreceptors possess the neuroplasticity
for gene augmentation outside the development
window? Lastly, can the treated photoreceptors
retain their fated cell identity and functional
capability upon gene augmentation?
Answers to these questions could inform the
feasibility and strategies to treat CRX-associated
retinopathies. To address these questions at least
partially, a new transgenic mouse model, Tet-On-­
hCRX, has been developed to allow both quanti-
tative and temporal control of augmented human
CRX (hCRX) gene expression under a given CRX
mutant background (Fig. 1). Upon binding of
doxycycline, a conformation change of the
reverse tetracycline-controlled transcriptional
activator (rtTA) is triggered [21], which allows
the resulted complex bind to tetracycline-­
responsive element (TRE) (Tet-On) [22]. FLAG-­
tagged human CRX protein will hence be
produced (Fig. 1a). Moreover, the photoreceptor-­
specific induction can be achieved by the combi-
nation of two transgenes, namely, a Cre-dependent
pCAG-LSL-rtTA (Fig. 1b) and a Crx promoter-­
driven Cre, pCrx-Cre [23] (Fig. 1c). Proof-of-­
concept validation of gene augmentation by
Tet-On-hCRX system shows that CRX expression
can be induced and detected in Crx−/− mouse reti-
138 C. Sun and S. Chen

Fig. 1 Components of Tet-On-hCRX system. (a) TRE-hCRX (b) pCAG-LSL-rtTA (c) pCrx-Cre

downstream Rho expression. Furthermore, the

comparisons between treated mice with different
starts of the treatments suggests the “early the
better” effect on induced CRX and Rho expres-
sion at P35, as samples with P0–35 treatment dis-
play significantly higher induced CRX and Rho
expression than those with P14–35 or P21–35
treatments (Fig. 2a, b). However, as compared to
the WT samples, treated mice still have signifi-
cantly lower CRX and Rho expression at P35
under current treatment schemes, implying a par-
tial rescue effect. These results suggest that Crx-­
null photoreceptors retain the machinery for
CRX-mediated gene expression and neuroplasti-
city for therapeutic intervention.
As compared to Tet-On-hCRX system, a clini-
Fig. 2 Quantitative PCR (qPCR) analysis of hCrx and
cally applicable approach is adeno-associated
Rho expression in untreated Crx−/−, Crx-BAC-Cre+, Tet-­
On-­hCRX ; doxycycline-treated Crx , Crx-BAC-Cre ,
+ −/− + virus (AAV)-mediated gene augmentation. The
Tet-On-hCRX ; WT mice. (a) Treatments started at P0;
+ retina is surgically accessible, which facilitates
samples were harvested at P5, P14, P21, or P35. (b) intravitreal or subretinal administration of the
Treatments started at P14 or P21; samples were harvested
viral vector [24, 25]. Since the retina is a rela-
at P35. Results are plotted as relative Log2 expression to
untreated samples (n ≥ 4). Asterisks (**, ***, ****) tively immune privileged tissue [24] and photore-
denote p ≤ 0.01, p ≤ 0.001 and p ≤ 0.0001, respectively, ceptors are nondividing and differentiated [26], a
by T-test small amount of the non-integrating AAV viral
vector can be tolerated to generate a therapeutic
nae at all tested ages throughout the entire devel- response [24, 25] with minimal risk of stimulat-
opmental window (postnatal (P) day 5, 14, 21 ing a severe inflammatory immune response [25].
and 35) (Fig. 2), confirming the success of Tet-­ Yet, two immediate challenges emerge during
On-­hCRX system. Doxycycline-treated samples testing AAV-mediated CRX gene augmentation
also display significant upregulation of CRX-­ with animal models, i.e., choice of AAV vectors
Gene Augmentation for Autosomal Dominant CRX-Associated Retinopathies
and cell-type specificity. To date, the AAV2/5 vec-
tor yields efficient transduction and good tropism
for photoreceptors in P0 mice [27]. Also, the size
of human or mouse CRX cDNA well fits into the
AAV packaging capacity. Also, photoreceptor-­
specific promoters, including CRX or GRK, can
be employed to achieve desirable sensitivity and
precision.
However, there are still several safety precau-
tions of applying AAV-mediated gene augmenta-
tion. Although subretinal administration is
currently the most efficient route for targeting
photoreceptors [28], it causes a transient detach-
ment of the RPE from photoreceptors, which
might damage photoreceptors at the injection
site. A possible solution is the use of low-volume
and low-concentration multiple blebs to reduce
the danger of the RPE detachment and systemic
exposure of high concentration by a single bleb,
despite of associated minor risks [29, 30]. In
addition, immunity and tolerance to AAV is
untested in human photoreceptors at early and
middle childhood [31], and multiplicity of infec-
tion (MOI) of viral vectors per cell may vary at
different stages of the disease, all of which
require further trials on human patients with
early-onset diseases.
3 Unanswered Questions
and Challenges
One-step gene augmentation may not rescue all
CRX-associated autosomal dominant disorders.
For examples, gain-of-function activities of a
mutant protein with altered DNA binding speci-
ficity, such as CRX K88N, may generate the irre-
versible but detrimental effects on the
developmental program. In such cases, expres-
sion from the mutant allele needs to be silenced
to prevent the disease progression. Similar
approaches of treating RHO-associated autoso-
mal dominant RP in the mouse and canine mod-
els have shown encouraging outcomes [32, 33].
In addition, the CRISPR-Cas9/gRNA technique
139
[34–37] can also be used to knockout the mutant
allele.
Since gene augmentation utilizes the tran-
scription machinery of the host cells to express
the functional protein, cellular conditions of the
host cells require close monitoring. In a develop-
ing retina, CRX gene augmentation may not fully
rescue mutations that block early differentiation
in photoreceptors, due to an insufficient but early
window of opportunity. On the contrary, when
the host cells are at the late stage of degeneration
or the degeneration tends to progress too fast,
gene augmentation may not succeed. Prerequisite
anti-apoptotic or neuroprotective therapies can
be combined to target the defective photorecep-
tors in order to gain a required time window for
gene augmentation [38, 39].
Maculopathy has been reported in human
patients of different CRX mutations with large
variability in disease progression and symptoms
[4, 40–42]. In addition, CRX may be involved in
foveal development, as the haploinsufficiency of
CRX results in subclinical foveal abnormalities in
human patients [10]. None of these observations
can be validated and studied in non-primate
models.
The phenotypic and onset variability between
patients sharing the same CRX mutant allele has
constantly been reported [4, 7, 10, 43, 44]. It
may be due to, firstly, possible polymorphisms
in the CRX promoter region; secondly, the
impacts of possible epigenetic modifications in
coding regions; thirdly, any differential expres-
sion of other transcription factors such as NRL
and NR2E3; fourthly, variable expression levels
of the WT and/or mutant alleles; lastly, sexual
dimorphisms [42], suggesting CRX may inter-
act with specific targets on the sex chromo-
somes. None of these hypotheses has
systematically been tested in animal models. In
addition, the stochastic effects of CRX muta-
tions and overexpression toxicity on the retinal
degeneration are currently unknown, which
appends uncertainty on the application of gene
augmentation.
140
4 Methods
4.1 Transgenic Mouse Lines
All male and female mice in this study were on
the genetic background of C57BL/6J. TRE-hCRX
line was generated for this study. The transgene
had a TRE promoter upstream of full-length
human CRX cDNA sequence, all inserted into the
References
H11 locus. pCAG-LSL-rtTA (Rosa26:pCAG-­ 1. Freund CL, et al. Cone-rod dystrophy due to muta-
LSL-­rtTA) line was obtained from the Jackson
Laboratory (Stock No: 029617). pCrx-Cre
(BAC-Tg Crx-Cre) line was obtained from a pub-
lished colony [23]. Doxycycline diets (200 mg/
kg, Bio-Serv, NJ) were provided to mice (>P14)
and breeding dams. Intraperitoneal (IP) injec-
tion of 100 μL of 20 mg/mL doxycycline solu-
tion was provided to mice (>P21) once a week
to maximize the treatment effect. All animal
procedures were conducted according to the
Guide for the Care and Use of Laboratory
Animals of the National Institute of Health and
were approved by the Washington University in
St. Louis Institutional Animal Care and Use
Committee.
4.2 Quantitative PCR (qPCR)
Each RNA sample was extracted from 2 retinae
of a mouse using the NucleoSpin RNA Plus kit
(Macherey-Nagel, PA). 1 μg of RNA was used to
produce cDNA using First Strand cDNA
Synthesis kit (Roche, IN). Technical triplicates
were run for each gene. Primers (5′ to 3′)
used in this study were Crx (F) TGTCCC
ATACTCAAGTGCCC, (R) TGCTGTTTCTGC
TGCTGTCG; Rho (F) GCTTCCCTACGCC
AGTGTG, (R) CAGTGGATTCTTGCCGCAG;
Ubb (F) CAACATCCAGAAAGAGTCAACC,
(R) ATGTTGTAATCAGAGAGGGTGC. The
reaction master mix consisted of EvaGreen poly-
merase (Bio-Rad Laboratories, CA), 1 μM primer
mix, and diluted cDNA samples. Samples were
run using a two-step 40-cycle protocol on a
Bio-Rad CFX96 Thermal Cycler (Bio-Rad
­ 13.
Laboratories, CA). The statistical analysis is
done by Student’s t-test with p < 0.05, CI:95%.
C. Sun and S. Chen
Acknowledgments The authors are grateful to Dr. Tom
Glaser for pCrx-Cre mice as a gift, to Dr. Ke Jiang for
critical evaluation of the manuscript. Funding was
provided by R01 EY012543 and R01 EY032136 (SC),
RPB unrestricted fund (WU-DOVS), EY002687
(WU-DOVS), and McDonnell Center for Cellular and
Molecular Neurobiology Fellowship (CS).
tions in a novel photoreceptor-specific Homeobox
gene (CRX) essential for maintenance of the photore-
ceptor. Cell. 1997;91(4):543–53.
2. Chen S, et al. Crx, a novel Otx-like paired-­
homeodomain protein, binds to and Transactivates
photoreceptor cell-specific genes. Neuron.
1997;19(5):1017–30.
3. Tran NM, et al. Mechanistically distinct mouse mod-
els for CRX-associated retinopathy. PLoS Genet.
2014;10(2):e1004111.
4. Hull S, et al. The phenotypic variability of retinal
dystrophies associated with mutations in CRX, with
report of a novel macular dystrophy phenotype. Invest
Ophthalmol Vis Sci. 2014;55(10):6934–44.
5. Sohocki MM, et al. Prevalence of mutations causing
retinitis pigmentosa and other inherited retinopathies.
Hum Mutat. 2001;17(1):42–51.
6. Freund CL, et al. De novo mutations in the CRX
homeobox gene associated with Leber congenital
amaurosis. Nat Genet. 1998;18(4):311–2.
7. Rivolta C, et al. Novel frameshift mutations in CRX
associated with Leber congenital amaurosis. Hum
Mutat. 2001;18(6):550–1.
8. Stenson PD, et al. The human gene mutation data-
base: building a comprehensive mutation repository
for clinical and molecular genetics, diagnostic test-
ing and personalized genomic medicine. Hum Genet.
2014;133(1):1–9.
9. Tran NM, Chen S. Mechanisms of blindness: animal
models provide insight into distinct CRX-associated
retinopathies. Dev Dyn. 2014;243(10):1153–66.
10. Ibrahim MT, et al. A complete, homozygous CRX
deletion causing nullizygosity is a new genetic
mechanism for Leber congenital amaurosis. Sci Rep.
2018;8(1):5034.
11. Ruzycki PA, et al. Crx-L253X mutation produces
dominant photoreceptor defects in TVRM65 mice.
Invest Ophthalmol Vis Sci. 2017;58(11):4644–53.
12. Swaroop A, et al. Leber congenital Amaurosis caused
by a homozygous mutation (R90W) in the homeodo-
main of the retinal transcription factor CRX: direct
evidence for the involvement of CRX in the devel-
opment of photoreceptor function. Hum Mol Genet.
1999;8(2):299–305.
Chen S, et al. Functional analysis of cone–rod homeo-
box (CRX) mutations associated with retinal dystro-
phy. Hum Mol Genet. 2002;11(8):873–84.
Gene Augmentation for Autosomal Dominant CRX-Associated Retinopathies
14. Nichols LL II, et al. Two novel CRX mutant pro-
teins causing autosomal dominant Leber congenital
amaurosis interact differently with NRL. Hum Mutat.
2010;31(6):E1472–83.
15. Terrell D, et al. OTX2 and CRX rescue overlapping
and photoreceptor-specific functions in the drosophila
eye. Dev Dyn. 2012;241(1):215–28.
16. Jacobson SG, et al. Retinal degenerations with
truncation mutations in the cone-rod homeo-
box (CRX) gene. Invest Ophthalmol Vis Sci.
1998;39(12):2417–26.
17. Lejeune F, Maquat LE. Mechanistic links between
nonsense-mediated mRNA decay and pre-mRNA
splicing in mammalian cells. Curr Opin Cell Biol.
2005;17(3):309–15.
18. Roger JE, et al. OTX2 loss causes rod differentiation
defect in CRX-associated congenital blindness. J Clin
Invest. 2014;124(2):631–43.
19. Campa C, et al. The role of gene therapy in the treat-
ment of retinal diseases: a review. Curr Gene Ther.
2017;17(3):194–213.
20. Vazquez-Dominguez I, Garanto A, Collin
RWJ. Molecular therapies for inherited retinal
diseases-­current standing. Oppor Chall Genes (Basel).
2019;10(9):654.
21. Das AT, Tenenbaum L, Berkhout B. Tet-on systems
for doxycycline-inducible gene expression. Curr
Gene Ther. 2016;16(3):156–67.
22. Gossen M, et al. Transcriptional activation by
tetracyclines in mammalian cells. Science.
1995;268(5218):1766–9.
23. Prasov L, Glaser T. Pushing the envelope of retinal
ganglion cell genesis: context dependent function of
Math5 (Atoh7). Dev Biol. 2012;368(2):214–30.
24. Öner A. Recent advancements in gene therapy for
hereditary retinal dystrophies. Turkish J Ophthalmol.
2017;47(6):338–43.
25. Gupta PR, Huckfeldt RM. Gene therapy for inher-
ited retinal degenerations: initial successes and future
challenges. J Neural Eng. 2017;14(5):051002.
26. Patrício MI, et al. Inclusion of the woodchuck
hepatitis virus posttranscriptional regulatory ele-
ment enhances AAV2-driven transduction of
mouse and human retina. Mol TherNucleic Acids.
2017;6:198–208.
27. Watanabe S, et al. Tropisms of AAV for subretinal
delivery to the neonatal mouse retina and its appli-
cation for in vivo rescue of developmental photo-
receptor disorders. PLoS One. 2013;8(1):e54146.
28. Planul A, Dalkara D. Vectors and gene delivery to the
retina. Annual Rev Vision Sci. 2017;3(1):121–40.
141
29. Peng Y, Tang L, Zhou Y. Subretinal injection: a review
on the novel route of therapeutic delivery for vitreo-
retinal diseases. Ophthalmic Res. 2017;58(4):217–26.
30. Xue K, et al. Technique of retinal gene therapy: deliv-
ery of viral vector into the subretinal space. Eye.
2017;31(9):1308–16.
31. Verdera HC, Kuranda K, Mingozzi F. AAV vector
immunogenicity in humans: a long journey to suc-
cessful gene transfer. Mol Ther. 2020;28(3):723–46.
32. Millington-Ward S, et al. Suppression and replace-
ment gene therapy for autosomal dominant disease in
a murine model of dominant retinitis pigmentosa. Mol
Ther. 2011;19(4):642–9.
33. Cideciyan AV, et al. Mutation-independent rho-
dopsin gene therapy by knockdown and replace-
ment with a single AAV vector. Proc Natl Acad Sci.
2018;115(36):E8547.
34. Yu W, Wu Z. In vivo applications of CRISPR-based
genome editing in the retina. Front Cell Dev Biol.
2018;6:53.
35. Hung SSC, et al. AAV-mediated CRISPR/Cas gene
editing of retinal cells in vivo. Invest Ophthalmol Vis
Sci. 2016;57(7):3470–6.
36. Trapani I, Auricchio A. Seeing the light after 25
years of retinal gene therapy. Trends Mol Med.
2018;24(8):669–81.
37. Suzuki K, et al. In vivo genome editing via CRISPR/
Cas9 mediated homology-independent targeted inte-
gration. Nature. 2016;540(7631):144–9.
38. Petit L, Punzo C. Gene therapy approaches for
the treatment of retinal disorders. Discov Med.
2016;22(121):221–9.
39. Chinskey ND, Besirli CG, Zacks DN. Retinal cell
death and current strategies in retinal neuroprotection.
Curr Opin Ophthalmol. 2014;25(3):228–33.
40. Ozdek S, et al. Bilateral disc edema and unilateral
macular hole in a patient with retinitis pigmentosa.
Eur J Ophthalmol. 2006;16(3):487–90.
41. Griffith JF, DeBenedictis MJ, Traboulsi EI. A novel
dominant CRX mutation causes adult-onset macular
dystrophy. Ophthalmic Genet. 2018;39(1):120–4.
42. Gonzalez-Gonzalez LA, et al. Novel clinical presen-
tation of a CRX rod-cone dystrophy. BMJ Case Rep.
2021;14(4):e233711.
43. Paunescu K, et al. Genotype–phenotype correlation in
a german family with a novel complex CRX mutation
extending the open reading frame. Ophthalmology.
2007;114(7):1348–57.e1.
44. Lu Q-K, et al. A novel CRX mutation by whole-exome
sequencing in an autosomal dominant cone-rod dys-
trophy pedigree. Int J Ophthalmol. 2015;8(6):1112–7.
 Txnip Gene Therapy of Retinitis
Pigmentosa Improves Cone Health

Yunlu Xue

Abstract Keywords

Retinitis pigmentosa · Cone photoreceptors ·

Retinitis pigmentosa (RP) is a hereditary reti-
nal degenerative disease that can lead to blind-
ness. In RP, rod photoreceptors die first,
followed by cone photoreceptors death due to
unknown mechanisms. However, one clue for
cone death concerns their metabolism. Early
changes suggest that they do not have enough
glucose, which normally fuels their metabo-
lism. We sought to design adeno-associated
virus (AAV)-based gene therapy to address
their metabolic challenges and found that
overexpressing Txnip is an effective gene
therapy that extends cone survival and vision
in three strains of RP mice. The Txnip-­
mediated rescue was found to be dependent
upon lactate dehydrogenase b (Ldhb), which
is required for lactate catabolism. Txnip also
was found to improve mitochondrial health.
Herein, we propose a model in which Txnip
shifts cones from their normal reliance on glu-
cose to enhanced utilization of lactate to ben-
efit cones in a condition where the glucose
supply is limiting.
Y. Xue (*)
Department of Genetics, Blavatnik Institute,
Harvard Medical School, Boston, MA, USA
e-mail: yunlu_xue@hms.harvard.edu
Retina metabolism · Gene therapy · Retinal
degeneration
1 Introduction
RP is one of the most prevalent inherited blinding
diseases. It affects ~1 in 4000 people worldwide.
RP also has a high heterogeneity in terms of the
types and number of disease genes. Mutation in
any one of ~100 genes creates night blindness,
which is followed by loss of cone-mediated day-
light, color, and high acuity vision. With the pro-
gression of the disease, RP patients gradually
lose their peripheral vision, being left with “tun-
nel vision.” Eventually, some of the patients lose
the central high acuity vision and become legally
blind. This devastating disease typically origi-
nates within the photoreceptors.
In RP, rods are typically directly affected by
the disease genes. At least some of the disease
genes are only expressed in rods (e.g., PDE6B)
and cones are initially totally functional. When
rods die, the cones gradually get sick and begin to
lose function. The cones start to die only when
the majority of the neighboring rods are gone,
leading to the severe loss of the daylight color
vision in the corresponding visual field.
Regardless of what disease genes patients carry,

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 143
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_22
144
it seems that the RP cone degeneration pattern is
always the same, that is, secondary to the rod
death. Our ultimate goals are (1) to understand
the mechanism of the nonautonomous cone death
in RP and (2) to find a generic (i.e., gene-­agnostic)
treatment to preserve cones in RP to save the day-
light color vision.
2 RP Glucose Hypothesis
Several hypotheses of RP cone degeneration have
been proposed. One of them is called the RP glu-
cose hypothesis [10]. Punzo et al. worked with
four RP mice strains to conduct microarray
experiments and identified common changes in
metabolic gene expression. Inspired by this find-
ing, Punzo et al. looked into the metabolic path-
ways more carefully and found multiple lines of
evidence which suggested an imbalance in RP
cone metabolism at an early stage of degenera-
tion. One of the observations concerned mTOR
signaling, which is a major regulator of metabo-
lism. Phosphorylated-mTOR (Ser2448) was
found in the inner segments of wild-type cone
photoreceptors but was missing at a very early
stage of degeneration in RP cones. The loss of
mTOR-phosphorylation could be induced by cul-
turing wild-type retinal explants in glucose-free
medium. In addition, evidence of an upregulation
in chaperone-mediated autophagy was found,
which is consistent with a nutrient shortage.
Punzo et al. proposed that RP cones suffer from a
glucose shortage, which might subsequently trig-
ger the nonautonomous cone death in RP. The
cause of this hypothesized glucose shortage was
suspected to be a disruption in the interactions
between the RPE processes and photoreceptor
inner and outer segments, which is a major inter-
face for the uptake of nutrients and shedding of
waste for photoreceptors.
Two independent studies subsequently pro-
vided evidence for the RP glucose hypothesis.
Aït-Ali et al. studied the mechanism for cone sur-
vival provided by rod-derived cone viability fac-
tor (RdCVF). They found that it could stimulate
Y. Xue
glucose uptake by cones via the binding or
RdCVF to its chaperone, Basigin1. This led to
the activation of GLUT1, the major glucose
transporter of cones [1]. With loss of rods in RP,
RdCVF secretion dropped, hampering glucose
uptake by cones. In a second study, Wang et al.
proposed that glucose could be trapped in the
RPE of RP animals using 2-NBDG, a fluorescent
analog of glucose, creating a glucose supply
issue for RP cones [11].
However, all of the studies provided only indi-
rect evidence in supporting the RP glucose
hypothesis. It was technically challenging to
measure glucose level in cones directly due to
their scarce number in retina. As one of our goals
was to find a therapy to delay RP cone degenera-
tion, we decided to focus on treatment first. It is
well known that glucose goes glycolysis to be
converted to pyruvate, which has two fates: either
turns into lactate via lactate dehydrogenase and
exits the cell or turns into acetyl-CoA in mito-
chondria and fuels the TCA cycle. To test if aug-
menting glycolytic pathway can provide any
therapeutic effect for RP cone survival, we over-
expressed key glycolytic enzymes (e.g., hexoki-
nases, phosphofructokinase, and pyruvate kinase)
in RP cones.
3 Txnip Presents a Robust
Therapeutic Effect
We used AAV serotype 8 with a cone-specific
promoter to provide safe and specific gene deliv-
ery to cones. We worked with three RP mouse
strains: rd1, rd10, and Rho−/− that degenerate
from fast to slow. Both rd1 and rd10 carry muta-
tions in Pde6b, a rod-specific phototransduction
gene, similar to Rho. Subretinal injection was
performed in RP mice at P0 to achieve a full-­
retina infection, as well allowing us working with
the fast-degenerating rd1 retina. We co-injected a
small fraction of AAV-H2BGFP to label the cone
nuclei and to facilitate the cell recognition by an
automated counting software. We screened 20
genes and some of their combinations using rd1.
Txnip Gene Therapy of Retinitis Pigmentosa Improves Cone Health
Among these tested genes, only Txnip, the thio-
redoxin interacting protein, showed enhanced
rd1 cone survival at P50 [13]. Similar rescue
effects were also observed in rd10 and Rho−/−
strains, suggesting Txnip to be a target for gene-­
agonistic RP cone treatment. Using optomotor
behavioral assay, we demonstrated that the loss
of cone-mediated vision was also significantly
delayed by Txnip in rd10 and Rho−/− strains.
What is Txnip? Txnip is a member of α-arrestin
family proteins. It is best known for three func-
tions: (1) modulating thiol redox signaling of
cells [4, 7], (2) reducing glucose uptake [12], and
(3) switching fuel source to non-glucose fuels
[2]. We started to investigate the possible rescue
mechanism of Txnip along these three
directions.
It has been well established that Txnip inter-
acts with thioredoxins via C247 residue to modu-
late the thiol redox signaling [8, 9]. A serine
mutation of this residue (Txnip.C247S) com-
pletely abolishes the interaction between Txnip
and thioredoxins. If modulating thiol redox sig-
naling is important for Txnip rescue, Txnip.
C247S would hamper the therapeutic effect. To
test this hypothesis, we made a Txnip.C247S
vector and tested its efficacy. Surprisingly, we
observed that Txnip.C247S was more efficacious
than the wild-type allele of Txnip in all three RP
strains. This result suggested that Txnip did not
work through interacting with thioredoxins, and
the well-known Txnip-Thioredoxins interaction
was indeed deleterious to the rescue. The C247S
mutation might also free up both Txnip and thio-
redoxin proteins to better benefit RP cone sur-
vival. In addition, we also ruled out that knocking
down GLUT1 alone can enhance RP cone sur-
vival, suggesting the Txnip rescue was unlikely
to be induced by reducing the glucose uptake
alone.
In a metabolomics study using conditional
knockout mice, Txnip was proposed to function
to switch the fuel source from glucose to non-­
glucose fuels such as lipids, lactate, amino acids,
and ketones [2]. In addition, a recent study
showed that Txnip-null patients presented lactic
acidosis [6], suggesting that Txnip may function
to enhance the lactate catabolism of cells.
145
Therefore, we investigated if Txnip rescued by
switching RP cone fuel source from glucose to
lactate. Using shRNAs, we found that Txnip res-
cue was dependent on Ldhb, a critical gene for
lactate to pyruvate conversion, suggesting that
lactate catabolism was critical for Txnip rescue.
We also observed that Txnip enhanced the
ATP:ADP level in RP cones bathed in lactate-­
only culture medium, and this phenotype was
dependent on Ldhb as well. Mitochondria in
Txnip-treated RP cones appeared to be healthier
than control in terms of size and transmembrane
potential; however, mitochondrial improvement
alone was not sufficient to rescue RP cones. With
Txnip treatment, the Na+/K+ ATPase pumps func-
tioned better in lactate-only medium. The cone
opsins also appeared to be better retained at pro-
tein level with Txnip treatment. This observation
was consistent with an improved energy status by
Txnip addition.
With some additional experimental evi-
dences, we proposed a working model for
Txnip rescue, in which the wild-type photore-
ceptors are genetically programmed to rely on
glucose as the major fuel. In wild-type retina,
glucose from choriocapillaris gets through RPE
to photoreceptors without much retention. In
return, the photoreceptors export lactate for the
RPE to use. In addition, photoreceptors daily
lose 10% of outer segments, which are enriched
by amino acids and lipids, to RPE as additional
fuels. This metabolic relationship between RPE
and photoreceptors has been described as an
ecosystem in the eye by Hurley and colleagues
[5]. In RP, due to the loss of rods, the fuel
exporting from photoreceptors to RPE is
expected to be dramatically reduced. RPE
might start to intersect the glucose for its own
use. As a potential consequence of this glucose
shortage, photoreceptors may start to starve and
show symptoms as described by Punzo et al.
[10]. Adding Txnip could reprogram the fuel
selection of RP cones and enable them to use
lactate instead of glucose, which they originally
rely on. Lactate could be more available to RP
cones than glucose from the blood circulation
[3], to relieve the starvation and to help them to
survive.
146
4 Future Directions
Currently, the molecular mechanism of Txnip
fuel switching is still not clear. Because Txnip
is one type of α-arrestin proteins, it is most
likely that Txnip works through protein-protein
interaction. However, neither reducing glucose
uptake, via GLUT1 interaction, nor improving
mitochondrial health, possibly via PARP1
interaction, alone could enhance the RP cone
survival. Txnip’s interaction with thioredoxins
is indeed detrimental to the rescue. Other than
GLUT1, PARP1, or thioredoxins, no protein
partner has been reported to functionally inter-
act with Txnip to explain the rescue to our
knowledge. In the future, it is important to
identify this unknown downstream protein
partner(s) of Txnip and to study how they phys-
ically interact with each other. With this miss-
ing piece uncovered, we also may be able to
modify Txnip to benefit RP patients even
further.
References
1. Aït-Ali N, Fridlich R, Millet-Puel G, et al. Rod-
derived cone viability factor promotes cone sur-
vival by stimulating aerobic glycolysis. Cell.
2015;161:817–32.
2. DeBalsi KL, Wong KE, Koves TR, et al. Targeted
metabolomics connects thioredoxin-interacting pro-
tein (TXNIP) to mitochondrial fuel selection and reg-
ulation of specific oxidoreductase enzymes in skeletal
muscle. J Biol Chem. 2014;289:8106–20.
Y. Xue
3. Hui S, Ghergurovich JM, Morscher RJ, et al. Glucose
feeds the TCA cycle via circulating lactate. Nature.
2017;551:115–8.
4. Junn E, Han SH, Im JY, et al. Vitamin D3 up-regulated
protein 1 mediates oxidative stress via suppressing the
thioredoxin function. J Immunol. 2000;164:6287–95.
5. Kanow MA, Giarmarco MM, Jankowski CS, et al.
Biochemical adaptations of the retina and retinal pig-
ment epithelium support a metabolic ecosystem in the
vertebrate eye. elife. 2017;6:e28899.
6. Katsu-Jiménez Y, Vázquez-Calvo C, Maffezzini C,
et al. Absence of TXNIP in humans leads to lactic aci-
dosis and low serum methionine linked to deficient
respiration on pyruvate. Diabetes. 2019;68:709–23.
7. Nishiyama A, Matsui M, Iwata S, et al. Identification
of thioredoxin-binding protein-2/vitamin D(3) up-­
regulated protein 1 as a negative regulator of thio-
redoxin function and expression. J Biol Chem.
1999;274:21645–50.
8. Patwari P, Chutkow WA, Cummings K, et al.
Thioredoxin-independent regulation of metabo-
lism by the α-arrestin proteins. J Biol Chem.
2009;284:24996–5003.
9. Patwari P, Higgins LJ, Chutkow WA, et al. The inter-
action of thioredoxin with Txnip: evidence for forma-
tion of a mixed disulfide by disulfide exchange. J Biol
Chem. 2006;281:21884–91.
10. Punzo C, Kornacker K, Cepko CL. Stimulation of
the insulin/mTOR pathway delays cone death in a
mouse model of retinitis pigmentosa. Nat Neurosci.
2009;12:44–52.
11. Wang W, Lee SJ, Scott PA, et al. Two-step reactivation
of dormant cones in retinitis pigmentosa. Cell Rep.
2016;15:372–85.
12. Wu N, Zheng B, Shaywitz A, et al. AMPK-dependent
degradation of TXNIP upon energy stress leads to
enhanced glucose uptake via GLUT1. Mol Cell.
2013;49:1167–75.
13. Xue Y, Wang SK, Rana P, et al. AAV-Txnip prolongs
cone survival and vision in mouse models of retinitis
pigmentosa. elife. 2021;10.
 Part V
Human Retinal Degeneration
 Factors Affecting Readthrough
of Natural Versus Premature
Termination Codons
Avigail Beryozkin, Kerstin Nagel-Wolfum,
Eyal Banin, and Dror Sharon
Abstract
Nonsense mutations occur within the open-­
reading frame of a gene resulting in a prema-
ture termination codon (PTC). PTC-containing
mRNAs can either be degeraded or cause pre-
mature translation termination producing a
truncated protein that can be either nonfunc-
tional or toxic. Translational readthrough
inducing drugs (TRIDs) are small molecules
that are able to induce readthrough, resulting
in the restoration of full-length protein expres-
sion. The re-expressed proteins usually harbor
a missense change. The effciency of individ-
ual TRIDs is variable and varies between dif-
ferent genes and even different nonsense
mutations in the same gene. This review sum-
marizes factors, including the sequences
located upstream and downstream the disease-­
causing mutation and the type of PTC, affect-
ing the translational readthrough process by
modulating the type of amino acid insertion
A. Beryozkin · E. Banin · D. Sharon (*)
Department of Ophthalmology, Hadassah Medical
Center, Faculty of Medicine, The Hebrew University
of Jerusalem, Jerusalem, Israel
e-mail: dror.sharon1@mail.huji.ac.il
K. Nagel-Wolfum
Institute of Molecular Physiology & Institute of
Developmental Biology and Neurobiology, Johannes
Gutenberg University of Mainz, Mainz, Germany
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_23
and the efficiency of the process during
readthrough following TRIDs treatments.
Keywords
Inherited retinal diseases · Nonsense muta-
tions · Stop codons · Translational
readthrough · Translation termination
Abbreviations
aa Amino acid
eRF1 Eukaryote release factor 1
IRDs Inherited retinal diseases
NMD Nonsense-mediated mRNA decay
PTC Premature termination codon
TR Translational readthrough
TRID Translational readthrough inducing
drug
UTR Untranslated region
1 Introduction
Nonsense mutations are responsible for ∼11% of
disease-causing mutations [1] and ∼18% in
inherited retinal diseases (IRDs) [2]. Different
translational readthrough (TR)-inducing drugs
(TRIDs) are known as a potential treatment strat-
egy for these mutations. Gentamicin was one of
149
150
the first reported TRIDs, but its severe side
effects, including in the retina, do not allow long-­
term treatment [3–5]. Additional compounds
with less side effects were reported, including
PTC124 (Translarna™) and G418 (Geneticin) [3,
6]. The efficiency of each TRID is different and
varies among genes and termination codons [6].
In this mini review, we summarize factors affect-
ing the efficiency of the readthrough process.
2 Protein Translation
The eukaryote ribosome (consisting of two sub-
units: 40S and 60S, Fig. 1) reads the mRNA
sequence and translates it into a chain of amino
acids (aas) which build the encoded protein. The
ribosome contains three sites (Fig. 1): A, the
entry site for a new tRNA attached to an aa; P,
occupied by peptidyl-­ tRNA which carries the
growing polypeptide chain; and E, the exit site
Fig. 1 Factors affecting readthrough during translation.
The eukaryote ribosome (60S subunit: light yellow, 40S
subunit: dark yellow) slides from 5′ toward 3′ on the
mRNA strand. New tRNA molecule charged with aa
enters the A site. If there is a match between the mRNA
A. Beryozkin et al.
for the tRNA that already delivered its aa. During
the initiation of translation, the initiator tRNA is
located at the P site. When elongation starts, a
new aminoacyl–tRNA enters the A site. The ribo-
some is responsible for the correct selection of
tRNA. During this proofreading process, tRNAs
with incorrect anticodons are rejected and
replaced by a new tRNA. A failure at this proof-
reading step results in a missense change. The
fidelity of the decoding is very high, and mis-
sense errors can be found in a frequency of 10−7
to 10−4, depending on the position of the aa in the
protein and the mismatch type [7].
3 The Process of Translation
Termination
The termination step occurs when one of the
three stop codons (UAA, UAG, or UGA) is posi-
tioned at the A site. None of the aminoacyl–
codon and the tRNA anticodon (grey polygon), the aa
joins the chain of aas of a previously synthesized peptide.
Different positions on the mRNA are marked by num-
bered squares. Nucleotides that show higher preference
for readthrough are shown in the upper left panel
Factors Affecting Readthrough of Natural Versus Premature Termination Codons
tRNAs fit these codons, and the polypeptide is
released from the ribosome. The basal level of
stop codon readthrough frequency is usually less
than 10−4 [8], but it can also appear more fre-
quently, depending on different cis and trans fac-
tors [9, 10]. The stop codon itself might also
influence the frequency of the basal readthrough,
where UGA has the highest basal readthrough
potential [11, 12].
4 Nucleotide Sequences
Upstream the Stop Codon
Nonrandom distribution of nucleotides located
upstream to the stop codon was observed in vari-
ous species. In addition, several codons appear
more frequently before specific termination
codons. These sequences are speculated to modu-
late the efficacy of peptide chain termination and
stop codon readthrough [13]. Several experi-
ments performed in yeasts aiming to estimate the
effect of the 5′ sequences revealed that adenine in
positions −1 and −2 stimulates TR of mainly
UAG but also other termination codons [14, 15].
Similar experiments on HEK293T cells showed
that purines in position −1 are associated with
higher TR levels, and uracil is associated with
lower levels [16, 17].
5 Nucleotide Sequence
Downstream the Stop Codon
The role of the +4 position in influencing TR
level and its correspondence with the stop codon
itself was studied extensively (Table 1). While it
is well accepted that the effect of TR depends
mostly on the stop codon itself, the findings
regarding the effect of the nucleotide in +4 posi-
tion are controversial. The highest basal levels of
TR in mammalian cells (up to 3–4%) were
observed in UGA followed by cytosine. Other
stop codons also showed enhanced TR when fol-
lowed by cytosine. However, the TR level of
other nucleotides in +4 position varies among
studies and therefore is probably influenced by
their cis and trans factors [11, 18–20]. The effect
151
of nucleotides at positions +5 to +9 varies
between the three termination codons (Table 1)
and between organisms [16, 23, 24]. A study in
yeasts identified a consensus sequence [CA(A/G)
N(U/C/G)A] downstream the stop codon, which
promotes more than 5% readthrough efficiency
[9]. A similar study preformed in HEK293T cells
revealed a much higher level of TR (7–31%) in
genes in which UGA as a stop codon was fol-
lowed by a CUAG sequence [16].
6 Nonsense Mutations and TR
Nonsense mutations, also known as premature
termination codons (PTCs), result either in the
activation of the nonsense-mediated mRNA
decay (NMD) process that degrades the aberrant
mRNA molecules or cause premature termina-
tion of protein synthesis, leading to a truncated
protein that might be toxic. Natural readthrough
of PTCs is higher (0.01–1%) [11, 25] than the
basal level of TR of termination codons (0.001–
0.1%) [10]. This difference stems from several
reasons, such as different upstream and down-
stream sequence signatures and proximity to 3′
UTR poly(A)-binding proteins.
About 18.5% of IRD-causing mutations are
nonsense [2], and several genes show even higher
percentage (e.g., >30% of choroideremia cases)
[26]. Therefore, targeting nonsense mutations
with different TRIDs can serve as a potential
treatment for a relatively high percentage of
IRDs.
The mechanism of TR of natural termination
codons is different from that of PTCs [27, 28],
and therefore the impact of the surrounding
sequences is different. Interestingly, the efficacy
of TR depends mostly on the sequence of the stop
codon itself, with the same ranking order as natu-
ral termination codons but also on the drug and
the sequence surrounding the PTC [11, 18–22,
29, 30]. It is well accepted that cytosine at posi-
tion +4 (Fig. 1 and Table 1) is associated with
higher TR. The effect of TR on other nucleotides
in this position is variable. Basal TR level of nat-
ural termination codons might result in the inser-
tion of different aas at different frequencies
152 A. Beryozkin et al.

Table 1 The effect of a stop codon and a nucleotide at +4 position on the TR potential with or without TRID
treatment
Stop codon
UGA > UAG > UAA Treatment Reference
C~U>G>A C > U> > G > A C > U> > G > A Untreated [18]
C> > A > U ~ G U>C>G~A C>G>U~A Untreated [11]
C>A~G~U C>A~G~U C>A~G~U Untreated [19]
C>A>G>U C>A~G~U C>A~G~U Untreated [20]
C>U>A~G C>U~G~A C~U~G~A Gentamicin [21]
C>A=G>U U>C=G>A C>G>A=U Gentamicin [11]
C>A~G~U C>A~G~U C>A~G~U Gentamicin [19]
C> > A = U = G C>A=U=G C>A=U=G Gentamicin [22]
C>A=U=G C>A=U=G C>A=U=G PTC124 [22]
C> > A = U = G C>A=U=G C>A=U=G G418 [22]
C>U>A>G C>U~G~A C>U>G~A G418 [21]
C>A=G>U U>C=G>A C>G>A=U G418 [11]

Table 2 Possible and actual aas that are inserted instead of termination codons
Termination Possible Possible Basal RT of natural Basal RT After ataluren After G418
codon mispairing aa termination codons of PTC treatment treatment
UGA UGU/C Cys [31, 32] [33, 34] [33, 35] [33, 35]
UGG Trp [31, 36, 37] [33, 35] [33, 35] [33, 35]
UAA Ter
UCA Ser
UUA Leu
GGA Gly
C/AGA Arg [31] [33–35] [33, 35] [33, 35]
UAG UAA Ter
UAU/C Tyr [37] [33–35, [33, 35] [33, 35]
38]
UGG Trp [35, 38] [35]
UCG Ser
UUG Leu
GAG Glu [31, 37] [34]
AAG Lys [33, 34, [33] [33, 35]
38]
CAG Gln [33, 35] [33, 35] [33, 35]
UAA UAG Ter
UAU/C Tyr [32, 37] [34, 35] [33, 35] [33, 35]
UCA Ser
UGA Ter
UUA Leu
GAA Glu [31, 37] [34]
AAA Lys [34]
CAA Gln [35] [33, 35] [33, 35]

instead of the termination codon (Table 2). 7 Decoding of Termination

Several studies showed that mainly tryptophan
and arginine are inserted during readthrough of
UGA [31, 36, 37]. Natural readthrough of UAG
and UAA usually results in insertion of a glu-
tamic acid (Tables 2 and 3) [31, 37].
Codons
TR of natural termination codons and PTCs can
appear in a basal level with the latter showing
higher readthrough levels. Studies in various
Factors Affecting Readthrough of Natural Versus Premature Termination Codons 153

Table 3 Amino acids inserted during readthrough

Condition Termination codon Alternatively inserted aas References
Naturally occurring termination codons UGA Arg > Cys > Trp [31]
Cys [32]
Trp [36]
Trp [37]
UAG Glu > Tyr > Gln [37]
Glu [31]
UAA Glu > Tyr > Gln [37]
Glu [31]
Tyr [32]
PTC Natural TR UGA Trp > Cys > Arg [33]
Arg > Trp [35]
Ata Arg > Trp > Cys [33]
Arg > Trp > Cys [35]
G418 Arg > Cys > Trp [33]
Arg > Trp > Cys [35]
Natural TR UAG Gln > Tyr > Lys [33]
Tyr > Gln > Trp [35]
Ata Gln > Tyr > Trp [33]
Gln > Tyr > Trp [35]
G418 Gln > Tyr [33]
Gln > Tyr > Lys [35]
Natural TR UAA Gln > Tyr > Lys [33]
Tyr > Gln [35]
Ata Tyr > Gln [33]
Tyr [35]
G418 Gln > Tyr [33]
Tyr > Gln [35]

organisms showed that TR is not a random pro-
cess. When TR occurs on natural termination
codons, they might be decoded only as particu-
lar aas (Table 2). TR of PTCs can result in the
same aas as in natural termination codons, as
well as additional ones (Table 2). Studies in
HEK293T cells revealed differences in the fre-
quency of the integrated aas after ataluren (argi-
nine, 69%; tryptophan, 28%; cysteine, 0.7%)
and gentamicin (arginine, 48%; cysteine, 27%;
tryptophan, 24%) treatments [33]. Interestingly,
most aas that are inserted after drug treatment
are the same as those inserted due to spontane-
ous TR of PTC but with different frequencies
(Tables 2 and 3). An additional interesting
observation is that some of the aas are not
decoded, even though there is only a single
nucleotide difference between the PTC and
codon of the potential aa.
To summarize, termination of the translation
process is important for functional proteins to be
produced. The distribution of nucleotides sur-
rounding the natural termination codon is not ran-
dom and therefore a PTC that appears within the
open reading frame will not be flanked by the
same elements appearing around natural termina-
tion codons and will therefore show different sen-
sitivity to TRIDs. Since treatment with TRIDs
does not yield WT proteins, but rather full-length
proteins with a single aa change, one needs to ver-
ify that the function of the newly produced, slightly
different proteins is high enough to correct the
phenotype.
Acknowledgments This study was funded by the Israeli
Ministry of Health (grant number 3-14995), FAUN
Foundation and German Research Council/DFG,
SPP2127 – Gene and Cell based therapies to counteract
neuroretinal degeneration (NA 399443882).
154 A. Beryozkin et al.

Declaration of Competing Interest The authors declare 13. Arkov AL, Korolev SV, Kisslev LL. 5′ contexts of
that they have no competing interests. Escherichia coli and human termination codons are
similar. Nucleic Acids Res. 1995;23:4712–6.
14. Bonetti B, Fu L, Moon J, Bedwell DM. The efficiency
References of translation termination is determined by a syner-
gistic interplay between upstream and downstream
sequences in Saccharomyces cerevisiae. J Mol Biol.
1. Mort M, Ivanov D, Cooper DN, Chuzhanova NA. A 1995;251:334–45.
meta-analysis of nonsense mutations causing human 15. Tork S, Hatin I, Rousset JP, Fabret C. The major 5′
genetic disease. Hum Mutat. 2008;29:1037–47. determinant in stop codon read-through involves
2. Schneider N, Sundaresan Y, Gopalakrishnan P, two adjacent adenines. Nucleic Acids Res.
Beryozkin A, Hanany M, Levanon EY, Banin E, 2004;32:415–21.
Ben-Aroya S, Sharon D. Inherited retinal diseases: 16. Loughran G, Chou MY, Ivanov IP, Jungreis I, Kellis
linking genes, disease-causing variants, and relevant M, Kiran AM, Baranov PV, Atkins JF. Evidence of
therapeutic modalities. Prog Retin Eye Res. 2022 efficient stop codon readthrough in four mammalian
Jul;89:101029. genes. Nucleic Acids Res. 2014;42:8928–38.
3. Goldmann T, Overlack N, Moller F, Belakhov V, 17. Cassan M, Rousset JP. UAG readthrough in mam-
van Wyk M, Baasov T, Wolfrum U, Nagel-Wolfrum malian cells: effect of upstream and downstream stop
K. A comparative evaluation of NB30, NB54 and codon contexts reveal different signals. BMC Mol
PTC124 in translational read-through efficacy for Biol. 2001;2:1–8.
treatment of an USH1C nonsense mutation. EMBO 18. Mccaughan KK, Brown CM, Dalphin ME, Berry
Mol Med. 2012;4:1186–99. MJ, Tate WP. Translational termination efficiency in
4. Lopez-Novoa JM, Quiros Y, Vicente L, Morales AI, mammals is influenced by the base following the stop
Lopez-Hernandez FJ. New insights into the mecha- codon. Proc Natl Acad Sci U S A. 1995;92:5431–5.
nism of aminoglycoside nephrotoxicity: an integrative 19. Floquet C, Hatin I, Rousset JP, Bidou L. Statistical
point of view. Kidney Int. 2011;79:33–45. analysis of readthrough levels for nonsense muta-
5. Goldmann T, Rebibo-Sabbah A, Overlack N, tions in mammalian cells reveals a major deter-
Nudelman I, Belakhov V, Baasov T, Ben-Yosef T, minant of response to gentamicin. PLoS Genet.
Wolfrum U, Nagel-Wolfrum K. Beneficial read-­ 2012;8(3):e1002608
through of a USH1C nonsense mutation by designed 20. Beznosková P, Wagner S, Jansen ME, Von Der Haar
aminoglycoside NB30 in the retina. Invest Ophthalmol T, Valášek LS. Translation initiation factor eIF3 pro-
Vis Sci. 2010;51:6671–80. motes programmed stop codon readthrough. Nucleic
6. Lee HLR, Dougherty JP. Pharmaceutical therapies Acids Res. 2015;43:5099–111.
to recode nonsense mutations in inherited diseases. 21. Howard MT, Shirts BH, Petros LM, Flanigan KM,
Pharmacol Ther. 2012;136:227–66. Gesteland RF, Atkins JF. Sequence specificity of
7. Manickam N, Nag N, Abbasi A, Patel K, Farabaugh aminoglycoside-induced stop codon readthrough:
PJ. Studies of translational misreading in vivo show Potential implications for treatment of Duchenne
that the ribosome very efficiently discriminates muscular dystrophy. Ann of Neuro. 2001;48:164–169.
against most potential errors. RNA. 2014;20:9–15. 22. Martorell L, Cortina V, Parra R, Barquinero J, Vidal
8. Schueren F, Thoms S. Functional translational F. Variable readthrough responsiveness of non-
readthrough: a systems biology perspective. PLoS sense mutations in hemophilia A. Haematologica.
Genet. 2016;12(8):e1006196. 2020;105:508–18.
9. Namy O, Hatin I, Rousset JP. Impact of the six nucle- 23. Beier H, Grimm M. Misreading of termination codons
otides downstream of the stop codon on translation in eukaryotes by natural nonsense suppressor tRNAs.
termination. EMBO Rep. 2001;2:787–93. Nucleic Acids Res. 2001;29:4767–82.
10. Tate WP, Poole ES, Horsfield JA, Mannering SA, 24. Urban C, Zerfaß K, Fingerhut C, Beier H. UGA sup-
Brown CM, Moffat JG, Dalphin ME, McCaughan pression by tRNACmCATrp occurs in diverse virus
KK, Major LL, Wilson DN. Translational termination RNAs due to a limited influence of the codon context.
efficiency in both bacteria and mammals is regulated Nucleic Acids Res. 1996;24:3424–30.
by the base following the stop codon. Biochem Cell 25. Keeling KM, Wang D, Conard SE, Bedwell
Biol. 1995;73:1095–103. DM. Suppression of premature termination codons as
11. Manuvakhova M, Keeling K, Bedwell a therapeutic approach. Crit Rev Biochem Mol Biol.
DM. Aminoglycoside antibiotics mediate context-­ 2012;47:444–63.
dependent suppression of termination codons in a 26. Moosajee M, Ramsden SC, Black GC, Seabra MC,
mammalian translation system. RNA. 2000;6:1044–55. Webster AR. Clinical utility gene card for: choroider-
12. Cridge AG, Crowe-Mcauliffe C, Mathew SF, Tate emia. Eur J Hum Genet. 2014;22(4):572.
WP. Eukaryotic translational termination effi- 27. Dabrowski M, Bukowy-Bieryllo Z, Zietkiewicz
ciency is influenced by the 3′ nucleotides within E. Translational readthrough potential of natural ter-
the ribosomal mRNA channel. Nucleic Acids Res. mination codons in eucaryotes-the impact of RNA
2018;46:1927–44. sequence. RNA Biol. 2015;12:950–8.
Factors Affecting Readthrough of Natural Versus Premature Termination Codons
28. Rodnina MV, Korniy N, Klimova M, Karki P, Peng
BZ, Senyushkina T, Belardinelli R, Maracci C,
Wohlgemuth I, Samatova E, Peske F. Translational
recoding: canonical translation mechanisms reinter-
preted. Nucleic Acids Res. 2020;48:1056–67.
29. Welch EM, Barton ER, Zhuo J, Tomizawa Y, Friesen
WJ, Trifillis P, Paushkin S, Patel M, Trotta CR,
Hwang S, Wilde RG, Karp G, Takasugi J, Chen G,
Jones S, Ren H, Moon Y-C, Corson D, Turpoff AA,
et al. PTC124 targets genetic disorders caused by non-
sense mutations. Nature. 2007;447:87–91.
30. Wangen JR, Green R. Stop codon context influ-
ences genome-wide stimulation of termination
codon readthrough by aminoglycosides. elife.
2020;9:e52611.
31. Feng YX, Copeland TD, Oroszlan S, Rein A, Levin
JG. Identification of amino acids inserted during sup-
pression of UAA and UGA termination codons at the
gag-pol junction of Moloney murine leukemia virus.
PNAS USA. 1990;87:8860–3.
32. Urban C, Beier H. Cysteine tRNAs of plant ori-
gin as novel UGA suppressors. Nucleic Acids Res.
1995;23:4591–7.
33. Roy B, Friesen WJ, Tomizawa Y, Leszyk JD,
Zhuo J, Johnson B, Dakka J, Trotta CR, Xue X,
Mutyam V, Keeling KM, Mobley JA, Rowe SM,
155
Bedwell DM, Welch EM, Jacobson A. Ataluren
stimulates ribosomal selection of near-cognate
tRNAs to promote nonsense suppression. PNAS.
2016;113:12508–13.
34. Blanchet S, Rowe M, Von Der Haar T, Fabret C,
Demais S, Howard MJ, Namy O. New insights into
stop codon recognition by eRF1. Nucleic Acids Res.
2015;43:3298–308.
35. Dabrowski M, Bukowy-Bieryllo Z, Zietkiewicz
E. Advances in therapeutic use of a drug-stimulated
translational readthrough of premature termination
codons. Mol Med BioMed Central Ltd. 2018;24.
36. Zerfass K, Beier H. The leaky UGA termination codon
of tobacco rattle virus RNA is suppressed by tobacco
chloroplast and cytoplasmic tRNAs(Trp) with CmCA
anticodon. EMBO J. 1992;11:4167.
37. Nilsson M, Rydén-Aulin M. Glutamine is incor-
porated at the nonsense codons UAG and UAA in
a suppressor-­free Escherichia coli strain. Biochim
Biophys Acta. 2003;1627:1–6.
38. Fearon K, Mcclendon V, Bonetti B, Bedwell
DM. Premature translation termination mutations
are efficiently suppressed in a highly conserved
region of yeast SteGp, a member of the ATP-binding
cassette (ABC) transporter family. J Biol Chem.
1994;269:17802–8.
 Integrating Computational
Approaches to Predict the Effect
of Genetic Variants on Protein
Stability in Retinal Degenerative
Disease

Michelle Grunin, Ellen Palmer, Sarah de Jong,

Bowen Jin, David Rinker, Christopher Moth,
John A. Capra, Jonathan L. Haines,
William S. Bush, and Anneke I. den Hollander

Abstract can be affected by a large change in the ter-

Protein function can be impacted by changes
in protein structure stability, but determining
which change has impact is complex. Stability
Authors Michelle Grunin, Ellen Palmer, Sarah de Jong,
Jonathan L. Haines, William S. Bush, and Anneke I. den
Hollander have equally contributed to this chapter.
tiary (3D) structure of the protein or due to
free-energy changes caused by single amino
acid substitutions. Changes in the DNA
sequence can have minor or major impact on
protein stability, which can lead to disease.
Inherited retinal degenerations are generally
caused by single mutations which are mostly
located in protein-coding regions, while age-­

M. Grunin (*) · E. Palmer · B. Jin · J. L. Haines ·
W. S. Bush
Department of Population and Quantitative Health
Sciences, Case Western Reserve University,
Cleveland, OH, USA
Cleveland Institute for Computational Biology,
Case Western Reserve University, Cleveland,
OH, USA
e-mail: mag235@case.edu; elp76@case.edu;
bxj139@case.edu; jlh213@case.edu; wsb36@case.
edu
S. de Jong (*)
Department of Ophthalmology, Donders
Institute for Brain, Cognition, and Behavior, Radboud
University Medical Center, Nijmegen, the
Netherlands
e-mail: sarah.dejong@radboudumc.nl
D. Rinker
Department of Biological Sciences,
Vanderbilt University, Nashville,
TN, USA
e-mail: david.rinker@vanderbilt.edu
C. Moth
Center for Structural Biology, Vanderbilt University,
Nashville, TN, USA
e-mail: chris.moth@vanderbilt.edu
J. A. Capra
Department of Biological Sciences, Vanderbilt
University, Nashville, TN, USA
Center for Structural Biology, Vanderbilt University,
Nashville, TN, USA
Vanderbilt Genetics Institute, Vanderbilt University
School of Medicine, Nashville, TN, USA
Department of Biomedical Informatics, Vanderbilt
University School of Medicine, Nashville, TN, USA
e-mail: tony.capra@vanderbilt.edu
A. I. den Hollander
Department of Ophthalmology, Donders Institute for
Brain, Cognition, and Behavior, Radboud University
Medical Center, Nijmegen, the Netherlands
Department of Human Genetics, Radboud University
Medical Center, Nijmegen, the Netherlands
e-mail: Anneke.denHollander@radboudumc.nl

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 157
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_24
158 M. Grunin et al.

related macular degeneration (AMD) is a tions are still unknown, while this may in part be
complex disorder that can be influenced by due to the ambiguous classification of genetic
some genetic variants impacting proteins variants [7]. As sequencing-based genetic studies
involved in the disease, although not all AMD increase the number of identified protein-altering
risk variants lead to amino acid changes. Here, mutations, more work in this area will be critical
we review ways that proteins may be affected, to understand their role in complex diseases[8]
the identification and understanding of these and to discriminate between harmless and more
changes, and how to identify causal changes damaging VUS.
that can be targeted to develop treatments to Missense variants comprise over 60% of all
alleviate retinal degenerative disease. known monogenic disease mutations [9], but they
disrupt protein structure and function in various,
Keywords sometimes unclear, ways [10]. Changes to alpha
Proteins · Age-related macular degeneration · helices or beta sheets are the most clearly under-
Mutations · Variants · Free-energy stood, as they generally impact protein stability
by changing hydrophobicity that affects protein
folding, like mutations in TGFb or Pim1 in can-
cer [9, 11, 12]. Amino acid changes in other loca-
1 Part I. Protein Stability: Role tions may affect the stability of a protein or
and Importance protein complex [6] through changing the tertiary
structure of the protein or through changing the
Multiple efforts are underway to gather informa- free energy needed to fold into a functional form.
tion on clinically meaningful mutations in pro- Depending on the context of the single amino
tein coding genes in databases such as the Human acid change, protein folding (i.e., free-energy
Gene Mutation Database (HGMD) [1, 2] or change) can be impacted enough to prevent the
ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) formation of structural motifs needed for critical
[3]. In 2003, HGMD contained more than 1000 function [6]. However, directly measuring free-­
mutations that were directly causative of disease; energy changes resulting from an amino acid
the number of reported mutations currently in substitution is a difficult experimental task
HGMD has grown to 323,661 as of Oct. 2021. because current approaches typically are expen-
ClinVar currently contains 1,159,307 unique sive, are time consuming, are performed on a
disease-­contributing variations (Oct. 16, 2021). single mutation at a time, and are hard to scale. In
Many of the mutations found in these databases, lieu of directly measuring experimental changes
but not all, can affect protein stability [4–6]. The in free-energy, computational methods are often
deleterious impact of mutations that clearly affect employed [13]. These methods typically compare
a protein’s sequence, fold, and function is some- wild-type and mutant protein folding using a
times obvious, such as frameshift mutations that solved template protein structure from the pro-
alter much of the protein sequence. More often, tein data bank (PDB, https://www.rcsb.org/) and
missense mutations are identified, such as single-­ then changing those structures to model the
point mutations that cause some familial forms of mutant protein using programs like PoPMusic
Alzheimer’s or Parkinson’s disease. Missense [14] or Phyre [15]. The free energy before and
mutations are generally more difficult to classify after folding is calculated for both the wild-type
and understand, and newly discovered variants and mutant proteins to produce two respective
may be given an ambiguous classification free-energy change measures (ΔG). These mea-
(referred to as “variants of unknown signifi- sures are then compared to estimate a change in
cance”; VUS), as these changes may alter protein ΔG due to the amino acid substitution (ΔΔG).
structure at different, hard to measure levels (e.g., Both experimentally solved and high-resolution
tertiary structure). An excellent example is retini- computational models of protein structures like
tis pigmentosa, as 60% of disease-causing muta- those found in the PDB can be used for accurate
Integrating Computational Approaches to Predict the Effect of Genetic Variants on Protein Stability…
folding estimates [16, 17]. PDB contains 183,386
structures in 2021, which were either determined
experimentally or by homology modeling based
on similar protein structures [18]. As of 2020,
14,028 solved and proven experimentally struc-
tures from the 183,386 were included in the
PDB. The sequence based or ab initio approaches
for identifying impactful variants are faster but
depend on machine learning training sets and do
not focus on the ultimate impact on the full post-­
secondary protein structure, utilizing protein
modeling, while the structure-based approaches
use multiple scoring methods as well as intensive
calculations, like the free-energy perturbation
(FEP) and thermodynamic integration (TI) meth-
ods [19, 20].
Computationally, protein homology models
can be constructed using methods like the Swiss-­
Model in the ExPASy webserver [21]. Proteins
can be graphed using Mol [22]or other programs
to visualize exactly where the structure changes
and where the variant impacts the protein struc-
ture. Variants that impact the free-energy change
in binding sites or core regions may be the most
damaging, even if the change is not obviously
damaging to the tertiary structure of the protein.
Mutations that destabilize proteins are described
for von Willebrand diseases [23], prion [24], and
retinal degenerative diseases that impact rhodop-
sin [25]. Depending on protein function, some
residue substitutions cause disease by increasing
protein stability, such as the CLIC2 protein in
some mental disorders [26].
2 Part II. Common
Computational Methods
for Determining Variant
Impact
Machine learning algorithms can assess the
impact of missense variants using a variety of
information including protein sequence and in
some cases, structure and folding. Programs like
SIFT (http://sift-­dna.org) [27], MutPred (http://
mutpred.putdb.org) [28], or Polyphen2 (http://
genetics.bwh.harvard.ed/pphw) [29] are trained
using a set of known deleterious mutations for
159
often severe Mendelian diseases. Some
approaches and programs either calculate free-­
energy changes and take the free-energy changes
into account when evaluating protein stability,
like I-Mutant2.0 (http://gpcr2.biocomp.unibo.
it/%7Eemidio/I-­Mutatnt/I-­Mutant.htm) [30],
SDM (http://www-­cryst.bioc.cam.ac.uk/~sdm/
sdm.php) [31], CUPSAT (http://cupsat.tu-­bs.de/)
[32], FoldX (http://fold-­x.embl-­heidelberg.de)
[33], ROSETTA (https://www.rosettacommons.
org/) [34], or AUTO-MUTE (http://proteins.gmu.
edu/automute) [35]. However, only few programs
take into account both information from tertiary
structures and the impact of free-energy change
on the protein structure. Only PolyPhen,
I-Mutant2.0, and HOPE (https://www3.cmbi.
umcn.nl/hope/about/) [36] consider both
sequence and protein structure changes but
include these among many other features in a
machine learning prediction based on highly pen-
etrant missense variants[6]. A comparison
between the different methods used to estimate
the effect of different mutations on protein stabil-
ity has been described in work of de Groot [37],
Thiltgen and Goldstein [38], and Kroncke [39].
3 Part III. New Methodologies:
PathProx and POKEMON
PathProx [16, 17] employs an alternative
approach: it specifically focuses on the spatial
context and stability of the full three-dimensional
protein. PathProx performs two types of analy-
ses: (1) PathProx evaluates the spatial proximity
of input variants to known pathogenic variants
(from resources like ClinVar) and to presumed
neutral variants within the protein; (2) PathProx
calculates differences in the free-energy and sta-
bility of the protein utilizing ROSETTA and
examines those variants in relationship to other
known pathogenic and presumably neutral vari-
ants that may be present in the protein structure.
The spatial proximity portion of the algorithm
uses Euclidean distance to determine if the input
variants are nearer to pathogenic risk variants (or
any variant of interest), as compared to “normal”
or neutral variants, such as those found in data-
160
bases like GnomAD, which draws on over
141,456 samples from the controls of dozens of
disease studies (https://gnomad.broadinstitute.
org/) [40]. Variants that are found closer to known
pathogenic variants and that are enriched in cases
(when case-control data is used) could indicate
that a particular protein region plays a significant
role in disease pathogenesis, whereas variants
that are found near neutral variants and are more
often found in controls or are evenly distributed
between cases and controls are likely neutral or
perhaps “protective” variants. The ROSETTA-­
based portion of the method uses free-energy cal-
culations to identify variants that are predicted to
impact the structure of a protein associated with a
given disease. Together, these two approaches
within PathProx create a candidate variant list for
further case enrichment, gene-based testing, and
functional testing at the bench. Paired together,
these approaches allow for the identification of
two different patterns of protein-altering
relationships.
POKEMON [41] adapts gene-based testing
methods employing kernel functions (such as
SKAT) to include information about missense
variant proximity within the 3D structure of a
protein. Using this kernel, a statistical test can be
conducted to determine if the spatial proximity of
variants within the protein is related to case sta-
tus. For example, a pocket of missense variants
found more frequently in cases within one par-
ticular area of a protein may point to a segment of
the protein that plays a role in disease. That area
may be important as a binding site, or impact pro-
tein stability at the weakest point, contributing to
disease pathogenesis. Results from POKEMON
and the spatial-clustering analyses of PathProx
have been found to be concordant in a study of
Alzheimer’s disease and provide orthogonal
methods of identifying disease-associated pro-
tein regions (unpublished data, 2021). We
recently utilized these two methods to identify
variants that can have a functional impact on pro-
tein stability and expression of complement fac-
tors in AMD (Grunin, Palmer, de Jong et al.,
unpublished).
M. Grunin et al.
4 Part IV. Retinal Diseases,
AMD, and Protein Stability
Multiple retinal degenerative diseases are caused
by mutations that affect protein stability [42].
One of the best known are rhodopsin mutations,
the most common cause of autosomal dominant
retinitis pigmentosa [43].The first identified
mutations inhibit protein stability that either
reduces its export out of the endoplasmic reticu-
lum (ER) (Class II mutations) [44] or increases
accumulation inside the cell (Class III mutations)
[45]. The majority of these mutations lead to
folding defects of the protein [45]. Class II muta-
tions also impact tertiary folding stability [46].
These mutations are common among the G
protein-­coupled receptors (GPCRs), but how
their thermodynamics are impacted by folding
stability is still not fully understood. Therefore,
computational methods to understand the effect
of these mutations is the avenue that has been
most explored [43].
Investigation of VUS has been a major focus
in genetic research, and the combination of both
computational and functional biology approaches
has been useful in identifying the impact of
VUSs. If computational approaches can differen-
tiate variants of significance from among the
VUSs, specifically those that have functional
effect, this would significantly improve variant
interpretation in diagnostic testing. For rhodop-
sin, variant interpretation has been performed
using a combination of computational and exper-
imental approaches: gain of function mutations
have systemically been analyzed using a compu-
tational approach, in addition to a full-scale
experimental screen to evaluate rhodopsin
expression in cells [47]. Two-stage approaches
using computational methods before moving to
functional testing have been applied, for exam-
ple, in Best disease, to determine destabilizing
mutations using I-mutant and then performing
functional testing on all variants [48]. Many tests
have shown that reliable first-stage computa-
tional testing of missense mutations can be done
through I-Mutant, Dmutant, and FoldX [49].
Integrating Computational Approaches to Predict the Effect of Genetic Variants on Protein Stability…
However, a two-stage approach can be used to
first predict the effect of a variant computation-
ally and then focus experimental work on vari-
ants that are predicted to affect protein stability
or function, which would narrow the testing pool,
time, and costs [50]. In AMD, one of the most
studied proteins is complement factor H (CFH).
Rare protein-coding AMD risk variants have
been mapped on the protein with corresponding
issues of protein unfolding or incorrect folding,
with 70% of mutations showing a destabilizing
effect. Recently, 105 variants in CFH were classi-
fied according to their pathogenicity and effect
on function utilizing functional assays [51].
Several other proteins of the complement
pathway are associated with AMD including C3,
C9, CFB, and CFI [52]. Rare protein-coding vari-
ants in these complement genes have been asso-
ciated with differences in protein concentration
in patients and controls [53–57]. However, in
AMD, a combination of common variants with
modest effect and rare variants with large effect
collectively contribute to the disease, and how
these variants contribute to AMD and whether
they have synergistic effects are currently
unknown. Analysis of variants in RPE65 and rho-
dopsin have shown similar results in destabiliza-
tion of the protein, utilizing an unfolding mutation
screen (UMS) [50]. However, these results were
not followed up by actual functional testing on
those mutations, because the mutations were
already known, and thus the method did not show
predictive power. We recently applied computa-
tional methodology utilizing PathProx and
POKEMON to patients with AMD and identified
variants that impact proteins in the complement
system. These variants were located in unique
spatial locations in the protein and lead to distinct
free-energy changes. We determined through
computational mining which variants cause an
in vitro change in complement protein expres-
sion. Therefore, the application of computational
filtering allows us to identify variants that have a
foreseeable functional impact (Grunin, Palmer,
deJong, unpublished data, 2021)
In conclusion, utilizing novel methods like
PathProx and POKEMON will enable under-
standing of which variants are likely to affect
161
protein stability and may provide new avenues
for identifying treatment-amenable variants with-
out the need to bench test every single mutation.
In addition, free-energy changes can be utilized
to predict the consequences that these variants
might have on the protein of interest. Reliable
predictive testing allows the identification of
variants of interest in disease more rapidly and
allows for targeted functional testing.
References
1. Stenson PD, Ball E V., Mort M, et al. Human Gene
Mutation Database (HGMD®): 2003 updateHum
Mutat;21. https://doi.org/10.1002/humu.10212. Epub
ahead of print 2003.
2. Stenson PD, Mort M, Ball E V., et al. The Human Gene
Mutation Database: towards a comprehensive reposi-
tory of inherited mutation data for medical research,
genetic diagnosis and next-generation sequencing
studies. Hum Genet;136. https://doi.org/10.1007/
s00439-­017-­1779-­6. Epub ahead of print 2017.
3. Landrum MJ, Lee JM, Benson M, et al. ClinVar:
improving access to variant interpretations and sup-
porting evidence. Nucleic Acids Res;46. https://doi.
org/10.1093/nar/gkx1153. Epub ahead of print 2018.
4. Wang Z, Moult J. SNPs, protein structure, and disease.
Hum Mutat;17. https://doi.org/10.1002/humu.22.
Epub ahead of print 2001.
5. Casadio R, Vassura M, Tiwari S, et al. Correlating
disease-­related mutations to their effect on protein sta-
bility: a large-scale analysis of the human proteome.
Hum Mutat;32. https://doi.org/10.1002/humu.21555.
Epub ahead of print 2011.
6. Stefl S, Nishi H, Petukh M, et al. Molecular mecha-
nisms of disease-causing missense mutations. J Mol
Biol;425. https://doi.org/10.1016/j.jmb.2013.07.014.
Epub ahead of print 2013.
7. González-Del Pozo M, Fernández-Suárez E, Martín-­
Sánchez M, et al. Unmasking Retinitis Pigmentosa
complex cases by a whole genome sequencing
algorithm based on open-access tools: hidden reces-
sive inheritance and potential oligogenic variants. J
Transl Med;18. https://doi.org/10.1186/s12967-­020-­
02258-­3. Epub ahead of print 2020.
8. Capriotti E, Calabrese R, Casadio R. Predicting
the insurgence of human genetic diseases associ-
ated to single point protein mutations with sup-
port vector machines and evolutionary information.
Bioinformatics;22. https://doi.org/10.1093/bioinfor-
matics/btl423. Epub ahead of print 2006.
9. Yue P, Li Z, Moult J. Loss of protein structure sta-
bility as a major causative factor in monogenic dis-
ease. J Mol Biol;353. https://doi.org/10.1016/j.
jmb.2005.08.020. Epub ahead of print 2005.
162
10. Calamini B, Lo DC, Kaltenbach LS. Experimental
models for identifying modifiers of polyglutamine-­
induced aggregation and neurodegeneration.
Neurotherapeutics;10. https://doi.org/10.1007/
s13311-­013-­0195-­4. Epub ahead of print 2013.
11. Kucukkal TG, Alexov E. Structural, dynamical, and
energetical consequences of RETT syndrome muta-
tion R133c in MeCP2. Comput Math Methods Med.
2015. https://doi.org/10.1155/2015/746157. Epub
ahead of print 2015.
12. Petukh M, Dai L, Alexov E. SAAMBE: webserver to
predict the charge of binding free energy caused by
amino acids mutations. Int J Mol Sci;17. https://doi.
org/10.3390/ijms17040547. Epub ahead of print 2016.
13. Magliery TJ. Protein stability: computation,
sequence statistics, and new experimental methods.
Curr Opin Struct Biol;33. https://doi.org/10.1016/j.
sbi.2015.09.002. Epub ahead of print 2015.
14. Dehouck Y, Kwasigroch JM, Gilis D, et al.
PoPMuSiC 2.1: a web server for the estimation
of protein stability changes upon mutation and
sequence optimality. BMC Bioinf;12. https://doi.
org/10.1186/1471-­2105-­12-­151. Epub ahead of
print 2011.
15. Kelley LA, Mezulis S, Yates CM, et al. The Phyre2
web portal for protein modeling, prediction and anal-
ysis. Nat Protoc. 2015;10:845–58.
16. Sivley RM, Sheehan JH, Kropski JA, et al. Three-­
dimensional spatial analysis of missense variants in
RTEL1 identifies pathogenic variants in patients with
Familial Interstitial Pneumonia. BMC Bioinf;19.
https://doi.org/10.1186/s12859-­018-­2010-­z. Epub
ahead of print 2018.
17. Sivley RM, Dou X, Meiler J, et al. Comprehensive
analysis of constraint on the spatial distribution
of missense variants in human protein structures.
Am J Hum Genet;102. https://doi.org/10.1016/j.
ajhg.2018.01.017. Epub ahead of print 2018.
18. Berman HM, Battistuz T, Bhat TN, et al. The protein
data bank Acta Crystallogr Sect D Biol Crystallogr;58.
https://doi.org/10.1107/S0907444902003451. Epub
ahead of print 2002.
19. Petukh M, Kucukkal TG, Alexov E. On human
disease-­causing amino acid variants: Statistical study
of sequence and structural patterns. Hum Mutat;36.
https://doi.org/10.1002/humu.22770. Epub ahead of
print 2015.
20. Michel J, Foloppe N, Essex JW. Rigorous free
energy calculations in structure-based drug design
Mol Inf;29. https://doi.org/10.1002/minf.201000051.
Epub ahead of print 2010.
21. Waterhouse A, Bertoni M, Bienert S, et al. SWISS-­
MODEL: homology modelling of protein structures
and complexes. Nucleic Acids Res;46. https://doi.
org/10.1093/nar/gky427. Epub ahead of print 2018.
22. Sehnal D, Bittrich S, Deshpande M, et al. Mol∗Viewer:
modern web app for 3D visualization and analysis of
large biomolecular structures. Nucleic Acids Res;49.
https://doi.org/10.1093/nar/gkab314. Epub ahead of
print 2021.
M. Grunin et al.
23. Xu AJ, Springer TA. Mechanisms by which von wil-
lebrand disease mutations destabilize the A2 domain.
J Biol Chem;288. https://doi.org/10.1074/jbc.
M112.422618. Epub ahead of print 2013.
24. Jetha NN, Semenchenko V, Wishart DS, et al.
Nanopore analysis of wild-type and mutant prion pro-
tein (PrPC): single molecule discrimination and PrPC
kinetics. PLoS One;8. https://doi.org/10.1371/journal.
pone.0054982. Epub ahead of print 2013.
25. Rakoczy EP, Kiel C, McKeone R, et al. Analysis of
disease-linked rhodopsin mutations based on struc-
ture, function, and protein stability calculations. J Mol
Biol;405. https://doi.org/10.1016/j.jmb.2010.11.003.
Epub ahead of print 2011.
26. Witham S, Takano K, Schwartz C, et al. A missense
mutation in CLIC2 associated with intellectual dis-
ability is predicted by in silico modeling to affect
protein stability and dynamics. Proteins Struct Funct
Bioinf;79. https://doi.org/10.1002/prot.23065. Epub
ahead of print 2011.
27. Sim NL, Kumar P, Hu J, et al. SIFT web server: pre-
dicting effects of amino acid substitutions on proteins.
Nucleic Acids Res;40 https://doi.org/10.1093/nar/
gks539. . Epub ahead of print 2012.
28. Pejaver V, Urresti J, Lugo-Martinez J, et al. Inferring
the molecular and phenotypic impact of amino acid
variants with MutPred2. Nat Commun;11. https://
doi.org/10.1038/s41467-­020-­19669-­x. Epub ahead of
print 2020.
29. Adzhubei IA, Schmidt S, Peshkin L, et al. A method
and server for predicting damaging missense muta-
tions. Nat Methods;7. https://doi.org/10.1038/
nmeth0410-­248. Epub ahead of print 2010.
30. Capriotti E, Fariselli P, Casadio R. I-Mutant2.0: pre-
dicting stability changes upon mutation from the
protein sequence or structure. Nucleic Acids Res;33.
https://doi.org/10.1093/nar/gki375. Epub ahead of
print 2005.
31. Pandurangan AP, Ochoa-Montaño B, Ascher DB,
et al. SDM: a server for predicting effects of mutations
on protein stability. Nucleic Acids Res;45. https://doi.
org/10.1093/nar/gkx439. Epub ahead of print 2017.
32. Parthiban V, Gromiha MM, Schomburg D. CUPSAT:
prediction of protein stability upon point mutations.
Nucleic Acids Res;34. https://doi.org/10.1093/nar/
gkl190. Epub ahead of print 2006.
33. Schymkowitz J, Borg J, Stricher F, et al. The FoldX
web server: an online force field. Nucleic Acids
Res;33. https://doi.org/10.1093/nar/gki387. Epub
ahead of print 2005.
34. Alford RF, Leaver-Fay A, Jeliazkov JR, et al. The
Rosetta all-atom energy function for macromolecu-
lar modeling and design. J Chem Theory Comput;13.
https://doi.org/10.1021/acs.jctc.7b00125. Epub ahead
of print 2017.
35. Masso M, Vaisman II. AUTO-MUTE 2.0: a portable
framework with enhanced capabilities for predicting
protein functional consequences upon mutation. Adv
Bioinf. 2014. https://doi.org/10.1155/2014/278385.
Epub ahead of print 2014.
Integrating Computational Approaches to Predict the Effect of Genetic Variants on Protein Stability…
36. Venselaar H, te Beek TAH, Kuipers RKP, et al.
Protein structure analysis of mutations causing inher-
itable diseases. An e-Science approach with life sci-
entist friendly interfaces. BMC Bioinf;11. https://doi.
org/10.1186/1471-­2105-­11-­548. Epub ahead of print
2010.
37. De Groot BL, Van Aalten DMF, Scheek RM, et al.
Prediction of protein conformational freedom
from distance constraints. Proteins Struct Funct
Genet;29. https://doi.org/10.1002/(SICI)1097-­
0134(199710)29:2<240::AID-­PROT11>3.0.CO;2-­O.
Epub ahead of print 1997.
38. Thiltgen G, Goldstein RA. Assessing predictors of
changes in protein stability upon mutation using self-­
consistency. PLoS One;7. https://doi.org/10.1371/
journal.pone.0046084. Epub ahead of print 2012.
39. Kroncke BM, Duran AM, Mendenhall JL, et al.
Documentation of an imperative to improve
methods for predicting membrane protein stabil-
ity. Biochemistry;55. https://doi.org/10.1021/acs.
biochem.6b00537. Epub ahead of print 2016.
40. Karczewski KJ, Francioli LC, Tiao G, et al. The muta-
tional constraint spectrum quantified from variation in
141,456 humans. Nature;581. https://doi.org/10.1038/
s41586-­020-­2308-­7. Epub ahead of print 2020.
41. Jin B, Capra JA, Benchek P, et al. An association
test of the spatial distribution of rare missense vari-
ants within protein structures improves statistical
power of sequencing studies. bioRxiv. https://doi.
org/10.1101/2021.08.09.455695
42. Tzekov R, Stein L, Kausha S. Protein misfolding
and retinal degeneration Cold Spring Harb Perspect
Biol;3. https://doi.org/10.1101/cshperspect.a007492.
Epub ahead of print 2011.
43. Marinko JT, Huang H, Penn WD, et al. Folding and
misfolding of human membrane proteins in health
and disease: from single molecules to cellular pro-
teostasis. Chem Rev;119. https://doi.org/10.1021/acs.
chemrev.8b00532. Epub ahead of print 2019.
44. Sung CH, Davenport CM, Hennessey JC, et al.
Rhodopsin mutations in autosomal dominant retinitis
pigmentosa. Proc Natl Acad Sci U S A;88. https://doi.
org/10.1073/pnas.88.15.6481. Epub ahead of print
1991.
45. Kaushal S, Khorana HG. Structure and function in
rhodopsin. 7. Point mutations associated with autoso-
mal dominant retinitis pigmentosa. Biochemistry;33.
https://doi.org/10.1021/bi00186a011. Epub ahead of
print 1994.
46. Rader AJ, Anderson G, Isin B, et al. Identification
of core amino acids stabilizing rhodopsin. Proc
Natl Acad Sci U S A;101. https://doi.org/10.1073/
pnas.0401429101. Epub ahead of print 2004.
163
47. Wan A, Place E, Pierce EA, et al. Characterizing vari-
ants of unknown significance in rhodopsin: A func-
tional genomics approach. Hum Mutat;40. https://doi.
org/10.1002/humu.23762. Epub ahead of print 2019.
48. Milenkovic A, Milenkovic VM, Wetzel CH, et al.
BEST1 protein stability and degradation pathways
differ between autosomal dominant Best disease and
autosomal recessive bestrophinopathy accounting for
the distinct retinal phenotypes. Hum Mol Genet;27.
https://doi.org/10.1093/hmg/ddy070. Epub ahead of
print 2018.
49. Khan S, Vihinen M. Performance of protein stability
predictors. Hum Mutat;31. https://doi.org/10.1002/
humu.21242. Epub ahead of print 2010.
50. McCafferty CL, Sergeev Y V. In silico mapping of
protein unfolding mutations for inherited disease.
Sci Rep;6. https://doi.org/10.1038/srep37298. Epub
ahead of print 2016.
51. Martin Merinero H, Zhang Y, Arjona E, et al.
Functional characterization of 105 Factor H vari-
ants associated with atypical HUS: lessons for vari-
ant classification. Blood. https://doi.org/10.1182/
blood.2021012037. Epub ahead of print 2021.
52. Fritsche LG, Igl W, Bailey JNC, et al. A large genome-­
wide association study of age-related macular degen-
eration highlights contributions of rare and common
variants. Nat Genet;48. https://doi.org/10.1038/
ng.3448. Epub ahead of print 2016.
53. Hallam TM, Marchbank KJ, Harris CL, et al. Rare
genetic variants in complement factor I lead to low
FI plasma levels resulting in increased risk of age-­
related macular degeneration. Investig Ophthalmol
Vis Sci;61. https://doi.org/10.1167/IOVS.61.6.18.
Epub ahead of print 2020.
54. Kremlitzka M, Geerlings MJ, De Jong S, et al.
Functional analyses of rare genetic variants in com-
plement component C9 identified in patients with age-­
related macular degeneration. Hum Mol Genet;27.
https://doi.org/10.1093/hmg/ddy178. Epub ahead of
print 2018.
55. Geerlings MJ, Kersten E, Groenewoud JMM, et al.
Geographic distribution of rare variants associated
with age- related macular degeneration. Mol Vis.
2018;9:75–82.
56. de Jong S, Gagliardi G, Garanto A, et al. Implications
of genetic variation in the complement system in age-­
related macular degeneration. Prog Retin Eye Res;84.
https://doi.org/10.1016/j.preteyeres.2021.100952.
Epub ahead of print 2021.
57. de Jong S, Volokhina EB, de Breuk A, et al. Effect
of rare coding variants in the CFI gene on factor I
expression levels. Hum Mol Genet;29. https://doi.
org/10.1093/hmg/ddaa114. Epub ahead of print 2020.
 Network Biology and Medicine
to Rescue: Applications for Retinal
Disease Mechanisms and Therapy

Anupam K. Mondal and Anand Swaroop

Abstract developments, especially gene agnostic treat-

Inherited retinal degenerations (IRDs) are
clinically and genetically heterogenous blind-
ing diseases that manifest through dysfunction
of target cells, photoreceptors, and retinal pig-
ment epithelium (RPE) in the retina. Despite
knowledge of numerous underlying genetic
defects, current therapeutic approaches,
including gene centric applications, have had
limited success, thereby asserting the need of
new directions for basic and translational
research. Human diseases have commonalities
that can be represented in a network form,
called diseasome, which captures relation-
ships among disease genes, proteins, metabo-
lites, and patient meta-data. Clinical and
genetic information of IRDs suggest shared
relationships among pathobiological factors,
making these a model case for network medi-
cine. Characterization of the diseasome would
considerably improve our understanding of
retinal pathologies and permit better design of
targeted therapies for disrupted regions within
the integrated disease network. Network med-
icine in synergy with the ongoing artificial
intelligence revolution can boost therapeutic
A. K. Mondal (*) · A. Swaroop
Neurobiology, Neurodegeneration & Repair
Laboratory, National Eye Institute, National Institutes
of Health, Bethesda, MD, USA
e-mail: mondalak@nih.gov
ment opportunities.
Keywords
Inherited retinal degeneration · Network
medicine · Systems biology · Diseasome ·
Neurodegeneration
1 Introduction
Inherited retinal degenerations (IRDs) manifest
through untimely dysfunction and degeneration
of the retina causing permanent vision loss.
Genetic etiology of retinal neurodegeneration is
remarkably diverse. IRDs arise from Mendelian
inheritance of pathogenic mutations in one of at
least 300 genes [1], though involvement of more
than one gene and modifier genes have been
implicated in producing a clinical phenotype [2].
In contrast, age-related macular degeneration
(AMD), glaucoma, and diabetic retinopathy
(DR) are complex multifactorial pathologies,
where a multitude of factors including genetics,
environment, diet, and other health conditions
contribute to disease risk [3]. IRDs present as a
spectrum of phenotypes, and appropriate clinical
management depends on accurate prognosis or
diagnosis, pathology forecast, drug development,
and treatment. However, IRDs remain generally
untreatable despite identification of many disease

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 165
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_25
166
genes. Treatments with gene replacement therapy
would be ideal for recessive IRD-like diseases
exhibiting loss of function phenotypes, but in
practice challenges are manifold. At this stage,
only one regimen has FDA approval, while few
other candidates are at various stages of develop-
ment and clinical trials [4, 5]. Overall, gene ther-
apy has proven cumbersome and expensive,
notwithstanding the complexity in designing
gene therapies for the huge diversity of genetic
mutations and disease genes associated with
IRDs. This has gravitated researchers to gene-­
agnostic methods that have shown promising pre-
liminary outcomes. Recently, a disease
gene-independent optogenetics-based vision
augmentation technology was found to provide
visual feedback in a patient with severe blindness
[6]. Stem cell-derived photoreceptor and RPE
replacement provide potentially interesting
approaches [7]; however, much remains to be
done especially with respect to cellular and func-
tional integration of grafted cells into host retina
with extensive degeneration. The applicability of
gene agnostic therapies to more than one pathol-
ogy makes these an arguably better treatment
alternative for IRDs [8, 9]. Nevertheless, success
of translational research depends on knowledge
of molecular etiology, and retinal degenerative
disease mechanisms remain poorly understood.
Systems biology approaches in the post-­
genomic era have guided unprecedented insights
into biomolecular interactions underlying human
health and diseases. Advent of high-throughput
large data analytics and their subsequent adop-
tion in biology and medicine have launched novel
methodological advances that have defied tradi-
tional “one-gene one-disease” research and
instead banked on integrating molecular land-
scapes to offer a “bird’s eye view” of cellular sys-
tems [10]. These strategies have been
transformative for studying protein-protein inter-
actions, metabolic simulations, cellular signal-
ing, and gene regulation, among others [11–14].
A notable feature in this movement has been the
use of graph theory to capture biomolecular
interactions in network graphs that can be ana-
lyzed using innovative algorithms. Network biol-
A. K. Mondal and A. Swaroop
ogy or network medicine, as this specialty is now
broadly referred to, is an exciting new way of
unraveling disease complexity through network
science, multi-omic data integration, and machine
intelligence [15, 16]. Network medicine has been
particularly insightful through creation of the
human disease network, the “diseasome,” which
has led to realizations that nearly two-third of all
pathologies might share comparable genetic
inceptions, while a majority of disease genes co-­
occur in pathologies [17]. Network medicine has
guided improved understanding of neurological
diseases [18, 19] as well as notable advances in
COVID-19 research among others [20–24].
Artificial intelligence is undergoing revolu-
tionary changes and is projected to have consid-
erable impact on the biomedical research
community [25, 26]. Ophthalmological scientists
have been at the forefront of using AI; however,
its use has remained confined to medical image
analyses of specific diseases [27]. AI has tremen-
dous potential in retinal disease research, particu-
larly for biomarker detection and drug discovery
[28, 29]. In this book chapter, we discuss the cur-
rent advances and future prospect of network
medicine and artificial intelligence as applicable
to retinal disease, especially IRD, research.
2 Molecular Genetics of IRDs
IRDs constitute a broad family of retinal dys-
functions and dystrophies, with estimated prev-
alence of ~1 in 3000 individuals and affecting
more than two million people globally [30, 31].
Inheritance is generally monogenic; however,
genotype-phenotype correlations have been
extremely difficult to establish [32]. In some
instances, di- or multi-genic inheritance pat-
terns have been noted [2], but modifier genes
have also been implicated for generating spe-
cific phenotypic variability [33]. To date, more
than 10,000 mutations in nearly 300 genes have
been attributed to IRDs, following autosomal-
recessive, autosomal-dominant, X-linked, or
mitochondrial patterns of inheritance [1].
Recent large-scale genomic studies have esti-
Network Biology and Medicine to Rescue: Applications for Retinal Disease Mechanisms and Therapy
mated that pathogenic mutations related with
IRDs are prevalent at a rate of 1 in 3 individuals
[30, 32]. This presents an interesting notion that
retinal disease mutations are more common
than previously predicted. Although IRD muta-
tions affect a few retinal cell classes, photore-
ceptors and particularly rods are the most
frequent targets [34, 35]. However, estimates
suggest nearly 30–50% clinical cases remain
unresolved, indicating that the genetic basis of
IRD is yet to be comprehensively characterized
[32]. Clinically, retinal degeneration can begin
at various stages of human lifetime. Leber con-
genital amaurosis (LCA) is when retinal degen-
eration initiates at birth or during early
childhood. Most adult-onset pathologies
marked by early rod dysfunction and night
blindness are called retinitis pigmentosa (RP).
In many cases, photoreceptors of the human
central retina (i.e., macula) undergo dystrophy
and thus contribute to macular degeneration
(MD). An example is Stargardt disease, a form
of early onset MD, where the ABCA4 gene is
the site of mutations that cause central vision
loss [34]. Juvenile onset MD is distinct from
age-related macular degeneration (AMD), a
multifactorial disease prevalent in older indi-
viduals. Genetic variants in a number of IRD
genes can also contribute to AMD, such as in
case of ABCA4 and TIMP3 [1]. Additionally,
depending on the disease gene involved, IRD
mutations can have extraocular phenotypes,
i.e., a syndromic pathology [34]. However,
IRDs have interesting genetic etiologies.
Depending on the mutation, disease genes can
cause different pathologies. Genes like ABCA4,
PROM1, and PRPH2 are implicated in distinct
clinical pathologies, while many others are
linked to a single disease. On the other hand,
similar IRD phenotypes can arise from muta-
tions in different genes. These associations are
suggestive of shared molecular events deter-
mining disease onset (Fig. 1a). Therefore, elu-
cidating the retinal diseasome, i.e., the
interaction framework of retinal pathologies,
disease genes, pathways, and other molecular
events, would be a step toward holistic under-
standing of IRDs.
167
3 Network Medicine
and Healthcare
The genomics era has brought revolutionary
changes in biomedical research. In this age of data
intense research, an important distinction is a
departure from the reductionist approach in favor
of a top-down scheme to study comprehensive
molecular interactions regulating health and dis-
ease. This has been made possible by technologi-
cal and conceptual innovations that are now a
mainstay in contemporary research. A pivotal
application in this movement has been the use of
networks to integrate biomolecular interactions at
systems resolution [11]. Network graphs are natu-
rally suited to represent biological relationships,
and assessment of biological networks using graph
theory tools have uncovered valuable knowledge
of the complex biology of health and disease [36].
Network Medicine A fundamental assumption
of network medicine is that pathology is estab-
lished in the finite space of interactome, and
therefore diseases can be predicted to have shared
mechanistic components [15, 36]. The human
diseasome and the human symptoms disease net-
work studies uncovered notable molecular and
phenotypic commonalities among diseases [17,
37]. Cellular homeostasis is preserved by thou-
sands of spatio-temporally regulated meaningful
biomolecular interactions. Pathogenic mutations
cause alterations in the expression or activity of
proteins coded by the disease gene; however,
these abnormalities propagate in the interactome
through pathways and functional neighborhoods
of the target protein. In this context, disease onset
can be imagined as a result of increasing aberra-
tions in homeostatic molecular events. Network
analysis has shown that disease factors have dis-
tinct placement in the molecular interactome and
can be found to cluster into disease modules [17].
Network-based approaches aim to capture these
trends in graph structures to create browsable in
silico models and have created opportunities
where mapping and characterization of disease
modules can identify additional operators of
pathology, which in turn could inspire transla-
tional outcomes [38].
168
Fig. 1 Integrative biology for retinal disease research. (a)
Shared genetic origin of IRDs. Nodes represent IRD
pathologies (blue) or disease genes (grey) listed in RetNet
[1], while edges connect disease genes to associated
pathologies. Distinct IRD pathologies can occur from
mutations in overlapping genes, whereas a particular IRD
phenotype can be an outcome of mutations in several dif-
ferent genes. This network suggests commonalities in
molecular phenotype underlying IRD pathogenesis. (b)
Illustration of IRD disease genes and temporally impacted
pathways in the cellular interactome. Individual mutations
The Artificial Intelligence (AI) Revolution and
a New Paradigm for Medicine Availability of
vast amounts of diverse biological and clinical
information is alluring data scientists to biomedi-
cal research [26, 39]. AI involves designing com-
puter programs to learn, interpret, and predict
real-world classifications mimicking human
intellect. For instance, machine learning models
can now diagnose retinal pathologies and cardio-
vascular events with accuracy comparable to that
of trained clinicians [40–42]. Interestingly, these
models can be reverse engineered to reveal novel
patterns in biomedical data and stimulate data-­
A. K. Mondal and A. Swaroop
affect the host gene (genes X and Y) and alter immediate
interactions (early impact); however, disease onset hap-
pens when functional dysregulation propagates (late
impact). In this scheme, influence from different genes
can be imagined to converge at common nodes, poten-
tially accounting for overlapping molecular phenotype.
(c) An integrative framework to model the retinal disea-
some. Characterizing the retinal diseasome will improve
our understanding of pathology mechanisms and promote
new therapeutic developments
driven hypotheses for laboratory investigations
[43]. Furthermore, network medicine in synergy
with AI can remarkably accelerate scientific dis-
coveries, as exemplified in the ongoing
COVID-­19 pandemic, where significant advances
in understanding pathology mechanisms, drug
candidate identification, clinical diagnosis, and
outbreak forecasts were achieved in record time
[21, 22, 44, 45]. Simply put, network medicine
and AI have the potential to enhance clinical
and preclinical research through multifaceted
innovations and are projected to transform
biomedicine.
Network Biology and Medicine to Rescue: Applications for Retinal Disease Mechanisms and Therapy
4 Retinal Degeneration
Mechanisms and Therapy
Retinal neurodegenerative diseases have limited
treatment options and most available therapies
attempt to control progression into severe pathol-
ogy. Mitigation strategies employed so far
include gene therapy, cell replacement therapies,
and prosthesis, among others [8, 9]. A major con-
straint in retinal therapy development is the lack
of understanding of underlying disease mecha-
nisms, despite availability of numerous animal
models and the retina being a well-characterized
tissue [34]. Furthermore, tremendous genetic
diversity of mutations and genes involved in
IRDs warrant treatments that can target multiple
pathologies. To this end, gene agnostic methods
backed by network medicine are a natural choice,
where innovative approach can lead to better
understanding of disease mechanisms, drug dis-
covery through repurposing/repositioning, and
improved clinical diagnosis and pathology
forecasts.
IRD Mechanisms and Models Offer a Case for
Temporal Multi-omics Study Known retinal
disease genes perform various molecular tasks
and participate in a wide range of pathways in
distinct retinal cells [46]. Across the genes and
thousands of mutations, it is still unclear how a
convergent fate of neuronal degeneration devel-
ops, albeit with different onset and progression
patterns. Over the years, some theoretical models
have been proposed to describe plausible integra-
tive mechanisms underlying IRD. In the cumula-
tive damage model, accumulation of abnormal
biochemical changes is imagined to trigger cell
death [47]. The one-hit model proposes a mutant
steady state in target retinal cells that eventually
succumb upon a random cause [48]. Similarly,
the stochastic model emphasizes a variable cell
death probability among mutant retinal cells,
where disease onset happens from apoptosis in a
fraction of target cells, and others survive rela-
tively longer resulting in a progressive gradient
[46]. Notably, the latter two models subscribe to
169
a constant cell death risk over the course of dis-
ease. In the convergent pathway hypothesis,
mutation signals are anticipated to arrive at one
of select “pre-apoptotic” switches that then deter-
mine the disease course [46, 49]. Interestingly, in
the majority of these models, pre-pathology inte-
gration can be predicted from a central regulator
such as mitochondria, for its crucial role in sig-
naling, apoptosis, and bioenergetics. Along these
lines, we have observed metabolic adaptations
and mitochondrial dysfunction as prominent fea-
ture of very early stages preceding disease onset
in a widely studied IRD model (rd1 mouse) [50].
Nonetheless, these models are yet to be tested
exhaustively, and the precise mode of IRD onset
and progression remains poorly understood.
Mapping pathway changes and interactions pre-
ceding disease onset onto interactome networks
would provide an integrated map of assessing
IRD pathology (Fig. 1b).
Network Medicine for Retinal Disease
Mechanisms and Therapies Managing retinal
degenerations requires addressing challenges on
all preclinical and clinical fronts. Network
medicine-­inspired study design and innovative
AI algorithms can provide definitive steps toward
elucidation of the retinal diseasome and a new
direction for ocular disease research.
Identification of genetic factors and disease genes
in the clinic remains a challenge [30, 32]; how-
ever, diagnosis can benefit from genomic screen-
ing and machine learning algorithms [51]. For
delineating disease mechanisms, layers of retinal
molecular landscapes, such as genome, transcrip-
tome, proteome, metabolome, and cellular sig-
naling events, need to be integrated, ideally at
various time points, before disease onset to pin-
point the originators of cellular dysregulation and
molecular pathology (Fig. 1c). Following similar
approaches, recent multi-omics studies of the
retina have uncovered interesting insights [50,
52]. Network medicine can speed up biomarker
discovery in ophthalmology and illustrate genetic
and molecular etiology of ocular diseases.
170
5 Conclusion
Fundamental insights and breakthroughs are nec-
essary to advance therapeutic developments for
clinical management and vision restoration
efforts. Multi-omic network medicine investiga-
tions can distinguish early pathological changes
in the retinal interactome and lead to biomarkers
and drug targets. Similar approach when extended
to complex retinal phenotypes like aging and
age-related pathologies should elucidate the reti-
nal diseasome and lead to strategies for healthy
vision.
References
1. RetNet. RetNet, the Retinal Information Network.
Available from: https://sph.uth.edu/retnet/
2. Rivolta C, Sharon D, DeAngelis MM, Dryja
TP. Retinitis pigmentosa and allied diseases: numer-
ous diseases, genes, and inheritance patterns. Hum
Mol Genet. 2002;11(10):1219–27.
3. Swaroop A, Chew EY, Rickman CB, Abecasis
GR. Unraveling a multifactorial late-onset disease:
from genetic susceptibility to disease mechanisms
for age-related macular degeneration. Annu Rev
Genomics Hum Genet. 2009;10:19–43.
4. Maguire AM, Simonelli F, Pierce EA, Pugh EN Jr,
Mingozzi F, Bennicelli J, et al. Safety and efficacy
of gene transfer for Leber's congenital amaurosis. N
Engl J Med. 2008;358(21):2240–8.
5. Levi SR, Ryu J, Liu PK, Tsang SH. Precision medi-
cine trials in retinal degenerations. Annu Rev Vis Sci.
2021;7:851–65.
6. Sahel JA, Boulanger-Scemama E, Pagot C, Arleo A,
Galluppi F, Martel JN, et al. Partial recovery of visual
function in a blind patient after optogenetic therapy.
Nat Med. 2021;27(7):1223–9.
7. West EL, Ribeiro J, Ali RR. Development of stem cell
therapies for retinal degeneration. Cold Spring Harb
Perspect Biol. 2020;12(8) 1.
8. Roska B, Sahel JA. Restoring vision. Nature.
2018;557(7705):359–67.
9. Scholl HP, Strauss RW, Singh MS, Dalkara D,
Roska B, Picaud S, et al. Emerging therapies for
inherited retinal degeneration. Sci Transl Med.
2016;8(368):368rv6.
10. Hood L, Heath JR, Phelps ME, Lin B. Systems biol-
ogy and new technologies enable predictive and pre-
ventative medicine. Science. 2004;306(5696):640–3.
11. Barabasi AL, Oltvai ZN. Network biology: under-
standing the cell's functional organization. Nat Rev
Genet. 2004;5(2):101–13.
12. Kitano H. Systems biology: a brief overview. Science.
2002;295(5560):1662–4.
A. K. Mondal and A. Swaroop
13. Orth JD, Thiele I, Palsson BO. What is flux balance
analysis? Nat Biotechnol. 2010;28(3):245–8.
14. Milo R, Shen-Orr S, Itzkovitz S, Kashtan N, Chklovskii
D, Alon U. Network motifs: simple building blocks of
complex networks. Science. 2002;298(5594):824–7.
15. Barabasi AL, Gulbahce N, Loscalzo J. Network medi-
cine: a network-based approach to human disease.
Nat Rev Genet. 2011;12(1):56–68.
16. Maron BA, Altucci L, Balligand JL, Baumbach
J, Ferdinandy P, Filetti S, et al. A global net-
work for network medicine. NPJ Syst Biol Appl.
2020;6(1):29.
17. Goh KI, Cusick ME, Valle D, Childs B, Vidal M,
Barabasi AL. The human disease network. Proc Natl
Acad Sci U S A. 2007;104(21):8685–90.
18. Corominas R, Yang X, Lin GN, Kang S, Shen Y,
Ghamsari L, et al. Protein interaction network of
alternatively spliced isoforms from brain links genetic
risk factors for autism. Nat Commun. 2014;5:3650.
19. Soler-Lopez M, Zanzoni A, Lluis R, Stelzl U, Aloy
P. Interactome mapping suggests new mechanistic
details underlying Alzheimer’s disease. Genome Res.
2011;21(3):364–76.
20. Dudley JT, Sirota M, Shenoy M, Pai RK, Roedder S,
Chiang AP, et al. Computational repositioning of the
anticonvulsant topiramate for inflammatory bowel
disease. Sci Transl Med. 2011;3(96):96ra76.
21. Gordon DE, Jang GM, Bouhaddou M, Xu J, Obernier
K, White KM, et al. A SARS-CoV-2 protein interac-
tion map reveals targets for drug repurposing. Nature.
2020;583(7816):459–68.
22. Gysi DM, Do Valle I, Zitnik M, Ameli A, Gan X, Varol
O, et al. Network medicine framework for identifying
drug repurposing opportunities for COVID-­19. ArXiv
2020.
23. Luo Y, Zhao X, Zhou J, Yang J, Zhang Y, Kuang
W, et al. A network integration approach for drug-­
target interaction prediction and computational drug
repositioning from heterogeneous information. Nat
Commun. 2017;8(1):573.
24. Sirota M, Dudley JT, Kim J, Chiang AP, Morgan
AA, Sweet-Cordero A, et al. Discovery and preclini-
cal validation of drug indications using compendia
of public gene expression data. Sci Transl Med.
2011;3(96):96ra77.
25. Goecks J, Jalili V, Heiser LM, Gray JW. How
machine learning will transform biomedicine. Cell.
2020;181(1):92–101.
26. Wainberg M, Merico D, Delong A, Frey BJ. Deep
learning in biomedicine. Nat Biotechnol.
2018;36(9):829–38.
27. Li JO, Liu H, Ting DSJ, Jeon S, Chan RVP, Kim JE,
et al. Digital technology, tele-medicine and artificial
intelligence in ophthalmology: a global perspective.
Prog Retin Eye Res. 2021;82:100900.
28. Campbell JP, Mathenge C, Cherwek H, Balaskas K,
Pasquale LR, Keane PA, et al. Artificial intelligence
to reduce ocular health disparities: moving from
concept to implementation. Transl Vis Sci Technol.
2021;10(3):19.
Network Biology and Medicine to Rescue: Applications for Retinal Disease Mechanisms and Therapy
29. Becker SM, Tumminia SJ, Chiang MF. The NEI
audacious goals initiative: advancing the frontier
of regenerative medicine. Transl Vis Sci Technol.
2021;10(10):2.
30. Hanany M, Rivolta C, Sharon D. Worldwide carrier
frequency and genetic prevalence of autosomal reces-
sive inherited retinal diseases. Proc Natl Acad Sci U S
A. 2020;117(5):2710–6.
31. Berger W, Kloeckener-Gruissem B, Neidhardt J. The
molecular basis of human retinal and vitreoretinal dis-
eases. Prog Retin Eye Res. 2010;29(5):335–75.
32. Carss KJ, Arno G, Erwood M, Stephens J, Sanchis-­
Juan A, Hull S, et al. Comprehensive rare variant
analysis via whole-genome sequencing to determine
the molecular pathology of inherited retinal disease.
Am J Hum Genet. 2017;100(1):75–90.
33. Kousi M, Katsanis N. Genetic modifiers and oligo-
genic inheritance. Cold Spring Harb Perspect Med.
2015;5(6):a017145.
34. Veleri S, Lazar CH, Chang B, Sieving PA, Banin E,
Swaroop A. Biology and therapy of inherited retinal
degenerative disease: insights from mouse models.
Dis Model Mech. 2015;8(2):109–29.
35. Hartong DT, Berson EL, Dryja TP. Retinitis pigmen-
tosa. Lancet. 2006;368(9549):1795–809.
36. Furlong LI. Human diseases through the lens of net-
work biology. Trends Genet. 2013;29(3):150–9.
37. Zhou X, Menche J, Barabasi AL, Sharma A. Human
symptoms-disease network. Nat Commun.
2014;5:4212.
38. Sonawane AR, Weiss ST, Glass K, Sharma A. Network
medicine in the age of biomedical big data. Front
Genet. 2019;10:294.
39. Baldi P. Deep learning in biomedical data science.
Annu Rev Biomed Data Sci. 2018;1(1):181–205.
40. Scruggs BA, Chan RVP, Kalpathy-Cramer J, Chiang
MF, Campbell JP. Artificial intelligence in retinopa-
thy of prematurity diagnosis. Transl Vis Sci Technol.
2020;9(2):5.
41. Ting DSW, Pasquale LR, Peng L, Campbell JP,
Lee AY, Raman R, et al. Artificial intelligence and
deep learning in ophthalmology. Br J Ophthalmol.
2019;103(2):167–75.
42. Ambale-Venkatesh B, Yang X, Wu CO, Liu K,
Hundley WG, McClelland R, et al. Cardiovascular
171
event prediction by machine learning: the
multi-ethnic study of atherosclerosis. Circ Res.
2017;121(9):1092–101.
43. Eraslan G, Avsec Z, Gagneur J, Theis FJ. Deep learn-
ing: new computational modelling techniques for
genomics. Nat Rev Genet. 2019;20(7):389–403.
44. Arik SO, Shor J, Sinha R, Yoon J, Ledsam JR, Le
LT, et al. A prospective evaluation of AI-augmented
epidemiology to forecast COVID-19 in the USA and
Japan. NPJ Digit Med. 2021;4(1):146.
45. Zhou Y, Hou Y, Shen J, Mehra R, Kallianpur
A, Culver DA, et al. A network medicine
approach to investigation and population-
based validation of disease manifestations
and drug repurposing for COVID-19. PLoS
Biol. 2020;18(11):e3000970.
46. Wright AF, Chakarova CF, Abd El-Aziz MM,
Bhattacharya SS. Photoreceptor degeneration: genetic
and mechanistic dissection of a complex trait. Nat
Rev Genet. 2010;11(4):273–84.
47. Travis GH. Mechanisms of cell death in the inher-
ited retinal degenerations. Am J Hum Genet.
1998;62(3):503–8.
48. Clarke G, Collins RA, Leavitt BR, Andrews DF,
Hayden MR, Lumsden CJ, et al. A one-hit model of
cell death in inherited neuronal degenerations. Nature.
2000;406(6792):195–9.
49. Swaroop A, Kim D, Forrest D. Transcriptional regu-
lation of photoreceptor development and homeo-
stasis in the mammalian retina. Nat Rev Neurosci.
2010;11(8):563–76.
50. Jiang K, Mondal AK, Adlakha Y, Gumerson J,
Aponte AM, Gieser L, et al. Multiomics analyses
reveal early metabolic imbalance and mitochondrial
stress in neonatal photoreceptors leading to cell
death in Pde6brd1/rd1 mouse model of retinal degen-
eration. Hum Mol Genet. 2022;31(13):2137–54.
51. Dockery A, Whelan L, Humphries P, Farrar GJ. Next-­
generation sequencing applications for inherited reti-
nal diseases. Int J Mol Sci. 2021;22(11):5684.
52. Cherry TJ, Yang MG, Harmin DA, Tao P, Timms
AE, Bauwens M, et al. Mapping the cis-regulatory
architecture of the human retina reveals noncoding
genetic variation in disease. Proc Natl Acad Sci U S
A. 2020;117(16):9001–12.
 Non-syndromic Retinal
Degeneration Caused
by Pathogenic Variants in Joubert
Syndrome Genes

Riccardo Sangermano, Egle Galdikaité-Braziené,

and Kinga M. Bujakowska

Abstract Keyword

Inherited retinal degenerations (IRDs) are a Non-syndromic IRD · Joubert syndrome ·

group of genetic disorders characterized by
progressive dysfunction and loss of photore-
ceptors. IRDs are classified as non-syndromic
or syndromic, depending on whether retinal
degeneration manifests alone or in combina-
tion with other associated symptoms. Joubert
syndrome (JBTS) is a genetically and clini-
cally heterogeneous disorder affecting the
central nervous system and other organs and
tissues, including the neuroretina. To date, 39
genes have been associated with JBTS, a
majority of which encode structural or func-
tional components of the primary cilium, a
specialized sensory organelle present in most
post-mitotic cells, including photoreceptors.
The use of whole exome and IRD panel next-­
generation sequencing in routine diagnostics
of non-syndromic IRD cases led to the discov-
ery of pathogenic variants in JBTS genes that
cause photoreceptor loss without other syn-
dromic features. Here, we recapitulate these
findings, describing the JBTS gene defects
leading to non-syndromic IRDs.
R. Sangermano · E. Galdikaité-Braziené ·
K. M. Bujakowska (*)
Ocular Genomics Institute, Massachusetts Eye and
Ear, Department of Ophthalmology, Harvard Medical
School, Boston, MA, USA
e-mail: kinga_bujakowska@meei.harvard.edu
Genotype-phenotype correlation · CEP290 ·
OFD1 · ARL3 · AHI1 · INPP5E
1 Introduction
Inherited retinal degenerations (IRDs) are a group
of genetically and clinically heterogeneous disor-
ders characterized by progressive photoreceptor
loss due to genetic defects in ~270 genes, inherited
in all Mendelian modes [1]. Non-­syndromic IRDs
manifest as an isolated retinal phenotype, while
syndromic IRDs affect other organs. A prominent
group of syndromic IRDs involves genes that code
for proteins that are necessary for the generation
and maintenance of the primary cilium, a special-
ized organelle present in most post-mitotic cells
[2]. These diseases are known as ciliopathies. As
the photoreceptor outer segment can be regarded
as a specialized primary cilium, many ciliopathies
often involve the retina [3].
Joubert syndrome (JBTS, OMIM #PS213300)
is an example of ciliopathy with retinal involve-
ment. JBTS is an autosomal or X-linked reces-
sive disorder, caused by defects in 39 different
genes (Fig. 1). Over the years, the increasing
mutational screening studies in non-syndromic
IRD patients led to the identification of several
cases carrying variants in genes initially

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 173
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_26
174
Fig. 1 Overlap of clinical and genetic causation for
Joubert syndrome, other syndromic conditions, and non-­
syndromic IRD. Gene names highlighted in red indicate
that the relationship between the phenotype and the gene
is provisional. BBS Bardet–Biedl syndrome, LCA Leber
a­ ssociated with JBTS. In this chapter, we pro-
vide an overview of these novel associations and
describe pathogenic variants detected in IRD
cases.
2 Joubert Syndrome Genes
Mutated in Non-syndromic
Retinal Degeneration
2.1 
CEP290
CEP290 encodes a 2479 residue Centrosomal
Protein 290 (kDa), which localizes to the centro-
meres of dividing cells and to the transition zone
of the cilia, sometimes referred to as ‘connecting
cilium’ in the photoreceptors [4]. CEP290 plays a
pivotal role in regulating cilia assembly and
development [5]. A recent study suggests that it is
essential for the initiation of transition zone
assembly [6].
CEP290 is the most frequently mutated gene
in recessive ciliopathies. Pathogenic variants in
this gene have been associated with Meckel syn-
drome (MKS; OMIM #611134), Senior–Løken
syndrome (SLS; OMIM #610189), Joubert syn-
drome (JBTS; OMIM #610188), and Bardet–
Biedl syndrome (BBS; OMIM #615991).
R. Sangermano et al.
congenital amaurosis, MKS Meckel syndrome, MORM
mental retardation, truncal obesity, retinal dystrophy, and
micropenis, OFDS oral-facial-digital syndrome, SGBS
Simpson–Golabi–Behmel syndrome, SLS Senior–Løken
syndrome
However, hypomorphic CEP290 mutations may
also cause non-syndromic IRDs, in particular
Leber Congenital Amaurosis (LCA), rod-cone
(RCD) and cone-rod dystrophies (CRD)
(Table 1) [7, 8].
The hypomorphic deep-intronic variant
c.2991 + 1655A > G, resulting in a mixture of
truncating (p.Cys998*) and wild-type proteins
[7], is by far the most frequent variant identified
in non-syndromic IRD patients harboring
CEP290 mutations (https://databases.lovd.nl/
shared/genes/CEP290) [9]. In fact, ~77% of
CEP290-IRD patients carry this variant in a com-
pound heterozygous state, while another ~21% is
homozygous [10].
Other two well-studied hypomorphic vari-
ants are c.451C > T, p.(Arg151*) and
c.4723A > T, p.(Lys1575*), both seemingly
resulting in truncating mutations. The first vari-
ant (c.451C > T), found in family members with
variable retinal phenotypes, leads to a mixture
of splicing products, one carrying the predicted
stop variant (p.(Arg151*)) and two resulting in
in-frame deletions (p.(Leu148_Glu165del) and
p.(Leu148_Lys172del)) [11]. The second vari-
ant (c.4723A > T) gives rise to a truncated pro-
tein (p.(Lys1575*)) and an altered splicing
product resulting in an in-frame deletion (­p.
Non-syndromic Retinal Degeneration Caused by Pathogenic Variants in Joubert Syndrome Genes 175

Table 1 CEP290 variants leading to non-syndromic IRD

Allele_1 (hg19) Allele_2 (hg19) Phenotype Probands References
c.2991 + 1655A > G, c.2991 + 1655A > G, LCA 38 Coppieters et al. (2010), den
p.(Cys998*) p.(Cys998*) Hollander et al. (2006),
Feldhaus et al. (2021),
Perrault et al. (2007),
Sallum et al. (2020), Testa et al.
(2021)
c.2991 + 1655A > G, Termination, frameshift and LCA or 103 Coppieters et al. (2010), den
p.(Cys998*) essential splice site variants RD Hollander et al. (2006),
Feldhaus et al. (2021),
Littink et al. (2010),
Perrault et al. (2007),
Sallum et al. (2020), Simonelli
et al. (2007), Skorczyk-­
Werner et al. (2020),
Testa et al. (2021), and
Tracewska et al. (2021)
c.2991 + 1655A > G, c.185A > G, p.(Lys62Arg) LCA 1 Tracewska et al. (2021)
p.(Cys998*)
c.2991 + 1655A > G, c.6012-12T > A, p.(?) LCA 1 Sallum et al. (2020)
p.(Cys998*)
c.2991 + 1655A > G, c.6271-8T > G, p.(?) LCA 2 Sallum et al. (2020)
p.(Cys998*)
c.164_167delCTCA, c.4723A > T, p.(Lys1575*) LCA 1 Sallum et al. (2020)
p.(Thr55Serfs*3)
c.180 + 1G > T, p.(?) c.7031_7034del, LCA or 1 Testa et al. (2021)
p.(Leu2344Hisfs*2) RD
c.250 + 2T > C, p.(?) c.7027del, RCD 2 Rafalska et al.
p.(Val2343Phefs*4) (2020), Tracewska et al. (2021)
c.353_354insGCAATTG, c.508A > T, p.(Lys170*) LCA 2 Sallum et al. (2020)
p.(Cys118Trpfs*6)
c.384_387delTAGA, c.4723A > T, p.(Lys1575*) LCA 1 Sallum et al. (2020)
p.(Asp128Glufs*34)
c.881C > G, p.(Ser294*) c.1522 + 1G > C, p.(?) LCA 1 Sallum et al. (2020)
c.1187_1188del, c.7341_7344dupACTT, LCA or 1 Testa et al. (2021)
p.(Lys396Argfs*25) p.(Ser2449Thrfs*7) RD
c.1511_1514 del GAGA, c.1511_1514 del GAGA, LCA 1 Aboussair et al. (2010)
p.(Arg504Serfs*10) p.(Arg504Serfs*10)
c.1666delA, c.2052 + 1_2052 + 2delGT, LCA 1 Sallum et al. (2020)
p.(Ile556Phefs*17) p.(?)
c.1666dupA, c.3310–1_3313delGCTTA, LCA 1 Chen et al. (2021)
p.(Ile556Asnfs*20) p.(Leu1104fs*6)
c.1711 + 5G > A, p.(?) c.5587-1G > C, p.(?) LCA 1 Perrault et al. (2007)
c.1936C > T, p.(Gln646*) c.6604delA, LCA 1 Perrault et al. (2007)
p.(Ile2203Leufs*23)
c.3012delA, c.4732G > T, p.(Glu1578*) LCA or 1 Testa et al. (2021)
p.(Glu1005Asnfs*6) RD
c.3640dupG, c.6604delA, LCA 1 Einsenberger et al. (2013)
p.(Glu1214Glyfs*7) p.(Ile2202Leufs*24)
c.4029 + 1G > A, p.(?) c.7048C > T, p.(Gln2350*) LCA 1 Feldhaus et al. (2021)
c.4040G > A, p. c.3104-2delA, p.(?) RCD 1 Shen et al. (2014)
(Trp1347*)
c.4705-1G > T, p.(?) c.3811C > T, p.(Arg1271*) LCA or 1 Testa et al. (2021)
RD
c.4711C > T, (p.Gln1597*) c.4711C > T, p.(Gln1597*) LCA 1 Beryzokin et al. (2014)
(continued)
176 R. Sangermano et al.

Table 1 (continued)
Allele_1 (hg19) Allele_2 (hg19) Phenotype Probands References
c.4723A > T, p.(Lys1575*) c.4723A > T, p.(Lys1575*) LCA 3 Perrault et al.
(2007), Coppieters et al. (2010)
c.4723A > T, p.(Lys1575*) c.1709C > G, p.(Ser570*) LCA 1 Perrault et al. (2007)
c.4882C > T, p.(Gln1628*) c.4882C > T, p.(Gln1628*) RCD 1 Tracewska et al. (2021)
c.4962_4963del, c.6604del, LCA or 1 Testa et al. (2021)
p.(Glu1656Asnfs*3) p.(Ile2202Leufs*24) RD
c.5493delA, c.5587-1G > C, p.(?) LCA 1 Feldhaus et al. (2021)
p.(Ala1832Profs*19)
c.5709 + 2T > G, p.(?) c.384_385del, LCA or 1 Testa et al. (2021)
p.(Asp128Glufs*17) RD
c.5813_5817del, c.6916A > T, p.(Arg2306*) LCA or 1 Testa et al. (2021)
p.(Thr1938Asnfs*15) RD
c.5850delT, c.5587-1G > C, p.(?) LCA 1 Perrault et al. (2007)
p.(Phe1950Leufs*14)
c.6012-2A > G, p.(?) c.6870delT, LCA 1 Einsenberger et al. (2013)
p.(Gln2291Lysfs*10)
c.6604del, c.6836 T > A, p.(Leu2279*) LCA or 1 Testa et al. (2021)
p.(Ile2202Leufs*24) RD
c.6916A > T, p.(Arg2306*) c.1987A > T, p.(Lys663*) LCA or 1 Testa et al. (2021)
RD
c.7341_7344dupACTT, c.1189 + 1G > A, p.(?) LCA or 1 Testa et al. (2021)
p.(Ser2449Thrfs*7) RD
c.289G > T, p.(Glu97*) c.5237G > A, p.(Arg1746Gln) CD 1 Feldhaus et al. (2021)
c.1219_1220del, c.4661_4663del, LCA or 1 Testa et al. (2021)
p.(Met407Glufs*13) p.(Glu1554del) RD
c.1451delA, c.5477T > C, p.(Leu1826Pro) LCA 1 Sallum et al. (2020)
p.(Lys484Argfs*8)
c.1593C > A, p.(Tyr531*) c.2T > A, p.(Met1Lys) LCA 1 Perrault et al. (2007)
c.1666del, c.6401T > C, p.(Ile2134Thr) LCA or 1 Testa et al. (2021)
p.(Ile556Phefs*17) RD
c.1666del, c.1466T > C, p.(Leu489Pro) LCA or 1 Testa et al. (2021)
p.(Ile556Phefs*17) RD
c.1984C > T, p.(Gln662*) c.223A > G, p.(Lys75Glu) RCD 1 Tracewska et al. (2021)
c.2578G > T, p.(Glu860*) c.3758G > A, p.(Arg1253His) LCA 1 Einsenberger et al. (2013)
c.2695C > T, p.(Gln899*) c.5777G > C, p.(Arg1926Pro) LCA 1 Sallum et al. (2020)
c.4723A > T, p.(Lys1575*) c.4696G > C, p.(Ala1566Pro) LCA 2 Perrault et al. (2007),
Coppieters et al. (2010)
c.4962_4963delAA, c.14T > C, p.(Ile5Thr) RD 1 Sallum et al. (2020)
p.(Glu1656Asnfs*3)
c.5493del, c.2723G > A, p.(Arg908Gln) LCA or 1 Testa et al. (2021)
p.(Ala1832Profs*19) RD
c.5850delT, c.4661_4663delAAG, LCA 1 Perrault et al. (2007)
p.(Phe1950Leufs*14) p.(Glu1554del)
c.7394_7395del, c.1664A > T, p.(Lys555Ile) LCA or 1 Testa et al. (2021)
p.(Glu2465Valfs*2) RD
CD cone degeneration, LCA Leber congenital amaurosis, RCD rod-cone degeneration, RD retinal degeneration

(Glu1569_Trp1604del) [11]. Additional
CEP290 truncating alleles leading to non-­
syndromic retinal degeneration have been dis-
covered (Table 1). It is likely that they also lead
to an altered splicing pattern and represent
hypomorphic alleles.
The high frequency of the c.2991 + 1655A > G
variant and its intronic location make it an optimal
target for therapeutic intervention, with gene
editing [12] and antisense oligonucleotide (AON)
[13] protocols undergoing clinical trials
(NCT03140969, NCT04855045, NCT03396042).
Non-syndromic Retinal Degeneration Caused by Pathogenic Variants in Joubert Syndrome Genes
2.2 
OFD1
The Oral-Facial-Digital 1 (OFD1) on X chromo-
some encodes a multitask ciliary protein local-
ized at centrosome and basal body of the primary
cilium. OFD1 regulates primary cilia formation
[14] and is part of the microtubule organizing
center (MTOC), which is essential for cell cycle
progression [15]. In addition, OFD1 was shown
to localize in the nuclei where it may be involved
in chromatin remodeling [16].
OFD1 is crucial for the embryonic develop-
ment. Complete loss-of-function mutations in
OFD1 were initially described to cause the
X-linked dominant oral-facial-digital type 1 syn-
drome (OMIM 311200), which is lethal in males
[17]. However, truncating mutations in the
C-terminal part of the protein are thought to be
hypomorphic, and they cause X-linked recessive
ciliopathies such as Simpson–Golabi–Behmel
syndrome (SGBS) [18], JBTS [19], and primary
ciliary dyskinesia (PCD) [20, 21]. Other hypo-
morphic alleles in OFD1 were associated with a
severe non-syndromic X-linked RCD in two fam-
ilies (Table 2) [22, 23].
In a fifth-generation RCD family, a deep-­
intronic variant c.935 + 706A > G in OFD1
was discovered in affected males [22]. RT-PCR
and direct sequencing of RNA extracted from
patients’ blood revealed insertion of a 62 bp
pseudoexon between exons 9 and 10, resulting
in a frameshift and premature termination
(p.Asn313fs*330). The cryptic exon inclusion
was present in 70% of transcripts, thus acting
as a hypomorphic allele. In the second family,
a hemizygous rare OFD1 missense variant
c.358A > G, p.(Thr120Ala) was detected in
one patient with an early onset severe form of
RCD [23]. However, it is unclear if this variant
is truly pathogenic as it occurs in a weakly
conserved amino acid position, which is not
part of any functional protein domain. The
amino acid change is also predicted to be
benign by multiple algorithms [23]. We cannot
exclude, however, a hypomorphic nature of
this variant that leads to an isolated retinal
phenotype.
177
2.3 
ARL3
ADP-ribosylation factor-like 3 (ARL3) encodes a
small GTPase involved in ciliogenesis and cyto-
kinesis [24]. ARL3 is predominantly localized to
the primary cilium transition zone and other
microtubule structures [25]. ARL3 is a key mol-
ecule in late-stage photoreceptor ciliogenesis. It
is a cargo displacement factor in photoreceptor
cilia [26], where it directs lipidated proteins into
the cilium in a GTP-dependent manner [27].
Transgenic mice expressing a dominant active
form of ARL3-Gln71Leu were shown to have
photoreceptor nuclei migration defects at post-­
natal day 6, revealing a novel role of this protein
[28]. The activity of ARL3 is regulated by a gua-
nine nucleotide exchange factor, ARL13b and a
GTPase activating protein, RP2, associated with
JBTS and RCD respectively [29, 30].
Mutations in the ARL3 gene are known to
cause autosomal recessive JBTS and dominant or
recessive non-syndromic IRD (Table 2) [31–35].
Clinical data suggest that rods and cones may be
differently affected, with maculopathy phenotype
manifesting at earlier stages [33]. To date, only
missense ARL3 variants have been detected in
both JBTS and non-syndromic IRD (https://data-
bases.lovd.nl/shared/genes/ARL3). A heterozy-
gous variant c.269A > G, p.(Tyr90Cys) was
found in two unrelated dominant IRD families
with early-onset decreased central vision and
central retinal thinning [34, 35]. Recently, another
heterozygous variant c.200A > T, p.(Asp67Val)
was identified in a multi-generation Ashkenazi-­
Jewish family with a dominant form of IRD,
characterized by a widespread severe progressive
retinal degeneration with maculopathy [33]. Two
additional studies reported recessive non-­
syndromic IRD caused by a homozygous
c.296G > T, p.(Arg99Ile) [32] and compound
heterozygous c.91A > G, p.(Thr31Ala) and
c.353G > T, p.(Cys118Phe) mutations [31]. Four
additional non-syndromic cases were discovered
in a large mutation screening study (Table 2);
however, their mode of inheritance was not speci-
fied [36]. It is unclear why some variants lead to
a syndromic disease and others to an isolated reti-
Table 2 OFD1, ARL3, AHI1, and INPP5E variants leading to non-syndromic IRD
178

Inheritance-­
Gene Allele_1 (hg19) Allele_2 (hg19) phenotype Proband Reference
OFD1 c.358A > G, p.(Thr120Ala) n.a. XL-CRD 1 Chen et al. (2018)
OFD1 c.935 + 706A > G, p.(Asn313fs*330) n.a. XL-CRD 1 Webb et al. (2012)
ARL3 c.91A > G, p.(Thr31Ala) c.353G > T, p.(Cys118Phe) AR-CRD 1 Fu et al. (2021)
ARL3 c.296G > T, p.(Arg99Ile) c.296G > T, p.(Arg99Ile) AR-CRD 2 Sheikh et al. (2019)
ARL3 c.200A > T, p.(Asp67Val) n.a. AD-RD 1 Ratnapriya et al. (2021)

ARL3 c.269A > G, p.(Tyr90Cys) n.a. AD-RCD 1 Holtan et al. (2019),

Strom et al. (2016)
ARL3 c.155A > C, p.(Asn52Thr) n.a. ?_ RCD 1 Koyanagi et al. (2019)
ARL3 c.308C > T, p.(Thr103Met) n.a. ?_ RCD 2 Koyanagi et al. (2019)
ARL3 c.353G > T, p.(Cys118Phe) n.a. ?_ RCD 3 Koyanagi et al. (2019)
ARL3 c.404C > T, p.(Pro135Leu) n.a. ?_ RCD 6 Koyanagi et al. (2019)
AHI1 c.660del, p.(Ser221Glnfs*10) c.2090C > T, p.(Pro697Leu) AR-RCD 1 Nguyen et al. (2017)
AHI1 c.653A > G, p.(Tyr218Cys) c.3257A > G, p.(Glu1086Gly) AR-RCD 1 Huang et al. (2015)

AHI1 c.1328T > A, p.(Val443Asp) c.3032C > G, p.(Ser1011*) AR-RCD 1 Repo et al. (2021)
AHI1 c.2087A > G, p.(His696Arg) c.2429C > T, p.(Pro810Leu) AR-RCD 1 Nguyen et al. (2017)
AHI1 c.[2174G > A; 2488C > T], p.[Trp725*; Arg830Trp] c.2258A > T, p.(Asp753Val) AR-RCD 1 Nguyen et al. (2017)

INPP5E c.473dup, p.(Asn159*) c.[746C > T; 1787G > C], p.[(Ser249Phe); RCD 1 Sangermano et al. (2021)
(Arg596Thr)]
INPP5E c.[746C > T; 1787G > C], p.[(Ser249Phe); c.[746C > T; 1787G > C], p.[(Ser249Phe); RCD 1 Sangermano et al. (2021)
(Arg596Thr)] (Arg596Thr)]

INPP5E c.844G > A, p.(Gly282Arg) c.1629C > A, p.(Tyr543*) PD 1 Birtel et al. (2018)
INPP5E c.874C > G, p.(Arg292Gly) c.1753C > T, p.(Arg585Cys) RCD 1 Stone et al. (2017)
R. Sangermano et al.
INPP5E c.914C > T, p.(Thr305Ile) c.1456C > T, p.(Arg486Cys) RCD 1 Sangermano et al. (2021)

INPP5E c.1073C > T, p.(Pro358Leu) c.1669C > T, p.(Arg557Cys) RCD 1 Xu et al. (2015)
INPP5E c.1094C > T, p.(Ser365Leu) c.1800C > G, p.(Asp600Glu) LCA 1 Sangermano et al. (2021)

INPP5E c.1393G > A, p.(Val465Ile) c.1393G > A, p.(Val465Ile) RCD 1 Sangermano et al. (2021)

INPP5E c.1402C > T, p.(Arg468Cys) c.1861C > T, p.(Arg621Trp) RCD 1 Sangermano et al. (2021)

INPP5E c.1456C > T, p.(Arg486Cys) c.1577C > T, p.(Pro526Leu) RCD 1 Sangermano et al. (2021)

INPP5E c.1543C > T, p.(Arg515Trp) c.1862G > A, p.(Arg621Gln) CRD 1 Stone et al. (2017)
INPP5E c.1670G > A, p.(Arg557His) c.1754G > A, p.(Arg585His) RCD 1 Sangermano et al. (2021)

INPP5E c.1754G > A, p.(Arg585His) c.1760del, p.(Val587Glyfs*7) RCD# 1 Sangermano et al. (2021)

INPP5E c.1861C > T, p.(Arg621Trp) c.1861C > T, p.(Arg621Trp) LCA 1 Wang et al. (2013)
INPP5E c.1862G > A, p.(Arg621Gln) c.1862G > A, p.(Arg621Gln) LCA/LCA# 3 Sangermano et al. (2021)

AD autosomal dominant, AR autosomal recessive, CRD cone-rod degeneration, LCA Leber congenital amaurosis, n.a. not applicable, PD pattern dystrophy, RCD rod-cone
degeneration, RD retinal degeneration, XL X-linked, # mild syndromic features present, ?_ inheritance not reported
Non-syndromic Retinal Degeneration Caused by Pathogenic Variants in Joubert Syndrome Genes
179
180
nal phenotype. The disease mechanism of the
dominant versus recessive variants is also
unknown, and future functional studies would
need to be undertaken to understand dominant
and recessive nature of the ARL3-associated
disease.
2.4 
AHI1
The Abelson helper integration site 1 (AHI1) was
the first gene associated with JBTS [37, 38]. It
encodes Jouberin, a 1196-amino acid protein
containing a coiled-coil region, seven WD40
repeats, and one Sarcoma homology 3 (SH3)
domain [38]. Its role in cerebellar and cortical
development is unknown, but the domain struc-
ture suggests involvement in intracellular signal-
ing pathways [39].
The majority of reported AHI1 variants in
JBTS cases are loss of function or homozygous
missense changes located within the WD40
repeats (https://databases.lovd.nl/shared/genes/
AHI1). To date, only five non-syndromic RCD
families carrying AHI1 mutations have been
described (Table 2) [40–42]. Affected individuals
from two families were compound heterozygous
for missense variants [40, 41], and the affected
members of the remaining three families carried
at least one truncating allele. Four of six missense
variants leading to non-syndromic RCD are also
located in the WD40 domain; therefore, location
of the mutations does not explain the severity of
the phenotype. AHI1 mutations leading to non-­
syndromic IRD likely preserve some Jouberin
activity, which is sufficient for ciliary function in
all relevant tissues, except for the retinal photore-
ceptor cells.
2.5 
INPP5E
The Inositol polyphosphate-5-phosphatase E
gene (INPP5E) encodes a phosphatase that plays
a critical role in controlling ciliary growth and
stability via the phosphoinositide 3-kinase sig-
naling pathway. Pathogenic INPP5E variants
have been reported in patients with ciliopathies
such as JBTS or MORM (mental retardation,
R. Sangermano et al.
truncal obesity, retinal dystrophy, and micropenis
syndrome, OMIM #610156) (https://databases.
lovd.nl/shared/genes/INPP5E).
To date, 17 families with severe early-onset
IRD (mainly RCD and LCA) carrying INPP5E
variants have been described [43–47]. Five of
them were identified in the past years, follow-
ing large mutational screening studies.
However, since these studies lacked a detailed
phenotypic description of patients, a clear asso-
ciation between INPP5E and non-syndromic
IRD was established recently [47]. Non-
syndromic RCD was caused predominantly by
missense variants (Table 2) [43–47]. A similar
trend was observed in the JBTS cases, and the
combined impact of INPP5E variants in syn-
dromic and non-­syndromic IRD patients does
not reveal a clear genotype–phenotype correla-
tion, suggesting the involvement of genetic
modifiers [47].
3 Conclusions
We described five JBTS genes (CEP290, OFD1,
ARL3, AHI1, and INPP5E) in which specific
alleles lead to isolate retinal phenotypes rather
than severe syndromic conditions. Hypomorphic
alleles due to the activation of cryptic splice
sites and the position of the mutations in
CEP290 and OFD1 are one of the explanations
for the broad phenotypic spectrum associated
with these genes. Hypomorphic variants in
AHI1, INPP5E, and recessive ARL3 disease are
also the most likely explanation; however, this
has yet to be proven. Similar tissue-dependent
activity–effect model was also suggested for
other syndromic and non-­syndromic retinal dis-
ease genes, CLN3, HGSNAT, and MFSD8 [48–
50]. Alternative splicing in the retina as proposed
for a ciliopathy gene TTC8 or epistatic effects of
other alleles as proposed for the CEP290-
associated disease can also be the reason for the
broad range of disease expressions [51, 52].
Understanding the functional consequences of
variants on gene function is at the forefront of
current functional genetics studies and will
bring explanation of the pleiotropic effects of
many genes.
Non-syndromic Retinal Degeneration Caused by Pathogenic Variants in Joubert Syndrome Genes 181

References 17. Ferrante MI, Giorgio G, Feather SA, et al.

Identification of the gene for oral-facial-digital type 1
syndrome. Am J Hum Genet. 2001;68:569–76.
1. Retinal Information Network (RetNet) [Internet].
18. Budny B, Chen W, Omran H, et al. A novel X-linked
[cited 2020 Apr 1]. Available from: https://sph.uth.
recessive mental retardation syndrome compris-
edu/retnet/home.htm
ing macrocephaly and ciliary dysfunction is allelic
2. Hildebrandt F, Benzing T, Katsanis N. Ciliopathies. N
to oral–facial–digital type I syndrome. Hum Genet.
Engl J Med. 2011;364:1533–43.
2006;120:171–8.
3. Bujakowska KM, Liu Q, Pierce EA. Photoreceptor
19. Coene KL, Roepman R, Doherty D, et al. OFD1 is
cilia and retinal ciliopathies. Cold Spring Harb
mutated in X-linked Joubert syndrome and interacts
Perspect Biol. 2017;9:a028274.
with LCA5-encoded lebercilin. Am J Hum Genet.
4. Sayer JA, Otto EA, O’Toole JF, et al. The centrosomal
2009;85:465–81.
protein nephrocystin-6 is mutated in Joubert syn-
20. Knowles MR, Daniels LA, Davis SD, et al. Primary
drome and activates transcription factor ATF4. Nat
ciliary dyskinesia. Recent advances in diagnostics,
Genet. 2006;38:674–81.
genetics, and characterization of clinical disease. Am
5. Stowe TR, Wilkinson CJ, Iqbal A, et al. The centrio-
J Respir Crit Care Med. 2013;188:913–22.
lar satellite proteins Cep72 and Cep290 interact and
21. Hannah WB, DeBrosse S, Kinghorn BA, et al. The
are required for recruitment of BBS proteins to the
expanding phenotype of OFD1-related disorders:
cilium. Mol Biol Cell. 2012;23:3322–35.
Hemizygous loss-of-function variants in three patients
6. Wu Z, Pang N, Zhang Y, et al. CEP290 is essential
with primary ciliary dyskinesia. Mol Genet Genomic
for the initiation of ciliary transition zone assembly.
Med. 2019;7:1–10.
PLoS Biol. 2020;18:e3001034.
22. Webb TR, Parfitt DA, Gardner JC, et al. Deep intronic
7. Den Hollander AI, Koenekoop RK, Yzer S, et al.
mutation in OFD1, identified by targeted genomic
Mutations in the CEP290 (NPHP6) gene are a fre-
next-generation sequencing, causes a severe form
quent cause of leber congenital amaurosis. Am J Hum
of X-linked retinitis pigmentosa (RP23). Hum Mol
Genet. 2006;79:556–61.
Genet. 2012;21:3647–54.
8. Feldhaus B, Weisschuh N, Nasser F, et al. CEP290
23. Chen X, Sheng X, Liu Y, et al. Distinct mutations with
mutation spectrum and delineation of the associated
different inheritance mode caused similar retinal dys-
phenotype in a large German cohort: a monocentric
trophies in one family: a demonstration of the impor-
study. Am J Ophthalmol. 2020;211:142–50.
tance of genetic annotations in complicated pedigrees.
9. Fokkema IFAC, Taschner PEM, Schaafsma GCP,
J Transl Med. 2018;16:1–12.
et al. LOVD v.2.0: the next generation in gene variant
24. Zhou C, Cunningham L, Marcus AI, et al. Arl2 and
databases. Hum Mutat. 2011;32:557–63.
Arl3 regulate different microtubule-dependent pro-
10. McAnany JJ, Genead MA, Walia S, et al. Visual acu-
cesses. Mol Biol Cell. 2006;17:2476–87.
ity changes in patients with Leber congenital amau-
25. Grayson C, Bartolini F, Chapple JP, et al. Localization
rosis and mutations in CEP290. JAMA Ophthalmol.
in the human retina of the X-linked retinitis pig-
2013;131:178–82.
mentosa protein RP2, its homologue cofactor C and
11. Littink KW, Pott JWR, Collin RWJ, et al. A novel
the RP2 interacting protein Arl3. Hum Mol Genet.
nonsense mutation in CEP290 induces exon skip-
2002;11:3065–74.
ping and leads to a relatively mild retinal phenotype.
26. Hanke-Gogokhia C, Zhang H, Frederick JM, et al. The
Investig Ophthalmol Vis Sci. 2010;51:3646–52.
function of Arf-like proteins ARL2 and ARL3 in pho-
12. Maeder ML, Stefanidakis M, Wilson CJ, et al.
toreceptors. Adv Exp Med Biol. 2016;854:655–61.
Development of a gene-editing approach to restore
27. Cavenagh MM, Breiner M, Schurmann A, et al.
vision loss in Leber congenital amaurosis type 10. Nat
ADP-ribosylation factor (ARF)-like 3, a new mem-
Med. 2019;25:229–33.
ber of the ARF family of GTP-binding proteins
13. Cideciyan AV, Jacobson SG, Drack AV, et al. Effect
cloned from human and rat tissues. J Biol Chem.
of an intravitreal antisense oligonucleotide on vision
1994;269:18937–42.
in Leber congenital amaurosis due to a photoreceptor
28. Wright ZC, Singh RK, Alpino R, et al. ARL3 regu-
cilium defect. Nat Med. 2019;25:225–8.
lates trafficking of prenylated phototransduction
14. Wang J, Chen X, Wang F, et al. OFD1, as a ciliary pro-
proteins to the rod outer segment. Hum Mol Genet.
tein, exhibits neuroprotective function in photorecep-
2016;25:2031–44.
tor degeneration models. PLoS One. 2016;11:1–18.
29. Cantagrel V, Silhavy JL, Bielas SL, et al. Mutations
15. Alfieri M, Iaconis D, Tammaro R, et al. The centro-
in the cilia gene ARL13B lead to the classical form of
somal/basal body protein OFD1 is required for micro-
Joubert syndrome. Am J Hum Genet. 2008;83:170–9.
tubule organization and cell cycle progression. Tissue
30. Veltel S, Gasper R, Eisenacher E, et al. The reti-
Cell. 2020;64:101369.
nitis pigmentosa 2 gene product is a GTPase-­
16. Giorgio G, Alfieri M, Prattichizzo C, et al. Functional
activating protein for Arf-like 3. Nat Struct Mol Biol.
characterization of the OFD1 protein reveals a nuclear
2008;15:373–80.
localization and physical interaction with subunits
31. Fu L, Li Y, Yao S, et al. Autosomal recessive rod-­
of a chromatin remodeling complex. Mol Biol Cell.
cone dystrophy associated with compound hetero-
2007;18:4397–404.
182
zygous variants in ARL3 gene. Front Cell Dev Biol.
2021;9:1–12.
32. Sheikh SA, Sisk RA, Schiavon CR, et al. Homozygous
variant in ARL3 causes autosomal recessive
cone rod dystrophy. Investig Ophthalmol Vis Sci.
2019;60:4811–9.
33. Ratnapriya R, Jacobson SG, Cideciyan AV, et al. A
novel ARL3 gene mutation associated with autosomal
dominant retinal degeneration. Front Cell Dev Biol.
2021;9:1–12.
34. Holtan JP, Teigen K, Aukrust I, et al. Dominant
ARL3-related retinitis pigmentosa. Ophthalmic
Genet. 2019;40:124–8.
35. Strom SP, Clark MJ, Martinez A, et al. De novo occur-
rence of a variant in ARL3 and apparent autosomal
dominant transmission of retinitis pigmentosa. PLoS
One. 2016;11:1–9.
36. Koyanagi Y, Akiyama M, Nishiguchi KM, et al.
Genetic characteristics of retinitis pigmentosa in 1204
Japanese patients. J Med Genet. 2019;56:662–70.
37. Ferland RJ, Eyaid W, Collura RV, et al. Abnormal
cerebellar development and axonal decussation due to
mutations in AHI1 in Joubert syndrome. Nat Genet.
2004;36:1008–13.
38. Dixon-Salazar T, Silhavy JL, Marsh SE, et al.
Mutations in the AHI1 gene, encoding Jouberin, cause
Jeubert syndrome with cortical polymicrogyria. Am J
Hum Genet. 2004;75:979–87.
39. Muñoz-Estrada J, Ferland RJ. Ahi1 promotes Arl13b
ciliary recruitment, regulates Arl13b stability and
is required for normal cell migration. J Cell Sci.
2019;132:jcs230680.
40. Huang XF, Huang F, Wu KC, et al. Genotype-­
phenotype correlation and mutation spectrum in a
large cohort of patients with inherited retinal dystro-
phy revealed by next-generation sequencing. Genet
Med. 2015;17:271–8.
41. Nguyen TMT, Hull S, Roepman R, et al. Missense
mutations in the WD40 domain of AHI1 cause
non-syndromic retinitis pigmentosa. J Med Genet.
2017;54:624–32.
42. Repo P, Järvinen RS, Sankila EM, et al. Identifying
haplotypes in recessive inherited retinal dystrophies
using whole-genome linked-read sequencing. Clin
Genet. 2021;99:193–8.
R. Sangermano et al.
43. Wang X, Wang H, Sun V, et al. Comprehensive
molecular diagnosis of 179 Leber congenital amau-
rosis and juvenile retinitis pigmentosa patients by
targeted next generation sequencing. J Med Genet.
2013;50:674–88.
44. Xu Y, Guan L, Xiao X, et al. Mutation analysis
in 129 genes associated with other forms of reti-
nal dystrophy in 157 families with retinitis pig-
mentosa based on exome sequencing. Mol Vis.
2015;21:477–86.
45. Stone EM, Andorf JL, Whitmore SS, et al. Clinically
focused molecular investigation of 1000 con-
secutive families with inherited retinal disease.
Ophthalmology. 2017;124:1314–31.
46. Birtel J, Eisenberger T, Gliem M, et al. Clinical and
genetic characteristics of 251 consecutive patients
with macular and cone/cone-rod dystrophy. Sci Rep.
2018;8:4824.
47. Sangermano R, Deitch I, Peter VG, et al. Broadening
INPP5E phenotypic spectrum: detection of rare
variants in syndromic and non-syndromic IRD. npj
Genomic Med. 2021;6:53.
48. Kitzmüller C, Haines RL, Codlin S, et al. A func-
tion retained by the common mutant CLN3 pro-
tein is responsible for the late onset of juvenile
neuronal ceroid lipofuscinosis. Hum Mol Genet.
2008;17:303–12.
49. Haer-Wigman L, Newman H, Leibu R, et al. Non-­
syndromic retinitis pigmentosa due to mutations in
the mucopolysaccharidosis type IIIC gene, heparan-­
alpha-­glucosaminide N-acetyltransferase (HGSNAT).
Hum Mol Genet. 2015;24:3742–51.
50. Roosing S, Van Den Born LI, Sangermano R, et al.
Mutations in MFSD8, encoding a lysosomal mem-
brane protein, are associated with nonsyndromic auto-
somal recessive macular dystrophy. Ophthalmology.
2015;122:170–9.
51. Riazuddin SA, Iqbal M, Wang Y, et al. A splice-site
mutation in a retina-specific exon of BBS8 causes
nonsyndromic retinitis pigmentosa. Am J Hum Genet.
2010;86:805–12.
52. Baala L, Audollent S, Martinovic J, et al.
Pleiotropic effects of CEP290 (NPHP6) mutations
extend to Meckel syndrome. Am J Hum Genet.
2007;81:170–9.
 Exonic Variants that Affect
Splicing – An Opportunity
for “Hidden” Mutations Causing
Inherited Retinal Diseases

Yogapriya Sundaresan, Eyal Banin,

and Dror Sharon

Abstract Keywords

Inherited retinal diseases (IRDs) are an Inherited retinal diseases · mRNA splicing ·
extremely diverse group of ocular disorders Exonic variants · Splice sites · Exonic
characterized by progressive loss of photore- splicing enhancers
ceptors leading to blindness. So far, patho-
genic variants in over 300 genes are reported
to structurally and functionally affect the ret- 1 Introduction
ina resulting in visual impairment. Around
15% of all IRD mutations are known to affect Pre-mRNA splicing is a molecular process which
an essential regulatory mechanism, pre-­ plays a significant role in regulating gene expres-
mRNA splicing, which contributes to the tran- sion as well as generating functional complexity.
scriptomic diversity. These variants disrupt This fundamental process excises the intervening
potential donor and acceptor splice sites as non-coding intronic sequences and links the cod-
well as other crucial cis-acting elements ing exons, thereby producing a mature mRNA
resulting in aberrant splicing. One group of molecule. Pre-mRNA splicing is regulated by a
these elements, the exonic splicing enhancers class of five small nuclear ribonucleoproteins
(ESEs), are involved in promoting exon defi- (snRNPs), namely U1, U2, U4, U5, and U6 and
nition and are likely to harbor “hidden” muta- around 150 other proteins, which together make
tions since sequence-analyzing pipelines up the macromolecular complex, spliceosome
cannot identify them efficiently. The main [1]. The functioning of the spliceosomal complex
focus of this review is to discuss the molecular depends on a set of cis elements present in the
mechanisms behind various exonic variants pre-mRNA sequence and additional trans factors
affecting splice sites and ESEs that lead to that bind to these elements. The primary splicing
impaired splicing which in turn result in an signal of most of the introns is a short sequence
IRD pathology. (cis element) positioned at the intron-exon junc-
tion that includes the 5′ and 3′ splice site as well
as the branch point [2]. Accurate splicing is
Y. Sundaresan · E. Banin · D. Sharon (*) achieved by gradual assembly of the snRNPs on
Department of Ophthalmology, Hadassah Medical the regulatory cis elements, which in turn results
Center, Faculty of Medicine, The Hebrew University
of Jerusalem, Jerusalem, Israel in removal of introns and two subsequent trans-
e-mail: dror.sharon1@mail.huji.ac.il esterification reactions combining the exonic

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 183
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_27
184
sequences. Further, the components of the
­spliceosomal complex are recycled for the fol-
lowing rounds of splicing [3].
In addition to the abovementioned pre-mRNA
embedded signals, other cis regulatory elements
present in exons and introns are also crucial in
exon recognition as well as in achieving precise
splicing. This includes the exonic splicing
enhancers (ESEs), exonic splicing silencers
(ESSs), intronic splicing enhancers, and intronic
splicing silencers [4]. The molecular interaction
between the elements and the components of the
splicing machinery enables to recognize an exon
prior to the excision of intronic sequences. One
of these elements, ESEs, plays a significant role
in promoting exon definition by facilitating the
recruitment of splicing factors to the upstream
introns. In addition, ESEs serve to be a binding
site for the members of Serine/Arginine (SR)-
rich protein family that is also involved in draw-
ing the factors of the spliceosomal complex,
thereby indicating an assisting role in exon defi-
nition [5, 6].
Inherited retinal diseases (IRDs) are geneti-
cally and clinically heterogeneous ocular pheno-
types in which mutations in genes associated
with retinal development, structure, and function
result in progressive loss of photoreceptors even-
tually compromising vision. Around 13–15% of
the total IRD-causing mutations affect the splic-
ing mechanism by disrupting the GU-AG dinu-
cleotides at the splice donor and acceptor site [7,
8]. The significance of donor and acceptor splice
sites for precise splicing is evident by the fact that
15% of the point mutations are located in these
regions resulting in one or a combination of
splice anomalies such as weakening or deleting a
regular splice site, creation of a novel splice sites
affecting exon recognition, and intron retention.
Donor splice mutations are more frequently
reported compared to mutations in acceptor site
[7–9].
In addition, disruption of potential ESE
sequences by mutations might lead to abnormal
splicing by eliminating the exon from the mature
mRNA transcript, which may result in a patho-
logical condition. Various mutations have been
previously reported in the ESE sequences that
Y. Sundaresan et al.
resulted in human genetic diseases such as fron-
totemporal dementia with parkinsonism, spinal
muscular atrophy, and Becker muscular dystro-
phy [10]. However, only a very few reports are
available on ESEs disrupting mutations in IRD
genes, leaving the role of ESE-affecting muta-
tions in IRDs poorly understood. We propose that
either a nonsense-associated premature termina-
tion codon (PTC) or other types of mutations
including silent or missense variants could pos-
sibly affect an ESE or ESS sequence, and their
consequent effect on splicing might also contrib-
ute to IRDs. Hence, besides mutations affecting
splice sites, we hypothesize that ESE-affecting
variants can cause IRDs, but are likely to be “hid-
den” variants that are not yet recognized
through variant analyses.
Hence, the primary focus of this chapter is to
briefly discuss the molecular mechanisms of var-
ious exonic variants affecting donor and acceptor
splice sites as well as ESE sequences, which in
turn contribute to a retinal phenotype.
2 Exonic Mutations Affecting
the Donor and Acceptor
Splice Sites
Genetic alterations found in the boundaries of an
exon (first or last nucleotide of exon and penulti-
mate nucleotides, Fig. 1) are called exonic splice
site variants. These variants can weaken or abol-
ish a splice site, thereby reducing the ability of
the spliceosomal complex from recognizing these
sites resulting in impaired splicing. As a conse-
quence, pronounced skipping of the correspond-
ing exon is evident [11]. Various exonic splice
site variants are reported in IRD genes, and a few
are explained in this section of the review.
Rhodopsin (RHO) is the major autosomal
dominant gene causing retinitis pigmentosa (RP),
a condition that is characterized by progressive
loss of rod photoceptors followed by the cones
leading to severe visual impairment [12]. The
gene encodes a G-protein-coupled receptor that
is abundantly present in rod photoreceptors and is
significantly essential as the primary photorecep-
tor molecule of vision [13]. So far, more than 100
Exonic Variants that Affect Splicing – An Opportunity for “Hidden” Mutations Causing Inherited Retinal…
RHO mutations have been reported as the cause
of RP. A hidden disease-causing mutation in this
gene is c.936G>A that does not affect the imme-
diate amino acid sequence of rhodopsin and can
therefore be considered as a silent change.
However, its location as the last nucleotide of
exon 4 raised the possibility that it might act as a
donor site variant [9]. Indeed, c.936G>A was
shown to generate two misspliced transcripts in
COS7 cells, indicating an interference in exon
definition. About 95% of variants located in the
last nucleotide of an exon are predicted to result
in missplicing, as the U1 snRNA fails to bind to
the modified exonic splice site. Such pathogenic
variants leading to altered exonic splice sites can
be corrected by a potential therapeutic approach
using mutation-adapted U1 snRNA. The above-­
mentioned mutation c.936G>A has been rescued
by mutation-adapted U1 snRNA in 90% of
abnormal transcripts in COS7 cells and retinal
explant cultures [9].
Another example is an apparently silent
CDHR1-c.783G>A variant affecting the last
nucleotide of exon 8. The cadherin-related family
member 1 (CDHR1) gene encodes a
photoreceptor-­specific protein that is responsible
for the morphogenesis and arrangement of photo-
receptor outer segment discs. Mutations in this
gene are often associated with cone-rod dystro-
phy and central areolar choroidal dystrophy.
Fig. 1 Putative ESE sequences of BEST1 exon 6 pre-
dicted by ESE finder 3.0. The illustration represents the
prediction of specific ESE sequences recognized by each
SR protein in exon 6 of the BEST 1 gene. The tool pro-
vides a threshold of 1.956, 2.38, 2.67, and 2.676 for
SRSF1, SRSF2, SRSF5, and SRSF6, respectively, based
on the inbuilt algorithm. The program identified 4, 2, 4,
185
Computational analysis using the tool NetGene2
predicted the loss of donor splice site in the
sequence carrying the variant. Subsequent mRNA
analysis from whole blood of patients carrying
the mutation identified that this variant caused
skipping of exon 8 where the resulting protein
lacks 48 amino acid residues and thus significant
parts of cadherin ectodomains 2 and 3 [14].
3 Exonic Variants Affecting
Exonic Splicing Enhancer
Sequences
ESEs are discrete sequences of 6–8 bps located
within most of the exons that promote constitu-
tive and regulated splicing (see example in
Fig. 1). These purine-rich sequences also serve as
binding motifs for various SR proteins and com-
binedly function to excise the adjacent intron.
Modification in the ESE sequences due to muta-
tions might greatly affect the binding factors
leading to missplicing events such as exon skip-
ping [15]. Identification of variants affecting the
ESE sequences is highly demanding as even a
silent variant could potentially disrupt an ESE
though the amino acid sequence remains
unchanged. Online prediction tools including
ESE finder 3.0 are being used to identify putative
ESE sequences [16]. However, such tools might
and 5 ESE sequences that had a score above the threshold
and are depicted by different colors based on the corre-
sponding SR protein. The image also presents two ESE
affecting variants, c.704T>C and c.707A>G identified in
exon 6 where c.704T>C weakened and c.707A>G abol-
ished an ESE sequence causing skipping of exon 6
186
have a high level of false-positive results, and
therefore, each suspected ESE sequence needs to
be verified by RT-PCR analysis of mRNA
transcripts.
An excellent example of an IRD disease that is
caused by ESE mutations as the major mecha-
nism is autosomal dominant vitreoretinocho-
roidopathy (ADVIRC) due to BEST1 mutations
(Fig. 1). BEST1 encodes Bestrophin-1, a trans-
membrane protein of basolateral membrane of
the retinal pigment epithelium. Mutations in this
gene mainly cause AD Best disease (which is
rarely inherited as an AR disease) and can also
cause RP and ADVIRC. All ADVIRC-associated
mutations (c.256G>A, p.V86M; c.704T>C,
p.V235A; c.707A>G, p.Y236C; and c.715G>A,
p.V239M) were reported to cause skipping of the
corresponding exons and therefore hypothesized
to affect ESE sequences [17, 18]. ESE-dependent
splice assays and gel-shift assays on two of the
mutations (c.704T>C, p.V235A; c.707A>G,
p.Y236C) located in exon 6 (Fig. 1) revealed that
c.704T>C weakened and c.707A>G abolished an
ESE sequence causing skipping of exon 6. This
study also suggests that the mutation might have
possibly introduced a composite exonic regula-
tory element site affecting precise splicing event
[18].
In addition, two unrelated patients with muta-
tions in CEP290 were presented with unusually
relatively mild retinal phenotype [19]. One of the
patients (P2) was found to harbor two heterozy-
gous nonsense mutations in trans: c.508A>T
(p.K170*) in exon 8 and c.4090G>T (p.E1364*)
in exon 32. Prediction software analysis of these
two mutations did not show any effect on splice-­
site scores but showed an increase in ESE/ESS
ratio suggesting that these mutations might dis-
rupt an ESE sequence leading to the skipping of
exons 8 and 32 compared to controls. Furthermore,
the c.4090G>T allele is expected to generate a
strong donor splice-site 60 bp downstream of the
start of exon 32. mRNA analysis by RT- PCR and
Sanger sequencing of patient skin-fibroblasts
confirmed the in silico prediction where RT-PCR
primers specific for exon 8 generated the follow-
ing three transcripts: (i) the canonical transcript
Y. Sundaresan et al.
(c.508T), (ii) the mutant (c.508A), and (iii) the
transcript skipping exon 8. Whereas the RT-PCR
primers specific for exon 32 produced the follow-
ing four transcripts: (i) the canonical transcript
(c.4090G), (ii) the mutant (c.4090T), (iii) the
transcript skipping exon 32, and (iv) the tran-
script lacking last 106 nucleotides of exon 32
[19]. Although both mutations are nonsense and
would be easily picked up by NGS pipelines,
these results have broader implications, since
only a lower percentage of transcripts include the
mutation (due to exon skipping), and therefore,
therapies targeting the mRNA (such as transla-
tion read-through inducing drugs and RNA edit-
ing) might show limited success.
Recessive pathogenic variants in USH2A,
which encodes the Usherin protein, can cause
either Usher syndrome and non-syndromic RP.
One of the most frequent mutations in USH2A is
the single base pair deletion in exon 13
(c.2299delG). RT-PCR analysis of nasal epithe-
lial cells revealed the presence of two different
transcripts in patients carrying the deletion com-
pared to healthy individuals [20]. Exon 13 skip-
ping was evident in one group of subjects and
skipping of exon 13 as well as 12 was identified
in the second group of subjects. Bioinformatic
tool predicted that the deletion in exon 13 has
disrupted a potential ESE sequence leading to
missplicing. In addition, the study also claims
that the deletion has not only affected an ESE but
also created an ESS sequence that resulted in
skipping.
4 Conclusion
The human retina displays extraordinary tran-
script diversity, which requires highly regulated
splicing activity that is achieved by specific splic-
ing factors. Over 50% of human genes produce
more than one transcript, and therefore, a rela-
tively high percentage of variants might alter
splicing. As described in this review, exonic vari-
ants affecting splice sites and ESE sequences are
sometimes hidden and present a challenge to be
identified. RNA-based analysis including next-­
Exonic Variants that Affect Splicing – An Opportunity for “Hidden” Mutations Causing Inherited Retinal…
generation sequencing might be a suitable exper-
imental method to determine these variants.
Additionally, the identification of novel variants
and understanding their role in retinal disease
pathogenesis demand retina-specific microenvi-
ronment. The use of retinal organoids differenti-
ated from patient-derived iPSCs is a convenient
disease-on-a-dish model for such functional anal-
ysis as they provide more insights. Furthermore,
novel mutation-specific therapies such as anti-
sense oligonucleotides, small interfering RNA,
and mutation-adapted U1 snRNA techniques can
be used as a promising therapeutic option to treat
missplicing-associated retinal diseases.
Acknowledgments This work was supported by the
Israel Science Foundation (grant No. 1778/20).
Declaration of Competing Interest The
authors declare that they have no competing
interests.
References
1. Wahl MC, Will CL, Lührmann R. The spliceosome:
design principles of a dynamic RNP machine. Cell.
2009;136(4):701–18.
2. Wang Z, Burge CB. Splicing regulation: from a parts
list of regulatory elements to an integrated splicing
code. RNA. 2008;14(5):802–13.
3. Gehring NH, Roignant JY. Anything but ordinary –
emerging splicing mechanisms in eukaryotic gene
regulation. Trends Genet. 2021;37(4):355–72.
4. Bacchi N, Casarosa S, Denti MA. Splicing-correcting
therapeutic approaches for retinal dystrophies: where
endogenous gene regulation and specificity matter.
Investig Ophthalmol Vis Sci. 2014;55(5):3285–94.
5. Lam BJ, Hertel KJ. A general role for splicing enhanc-
ers in exon definition. RNA. 2002;8(10):1233–41.
6. Cáceres EF, Hurst LD. The evolution, impact and
properties of exonic splice enhancers. Genome Biol.
2013;14(12):R143.
7. Liu MM, Zack DJ. Alternative splicing and retinal
degeneration. Clin Genet. 2013;84(2):142–9.
8. Schneider N, Sundaresan Y, Gopalakrishnan P,
Beryozkin A, Hanany M, Levanon EY, Banin E,
Ben-Aroya, Sharon D. Inherited Retinal Diseases:
linking genes, disease- causing variants, and relevant
187
therapeutic modalities. Prog Retin Eye Res. 2022;
89:101029.
9. Tanner G, Glaus E, Barthelmes D, Ader M,
Fleischhauer J, Pagani F, Berger W, Neidhardt
J. Therapeutic strategy to rescue mutation-induced
exon skipping in rhodopsin by adaptation of U1
snRNA. Hum Mutat. 2009;30(2):255–63.
10. Blencowe BJ. Exonic splicing enhancers: mechanism
of action, diversity and role in human genetic dis-
eases. Trends Biochem Sci. 2000;25(3):106–10.
11. Anna A, Monika G. Splicing mutations in human
genetic disorders: examples, detection, and confirma-
tion. J Appl Genet. 2018;59(3):253–68.
12. Berson EL. Retinitis pigmentosa. The Friedenwald lec-
ture. Invest Ophthalmol Vis Sci. 1993;34(5):1659–76.
13. Lenahan C, Sanghavi R, Huang L, Zhang
JH. Rhodopsin: a potential biomarker for neurodegen-
erative diseases. Front Neurosci. 2020;14:326.
14. Charbel Issa P, Gliem M, Yusuf IH, Birtel J, Müller PL,
Mangold E, Downes SM, MacLaren RE, Betz C, Bolz
HJ. A specific macula-predominant retinal phenotype
is associated with the CDHR1 variant c.783G>A, a
silent mutation leading to in-frame exon skipping.
Invest Ophthalmol Vis Sci. 2019;60(10):3388–97.
15. Taniguchi I, Masuyama K, Ohno M. Role of purine-­
rich exonic splicing enhancers in nuclear reten-
tion of pre-mRNAs. Proc Natl Acad Sci U S A.
2007;104(34):13684–9.
16. Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer
AR. ESEfinder: a web resource to identify
exonic splicing enhancers. Nucleic Acids Res.
2003;31(13):3568–71.
17. Yardley J, Leroy BP, Hart-Holden N, Lafaut BA,
Loeys B, Messiaen LM, Perveen R, Reddy MA,
Bhattacharya SS, Traboulsi E, Baralle D, De Laey JJ,
Puech B, Kestelyn P, Moore AT, Manson FD, Black
GC. Mutations of VMD2 splicing regulators cause
nanophthalmos and autosomal dominant vitreoreti-
nochoroidopathy (ADVIRC). Invest Ophthalmol Vis
Sci. 2004;45(10):3683–9.
18. Burgess R, MacLaren RE, Davidson AE, Urquhart JE,
Holder GE, Robson AG, Moore AT, O’Keefe R, Black
GCM, Manson FDC. ADVIRC is caused by distinct
mutations in BEST1 that alter pre-mRNA splicing. J
Med Genet. 2009;46(9):620–5.
19. Barny I, Perrault I, Michel C, Soussan M, Goudin N,
Rio M, Thomas S, Atti-Bitach T, Hamel C, Dollfus
H, Kaplan J, Rozet JM, Gerard X. Basal exon skip-
ping and nonsense-associated altered splicing allows
bypassing complete CEP290 loss-of-function in indi-
viduals with unusually mild retinal disease. Hum Mol
Genet. 2018;27(15):2689–702.
20. Lenassi E, Saihan Z, Bitner-Glindzicz M, Webster
AR. The effect of the common c.2299delG muta-
tion in USH2A on RNA splicing. Exp Eye Res.
2014;122:9–12.
 Enhanced S-cone Syndrome,
a Mini-review

Yiyi Wang, Jessica Wong, Jacque L. Duncan,

Austin Roorda, and William S. Tuten

Abstract and also shed light on the role of NR2E3

Enhanced S-cone Syndrome (ESCS) is an
autosomal recessive inherited retinal disease
mostly associated with disease-causing vari-
ants in the NR2E3 gene. During retinal devel-
opment in ESCS, rod photoreceptor precursors
are misdirected to form photoreceptors similar
to short-wavelength cones, or S-cones.
Compared to a normal human retina, patients
with ESCS have no rods and significantly
increased numbers of S-cones. Night blind-
ness is the main visual symptom, and visual
acuity and color vision can be normal at early
disease stages. Histology of donor eyes and
adaptive optics imaging revealed increased
S-cone density outside of the fovea compared
to normal. Visual function testing reveals
absent rod function and abnormally enhanced
sensitivity to short-wavelength light. Unlike
most retinal degenerative diseases, ESCS
results in a gain in S-cone photoreceptor func-
tion. Research involving ESCS could improve
understanding of this rare retinal condition
Y. Wang (*) · A. Roorda · W. S. Tuten
Herbert Wertheim School of Optometry and Vision
Science, University of California, Berkeley, CA, USA
e-mail: yiyiwang@berkeley.edu
J. Wong · J. L. Duncan
Department of Ophthalmology, University of
California, San Francisco, CA, USA
expression in photoreceptor survival.
Keywords
Enhanced S-cone Syndrome (ESCS) ·
Inherited retinal degeneration · Visual
function · Retina · Photoreceptors · NR2E3 ·
S-cones
1 Introduction
Enhanced S-cone Syndrome (ESCS) is a rare
inherited autosomal recessive retinal degenera-
tion, associated with disease-causing variants in
the nuclear receptor subfamily 2, group E, mem-
ber 3 (NR2E3) gene, first described in 1989 with
characteristic electroretinogram (ERG) findings
[20, 25, 27]. Patients with ESCS have night
blindness as the main visual symptom and can be
misdiagnosed as atypical retinitis pigmentosa or
congenital stationary night blindness [48].
Clinical appearance can be variable as the early
stage of the disease shows normal visual acuity,
visual field, color vision, and fundus appearance
in some patients. More severe clinical findings
are reduced visual acuity, impaired color vision,
cystoid maculopathy, macular hole, pigmentary
degeneration along the arcades, and advanced
macular atrophy [15]. ESCS is a retinal degener-
ative disease with progressive slow and irrevers-

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 189
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_28
190
ible vision loss, especially when foveomacular
schisis is present that later develops into retinal
atrophy [15]. Prior to the onset of severe retinal
degeneration and visual impairment, ESCS
patients exhibit enhanced sensitivity to short-­
wavelength light, revealed by ERG and perimetry
[35]. Additionally, some mutations in human
NR2E3 cause not only ESCS but also other phe-
notypes of inherited retinal degeneration includ-
ing Goldmann–Favre syndrome (GFS), Clumped
Pigmentary Retinal Degeneration (CPRD), and
up to 1% of all autosomal dominant retinitis pig-
mentosa (adRP) [16, 39].
2 
NR2E3 Gene Affects
Photoreceptor
Differentiation
The retina in a normal human eye has about 120
million rod photoreceptors. They are absent at the
fovea and have the highest density at about 10–20
degrees eccentricity [10]. Rods are very sensitive
to dim light and are responsible for night vision.
Normal human eyes have around six million cone
photoreceptors, which are used for fine spatial
resolution and color vision under photopic condi-
tions. There are three types of cone photorecep-
tor, sensitive to long, medium, and short
wavelengths of light, and are called L-, M-, and
S-cones, respectively. S-cones comprise 5–10%
of all the cones and a mere ~0.02% of all photo-
receptors in normal eyes [36].
In ESCS retinal development, photoreceptor
precursors that would normally develop into
rods are misdirected to form S-cone-like photo-
receptors, most commonly due to disease-caus-
ing variants in a gene called NR2E3 [30]. The
NR2E3 gene product guides photoreceptor dif-
ferentiation and retinal progenitor competency
[18]. A recent study found that NR2E3-
administered therapy can improve photorecep-
tor structure and function in multiple mouse
models of retinitis pigmentosa [23]. Conversely,
another group has pointed out that knockout of
nr2e3 in adult mice could de-repress cone genes
in inherited retinal degeneration to improve
photoreceptor survival [31].
Y. Wang et al.
NR2E3 encodes a transcription factor that
directs retinal photoreceptor precursors toward a
rod fate [19]. Together with CRX, NR2E3 pro-
motes rod differentiation and suppresses the pro-
duction of cone photoreceptors, as shown in the
rd7 mutant mouse, a model for human ESCS [7,
9]. Since S-cones are produced earlier than the
other two cone subtypes, they are considered as
the default primordial cone cells [43]. S-opsins
are expressed first before a portion of precursor
cells changes to M-cones in rodent retinas [44].
Additionally, human fetal retina is shown to have
about 90% S-cones in early development, and
this ratio changes significantly later in photore-
ceptor development, suggesting an identity
switch from the S-opsin to L- or M-opsin expres-
sion by the precursor cells [43]. Disease-causing
variants in NR2E3 disrupt photoreceptor fate
determination and further impact the cell ratio
and topographic distributions of rods and cone
subtypes in the retina [47].
Nr2e3 gene variation can affect animal mod-
els differently. The mutant retina of the rd7
mouse has shown slow and progressive retinal
degeneration and abnormal lamination with
rosette formation, but has normal ERG responses,
unlike those seen in human ESCS [9].
Additionally, the rd7 retina shows that most cells
express both rod-specific and cone-specific
genes, suggesting that not only is there an
increase of the S-opsin-expressing cones, but a
hybrid photoreceptor cell type is also formed
from rod precursors that express rod- and cone-­
specific genes [9].
3 Retinal Structure of ESCS
Retinal structure information in ESCS has pri-
marily been restricted to postmortem observa-
tions, which have confirmed an absence of rod
photoreceptors, a twofold increased cone density
with 92% being S-cones, and an overall disrupted
retinal structure [30]. This histology study pro-
vides evidence of retinal degeneration in the
R311Q NR2E3 phenotype where the retina
degenerates with loss of cone photoreceptors,
migration of the RPE cells and gliosis of the
Enhanced S-cone Syndrome, a Mini-review
Müller cells [30]. Other histological findings
from patients with Goldmann–Favre syndrome,
which is one phenotype of ESCS [21, 39], show
absent rods, an abnormal distribution of L/M-
and S-cone opsins [6], diffuse degenerative
changes, vascular occlusive abnormalities, and
pre-retinal glial proliferation [33].
In living eyes, spectral domain optical coher-
ence tomography (SD-OCT) studies reveal that
ESCS patients have thickening of the outer
nuclear layer and abnormal retinal layer organi-
zation [2, 37, 42]. In addition, OCT demonstrates
macular abnormalities including foveomacular
schisis and macular holes [15, 24]. While OCT
provides valuable retinal layer thickness and
integrity information as a commercially available
technology to study retinal structure in eye dis-
eases, it is unable to resolve or distinguish
between individual cone or rod photoreceptors,
thus direct observation of cone photoreceptor
topography in ESCS is not possible with
SD-OCT. In vivo retinal imaging using adaptive
optics scanning laser ophthalmoscopy (AOSLO)
to examine photoreceptor structures in early
ESCS patients shows that cone densities outside
the macula are higher than normal [2, 37].
The progression of ESCS retinal degenera-
tion was described to have three clinical phases
[41]. In the first phase, the mid-peripheral retina
that is typically densely packed with rods is
filled with rod-cone hybrid cells that are prone
to cell death at early stages [9], whereas the cen-
tral macular region is preserved due to normally
developed L- and M-cones near the fovea [41].
In the second phase, macular schisis develops
during young adulthood at the macular region,
affecting visual acuity centrally and reducing
visual field when inner retinal structure is com-
promised mechanically, as is observed similarly
in X-linked retinoschisis [41]. In the third phase,
as the retinoschisis resolves, the retinal thick-
ness reduces to normal or abnormally thin due
to collapse of schisis cavities, but the retinal
sensitivity maintains reduced [41].
The origin of retinoschisis in ESCS is
unknown, but it has a similar phenotype to
X-linked retinoschisis, caused by mutations in
the RS1 gene with reduced levels of retinoschisin
191
[40]. However, the NR2E3 gene was not shown to
be essential for RS1 gene expression [22].
Nevertheless, a link between NR2E3 and Müller
cell function is suggested because disease-­
causing variants in NR2E3 could disrupt retinal
integrity by compromising Müller cell function,
making the ESCS retina more vulnerable to schi-
sis formation [41].
In addition to the retinal degeneration result-
ing from schisis in the macular region, photore-
ceptor degeneration of the all-cone retina in
ESCS could also be attributed to the lack of rods
and rod-derived cone viability factor (RdCVF),
as RdCVF is secreted by rods to promote cone
survival in retinitis pigmentosa [1].
4 Visual Function of ESCS
4.1 Visual Sensitivity
The conventional diagnostic test for ESCS is
ERG, which measures full-field electrical
responses of rods and cones with different light
stimulations and conditions [28]. In a dark-­
adapted condition, ESCS patients have absent
rod responses, but when the stimulus becomes
brighter, eliciting responses from both rods and
cones, a simplified and delayed response is
observed. In the light-adapted condition, the cone
response is large but slow. When short-­wavelength
stimuli are used, ESCS patients show enhanced
responses to blue light [20, 24, 25]. The ERG fea-
tures suggest that S-cones may partially replace
L- and M- cones and completely replace rod pho-
toreceptors [26]. Multifocal ERG results show
normal amplitudes and latency in the central ret-
ina, but profoundly delayed responses in the
periphery, which suggests that central L- and
M-cone development is relatively normal, but
S-cones are predominantly distributed in the
peripheral retina and have slower responses [26].
S-cone perimetry further supports this hypothe-
sis: short-wavelength automated perimetry
(SWAP) revealed increased sensitivity to blue
light across the central and the midperipheral
retina compared to normal eyes in early disease
stages [2]. As the disease progresses, the super-­
192
normal sensitivity in the ESCS retina becomes
normal in mild-to-moderate disease stages and
eventually becomes abnormal with an S-cone
scotoma in the peripheral retina beyond 40
degrees and photoreceptor degeneration over
time [35].
4.2 Color Vision
Color vision, measured with Ishihara plates and
Farnsworth D-15 screening tests, was reported to
be mostly normal in ESCS patients [32].
4.3 Temporal Vision
Temporal vision in ESCS has been studied to
understand the post-receptoral mechanism of
S-cone signaling in ESCS [34]. S-cone critical
flicker fusion and S-cone temporal contrast sensi-
tivity in medium-to-high luminance levels are
improved in ESCS compared to normal subjects,
which implies a faster than normal S-cone path-
way in ESCS [34]. The faster S-cone signals
observed in the study are suggested to either orig-
inate from increased numbers of S-cone path-
ways or increased S-cone access to the normal
faster luminance pathways [34]. Spatial acuity
measurement would be essential to test these
theories.
4.4 Spatial Vision
The neural sampling limit for human vision is
governed by the retinal ganglion cells (RGCs)
that convey signals from the retina to the brain
[12]. At the fovea, there is minimal convergence
from cones to retinal ganglion cells, as one cone
photoreceptor connects to at least one
ON-ganglion cell and one OFF-ganglion cell.
This preserves visual information such that cen-
tral foveal vision is limited by optical aberrations
and the sampling of the cone photoreceptors [12].
Just outside of the fovea, spatial vision becomes
poorer than predicted by the sampling limit of the
photoreceptors and better matches the sampling
Y. Wang et al.
limit of midget ganglion cells as they collect sig-
nals from multiple cones [3, 4, 38, 45].
S-cones are generally considered not to con-
tribute to the pathways that support fine spatial
vision for several reasons. First, S-cones are not
present in the foveal center [11, 46]. Second, they
are quite sparse elsewhere in the retina compris-
ing only 10% of the cones at most. Third, S-cone
excitatory signals are transmitted by a different
class of retinal ganglion cells, the small bistrati-
fied retinal ganglion cells (sbRGCs) [14]. In a
normal eye, S-cone-mediated spatial resolution is
very poor and closely correlates with the sam-
pling limit of the small bistratified cells [5, 13].
The density range of the human small bistratified
retinal ganglion cells is estimated to range from
400 cells/mm2 centrally to 20 cells/mm2 periph-
erally [13]. Given a maximal density of around
400 cells/mm2 centrally, the predicted maximal
S-cone acuity guided by sbRGCs is around three
cycles/deg. The S-cone-mediated acuity reported
in several psychophysical studies is generally
below eight cycles/degree in the central and
peripheral retina [5, 8, 29].
So what, if any, benefits in spatial vision might
be conferred by the larger number of cones in an
ESCS retina?
The impact of supernormal S-cone density
on spatial vision is the least well-established of
the functional metrics. The foveal achromatic
acuity of ESCS patients was reported to be
about 20/40 on average among 56 patients,
ranging from 20/20 to 20/1000 [15]. One study
reported that the S-cone-mediated grating acu-
ity six degrees superior to the fovea was
8.16 cycles/degree (20/70 Snellen equivalent)
on average in ESCS, compared to 3.7 cycles/
degree (20/160 Snellen equivalent) in normal
subjects [17]. The spatial vision in this study
was measured at a single retinal location and
was not compared directly to the topography of
the photoreceptor mosaic. Thus, it is still unclear
whether spatial vision in ESCS is determined by
the sampling density of S-cones or by the post-
receptoral neural circuitry.
ESCS provides a unique phenotype to study
how the human visual system adapts to changes
in photoreceptor development and altered visual
Enhanced S-cone Syndrome, a Mini-review
inputs from abnormally distributed cone photore-
ceptors. In ESCS, S-cones are overexpressed at
the expense of other photoreceptor types [30]. If
the increased number of S-cones in ESCS are
pooled into the normal blue-yellow small bistra-
tified ganglion cell pathway, the extra S-cones
may not contribute to improving spatial resolu-
tion that is normally guided by L- and M-cones.
On the other hand, if S-cones that replaced L- and
M-cones during retinal development are wired
into the midget ganglion cell pathway, we would
expect an improvement in the spatial resolution
mediated by S-cones only and a lower-than-­
normal acuity mediated by the L- and M-cones
exclusively. Studying the cone-type-mediated
spatial resolution in ESCS will shed light on how
the photoreceptors connect to the downstream
neural pathways.
In summary, ESCS is an inherited retinal dis-
ease that has the unique feature of showing a gain
in cone photoreceptor function [19]. An increased
understanding of this rare retinal disease will not
only help shed light on the role of NR2E3 during
normal retinal development but also allow us to
investigate how the ESCS S-cone pathway is
involved with spatial resolution.
References
1. Aït-Ali N, Fridlich R, Millet-Puel G, et al. Rod-derived
cone viability factor promotes cone survival by stimu-
lating aerobic glycolysis. Cell. 2015;161:817–32.
2. Ammar MJ, Scavelli KT, Uyhazi KE, et al.
Enhanced S-cone syndrome: visual function, cross-­
sectional imaging, and cellular structure with adap-
tive optics ophthalmoscopy. Retin Cases Brief Rep.
2021;15:694–701.
3. Anderson RS, Wilkinson MO, Thibos
LN. Psychophysical localization of the human visual
streak. Optom Vis Sci. 1992;69:171–4.
4. Anderson RS, Evans DW, Thibos LN. Effect of win-
dow size on detection acuity and resolution acuity for
sinusoidal gratings in central and peripheral vision. J
Opt Soc Am A. 1996;13:697.
5. Anderson RS, Zlatkova MB, Demirel S. What lim-
its detection and resolution of short-wavelength
sinusoidal gratings across the retina? Vis Res.
2002;42:981–90.
6. Bonilha VL, Fishman GA, Rayborn ME, et al. Retinal
pathology of a patient with Goldmann-Favre syn-
drome. Ophthalmic Genet. 2009;30:172–80.
193
7. Chen J. The rod photoreceptor-specific nuclear recep-
tor Nr2e3 represses transcription of multiple cone-­
specific genes. J Neurosci. 2005;25:118–29.
8. Coates DR, Chung STL. Crowding in the S-cone
pathway. Vis Res. 2016;122:81–92.
9. Corbo JC, Cepko CL. A hybrid photoreceptor express-
ing both rod and cone genes in a mouse model of
enhanced S-cone syndrome. PLoS Genet. 2005;1:e11.
10. Curcio CA, Sloan KR, Kalina RE, et al. Human
photoreceptor topography. J Comp Neurol.
1990;292:497–523.
11. Curcio CA, Allen KA, Sloan KR, et al. Distribution
and morphology of human cone photorecep-
tors stained with anti-blue opsin. J Comp Neurol.
1991;312:610–24.
12. Dacey D. The mosaic of midget ganglion cells in the
human retina. J Neurosci. 1993a;13:5334–55.
13. Dacey DM. Morphology of a small-field bistratified
ganglion cell type in the macaque and human retina.
Vis Neurosci. 1993b;10:1081–98.
14. Dacey DM, Lee BB. The ‘blue-on’ opponent pathway
in primate retina originates from a distinct bistratified
ganglion cell type. Nature. 1994;367:731–5.
15. de Carvalho ER, Robson AG, Arno G, et al. Enhanced
S-cone syndrome: spectrum of clinical, imaging, elec-
trophysiologic, and genetic findings in a retrospec-
tive case series of 56 patients. Ophthalmol Retina.
2021;5:195–214.
16. Gire AI, Sullivan LS, Bowne SJ, et al. The Gly56Arg
mutation in NR2E3 accounts for 1–2% of auto-
somal dominant retinitis pigmentosa. Mol Vis.
2007;13:1970–5.
17. Greenstein VC, Zaidi Q, Hood DC, et al. The enhanced
S cone syndrome: an analysis of receptoral and post-­
receptoral changes. Vis Res. 1996;36:3711–22.
18. Haider NB, Demarco P, Nystuen AM, et al. The tran-
scription factor Nr2e3 functions in retinal progeni-
tors to suppress cone cell generation. Vis Neurosci.
2006;23:917–29.
19. Haider NB, Jacobson SG, Cideciyan AV, et al.
Mutation of a nuclear receptor gene, NR2E3, causes
enhanced S cone syndrome, a disorder of retinal cell
fate. Nat Genet. 2000;24:127–31.
20. Jacobson SG, Marmor MF, Kemp CM, et al. SWS
(blue) cone hypersensitivity in a newly identified
retinal degeneration. Invest Ophthalmol Vis Sci.
1990;31:827–38.
21. Jacobson SG, Roman AJ, Roman MI, et al. Relatively
enhanced S cone function in the Goldmann-Favre
syndrome. Am J Ophthalmol. 1991;111:446–53.
22. Langmann T, Lai CCL, Weigelt K, et al. CRX controls
retinal expression of the X-linked juvenile retinoschi-
sis (RS1) gene. Nucleic Acids Res. 2008;36:6523–34.
23. Li S, Datta S, Brabbit E, et al. Nr2e3 is a genetic mod-
ifier that rescues retinal degeneration and promotes
homeostasis in multiple models of retinitis pigmen-
tosa. Gene Ther. 2020;28:223–41.
24. Magliyah MS, Alsulaiman SM, Schatz P, et al.
Evolution of macular hole in enhanced S-cone syn-
drome. Doc Ophthalmol. 2021;142:239–45.
194
25. Marmor MF. Large rod-like photopic signals in a pos-
sible new form of congenital night blindness. Doc
Ophthalmol. 1989;71:265–9.
26. Marmor MF, Tan F, Sutter EE, et al. Topography
of cone electrophysiology in the enhanced S
cone syndrome. Invest Ophthalmol Vis Sci.
1999;40:1866–73.
27. Marmor MF, Jacobson SG, Foerster MH, et al.
Diagnostic clinical findings of a new syndrome with
night blindness, maculopathy, and enhanced S cone
sensitivity. Am J Ophthalmol. 1990;110:124–34.
28. McCulloch DL, Marmor MF, Brigell MG, et al.
ISCEV standard for full-field clinical electroretinogra-
phy (2015 update). Doc Ophthalmol. 2015;130:1–12.
29. Metha AB, Lennie P. Transmission of spatial
information in S-cone pathways. Vis Neurosci.
2001;18:961–72.
30. Milam AH, Rose L, Cideciyan AV, et al. The nuclear
receptor NR2E3 plays a role in human retinal pho-
toreceptor differentiation and degeneration. Proc Natl
Acad Sci U S A. 2002;99:473–8.
31. Kolesnikov A, Murphy DP, Corbo J, et al. Knockout
of Nr2e3 protects against photoreceptor degeneration
in two mouse models of retinitis pigmentosa. Invest
Ophthalmol Vis Sci. 2022; 63:3135.
32. Nishiguchi KM, Friedman JS, Sandberg MA, et al.
Recessive NRL mutations in patients with clumped
pigmentary retinal degeneration and relative preserva-
tion of blue cone function. Proc Natl Acad Sci U S A.
2004;101:17819–24.
33. Peyman GA, Fishman GA, Sanders DR, et al.
Histopathology of Goldmann-Favre syndrome
obtained by full-thickness eye-wall biopsy. Ann
Ophthalmol. 1977;9:479–84.
34. Ripamonti C, Aboshiha J, Henning GB, et al. Vision
in observers with enhanced S-cone syndrome: an
excess of S-cones but connected mainly to conven-
tional S-cone pathways. Invest Ophthalmol Vis Sci.
2014;55:963.
35. Roman AJ, Powers CA, Semenov EP, et al. Short-­
wavelength sensitive cone (S-cone) testing as an out-
come measure for NR2E3 clinical treatment trials. Int
J Mol Sci. 2019;20:2497.
Y. Wang et al.
36. Roorda A, Williams DR. The arrangement of the
three cone classes in the living human eye. Nature.
1999;397:520–2.
37. Roorda A, Sundquist S, Solovyev A, et al. Adaptive
optics imaging reveals supernormal cone density in
enhanced S-cone syndrome. Invest Ophthalmol Vis
Sci. 2010;51:2934.
38. Rossi EA, Roorda A. The relationship between visual
resolution and cone spacing in the human fovea. Nat
Neurosci. 2010;13:156–7.
39. Sharon D. Shared mutations in NR2E3 in enhanced
S-cone syndrome, Goldmann-Favre syndrome, and
many cases of clumped pigmentary retinal degenera-
tion. Arch Ophthalmol. 2003;121:1316.
40. Sikkink SK, Biswas S, Parry NRA, et al. X-linked ret-
inoschisis: an update. J Med Genet. 2007;44:225–32.
41. Sohn EH, Chen FK, Rubin GS, et al. Macular function
assessed by microperimetry in patients with enhanced
S-cone syndrome. Ophthalmology. 2010;117:1199–
1206.e1191.
42. Sustar M, Perovšek D, Cima I, et al.
Electroretinography and optical coherence tomog-
raphy reveal abnormal post-photoreceptoral activ-
ity and altered retinal lamination in patients with
enhanced S-cone syndrome. Doc Ophthalmol.
2015;130:165–77.
43. Swaroop A, Kim D, Forrest D. Transcriptional regu-
lation of photoreceptor development and homeo-
stasis in the mammalian retina. Nat Rev Neurosci.
2010;11:563–76.
44. Szél Á, Van Veen T, Röhlich P. Retinal cone differen-
tiation. Nature. 1994;370:336.
45. Thibos LN, Cheney FE, Walsh DJ. Retinal limits to
the detection and resolution of gratings. J Opt Soc Am
A. 1987;4:1524–9.
46. Williams DR, MacLeod DI, Hayhoe MM. Foveal trit-
anopia. Vis Res. 1981;21:1341–56.
47. Xiao M, Hendrickson A. Spatial and temporal expres-
sion of short, long/medium, or both opsins in human
fetal cones. J Comp Neurol. 2000;425:545–59.
48. Yzer S, Barbazetto I, Allikmets R, et al. Expanded
clinical spectrum of enhanced S-cone syndrome.
JAMA Ophthalmol. 2013;131:1324–30.
 Part VI
Inflammation
 The Role of Microglia in Inherited
Retinal Diseases

Asha Kumari and Shyamanga Borooah

Abstract 1 Introduction

Inherited retinal diseases (IRDs) are a leading
cause of irreversible visual loss in the devel-
oped world. The primary driver of pathology
in IRDs is pathogenic genetic variant.
However, there is increasing evidence, from
recent studies, for a role of the immune system
in disease mechanism, particularly retinal
microglia. Microglia are the primary immune
cells in the retina and actively contribute to
disease pathogenesis when activated locally
by phagocytosing photoreceptors, inducing
inflammation and signaling infiltration of cir-
culating monocytes. In this article, we discuss
the evidence for the contribution of retinal
microglia to IRD pathogenesis reported so far
using mice model.
Keywords
Microglia · Inflammation · Inherited retinal
dystrophy · Animal model · Retinal
degeneration
A. Kumari · S. Borooah (*)
Jacobs Retina Center, Shiley Eye Institute, University
of California San Diego,
La Jolla, CA, USA
e-mail: sborooah@health.ucsd.edu
Microglia are the primary resident immune cells
of the retina and perform a major role in immune
surveillance within the eye [3, 33]. After post-­
natal development, in health, microglia normally
maintain a ramified morphology and reside pri-
marily within the inner plexiform (IPL) and gan-
glion cell layers (GCLs) of the retina [34] (Fig. 1).
Microglia take part in the repair and maintenance
of retinal tissue by inducing regeneration of new
cells and blood vessels. Their ramified processes
remain in close proximity to neuronal synapses,
and microglial activity is important for normal
retinal visual signal transmission [40]. There is
heterogeneity even among retinal microglia, and
recent studies have identified different subclasses
of microglia in the different retinal layers consis-
tent with distinct functional roles, and as a result,
microglia are likely to play a dynamic role
in location-based homeostasis within the retina
[18, 26]. In disease, microglia can rapidly induce
retinal damage driven by pro-inflammatory cyto-
kines, neurotoxic molecules, complement path-
way proteins, and oxidative stress [32].
Additionally, activated microglia can recruit
other immune cells, including macrophages,
from the systemic blood circulation, iris, or cili-
ary body to the retina which further intensifies
damage [18, 25]. In retinal degeneration,

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 197
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_29
198
Fig. 1 Retinal cryosection immunofluresence staining of
wild-type mouse, Panel I-Iba-1 (pan microglial marker),
Panel II-CD68 (microglial activation marker), Panel III-
DAPI, Panel IV-Brightfield. Most of the microglia are
present in the IPL and OPL (GCL-Ganglion cell layer,
­ icroglia proliferate and accumulate near areas
m 2 Phosphodiesterase 6B
of retinal damage, where they can phagocytose
living photoreceptors and contribute to cell death
[17, 43]. In addition, there is a transition from
inactive ramified to more active ameboid forms
with subsequent secretion of pro-inflammatory
cytokines such as TNF-α, IL-1β, ROS, NO,
CCL2, and CCL3, which may accelerate damage
[4, 42]. The duration of this active state and cyto-
kine profile is thought to be determined by the
local tissue environment, location, as well as the
timing and duration of stimuli [12]. A change in
the microglial niche can trigger transcriptional
reprogramming, which can also contribute to a
heterogenic microglial population associated
with pathogenicity [27]. This review focuses on
the evidence that microglia propagate inherited
retinal disease (IRDs), with particular focus on
the evidence from mouse models based on
the major affected IRD associated genes (Fig. 2).
A. Kumari and S. Borooah
IPL-Inner plexiform layer, INL-Inner nuclear layer, OPL-
Outer plexiform layer, ONL-Outer nuclear layer, IS/OS-
Inner and Outer segments, RPE-Retinal pigment
epithelium)
(Pde6b)
The rd1 mouse model results from homozygous
nonsense mutations in exon 7 of the Pde6b gene,
which encodes the beta subunit of cGMP-­Specific
3′,5′-Cyclic Phosphodiesterase [8, 31]. This
mutation results in defects in the rod photorecep-
tor signaling cascade. High cGMP levels facili-
tate prolonged opening of cGMP-channels,
resulting in the apoptosis of rod photoreceptors
and degeneration [7]. Degeneration occurs
extremely early in this model, with rod dysfunc-
tion occurring after P7. By 1 month of age, rd1
mice demonstrate retinal thinning on SD-OCT
imaging and responses are lost on full-field elec-
troretinogram (ffERG). Microglial activation has
been reported in rd1 mice as early as P8. At this
stage, microglia migrate from the IPL to the
ONL. This microglial migration peaks at P14.
The Role of Microglia in Inherited Retinal Diseases 199

Fig. 2 Retinal cryosection immunofluresence staining of
Mfrp loss of function mouse model. Panel I—Iba-1 (pan
microglial marker), panel II—CD68 (microglial activa-
tion marker), panel III—DAPI, panel IV—brightfield.
Most of the microglia are present in IPL, OPL, IS/OS
region. There is a marked increase in microglia compared
to wild-type mouse retina (GCL ganglion cell layer, IPL
inner plexiform layer, INL inner nuclear layer, OPL outer
plexiform layer, ONL outer nuclear layer, IS/OS inner and
outer segments, RPE retinal pigment epithelium)

Microglia in rd1 mice have classically activated secrete pro-inflammatory cytokines, including
microglial expression phenotypes with high IL-1β, leading to further degeneration [43].
CD86+CD206−, CD16/32, CD40, and pro-­ Administration of the IL-1β antagonist anakinra,
inflammatory cytokines (TNF-α, IL-6, and intraocularly, led to greater ONL preservation
CCL2). The number of CD206+CD86− cells was compared to control-treated eyes. This study pro-
low [44]. The rd10 mouse model results from vides strong evidence of retinal microglial activa-
another mutation in Pde6b. In this model, mis- tion and that microglial phagocytosis and
sense mutations are present in exon 13 of the beta cytokine signaling play a crucial role in retinal
subunit of Pde6b. This leads to decreased protein degeneration in the rd10 mouse model of
stability, transport, and phosphodiesterase activ- IRD. Peng et al. also used intraperitoneal admin-
ity. Increased cGMP levels lead to the increased istration of minocycline to inhibit microglial acti-
opening of the cGMP-gated channels and cal- vation in rd10 mice model. Their group reported
cium influx. This is thought to be the underlying improved retinal structure, function, and visual
cause of cell death of cones as well as rods in this behavior in these mice due to minocycline-­
model [39]. Zhao et al. reported that microglia induced inhibition of photoreceptor apoptosis
actively phagocytize dying rods, which express a and inflammation [30]. These studies suggest that
phosphatidylserine ‘eat me’ signal. Accelerating targeting of activated microglia could be a benefi-
the degeneration process further, microglia cial approach for IRD treatment.
200
3 Membrane Frizzled Related
Protein (Mfrp)
The rd6 mouse model results from a spontaneous
mutation mapped to the mouse membrane friz-
zled receptor protein (Mfrp) gene on chromo-
some 9. The gene has a human homolog on
Chr11q23. The rd6 mouse mutation was found to
result from a four-base pair deletion in Mfrp in a
splice donor site, which resulted in skipping exon
4 and a predicted truncation of MFRP protein
[20]. Phenotypically, there is abnormal develop-
ment of photoreceptor outer segments with
defects including disorganized and reduced api-
cal RPE microvilli, confirming the importance of
MFRP for normal functioning and maintenance
of photoreceptors [15]. There are several other
models associated with mutations in Mfrp. A
deletion in exon 3 had been reported in the pro-
tein truncation represented as 174delG. Mice
develop whitish autofluorescent spots across
their fundus. The white dot appearance in the
subretinal cells in mice was identified as inflam-
matory monocyte-derived cells with F4/80,
CD11b, Iba1, and CD68 expression [13]. To
investigate the origin of the inflammatory cells,
the authors generated bone marrow chimeras
with labeled monocytes in mice carrying muta-
tions in Mfrp. The labeled monocytes were
observed approximately 8 weeks later. However,
these mice were lethally irradiated as weanlings,
which may have affected the BRB and retinal
microglia, and so this limits the conclusions,
which can be drawn using this model [14].
Additionally, there was no investigation into
whether the inflammatory cells modified disease
progression in this model. Another Mfrp model,
resulting from homozygous insertion of a cyto-
sine in exon 5, a frame shift generating a prema-
ture termination of the Mfrp transcript. This
mouse model carrying homozygous
c.498_499insC mutations in Mfrp (MfrpKI/KI) has
been recently described [10]. The lack of func-
tional MFRP protein resulted in hyperopia, auto-
fluorescent spots, and retinal degeneration, which
were detectable by scanning laser ophthalmos-
copy and optical coherence tomography as early
as 1 month of age. Mice carrying c.498_499insC
A. Kumari and S. Borooah
mutations have activated subretinal microglia
However, the role of microglia in this model is
yet to be studied in detail (Fig. 3).
4 Crumbs Cell Polarity
Complex Component 1 Gene
(Crb1)
Mutations in the gene encoding human Crumbs
cell polarity complex component 1 gene (CRB1)
have been associated with several retinal dystro-
phies including Leber congenital amaurosis and
RP. The Crumbs protein is linked with several
biological processes in the mammalian eye,
including retinal patterning, ciliogenesis, and
vesicular transport [16]. Rd8 mice have muta-
tions in the Crb1 gene resulting in white retinal
spots from retinal folding known as neuroretinal
rosettes [8]. There is marked phenotypic variabil-
ity in mice harboring this mutation, and evidence
suggests that variation in the genetic background
may further affect microglial responses [23]. It
has been reported that there is a clear correlation
between these fundus white spots and Iba-1+
microglia number in mice with homozygous
mutations of Crb1. With increasing age, there
was a greater correlation between spots and Iba-­
1+ microglia in 14–21-month-old mice compared
to 1–9-month-old mice [22]. Evidence for
microglial activation was seen in a comparative
study using (C57BL/6N) carrying the rd8 muta-
tion and (C57BL/6J) without the rd8 mutation,
which demonstrated increased expression of
CCL2, CFB, C3, NF-kβ, CD200R, and TNF-α in
the rd8 mice [23, 24]. C57BL/6N mice were
more prone to subretinal accumulation of microg-
lia with a pro-inflammatory shift characterized
by upregulation of cytokine positive regulatory
genes and genes involved in oxidative stress [5].
Microglial accumulation in the sub-retinal space,
in addition to upregulation of pro-inflammatory
genes and complement pathway proteins, occurs
with age and increasing degeneration [5].
Although markers of activation were noted in the
rd8 model, studies to deplete or inhibit active
microglia, to see if they contribute to retinal
degeneration, have so far not been performed.
The Role of Microglia in Inherited Retinal Diseases
Fig. 3 Illustration of the role of microglia in inherited
retinal diseases (IRDs). Pde6b phosphodiesterase 6B,
MFRP membrane frizzled related protein, Crb-1 crumbs
cell polarity complex-1, Cx3cr1 CX3C chemokine recep-
5 CX3C Chemokine Receptor 1
(Cx3cr1)
Chemokines are a group of small secretory mol-
ecules, which bind to their G-protein-coupled
receptor and play an important role in the regula-
tion of the immune system in several diseases
including retinal degeneration [6]. CX3CR1 (the
fractalkine receptor) is the only CX3C family
receptor, but it is nonetheless important for pro-
liferation and the recruitment of monocytes. The
role of microglia in retinal degeneration was
evaluated using CX3CR1 deficient rd10 mice,
resulting in the augmentation of inflammatory
cytokines, microglial activation markers, and
increased phagosomes. These effects were
201
tor 1, Mertk Mer proto-oncogene tyrosine kinase, Rpe65
retinoid isomerohydrolase, Nr2e3 nuclear receptor sub-
family 2 group E member 3, P3h1 prolyl 3-hydroxylase 1
reversed when CX3CL1-CX3CR1 signaling was
improved, using exogenous recombinant
CX3CR1, resulting in lowered microglial infil-
tration, phagocytosis, activation, and higher pho-
toreceptor survival. Current studies suggest that
CX3CL1-CX3CR1 signaling is an important
molecular mechanism capable of modulating
microglial-mediated degeneration [41].
Microglia interact closely with photoreceptors
during early retinal development, modulating
photoreceptor development and maturation.
CX3CR1 ablation in Cx3cr1GFP/GFP mice resulted
in a significant decrease in photoreceptor length
and aberrant photoreceptor maturation during
postnatal development when compared with
wild-type mice [19].
202
6 MER Proto-Oncogene,
Tyrosine Kinase (Mertk)
The Royal College of Surgeons (RCS) rat is one
of the most commonly used animal models for
IRD studies. The model carries mutations in the
receptor tyrosine kinase gene (Mertk) resulting in
defective phagocytosis of photoreceptor outer
segments. They represent relevant models for
studying retinal degeneration and pathologies [2,
36]. In an attempt to identify the fate of microglia
in mouse models of MERTK deficiency, several
transgenic mice were generated. Kohno et al.
used Mertk −/− Cx3cr1 GFP/+ Ccr2 RFP/+ mice with
defective RPE phagocytosis. As CX3CR1 and
CCR2 are relatively specific markers of microg-
lia and activated macrophages, respectively, fluo-
rescent protein sequences were inserted to enable
the tagging and investigation of those cells in this
model. CCR2+-activated macrophages and
double-­positive macrophages, which had become
microglia-like, were reported in the subretinal
space at week 8. Initially (4 weeks), only
CX3CR1+ (GFP+) cells were observed, which
represent resident microglia [21]. This suggests
strong evidence of an extra-ocular origin for reti-
nal microglia in the Mertk mouse model.
7 Nuclear Receptor Subfamily
2 Group E Member 3 (Nr2e3)
The rd7 mouse model results from a spontaneous
380 nucleotide deletion in Nr2e3 on mouse chro-
mosome 9. Nr2e3 is normally expressed by pho-
toreceptors. The deletion results in a frame shift
and produces a premature stop codon [1]. Rd7
mice develop multiple autofluorescent retinal
white spots across the retina at an early age (P27).
The white dot appearance has been linked to his-
topathological changes in the retina resulting in
retinal whorls and rosettes [11]. These mice show
an early attenuation of both a- and b-waves.
However, electroretinography stabilizes in the
first year before deteriorating further [9]. Rd7
mouse retina have abnormal accumulation of
outer segments debris containing microglia,
which appeared as autofluorescent spots in reti-
A. Kumari and S. Borooah
nal rosette at P60 [38]. The autofluorescent spots
were like those present in human cases with
Nr2e3 mutation and autofluorescent spots in the
macula. The contribution of BM-derived cells in
retinal degeneration was studied by crossing
mice carrying the macrophage Fas-induced apop-
tosis transgene (Mafia) with rd7 mice carrying
the Nr2e3 mutation. A synthetic dimerizer,
AP20187, was used to deplete only BM-derived
microglia, resulting in decreased photoreceptor
count and an increase in pro-inflammatory mark-
ers including IL-1β, IL-6, and TNF-α [37].
Additionally, the number of white spots increased
after the depletion of BM derived cells. This was
driven by a proliferation of resident retinal
microglia. This model again provides evidence
for a divergent role for BM-derived and resident
retinal microglia in IRD.
8 Retinoid Isomerohydrolase
(Rpe65)
The rd12 mouse model arose from a spontaneous
homozygous nonsense mutation near the Rpe65
gene located on mouse chromosome 3. This
model is useful in the study of slow-onset retinal
degeneration as it has an even slower progression
than rd10 models [28]. Although ultrastructural
changes were noted as early as 3 weeks of age in
this model, the main pathology occurred at
approximately 7 months of age with only six to
eight layers of the ONL remaining. However, like
human disease, the scotopic electroretinography
results were profoundly diminished early, even
by P21 [29]. Sasahara et al. investigated the role
of BM-derived microglia in retinal degeneration
in rd12 alongside the rd1 and rd10 mouse mod-
els. They transplanted BM-derived cells from
CAG-EGFP mice into rd12 mice at P30 and into
rd10 mice at P15. Transplanted (BM-derived)
microglial cells were seen in the retina at P60 in
rd12 and at P30 in rd10 model, which suggests
that macrophagic migration to the retina coin-
cides with degeneration. Again, a limiting factor
of these studies is that the mice were all lethally
irradiated, and the mice were not tested for rd8
mutations [35].
The Role of Microglia in Inherited Retinal Diseases
9 Future Perspectives
There is currently some evidence, from mouse
models of IRD, pointing to a role for microglia in
retinal degeneration. However, further work is
required in most models to establish their causal
role in retinal degeneration. Microglia and mac-
rophages appear to play a role in the clearance of
dying photoreceptors, but it is still not clear
whether activated microglia have a deleterious
effect on disease progression. There is a need for
focused studies, using animal models, on acti-
vated retinal microglia. The development of
inducible models is also likely to assist with the
use of depletion studies. In addition, a better
understanding of microglial response is required
in humans with IRD. In vivo clinical studies,
optimized in animal models, using the latest
imaging and microglial labeling, could assist.
Single-cell transcriptome profiling can help iden-
tify subgroups of cells and generate better tran-
scriptomic networks of activation, which will
allow targeting of retinal microglia. Finally, tech-
niques such as spatial sequencing and highly
multiplexed immunohistochemistry and RNA
labeling may provide even more clues to microg-
lial heterogeneity by highlighting regional differ-
ences. The repurposing of existing systemic
treatments for local use in the context of retinal
degeneration is extremely tempting and may pro-
vide an opportunity to slow degeneration either
as a primary treatment or in combination with
other therapies.
Acknowledgments S.B. is supported by the Foundation
Fighting Blindness Career Development Award. This
artwork was prepared using BioRender.com.
Conflict of Interest None.
References
1. Akhmedov NB, Piriev NI, Chang B, Rapoport AL,
Hawes NL, Nishina PM, Nusinowitz S, Heckenlively
JR, Roderick TH, Kozak CA, Danciger M, Davisson
MT, Farber DB. A deletion in a photoreceptor-­
specific nuclear receptor mRNA causes retinal degen-
203
eration in the rd7 mouse. Proc Natl Acad Sci U S A.
2000;97:5551–6.
2. Al-Khersan H, Shah KP, Jung SC, Rodriguez A,
Madduri RK, Grassi MA. A novel MERTK mutation
causing retinitis pigmentosa. Graefes Arch Clin Exp
Ophthalmol. 2017;255:1613–9.
3. Aloisi F. Immune function of microglia. Glia.
2001;36:165–79.
4. Appelbaum T, Santana E, Aguirre GD. Strong
upregulation of inflammatory genes accompanies
photoreceptor demise in canine models of retinal
degeneration. PLoS One. 2017;12:e0177224.
5. Aredo B, Zhang K, Chen X, Wang CX-Z, Li T, Ufret-­
Vincenty RL. Differences in the distribution, phe-
notype and gene expression of subretinal microglia/
macrophages in C57BL/6N (Crb1 rd8/rd8) versus
C57BL6/J (Crb1 wt/wt) mice. J Neuroinflammation.
2015a;12:6.
6. Balkwill FR. The chemokine system and cancer. J
Pathol. 2012;226:148–57.
7. Bowes C, Li T, Danciger M, Baxter LC, Applebury
ML, Farber DB. Retinal degeneration in the rd mouse
is caused by a defect in the β subunit of rod cGMP-­
phosphodiesterase. Nature. 1990;347:677.
8. Chang B, Hawes N, Hurd R, Davisson M, Nusinowitz
S, Heckenlively J. Retinal degeneration mutants in the
mouse. Vis Res. 2002;42:517–25.
9. Chang BHJR, Hawes NL, Davisson MT. A new
mouse model of retinal dysplasia and degeneration
(rd7). Invest Ophthalmol Vis Sci. 1998;39:s880.
10. Chekuri A, Sahu B, Chavali VRM, Voronchikhina M,
Soto-Hermida A, Suk JJ, Alapati AN, Bartsch D-U,
Ayala-Ramirez R, Zenteno JC. Long-term effects
of gene therapy in a novel mouse model of human
MFRP-associated retinopathy. Hum Gene Ther.
2019;30:632–50.
11. Cheng H, Khan NW, Roger JE, Swaroop A. Excess
cones in the retinal degeneration rd7 mouse, caused
by the loss of function of orphan nuclear receptor
Nr2e3, originate from early-born photoreceptor pre-
cursors. Hum Mol Genet. 2011;20:4102–15.
12. Chiu IM, Morimoto ET, Goodarzi H, Liao JT,
O’Keeffe S, Phatnani HP, Muratet M, Carroll MC,
Levy S, Tavazoie S, Myers RM, Maniatis T. A
neurodegeneration-­ specific gene-expression signa-
ture of acutely isolated microglia from an amyo-
trophic lateral sclerosis mouse model. Cell Rep.
2013;4:385–401.
13. Fogerty J, Besharse JC. 174delG mutation in mouse
MFRP causes photoreceptor degeneration and RPE
atrophy. Invest Ophthalmol Vis Sci. 2011;52:7256–66.
14. Fogerty J, Besharse JC. Subretinal infiltration of
monocyte derived cells and complement misregula-
tion in mice with AMD-like pathology. Adv Exp Med
Biol. 2014a;801:355–63.
15. Fogerty J, Besharse JC. Subretinal infiltration of
monocyte derived cells and complement misregula-
tion in mice with AMD-like pathology. In: Retinal
degenerative diseases. Springer, New York; 2014b.
p. 355–63.
204
16. Gosens I, den Hollander AI, Cremers FP, Roepman
R. Composition and function of the Crumbs protein
complex in the mammalian retina. Exp Eye Res.
2008;86:713–26.
17. Gupta N, Brown KE, Milam AH. Activated microg-
lia in human retinitis pigmentosa, late-onset retinal
degeneration, and age-related macular degeneration.
Exp Eye Res. 2003;76:463–71.
18. Huang Y, Xu Z, Xiong S, Qin G, Sun F, Yang J, Yuan
T-F, Zhao L, Wang K, Liang Y-X, Fu L, Wu T, So K-F,
Rao Y, Peng B. Dual extra-retinal origins of microglia
in the model of retinal microglia repopulation. Cell
Discov. 2018;4:9–9.
19. Jobling AI, Waugh M, Vessey KA, Phipps JA, Trogrlic
L, Greferath U, Mills SA, Tan ZL, Ward MM, Fletcher
EL. The role of the microglial Cx3cr1 pathway in
the postnatal maturation of retinal photoreceptors. J
Neurosci. 2018;38:4708–23.
20. Kameya S, Hawes NL, Chang B, Heckenlively JR,
Naggert JK, Nishina PM. Mfrp, a gene encoding a
frizzled related protein, is mutated in the mouse retinal
degeneration 6. Hum Mol Genet. 2002;11:1879–86.
21. Kohno H, Koso H, Okano K, Sundermeier TR, Saito
S, Watanabe S, Tsuneoka H, Sakai T. Expression pat-
tern of Ccr2 and Cx3cr1 in inherited retinal degenera-
tion. J Neuroinflammation. 2015;12:188.
22. Li T, Aredo B, Chen X, Zhang K, Ufret-Vincenty
R. Change in the distribution and phenotype of sub-
retinal microglia in C57BL/6J and RD8 mutant mice
with aging. Invest Ophthalmol Vis Sci. 2014;55:81.
23. Luhmann UF, Carvalho LS, Holthaus SM, Cowing
JA, Greenaway S, Chu CJ, Herrmann P, Smith AJ,
Munro PM, Potter P, Bainbridge JW, Ali RR. The
severity of retinal pathology in homozygous Crb1rd8/
rd8 mice is dependent on additional genetic factors.
Hum Mol Genet. 2015;24:128–41.
24. Mattapallil MJ, Wawrousek EF, Chan CC, Zhao H,
Roychoudhury J, Ferguson TA, Caspi RR. The Rd8
mutation of the Crb1 gene is present in vendor lines
of C57BL/6N mice and embryonic stem cells, and
confounds ocular induced mutant phenotypes. Invest
Ophthalmol Vis Sci. 2012;53:2921–7.
25. O’Koren EG, Mathew R, Saban DR. Fate mapping
reveals that microglia and recruited monocyte-derived
macrophages are definitively distinguishable by phe-
notype in the retina. Sci Rep. 2016;6:20636.
26. O’Koren EG, Yu C, Klingeborn M, Wong AYW,
Prigge CL, Mathew R, Kalnitsky J, Msallam RA,
Silvin A, Kay JN, Bowes Rickman C, Arshavsky VY,
Ginhoux F, Merad M, Saban DR. Microglial func-
tion is distinct in different anatomical locations dur-
ing retinal homeostasis and degeneration. Immunity.
2019;50:723–737.e727.
27. O’Koren EG, Yu C, Klingeborn M, Wong AY, Prigge
CL, Mathew R, Kalnitsky J, Msallam RA, Silvin A,
Kay JN. Microglial function is distinct in different
anatomical locations during retinal homeostasis and
degeneration. Immunity. 2019;50(723–737):e727.
A. Kumari and S. Borooah
28. Pang J, Chang B, Hawes NL, Hurd RE, Davisson
MT, Li J, Noorwez SM, Malhotra R, McDowell
JH, Kaushal S. Retinal degeneration 12 (rd12):
a new, spontaneously arising mouse model for
human Leber congenital amaurosis (LCA). Mol Vis.
2005a;11:152–62.
29. Pang JJ, Chang B, Hawes NL, Hurd RE, Davisson
MT, Li J, Noorwez SM, Malhotra R, McDowell JH,
Kaushal S, Hauswirth WW, Nusinowitz S, Thompson
DA, Heckenlively JR. Retinal degeneration 12 (rd12):
a new, spontaneously arising mouse model for
human Leber congenital amaurosis (LCA). Mol Vis.
2005b;11:152–62.
30. Peng B, Xiao J, Wang K, So KF, Tipoe GL, Lin
B. Suppression of microglial activation is neuropro-
tective in a mouse model of human retinitis pigmen-
tosa. J Neurosci. 2014;34:8139–50.
31. Pittler SJ, Baehr W. Identification of a nonsense muta-
tion in the rod photoreceptor cGMP phosphodiester-
ase beta-subunit gene of the rd mouse. Proc Natl Acad
Sci U S A. 1991;88:8322–6.
32. Rashid K, Akhtar-Schaefer I, Langmann T. Microglia
in retinal degeneration. Front Immunol. 2019; 10:
1975.
33. Ronning KE, Karlen SJ, Miller EB, Burns
ME. Molecular profiling of resident and infiltrating
mononuclear phagocytes during rapid adult retinal
degeneration using single-cell RNA sequencing. Sci
Rep. 2019;9:4858.
34. Santos AM, Calvente R, Tassi M, Carrasco MC,
Martin-Oliva D, Marin-Teva JL, Navascues J,
Cuadros MA. Embryonic and postnatal develop-
ment of microglial cells in the mouse retina. J Comp
Neurol. 2008;506:224–39.
35. Sasahara M, Otani A, Oishi A, Kojima H, Yodoi Y,
Kameda T, Nakamura H, Yoshimura N. Activation of
bone marrow-derived microglia promotes photore-
ceptor survival in inherited retinal degeneration. Am
J Pathol. 2008;172:1693–703.
36. Shivaram AM. Isolation and characterization of reti-
nal microglia in Royal College of Surgeons Rat. 2003.
37. Wang N-K, Lai C-C, Liu C-H, Yeh L-K, Chou CL,
Kong J, Nagasaki T, Tsang SH, Chien C-L. Origin
of fundus hyperautofluorescent spots and their
role in retinal degeneration in a mouse model of
Goldmann-­ Favre syndrome. Dis Model Mech.
2013;6:1113–22.
38. Wang NK, Fine HF, Chang S, Chou CL, Cella W,
Tosi J, Lin CS, Nagasaki T, Tsang SH. Cellular ori-
gin of fundus autofluorescence in patients and mice
with a defective NR2E3 gene. Br J Ophthalmol.
2009;93:1234–40.
39. Wang T, Reingruber J, Woodruff ML, Majumder A,
Camarena A, Artemyev NO, Fain GL, Chen J. The
PDE6 mutation in the rd10 retinal degeneration mouse
model causes protein mislocalization and instability
and promotes cell death through increased ion influx.
J Biol Chem. 2018;293:15332–46.
Mini Review: The Role of Microglia in Inherited Retinal Diseases
40. Wang X, Zhao L, Zhang J, Fariss RN, Ma W,
Kretschmer F, Wang M, Qian H, Badea TC, Diamond
JS, Gan W-B, Roger JE, Wong WT. Requirement
for microglia for the maintenance of synaptic func-
tion and integrity in the mature retina. J Neurosci.
2016;36:2827–42.
41. Zabel MK, Zhao L, Zhang Y, Gonzalez SR, Ma W,
Wang X, Fariss RN, Wong WT. Microglial phago-
cytosis and activation underlying photoreceptor
degeneration is regulated by CX3CL1-CX3CR1 sig-
naling in a mouse model of retinitis pigmentosa. Glia.
2016;64:1479–91.
205
42. Zeng H, Ding M, Chen X-X, Lu Q. Microglial NADPH
oxidase activation mediates rod cell death in the retinal
degeneration in rd mice. Neuroscience. 2014;275:54–61.
43. Zhao L, Zabel MK, Wang X, Ma W, Shah P, Fariss
RN, Qian H, Parkhurst CN, Gan WB, Wong
WT. Microglial phagocytosis of living photoreceptors
contributes to inherited retinal degeneration. EMBO
Mol Med. 2015a;7:1179–97.
44. Zhou T, Huang Z, Sun X, Zhu X, Zhou L, Li M,
Cheng B, Liu X, He C. Microglia polarization with
M1/M2 phenotype changes in rd1 mouse model of
retinal degeneration. Front Neuroanat. 2017;11:77.
 CD68: Potential Contributor
to Inflammation and RPE Cell
Dystrophy
Mayur Choudhary and Goldis Malek
Abstract
Age-related macular degeneration (AMD) is
the leading cause of visual impairment in the
elderly in developed countries. It is a complex,
multifactorial, progressive disease with
diverse molecular pathways, including inflam-
mation, regulating its pathogenesis. The
myeloid marker CD68 is a protein highly
expressed in circulating and tissue macro-
phages. Recent observations of immune mark-
ers in human AMD tissues have varied with
some finding ectopic RPE cells in advanced
AMD and others noting negligible numbers of
CD68-positive cells. Additionally, animal
models of retinal degeneration have shown
upregulation of CD68, in a protective popula-
tion of retinal microglia. Herein, we review
the potential role of CD68 in regulating RPE
health and inflammation in the sub-retinal
M. Choudhary
Department of Ophthalmology, Albert Eye Research
Institute, Duke University School of Medicine,
Durham, NC, USA
G. Malek (*)
Department of Ophthalmology, Albert Eye Research
Institute, Duke University School of Medicine,
Durham, NC, USA
Department of Pathology, Albert Eye Research
Institute, Duke University School of Medicine,
Durham, NC, USA
e-mail: gmalek@duke.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_30
space and discuss observations on its localiza-
tion in a mouse model that presents with
AMD-like features.
Keywords
Age-related macular degeneration ·
Inflammation · CD68 · Retinal pigment
epithelial cells · Sub-retinal immune cells
1 Introduction
Age-related macular degeneration (AMD) is a
major cause of irreversible blindness affecting
elderly people worldwide [1]. It is a complex
neurodegenerative disease regulated by both
genetic and environmental risk factors [2].
Despite substantial advancement in our under-
standing of the pathogenesis of AMD, there are
multiple aspects related to its development and
progression, which remain to be investigated in
detail. Though it is well known that the retinal
pigment epithelium (RPE) supports cells ino the
overlying neurosensory retina and underlying
choroid, and performs several vital functions
including phagocytosis of photoreceptor outer
segments, processing of visual-cycle metabolites,
maintenance of outer blood–retina barrier, and
secretion of growth factors, cytokines, and lipo-
protein particles [3], the early molecular events
precipitating RPE damage remain to be identified
207
208
and are an area of intense investigation. This has
been a challenge given the complexity of the clin-
icopathology of RPE cells in the early and
intermediate stages of AMD including altered
­ cultured monocyte THP-1 cells, suggesting that it
RPE morphology, mediated by a number of fac-
tors, including but not limited to accumulation of
lipid- and protein-rich deposits within and under-
neath the RPE, modulation of cytokines in the
sub-retinal space, presence of sub-retinal immune
cells, and epithelial-to-mesenchymal transition
of RPE cells [2, 4–7]. These changes may eventu-
ally lead to RPE atrophy and fatally impact the
overlying photoreceptor cells, as seen in late dry
AMD, also referred to as geographic atrophy [2].
Thus, it is imperative to understand the molecular
mechanisms that regulate AMD pathogenic
changes along the course of the disease, in order
to develop potential therapies to either decelerate
or prevent loss of RPE function.
Hints to pathways that may trigger RPE dam-
age include studies demonstrating loss of retinoid
markers such as RPE65 (retinoid isomerohydro-
lase) and CRALBP (cellular retinaldehyde-­
binding protein) [8, 9] and altered expression of
immune markers such as CD68 and CD163, in
abnormal RPE cells as observed in human late-­
dry AMD retinal cross sections [10]. These RPE
changes have been attributed to transdifferentia-
tion. The focus of this mini review is on the role
of CD68 in regulating RPE cell homeostasis as
well as the immune environment of the sub-­
retinal space.
2 CD68 Expression in the Eye
CD68, also known as macrosialin in mice, is a
heavily glycosylated type I transmembrane gly-
coprotein, mainly associated with endosomal/
lysosomal organelles [11, 12]. It is a member of
the LAMP (lysosomal-associated membrane pro-
teins) family of glycoproteins and is also called
LAMP-4. Structurally, CD68 contains a single
LAMP-like domain, with two conserved disul-
fide bridges and a mucin-like domain [13].
Interestingly, the function of CD68 is still not
well defined, but its localization within late endo-
somes suggests a role in peptide transport/pro-
M. Choudhary and G. Malek
cessing and involvement in lysosomal/autophagy
pathways. CD68 has been shown to bind
oxidized-­low density lipoproteins (oxLDL) in
may function as a receptor for oxLDL, though
this function has not been confirmed in vivo [14–
16]. CD68 is also a well-known myeloid-specific
surface marker, expressed abundantly by macro-
phages [13]. In the posterior retina, CD68 expres-
sion has been reported in primary human RPE
cultures as well as freshly isolated RPE cells [17]
in a predominantly granular perinuclear staining
pattern similar to that observed in mononuclear
phagocytes [17]. Additionally, CD68 expression
has been studied in the retina of senescence-­
accelerated OXYS rats, with CD68-positive cells
detected throughout much of the inner retina
including the retinal ganglion cell layer, inner
nuclear layer, inner plexiform layer, and outer
plexiform layer, but not the photoreceptor layer
[18]. Finally, CD68-positive cells are often
immunopositive for the microglial marker Iba1,
suggesting a potential immune cell origin for
CD68-positive cells. These observations imply
that CD68 is expressed in immune cells as well
as RPE cells in the eye [18].
3 CD68 Expression Is
Associated with RPE
Dystrophy and Inflammation
Infiltration of immune cells into the sub-retinal
space has been widely observed in human neo-
vascular AMD specimens as well in the experi-
mental choroidal neovascularization mouse
model, developed by a laser-induced breach of
Bruch’s membrane [19–24]. The presence of sub-­
retinal immune cells has been recognized as an
important factor in the pathogenesis of CNV for-
mation [25], potentially sourced from the circula-
tion, and the resting microglia residing in the
inner retina [26]. Notably, the presence of sub-­
retinal immune cells has been associated with
both intermediate AMD and geographic atrophy
[25], as revealed by immunolocalization of
immune markers including CD163+ and comple-
ment factor-3+ cells throughout AMD donor tis-
CD68: Potential Contributor to Inflammation and RPE Cell Dystrophy
sue [10, 21, 27, 28]. With regard to CD68 as a
marker of immune cells, two studies reported
negligible numbers of CD68+ cells in retinal
cross sections as a function of age and AMD,
suggesting potential heterogeneity in its expres-
sion by immune cells in the retina [21, 29]. In
vivo studies using transgenic mice have provided
further evidence for the involvement of immune
cells in disease progression. Aged mice with a
genetic deletion of the aryl hydrocarbon receptor
(Ahr), known for its role in toxin metabolism and
clearance, develop human dry AMD-like fea-
tures, including decreased retinal function, accu-
mulation of thick sub-RPE basal laminar deposits,
and RPE and choroidal atrophy [24, 30]. These
mice also present with a significantly larger neo-
vascular lesion in response to laser injury [24].
Evaluation of the content of the CNV lesions
revealed the presence of a greater number of
immune cells, suggesting that dysregulation of
inflammation plays a role in its etiology. Further
support for an Ahr-driven inflammatory role
comes from in vitro findings, in which knocking
down Ahr resulted in an increase in the produc-
tion of inflammatory cytokines and growth fac-
tors in RPE and choroidal endothelial cells.
Importantly, RPE flatmounts prepared from two
cohorts of aged Ahr−/− mice (12–14 months old
and 18–20 months old) exhibited significantly
higher number of sub-retinal immune cells, com-
pared to age-matched wild-type mice, which
were associated with regions of RPE dystrophy
(Fig. 1a, b). The flatmounts from both cohorts
(12–14 months and 18–22 months) of Ahr−/−
mice also exhibited a significantly larger area
with RPE dystrophy as compared to wild-type
mice (Fig. 1c, d). When RPE flatmounts from the
Ahr−/− cohort were probed with an antibody to
CD68, increased immunoreactivity was detected
in RPE cells, in a granular, punctate perinuclear
staining pattern. Additionally, an upregulation in
the number of F4/80+ (marker for murine macro-
phages) and CD68+ sub-retinal immune cells
was observed. Interestingly, only 13–21% of the
F4/80+ immune cells were also CD68+, suggest-
ing that there may be distinct populations of
immune cells in the sub-retinal space of these
mice (Fig. 2). To identify stimulants for CD68,
209
in vitro experiments were performed in human
primary RPE cells (93-year-old, female, passages
4–6), which showed an upregulation of CD68 in
response to treatment with AMD-relevant oxi-
dants, sodium iodate, and cigarette smoke extract
(Fig. 3). The RPE cells again displayed a punc-
tate, granular, and perinuclear staining pattern
consistent with the in vivo observations.
Comparable results were observed in a second
mouse model, which also presents with AMD-­
like pathology, aged Liver-X-Receptor alpha–
deficient (Lxra−/−) mice [31]. These mice
(12–14 months) exhibit significant upregulation
of sub-retinal immune cells, increase in proin-
flammatory cytokines, as well as RPE dystrophy.
The sub-retinal cells observed in posterior RPE
flatmounts stained positive for CD68 and the
microglial marker Iba1, associated with regions
of RPE dystrophy (data not shown). Collectively,
these results highlight the interconnection
between CD68 expression in sub-retinal immune
cells and RPE, and RPE injury and dystrophy.
4 Unresolved Roles of CD68
in AMD Pathogenesis
In light of the discussed observations in murine
models and clinicopathology studies of human
AMD, CD68 appears to be associated with ecto-
pic RPE as well as RPE dystrophy [10]. The pres-
ence of CD68-positive sub-retinal immune cells
in the Ahr−/− and Lxra−/− mouse models, which
present with AMD-like features, adds another
layer of complexity in deciphering the function
and role of CD68 in AMD pathogenesis indicat-
ing that CD68 should be investigated in the con-
text of RPE cells, disease-associated sub-retinal
immune cells, keeping in mind that its role may
differ in mice versus humans [21, 29].
Immune cells in the retina are derived from
two sources, resident microglia, which constitute
about 85% of the immune cells in the retina, and
perivascular macrophages [26]. The retinal
microglia are heterogeneous in nature and occupy
two distinct niches in the retina, the outer plexi-
form layer and inner plexiform layer. The microg-
lia residing in the inner plexiform layer are
210
Fig. 1 Aged Ahr−/− mice exhibit a greater number of sub-­
retinal immune cells concomitant with diffuse RPE dys-
trophy. (a) Flatmounts from wild-type (Ahr+/+) and
Ahr−/− mice stained with phalloidin (RPE cytoskeleton),
F4/80 (murine macrophages), and Hoechst (cell nuclei)
(scale bar = 50 μm). (b) Quantification of F4/80+ cells in
Ahr+/+ and Ahr−/− mice (n = 4 per group, *p < 0.05, ns not
dependent on interleukin-34 (IL-34), a cytokine
secreted by retinal ganglion cells, for their sur-
vival, whereas the microglia in the outer
­plexiform layer are independent of IL-34 signal-
ing [32]. Aging and disease can also bring about
the migration of immune cells into the sub-retinal
space, a known disease-associated niche [26].
Both populations of retinal microglia are
central to the modulation of the immune-­
M. Choudhary and G. Malek
significant). (c) Two representative high-magnification
images from flatmounts from two Ahr−/− mice showing
regions of RPE dystrophy. Ahr+/+ mice displayed normal
RPE morphology (scale bar = 50 μm). (d) Quantification
of percentage of flatmount area, which displayed RPE
dystrophy (n = 4 per group, *p < 0.05, ns not significant)
microenvironment in the sub-retinal space in
response to aging as well as disease. In the sub-­
retinal space, they adhere to the apical side of the
RPE cells. This upregulation of microglial cells
in the sub-retinal space, associated with retinal
and RPE degenerative changes, has consistently
been reported in several mouse models, including
the light degeneration model, sodium-iodate-­
induced RPE injury model, RhoP23H/WT retinitis
CD68: Potential Contributor to Inflammation and RPE Cell Dystrophy
Fig. 2 Aged Ahr−/− mice exhibit a greater number of
CD68+ and F4/80+ sub-retinal immune cells. (a)
Flatmounts from wild-type (Ahr+/+) and Ahr−/− mice
stained with phalloidin (RPE cytoskeleton) and probed
Fig. 3 RPE cells exhibit an upregulation of CD68 immu-
nostaining in response to oxidant injury. Representative
images of RPE cells from a 93-year-old, female (passages
pigmentosa model, as well as, in the Ahr−/− and
Lxra−/− knockout mouse models with AMD-like
pathologies [24, 30–34]. In one study examining
retinal degeneration in mice following light-­
induced degeneration, a distinct population of
CD68+ retinal microglia in the sub-retinal space
was found to express a number of other genes
including Lgals3 (Galectin3), Lpl (lipoprotein
lipase), Fabp5 (fatty acid binding protein 5),
Apoe (Apolipoprotein e), Lilr4b (leukocyte
immunoglobulin-like receptor B4), Trem2 (trig-
gering receptor expressed on myeloid cells 2),
Cstb (cystatin B), and Sqstm1 (sequestosome 1)
[32]. Importantly, it was shown that this microg-
lial population protects RPE from disease-­
associated damage, in light degeneration as well
as the RhoP23H/WT retinitis pigmentosa model [32].
Therefore, it is postulated that microglia may
211
with antibodies to F4/80 (murine macrophages) and CD68
(immune cells) (scale bar = 50 μm). (b) Quantification of
CD68+ and F4/80+ cells in Ahr+/+ and Ahr−/− mice (n = 4
per group, *p < 0.05)
4–6) treated with (a) DMSO control, (b) sodium iodate
(NaIO3), and (c) cigarette smoke extract (CSE) (scale
bar = 20 μm)
have a distinct protective role in the sub-retinal
space in mouse models. Additional studies using
human donor tissue are needed to further cor-
roborate this finding.
CD68 may also be involved in regulating RPE
health and function. CD68 has been reported by
different groups to be upregulated in ectopic RPE
cells in advanced AMD, downregulated in human
AMD samples, as well as expressed in mouse
models exhibiting AMD-like features (Ahr−/− and
Lxra−/−) [10, 21, 23, 24, 29, 31]. Our studies have
brought to light that aged Ahr−/− mice display an
upregulation of CD68 immunostaining in regions
displaying RPE dystrophy, leading one to con-
clude that CD68 may regulate multiple homeo-
static pathways in RPE cells, which may extend
to transdifferentiation, epithelial-to-­mesenchymal
transition, inflammation, autophagy, and lyso-
212
some function. It remains to be determined
whether CD68 expression is upregulated prior to
the appearance of RPE cell dystrophy or is a con-
sequence of stressed RPE cells attempting to res-
cue its phenotype by pushing autophagy and
lysosomal pathways into overdrive. Detailed
investigation is warranted to address the role of
CD68 in the context of retinal microglia as well
as RPE cells.
Acknowledgements This study was supported by NEI
grants: EY027802 (GM), EY028160 (GM), EY032751
(GM), and EY005722 (Duke Eye Center) and Research to
Prevent Blindness core grant (Duke Eye Center).
References
1. Wong WL, Su X, Li X, Cheung CM, Klein R, Cheng 16. Ramprasad MP, Terpstra V, Kondratenko N,
CY, et al. Global prevalence of age-related macular
degeneration and disease burden projection for 2020
and 2040: a systematic review and meta-analysis.
Lancet Glob Health. 2014;2(2):e106–16.
2. Ambati J, Fowler BJ. Mechanisms of age-related
macular degeneration. Neuron. 2012;75(1):26–39.
3. Lakkaraju A, Umapathy A, Tan LX, Daniele L, Philp
NJ, Boesze-Battaglia K, et al. The cell biology of
the retinal pigment epithelium. Prog Retin Eye Res.
2020;78:100846.
4. Ambati J, Atkinson JP, Gelfand BD. Immunology of
age-related macular degeneration. Nat Rev Immunol.
2013;13(6):438–51.
5. Wang L, Clark ME, Crossman DK, Kojima K,
Messinger JD, Mobley JA, et al. Abundant lipid 19. Gehrs KM, Heriot WJ, de Juan E Jr. Transmission
and protein components of drusen. PLoS One.
2010;5(4):e10329.
6. Curcio CA, Johnson M, Rudolf M, Huang JD. The
oil spill in ageing Bruch membrane. Br J Ophthalmol. 20. Seregard S, Algvere PV, Berglin L. Immuno­
2011;95(12):1638–45.
7. Curcio CA, Johnson M, Huang JD, Rudolf M. Aging,
age-related macular degeneration, and the response-­
to-­retention of apolipoprotein B-containing lipopro- 21. Lad EM, Cousins SW, Van Arnam JS, Proia
teins. Prog Retin Eye Res. 2009;28(6):393–422.
8. Kiser PD. Retinal pigment epithelium 65 kDa pro-
tein (RPE65): an update. Prog Retin Eye Res.
2021;88:101013.
9. Xue Y, Shen SQ, Jui J, Rupp AC, Byrne LC, Hattar 22. Sennlaub F, Auvynet C, Calippe B, Lavalette S,
S, et al. CRALBP supports the mammalian reti-
nal visual cycle and cone vision. J Clin Invest.
2015;125(2):727–38.
10. Cao D, Leong B, Messinger JD, Kar D, Ach T,
Yannuzzi LA, et al. Hyperreflective foci, optical
coherence tomography progression indicators in age-­ 23. Choudhary M, Safe S, Malek G. Suppression of aber-
related macular degeneration, include transdifferenti-
ated retinal pigment epithelium. Invest Ophthalmol
Vis Sci. 2021;62(10):34.
M. Choudhary and G. Malek
11. Holness CL, Simmons DL. Molecular cloning of
CD68, a human macrophage marker related to lyso-
somal glycoproteins. Blood. 1993;81(6):1607–13.
12. Holness CL, da Silva RP, Fawcett J, Gordon S,
Simmons DL. Macrosialin, a mouse macrophage-­
restricted glycoprotein, is a member of the lamp/lgp
family. J Biol Chem. 1993;268(13):9661–6.
13. Chistiakov DA, Killingsworth MC, Myasoedova
VA, Orekhov AN, Bobryshev YV. CD68/macrosia-
lin: not just a histochemical marker. Lab Investig.
2017;97(1):4–13.
14. Kurushima H, Ramprasad M, Kondratenko N, Foster
DM, Quehenberger O, Steinberg D. Surface expres-
sion and rapid internalization of macrosialin (mouse
CD68) on elicited mouse peritoneal macrophages. J
Leukoc Biol. 2000;67(1):104–8.
15. van der Kooij MA, von der Mark EM, Kruijt JK,
van Velzen A, van Berkel TJ, Morand OH. Human
monocyte-derived macrophages express an approxi-
mately 120-kD Ox-LDL binding protein with strong
identity to CD68. Arterioscler Thromb Vasc Biol.
1997;17(11):3107–16.
Quehenberger O, Steinberg D. Cell surface expres-
sion of mouse macrosialin and human CD68 and
their role as macrophage receptors for oxidized
low density lipoprotein. Proc Natl Acad Sci U S A.
1996;93(25):14833–8.
17. Elner SG, Elner VM, Nielsen JC, Torczynski E,
Yu R, Franklin WA. CD68 antigen expression by
human retinal pigment epithelial cells. Exp Eye Res.
1992;55(1):21–8.
18. Telegina DV, Kozhevnikova OS, Bayborodin SI,
Kolosova NG. Contributions of age-related altera-
tions of the retinal pigment epithelium and of glia
to the AMD-like pathology in OXYS rats. Sci Rep.
2017;7:41533.
electron microscopic study of a subretinal choroidal
neovascular membrane due to age-related macular
degeneration. Arch Ophthalmol. 1992;110(6):833–7.
histochemical characterization of surgically removed
subfoveal fibrovascular membranes. Graefes Arch
Clin Exp Ophthalmol. 1994;232(6):325–9.
AD. Abundance of infiltrating CD163+ cells in the
retina of postmortem eyes with dry and neovascular
age-related macular degeneration. Graefes Arch Clin
Exp Ophthalmol. 2015;253(11):1941–5.
Poupel L, Hu SJ, et al. CCR2(+) monocytes infiltrate
atrophic lesions in age-related macular disease and
mediate photoreceptor degeneration in experimental
subretinal inflammation in Cx3cr1 deficient mice.
EMBO Mol Med. 2013;5(11):1775–93.
rant choroidal neovascularization through activation
of the aryl hydrocarbon receptor. Biochim Biophys
Acta Mol basis Dis. 2018;1864(5 Pt A):1583–95.
CD68: Potential Contributor to Inflammation and RPE Cell Dystrophy
24. Choudhary M, Kazmin D, Hu P, Thomas RS,
McDonnell DP, Malek G. Aryl hydrocarbon recep-
tor knock-out exacerbates choroidal neovascular-
ization via multiple pathogenic pathways. J Pathol.
2015;235(1):101–12.
25. Guillonneau X, Eandi CM, Paques M, Sahel JA,
Sapieha P, Sennlaub F. On phagocytes and macular
degeneration. Prog Retin Eye Res. 2017;61:98–128.
26. Yu C, Roubeix C, Sennlaub F, Saban DR. Microglia
versus monocytes: distinct roles in degen-
erative diseases of the retina. Trends Neurosci.
2020;43(6):433–49.
27. Nozaki M, Raisler BJ, Sakurai E, Sarma JV, Barnum
SR, Lambris JD, et al. Drusen complement compo-
nents C3a and C5a promote choroidal neovasculariza-
tion. Proc Natl Acad Sci U S A. 2006;103(7):2328–33.
28. Gupta N, Brown KE, Milam AH. Activated microg-
lia in human retinitis pigmentosa, late-onset retinal
degeneration, and age-related macular degeneration.
Exp Eye Res. 2003;76(4):463–71.
29. Madigan MC, van den Berg C, Jager MJ, Provis
JM. Expression of macrophage markers and C3d in
central and peripheral choroid of young, aged and
213
age-related macular degeneration eyes. Clin Exp
Ophthalmol. 2013;41:129.
30. Hu P, Herrmann R, Bednar A, Saloupis P, Dwyer MA,
Yang P, et al. Aryl hydrocarbon receptor deficiency
causes dysregulated cellular matrix metabolism and
age-related macular degeneration-like pathology.
Proc Natl Acad Sci U S A. 2013;110(43):E4069–78.
31. Choudhary M, Ismail EN, Yao PL, Tayyari F, Radu
RA, Nusinowitz S, et al. LXRs regulate features of
age-related macular degeneration and may be a poten-
tial therapeutic target. JCI Insight. 2020;5(1):131928.
32. O’Koren EG, Yu C, Klingeborn M, Wong AYW,
Prigge CL, Mathew R, et al. Microglial function is
distinct in different anatomical locations during
retinal homeostasis and degeneration. Immunity.
2019;50(3):723–37 e7.
33. Reyes NJ, O’Koren EG, Saban DR. New insights into
mononuclear phagocyte biology from the visual sys-
tem. Nat Rev Immunol. 2017;17(5):322–32.
34. O’Koren EG, Mathew R, Saban DR. Fate mapping
reveals that microglia and recruited monocyte-derived
macrophages are definitively distinguishable by phe-
notype in the retina. Sci Rep. 2016;6:20636.
 Gene Expression of Clusterin,
Tissue Inhibitor
of Metalloproteinase-1, and Their
Receptors in Retinal Pigment
Epithelial Cells and Müller Glial
Cells Is Modulated
by Inflammatory Stresses
Mengmei Zheng, Eun-Jin Lee, Shinwu Jeong,
and Cheryl Mae Craft
Abstract
Balanced activities of matrix metalloprotein-
ases (MMPs) and their inhibitors are essential
for photoreceptor (PR) cell survival. PR rod
cell survival in rodent models of inherited reti-
nitis pigmentosa (RP) is prolonged by recom-
binant tissue inhibitor of metalloproteinase
(TIMP)-1 or clusterin (CLU) proteins. Retinal
pigment epithelial cells (RPE) and Müller glia
(MG) cells support PR cells. In human RPE
and MG cell lines, we measured their mRNA
M. Zheng · S. Jeong · C. M. Craft (*)
Mary D. Allen Vision Research Laboratory, USC
Roski Eye Institute, Department of Ophthalmology,
Keck School of Medicine of the University of
Southern California, Los Angeles, CA, USA
e-mail: CherylMae.Craft@med.usc.edu
E.-J. Lee
Mary D. Allen Vision Research Laboratory, USC
Roski Eye Institute, Department of Ophthalmology,
Keck School of Medicine of the University of
Southern California, Los Angeles, CA, USA
Department of Ophthalmology, Stanford University,
Palo Alto, CA, USA
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_31
levels of the two genes with quantitative real-­
time PCR (qRT-PCR) with interleukin (IL)-1β
treatment, a key pathological component in
retinal degeneration. Endogenous CLU gene
expression was significantly downregulated
by IL-1β in both cell types, whereas TIMP-1
expression was upregulated in MG cells, sug-
gesting the transcriptional control of CLU is
potentially more sensitive to inflammatory
conditions. The expression levels of CLU
endocytic receptors revealed that the low-­
density lipoprotein receptor-related protein 2
(LRP2) was upregulated only in MG cells by
the treatment with no detectable change in
RPE cells. Like LRP2, IL-1β upregulated
TIMP-1 receptor LRP1 expression in MG
cells; however, it was decreased in the expres-
sion of RPE cells. These data suggest that the
gene expression of CLU and TIMP-1 and their
receptors may be dynamically modulated in
inflammatory conditions.
Keywords
Retinal degeneration · Cytokine · Oxidative
stress · Clusterin · Tissue inhibitor of metal-
loproteinase 1 · Matrix metalloproteinase
215
216
1 Introduction
Retinal Müller glial (MG) cells are the most
abundant resident radial glial cells and are closely
associated with all neuronal cell types in the ret-
ina. In contrast, retinal pigment epithelial (RPE)
cells are differentiated monolayer cells, apically
lining photoreceptor (PR) cells. Both MG and
RPE cells are essential for PR’s function and sur-
vival [1, 2]. The integrity and function of retinal
neurons are determined, not only by an internal
balance between survival and death signaling, but
also by a homeostatic maintenance of retinal
architecture composed of multiple neuronal cell
types and surrounding extracellular matrix
(ECM), which is a target of modulation by pro-
teinases such as matrix metalloproteinases
(MMPs).
By showing prolonged rod cell survival with
the treatments of recombinant clusterin (CLU)
and tissue inhibitor of metalloproteinase
(TIMP)-1 proteins, our published work using
human-inherited RP models, the rd1 mouse and
S334ter-line-3 transgenic rat, demonstrated that
MMP inhibitors have both a positive neuronal
cell survival effect and a therapeutic potential to
slow rod cell death [3–5]. Furthermore, both
exogenous treatments exert their functions as cell
signaling molecules by binding to their cell sur-
face receptors, including low-density lipoprotein
receptor-related protein (LRP) 1 for TIMP-1 and
LRP2 for CLU [6–8].
To gain insight into how TIMP-1 and CLU
and their receptors may function, we investigated
their transcriptional regulation in vitro in MG and
RPE cells under an inflammatory condition.
2 Methods
2.1 Cytokine Treatments
and Quantitative RT-PCR
Human MG cell line MIO-M1 and RPE cell line
ARPE-19 were maintained in regular Dulbecco’s
Modified Eagle’s Medium (DMEM) containing
10% fetal bovine serum (FBS). These cells were
M. Zheng et al.
grown in six-well plates subconfluently before
treating the cells with interleukin (IL)-1β at
10 ng/mL for 24 h in FBS-free media. Total RNA
was prepared using TRI Reagent (Sigma Aldrich,
St. Lois, MO), and High-Capacity RNA-to-­
cDNA™ Kit (ThermoFisher Sci., Chino, CA)
was used for cDNA synthesis. Quantitative
Polymerase Chain Reaction (QPCR) was per-
formed on QuantStudio 6 Flex Real-Time PCR
System (Applied Biosystems, Waltham, MA)
using gene transcript-specific oligo DNA pri­
mers for the expression of CLU (Fwd
5′-ACCAGTACTATCTGCGGGTCA-3′, Rev
5′-CGTCACAGTGATGGGATCAG-3′), TIMP-1
(Fwd 5′-CTGCAATTCCGACCTCGTC-3′, Rev
5′-GGAAGTATCCGCAGACACTCTC-3′),
LRP-1 (Fwd 5′-CGAGGCCCCTGAGATTT
GT-3′, Rev 5′-CATCGAGTGTGGGGACAC-3′),
LRP-2 (5′-CCTCCCCAAATGCAAGTGT-3′,
Rev 5′-GCCCCTGATCTGAAGGTCA-3′), and
β-Actin (Fwd 5′- AGGCACCAGGGCGTG-3′,
Rev 5′-CCCGTCACCGGAGTCC-3′) genes.
Quantification of relative amounts of transcripts
was done using a delta-delta Ct method and
β-actin transcription as an internal normalization
control. Student’s t-test was performed to exam-
ine the differences among the control and test
groups, using GraphPad Prism6 (La Jolla, CA,
USA). The statistical values are presented as
mean ± standard error of the mean (SEM). The
difference between the means of separate treat-
ment groups was considered statistically signifi-
cant at p-value (p) <0.05.
3 Results
PR cells are surrounded radially by MG and api-
cally by RPE cells. Both cell types play vital
functions to maintain PR function and survival,
responding to inflammatory stress occurred upon
the onset of retinal degeneration. To gain insight
into how an inflammatory stress affects the gene
expression from these cells, we adopted in vitro
culture system using MIO-M1 and ARPE-19,
which are spontaneously established cell lines
from in vitro human primary cell cultures of MG
Gene Expression of Clusterin, Tissue Inhibitor of Metalloproteinase-1, and Their Receptors in Retinal… 217

LRP2 Relative Expression Level

b

CLU Relative Expression Level

a 1.5 b 5

4
1.0
3

2
0.5
1

0 0
IL-1b - + - + IL-1b - + - +
MIO-M1 ARPE-19 MIO-M1 ARPE-19
TIMP-1 Relative Expression Level

LRP1 Relative Expression Level

c 3 d 1.5

2 1.0

1 0.5

0 0
IL-1b - + - + IL-1b - + - +
MIO-M1 ARPE-19 MIO-M1 ARPE-19

Fig. 1a-d Sub-confluent MIO-M1 and ARPE-19 cells
were untreated (−) or treated (+), each in triplicate, with
IL-1β at 10 ng/mL for 1 day before extracting total RNA,
which was then used for cDNA synthesis. QPCR was per-
formed with gene-specific primer sets. To assess the rela-
tive expression amounts of gene transcripts for CLU (a),
LRP2 (b), TIMP-1 (c), and LRP1 (d), the level of β-actin
transcripts was used as internal control for normalization.
The statistical significance level was calculated using
Students’ t-test: *p < 0.05; **p < 0.01; ****p < 0.0001

and RPE cells, respectively. Cells were treated

with IL-1β at 10 ng/mL for 24 h, and gene
­transcription was measured by quantitative PCR
using gene transcript-specific DNA primers. In
Fig. 1a, with IL-1β treatment, the level of CLU
transcripts was significantly reduced by 25% and
32% in MIO-M1 and ARPE-19, respectively.
However, its receptor LRP2 was increased by
223% in MIO-M1 cells, with no change in
ARPE-­19 (Fig. 1b). In Fig. 1c, TIMP-1 transcrip-
tion was highly augmented by 154% in MIO-M1
cells by the treatment. TIMP-1 receptor LRP1
expression level was increased by 28% in MIO-
M1 cells but decreased by 20% in ARPE-19 cells
(Fig. 1d).
4 Discussion
Pathological progress of inherited retinal degen-
eration develops with increased levels of disease
factors such as inflammatory and oxidative
stresses and leads to an alteration of retinal archi-
tecture [9, 10]. CLU and TIMP-1 share the MMP
inhibitory activity with their own distinct proper-
ties [6, 11, 12]. CLU has versatile chaperone
functions to attenuate extracellular stress by
clearing dead cells or macromolecular aggre-
gates; TIMP-1 acts as signaling molecule to pro-
mote cell survival. Consistent with these
pro-survival properties of these proteins, we
218
demonstrated that recombinant CLU and TIMP-1
proteins extend rod cell survival in RP animal
models [3–5]. However, how they function in the
retina is still unresolved. To gain insight into how
these two proteins work in vivo, the regulation of
expression in RPE and MG cells, which are
essential to supporting PR cell survival, was
investigated in vitro.
CLU has discrete domains, each responsible
for binding to the receptor LRP-2 and stressed or
unstressed proteins [13]. LRP2 expression is
detected mainly in RPE and MG cells [14, 15].
We also observed LRP2 expression in Long-­
Evans rat retina at the RPE layer and inner seg-
ment region where MG apical processes are
normally localized (data not shown). MG cells
are one of the primary responders to the onset of
rod cell death in the RP retina, showing reactive
gliosis [16].
In our study, MG cells show highly increased
expression of the CLU receptor LRP2 with cyto-
kine treatment (Fig. 1b), whereas endogenous
CLU expression is downregulated in both MIO-­
M1 and ARPE-19 cells under the same treatment
(Fig. 1a). CLU was also down-regulated by oxi-
dative stress (H2O2 treatment; data not shown).
These results suggest that CLU expression is sen-
sitive to pathological factors. Contrary to the cur-
rent gene regulation in human RPE and MG cells
in vitro, we previously observed an increase in
CLU protein level in rat RP retina [3]. This may
reflect the complexity of the CLU gene expres-
sion regulation in the retina, spatiotemporally
involving more diverse retinal cell types and fac-
tors. On the other hand, LRP2 expression is
increased in MG cells, which could potentially
recruit more secreted CLU molecules from other
cells to MG cells. Consistently, in the RP retina
of S334-ter-line, increased CLU immunoreactiv-
ity was detected and associated with MG pro-
cesses, compared with WT control rats [3]. Both
MG and RPE are important for clearance or
phagocytosis of released PR membrane. In light
of CLU’s function of clearing dead cells or
stressed proteins [11], it is intriguing to propose
that being intravitreally injected recombinant
CLU proteins may not only act against MMPs’
destructive activity but also be recruited to MG
M. Zheng et al.
cell surface, promoting the cells to clear dead PR
cells and restore the protein homeostasis in the
retina. CLU may also work indirectly for PR cell
survival, by acting as a signaling molecule
through LRP2 [17], to modulate MG cells to
express neuroprotective molecules to neurons. It
will be interesting to see if any changes occur in
transcriptome or proteome profiles of the MG
cells after CLU treatment.
TIMPs act as inhibitors of MMPs and play a
cytokine-like role by binding to membrane recep-
tors, including LRP-1 [6, 7]. In contrast to CLU,
the TIMP-1 expression was upregulated by the
cytokine treatment (Fig. 1c). We recently reported
that IL-1β treatment does not change the level of
TIMP-1 secretion from MIO-M1 cells but results
in its intracellular aggregate formation [18]. The
current observation of the significant upregulation
of TIMP-1 at the transcriptional level may be
explained by the possibility that the TIMP-1 tran-
script is more susceptible to post-transcriptional
degradation under cytokine treatment, and/or that
the increased protein product translated due to the
increased mRNA levels may be subjected to the
aggregation, attenuating the level of its secretion.
Since TIMP-1 has pleiotropic cytokine-like sig-
naling activity that plays a critical role in cellular
activities, its aggregation may affect the response
of MG cells to inflammatory stress in the retina.
The opposite pattern of LRP1 transcriptional reg-
ulation shown in MG and RPE cells by the same
treatment reflects the complicated in vivo situa-
tion that occurs in the RP retina (Fig. 1d).
In summary, the expressions of CLU and
TIMP-1 and their receptors are regulated differ-
ently by a single cytokine. The current results
suggest that each of the genes may be regulated
spatiotemporally during RP progression with
inflammatory or oxidative stress, thus possibly
providing different local environmental impacts
in the RP retina of a multi-factorial inflammatory
nature. From the therapeutic perspective, one
way to overcome this heterogeneity of RP pathol-
ogy in treating the diseased retina may be a com-
bined therapy with diverse neuroprotective
therapeutic candidates; for example, the com-
bined treatment, simultaneously or sequentially,
of recombinant CLU and TIMP-1 proteins, both
Gene Expression of Clusterin, Tissue Inhibitor of Metalloproteinase-1, and Their Receptors in Retinal…
of which are neuroprotective with different
mechanisms. It may be warranted to investigate
how CLU or TIMP-1 proteins interact with MG
and RPE cells to benefit their roles for these cells
in normal and diseased retinas.
Acknowledgments We thank Dr. Hossein Ameri for pro-
viding the MOMI cell line. This study was supported, in
part, by Mary D. Allen Foundation; Dorie Miller; unre-
stricted Grant to the Department of Ophthalmology from
Research to Prevent Blindness, New York, NY, and the
NIH-NEI P30EY029220.
References
1. de Hoz R, et al. Retinal macroglial responses in health
and disease. Biomed Res Int. 2016;2016:2954721.
2. Strauss O. The retinal pigment epithelium in visual
function. Physiol Rev. 2005;85(3):845–81.
3. Vargas A, et al. Protective effect of clusterin on rod
photoreceptor in rat model of retinitis pigmentosa.
PLoS One. 2017;12(8):e0182389.
4. Kim HS, et al. Tissue inhibitor of metalloproteinases
1 enhances rod survival in the rd1 mouse retina. PLoS
One. 2018;13(5):e0197322.
5. Shin JA, et al. Inhibition of matrix metalloproteinase 9
enhances rod survival in the S334ter-line3 retinitis pig-
mentosa model. PLoS One. 2016;11(11):e0167102.
6. Ries C. Cytokine functions of TIMP-1. Cell Mol Life
Sci. 2014;71(4):659–72.
7. Grunwald B, Schoeps B, Kruger A. Recognizing
the molecular multifunctionality and interactome of
TIMP-1. Trends Cell Biol. 2019;29(1):6–19.
219
8. Moezzi SM, et al. Apolipoprotein J in Alzheimer’s dis-
ease: shedding light on its role with cell signaling path-
way perspective and possible therapeutic approaches.
ACS Chem Neurosci. 2020;11(24):4060–72.
9. Jones BW, et al. Retinal remodeling in human retinitis
pigmentosa. Exp Eye Res. 2016;150:149–65.
10. McMurtrey JJ, Tso MOM. A review of the immuno-
logic findings observed in retinitis pigmentosa. Surv
Ophthalmol. 2018;63(6):769–81.
11. Humphreys DT, et al. Clusterin has chaperone-like
activity similar to that of small heat shock proteins. J
Biol Chem. 1999;274(11):6875–81.
12. Jeong S, et al. Interaction of clusterin and matrix
metalloproteinase-9 and its implication for epithe-
lial homeostasis and inflammation. Am J Pathol.
2012;180(5):2028–39.
13. Lakins JN, et al. Evidence that clusterin has discrete
chaperone and ligand binding sites. Biochemistry.
2002;41(1):282–91.
14. Christensen EI, Birn H. Megalin and cubilin: mul-
tifunctional endocytic receptors. Nat Rev Mol Cell
Biol. 2002;3(4):256–66.
15. Nuutinen T, et al. Clusterin: a forgotten
player in Alzheimer’s disease. Brain Res Rev.
2009;61(2):89–104.
16. Hippert C, et al. Muller glia activation in response
to inherited retinal degeneration is highly varied and
disease-specific. PLoS One. 2015;10(3):e0120415.
17. Li Y, et al. Differential functions of members of the
low density lipoprotein receptor family suggested
by their distinct endocytosis rates. J Biol Chem.
2001;276(21):18000–6.
18. Lee EJ, et al. Matrix metalloproteinase-9 (MMP-9)
and tissue inhibitor of metalloproteinases 1 (TIMP-­
1) are localized in the nucleus of retinal Muller glial
cells and modulated by cytokines and oxidative stress.
PLoS One. 2021;16(7):e0253915.
 Part VII
Mechanisms of Degeneration
 Axonal Transport Defects
in Retinal Ganglion Cell Diseases

Iskalen Cansu Topcu Okan, Fatma Ozdemir,

and Cavit Agca

Abstract Abbreviations

For the survival and maintenance of retinal ALS Amyotrophic lateral sclerosis
ganglion cells (RGCs), axonal transportation ATP Adenine triphosphate
is fundamental. Axonal transportation defects CTB Cholera toxin B
can cause severe neuropathies leading to neu- GC Glucocorticoid
ronal loss. Axonal transport defects usually DEX Dexamethasone-21-acetate
precede axonal degeneration and RGC loss in DOA Dominant optic atrophy
disease models. To date, the main causes of IOP Intraocular pressure
axonal transport defects have not been fully LGN Lateral geniculate nucleus
understood. Therefore, elucidation of the LHON Leber’s hereditary optic neuropathy
mechanisms that lead to transport defects will NMDA N-methyly-D-aspartate
help us to develop novel therapeutic targets OPA 1 Optic atrophy 1
and early diagnostic tools. In this review, we POAG Primary open-angle glaucoma
provide an overview of optic neuropathies and RNFL Retinal nerve fiber layer
axonal degeneration with a focus on axonal RGC Retinal ganglion cell
transport. SC Superior colliculus
TEM Transmission electron microscopy
Keywords TTc Tetanus toxin

Axonal transport · Axonal degeneration ·

Glaucoma · OPA1 · Mitochondria 1 Introduction

Axonal transport, or axoplasmic flow, is the pro-

I. C. T. Okan · F. Ozdemir
Molecular Biology, Genetics and Bioengineering
Program, Sabanci University, Istanbul, Turkey
C. Agca (*)
Molecular Biology, Genetics and Bioengineering
Program, Sabanci University, Istanbul, Turkey
Nanotechnology Research and Application Center
(SUNUM), Sabanci University, Istanbul, Turkey
e-mail: cavit.agca@sabanciuniv.edu
cess by which motor proteins actively travel
along microtubules to deliver various cargoes,
such as mitochondria, lipids, synaptic vesicles,
and other organelles. In this process, neurons
shuttle miscellaneous substances in a bidirec-
tional fashion along the axonal microtubule,
which is considered essential for the function and
the survival of neurons. Depending on the

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 223
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_32
224
d­ irection of material flow, this physiological pro-
cess is divided into two categories: anterograde
(from the cell body to the axon terminal) and ret-
rograde (from the axon terminal to the neuronal
soma) axonal transport [1]. While anterograde
transport is driven by the kinesin superfamily,
retrograde axonal transport is dependent on the
cytoplasmic dyneins [2, 3].
Axonal transport in RGCs is a sensitive phe-
nomenon due to the regulation of homeostasis as
a requirement for ATP and oxygen consumption.
Since RGCs have a relatively larger cell body and
a unique cytostructure, there is an uneven energy
distribution and consumption in RGCs compared
to other neuronal cells [4]. Therefore, RGCs are
essentially considered to be more vulnerable to
degeneration [5, 6]. Any disruption or deficiency
in axonal transport in RGCs possibly results in
neurodegenerative pathologies causing irrevers-
ible vision loss [7]. Thus, defects in axonal trans-
port have become an intriguing topic.
Another critical issue that has to be addressed
is the assessment of the axonal degeneration and
transport defects. It is essential to detect early
defects to prevent axonal degeneration and RGC
loss. Thus, early diagnostics of optic neuropa-
thies in RGC and their axons has become an
emerging field. Unfortunately, available clinical
imaging techniques are insufficient as they tend
to show morphological changes only when vision
loss occurs late in the course of the disease [8].
Yet, there is an unmet diagnostic need to detect
the early stages of optic neuropathies before neu-
ronal and visual loss.
2 Axonal Degeneration
and Transport Defects
Mutations in coding genes of the crucial compo-
nents of axonal transport machinery lead to well-­
known neurodegenerative diseases, including
amyotrophic lateral sclerosis (ALS), parkinson-
ism, and Alzheimer’s disease [9]. Unlike existing
optic neuropathies, they are also well character-
ized by deficiencies in axonal transport. In optic
neuropathies, axonal degeneration can occur bidi-
rectionally [30]. Anterograde (Wallerian) degen-
I. C. T. Okan et al.
eration arises when the nerve fibers are damaged
and it takes place at the site of the lesion that
occurs in the neuron towards the distal end of the
axon. Retrograde degeneration occurs when the
degeneration spreads from the proximal site
(lesion site) along the axon to the cell soma caus-
ing RGC death [30]. This degeneration can be
detected in retinal neurodegenerative diseases by
the changes in the thickness of the retinal nerve
fiber layer (RNFL) [10].
Despite the major factor of optic pathologies
being established as degeneration of RGC axons
and their soma, the main mechanism whether the
axonal degeneration precedes the RGC loss or
not has been not fully understood. There is an
increasing number of supportive studies showing
that axonal degeneration occurs before cell death
and the same conclusion is applicable in optic
neuropathies like glaucoma [8]. In primate mod-
els [11] and also in human glaucoma studies [12],
it was also shown that disruption of axonal trans-
port precedes RGC cell death in both anterograde
and retrograde transports. In a recent study, simi-
lar results were obtained using an excitotoxic rat
retinopathy model generated by N-methyl-D-­
aspartate (NMDA) delivery. Through the in vivo
imaging, the loss of axonal transport that occurred
before the retinal cell death was demonstrated
using tetanus toxin (TTc) [8], a fast axonal trans-
port biomarker for neuronal imaging [13].
Overall, the importance of understanding the
interrelationship of transport deficits and axonal
degeneration has been put forward along with the
need for early diagnostic tools for optic
neuropathies.
3 Optic Neuropathies
Optic neuropathy is attributed to the degeneration
of the optic nerve and more commonly, it leads to
characteristic changes in RNFL, optic disc, and
axons of RGC. Subsequently, the degeneration in
the axons causes apoptosis of RGC and thus,
vision loss may develop [14, 15]. RGCs are quite
vulnerable to mitochondrial disorders. The two
well-known hereditary optic neuropathies,
Dominant Optic Atrophy (DOA), and Leber
Axonal Transport Defects in Retinal Ganglion Cell Diseases
hereditary optic neuropathy (LHON) are related
to mitochondrial dysfunction [16]. Dominant
Optic Atrophy (DOA) is an autosomal inherited
optic nerve disorder where RGCs and their axons
forming the optic nerve are severely impaired.
About 50–60% of cases are related to optic atro-
phy 1 (OPA1) gene [17] and the majority of the
mutations result in OPA1 haploinsufficiency
[18]. OPA1 is a mitochondrial membrane protein
involved in mitochondrial cristae structure, and
fusion of the outer membrane, together with sev-
eral other mitochondrial functions [16, 19].
Likewise, Leber’s hereditary optic neuropathy
(LHON) is a mitochondrial disease due to mito-
chondrial DNA mutations, which selectively
degenerate RGCs [20]. Despite all the neurons
having the same mutations and mitochondrial
dysfunction, the selective loss of RGC in both
hereditary optic neuropathies may be a result of
RGC-specific features. Therefore, this peculiar
phenomenon may be attributed to lack of myelin-
ation in lamina cribrosa, which requires excess
energy and thus results in the accumulation of
mitochondria in the region. In simple terms, hav-
ing mitochondrial dysfunction makes RGC more
prone to selective degeneration.
Glaucoma is another type of optic neuropathy
that occurs in retinal cells causing irreversible
vision loss by damaging the optic nerves [32]. It
is a worldwide disease and approximately 111.8
million people will suffer from this disease by
2040, which already reached 64.8 million people
in 2013 [29]. Although it is a multifactorial dis-
ease, the first risk factor has been identified as
increased intraocular pressure (IOP) above the
limit [22, 33]. Since retrograde degeneration may
induce apoptosis in RGCs, it also cumulatively
leads to glaucoma [21]. Notably, it has been
accepted that aging can be an initiating risk factor
for glaucoma and this is also correlated with
mitochondrial dysfunction [16]. In the last
decade, an increasing number of studies have
argued that one of the early-stage characteriza-
tions of glaucoma includes functional deficits in
axonal transport [6, 23].
225
4 Animal Models and Axonal
Transport Defects
DBA/2 J is a mouse model which mimics the
human primary open-angle glaucoma (POAG)
condition due to elevated intraocular pressure
(IOP) [34]. Therefore, it is commonly used as an
animal model for glaucoma. A recent study using
fluorescently labeled Cholera toxin B (CTB) for
anterograde labeling of RGC or retrograde label-
ing through intracranial injections to retinorecipi-
ent brain regions showed axonal transport defects
in the DBA/2 J animals [6]. In these studies, IOP
is surprisingly reported as an associated factor of
glaucoma but aging turns out to be the main risk
factor. This was demonstrated in 3- to 10-month-
old animals as the gradual increase of IOP levels
further contributed to degeneration. At 11 months
of age, complete failure of axonal transport was
also reported [23]. Furthermore, 9–10 month-old
animals showed 69% and 23% reduction for
anterograde and retrograde axonal transports,
respectively. These findings already confirmed
that axonal transport deficiency was predegener-
ative and preceded the RGC loss. Moreover, it
was shown that the RGC axons and presynaptic
terminals were intact in Superior Colliculus (SC)
albeit with severe anterograde transport defects
[6].
As mentioned previously, DOA is an autoso-
mal inherited optic nerve disorder where RGCs,
and their axons forming the optic nerve are
severely impaired [24]. In the OPA1 haploinsuf-
ficiency animal model, it has been shown that the
RGCs and their axons are intact at the early
stages of the disease [25]. Our unpublished
results also showed a delay in axonal transport,
especially in SC and lateral geniculate nucleus
(LGN) after anterograde transport of the
CTB. This also argued for axonal transport defi-
ciency as an early marker for DOA.
In a laser-induced intraocular pressure model,
axonal transport of mitochondria in the optic nerve
was followed using multiphoton microscopy. In
this model, both the anterograde and the retro-
226 I. C. T. Okan et al.

grade transport of mitochondria were reduced. which have the potential to affect disease out-
This affected the overall mitochondrial distribu- comes. These findings suggest that axonal trans-
tion in RGC axons leading to several mitochon- port can be used as an early biomarker and
dria-free areas. Axonal transport of mitochondria predictor for developing optic neuropathies. This
was further reduced in aged animals showing fur- will allow us to make interventions to save neu-
ther similarities to the DBA2J model [26]. rons and vision, especially in the elderly popula-
Another mouse model, the Glucocorticoid tion considering the fact that aging is a main risk
(GC)-induced RGC degeneration model, was factor for glaucoma.
generated to mimic human POAG disease by To conclude, the treatment of axonal transport
inducing glaucomatous neurodegeneration via defects and improvement of transport efficiency
periocular injections of dexamethasone-21-­ by targeting several aspects of motor proteins
acetate (Dex). Dex is a glucocorticosteroid that is may also be a valuable therapeutic target for
usually used for edema reduction. Analysis of RGC diseases, especially in glaucoma and DOA.
axonal transport by CTB injection and axonal
loss by transmission electron microscopy (TEM)
showed that axonal transport persists at 5 weeks-­
References
time point where there was only 32% axonal loss.
However, when axonal loss reached 48% at 1. Alberts B, Johnson A, Lewis J, Raff M, Roberts K,
8 weeks, complete blockage of CTB in antero- Walter P. The cytoskeleton. In: Bochicchio A, editor.
grade transport occurred. Taken all together, Molecular biology of the cell. New York: Taylor and
these data also show that Dex induction initiates Francis Group; 2014. p. 939–47.
2. Hirokawa N, Niwa S, Tanaka Y. Molecular motors
axonal degeneration, and more importantly, this in neurons: transport mechanisms and roles in
blockage in the axonal transport precedes the brain function, development, and disease. Neuron.
degeneration and RGC loss [31]. 2010;68(4):610–38.
Further evidence supporting the glaucoma-­ 3. Reck-Peterson SL, Redwine WB, Vale RD, Carter
AP. The cytoplasmic dynein transport machin-
related axonal transport defect in animal models ery and its many cargoes. Nat Rev Mol Cell Biol.
involves accumulation of Tau, a microtubule-­ 2018;19(6):382–98.
binding protein. More interestingly, Tau accumu- 4. Yu D-Y, Cringle SJ, Balaratnasingam C, Morgan
lation in RGCs has been shown to disrupt WH, Paula KY, Su E-N. Retinal ganglion cells: ener-
getics, compartmentation, axonal transport, cyto-
anterograde axonal transport. Therefore, the skeletons and vulnerability. Prog Retin Eye Res.
accumulation of Tau protein in the rat glaucoma 2013;36:217–46.
model [27, 28] suggests that Tau accumulation 5. Morgan JE. Circulation and axonal transport in the
and thus, anterograde axonal transport defect is optic nerve. Eye. 2004;18(11):1089–95.
6. Dengler-Crish CM, Smith MA, Inman DM, Wilson
involved in this glaucoma model. Collectively, GN, Young JW, Crish SD. Anterograde transport
these findings demonstrate that axonal transport blockade precedes deficits in retrograde transport in
deficiency is predegenerative and precedes RGC the visual projection of the DBA/2J mouse model of
loss in several RGC disease models. glaucoma. Front Neurosci. 2014;8:290.
7. Fischer RA, Risner ML, Roux AL, Wareham LK,
Sappington RM. Impairment of membrane repolar-
ization accompanies axon transport deficits in glau-
5 Future Perspectives coma. Front Neurosci. 2019;13:1139.
8. Le Roux LG, Qiu X, Jacobsen MC, Pagel MD,
Gammon ST, Piwnica-Worms DR, et al. Axonal trans-
The axonal transport defects that are seen in both port as an in vivo biomarker for retinal neuropathy.
DBA2J and OPA1 haploinsufficiency models are Cell. 2020;9(5):1298.
an early phenomenon and thus independent of 9. Sleigh JN, Rossor AM, Fellows AD, Tosolini AP,
axonal degeneration. This was further supported Schiavo G. Axonal transport and neurological dis-
ease. Nat Rev Neurol. 2019;15(12):691–703.
by mitochondrial transport defects in the laser 10. Herro AM, Lam BL. Retrograde degeneration of reti-
IOP model. Overall, these defects may contribute nal ganglion cells in homonymous hemianopsia. Clin
to metabolic deficiencies in debilitated RGCs, Ophthalmol. 2015;9:1057.
Axonal Transport Defects in Retinal Ganglion Cell Diseases
11. Quigley HA, Addicks EM. Chronic experimen-
tal glaucoma in primates. II. Effect of extended
­intraocular pressure elevation on optic nerve head and
axonal transport. IOVS. 1980;19(2):137–52.
12. Quigley HA, Addicks EM, Green WR, Maumenee
A. Optic nerve damage in human glaucoma: II. The
site of injury and susceptibility to damage. Arch
Ophthalmol. 1981;99(4):635–49.
13. Schellingerhout D, Le Roux LG, Bredow S, Gelovani
JG. Fluorescence imaging of fast retrograde axo-
nal transport in living animals. Mol Imaging.
2009;8(6):319–29.
14. O’Neill EC, Danesh-Meyer HV, Connell PP, Trounce
IA, Coote MA, Mackey DA, et al. The optic nerve
head in acquired optic neuropathies. Nat Rev Neurol.
2010;6(4):221–36.
15. O’Neill EC, Mackey DA, Connell PP, Hewitt AW,
Danesh-Meyer HV, Crowston JG. The optic nerve
head in hereditary optic neuropathies. Nat Rev
Neurol. 2009;5(5):277–87.
16. Ito YA, Di Polo A. Mitochondrial dynamics, transport,
and quality control: a bottleneck for retinal ganglion
cell viability in optic neuropathies. Mitochondrion.
2017;36:186–92.
17. Yu-Wai-Man P, Chinnery PF. Dominant optic atro-
phy: novel OPA1 mutations and revised preva­lence
estimates. Ophthalmology. 2013;120(8):1712–e1.
18. Pesch UE, Leo-Kottler B, Mayer S, Jurklies B,
Kellner U, Apfelstedt-Sylla E, et al. OPA1 mutations
in patients with autosomal dominant optic atrophy
and evidence for semi-dominant inheritance. Hum
Mol Genet. 2001;10(13):1359–68.
19. Lenaers G, Neutzner A, Le Dantec Y, Juschke C, Xiao
T, Decembrini S, et al. Dominant optic atrophy: cul-
prit mitochondria in the optic nerve. Prog Retin Eye
Res. 2020;83:100935.
20. Hage R, Vignal-Clermont C. Leber hereditary optic
neuropathy: review of treatment and management.
Front Neurol. 2021;12:651639.
21. Evangelho K, Mogilevskaya M, Losada-Barragan
M, Vargas-Sanchez JK. Pathophysiology of primary
open-angle glaucoma from a neuroinflammatory and
neurotoxicity perspective: a review of the literature.
Int Ophthalmol. 2019;39(1):259–71.
22. Group CN-TGS. Comparison of glaucomatous pro-
gression between untreated patients with normal-­
tension glaucoma and patients with therapeutically
reduced intraocular pressures. Am J Ophthalmol.
1998;126(4):487–97.
23. Crish SD, Sappington RM, Inman DM, Horner PJ,
Calkins DJ. Distal axonopathy with structural per-
sistence in glaucomatous neurodegeneration. PNAS.
2010;107(11):5196–201.
227
24. Carelli V, La Morgia C, Valentino ML, Barboni P,
Ross-Cisneros FN, Sadun AA. Retinal ganglion cell
neurodegeneration in mitochondrial inherited disor-
ders. BBA-Bioenergetics. 2009;1787(5):518–28.
25. Alavi MV, Bette S, Schimpf S, Schuettauf F,
Schraermeyer U, Wehrl HF, et al. A splice site muta-
tion in the murine Opa1 gene features pathology of
autosomal dominant optic atrophy. Brain. 2007;130
(Pt 4):1029–42.
26. Takihara Y, Inatani M, Eto K, Inoue T, Kreymerman
A, Miyake S, et al. In vivo imaging of axonal trans-
port of mitochondria in the diseased and aged mam-
malian CNS. PNAS. 2015;112(33):10515–20.
27. Chiasseu M, Vargas JLC, Destroismaisons L,
Velde CV, Leclerc N, Di Polo A. Tau accumula-
tion, altered phosphorylation, and missorting pro-
mote neurodegeneration in glaucoma. J Neurosci.
2016;36(21):5785–98.
28. Chiasseu M, Alarcon-Martinez L, Belforte N,
Quintero H, Dotigny F, Destroismaisons L, et al. Tau
accumulation in the retina promotes early neuronal
dysfunction and precedes brain pathology in a mouse
model of Alzheimer’s disease. Mol Neurodegener.
2017;12(1):1–20.
29. Yih-Chung, Tham Xiang, Li Tien Y., Wong Harry A.,
Quigley Tin, Aung Ching-Yu, Cheng (2014) Global
Prevalence of Glaucoma and Projections of Glaucoma
Burden through 2040 Ophthalmology 121(11) 2081–­
2090. https://doi.org/10.1016/j.ophtha.2014.05.013
30. Retrograde and Wallerian Axonal Degeneration Occur
Synchronously after Retinal Ganglion Cell Axotomy
The American Journal of Pathology (2012);181(1):
62–73. https://doi.org/10.1016/j.ajpath.2012.03.030
31. Prabhavathi, Maddineni Ramesh B., Kasetti Pinkal
D., Patel J. Cameron, Millar Charles, Kiehlbauch
Abbot F., Clark Gulab S., Zode. CNS axonal degen-
eration and transport deficits at the optic nerve head
precede structural and functional loss of retinal gan-
glion cells in a mouse model of glaucoma Abstract
Molecular Neurodegeneration 2020;15(1). https://doi.
org/10.1186/s13024-020-00400-9
32. Neuronal death in glaucoma Progress in Retinal
and Eye Research 1999;18(1):39–57. https://doi.
org/10.1016/S1350-9462(98)00014-7
33. The effectiveness of intraocular pressure reduction in
the treatment of normal-tension glaucoma American
Journal of Ophthalmology 1998;126(4): 498–505.
https://doi.org/10.1016/S0002-9394(98)00272-4
34. John, Simon & Smith, R & Savinova, Olga & Hawes,
N & Chang, Bennny & Turnbull, D & Davisson, M
& Roderick, T & Heckenlively, J. Essential iris atro-
phy, pigment dispersion, and glaucoma in DBA/2J
mice. Investigative ophthalmology & visual science.
1998;39:951–62.
 Connexins Biology
in the Pathophysiology of Retinal
Diseases

Alejandro Ponce-Mora, Andrea Yuste,

Giuliana Perini-Villanueva, María Miranda,
and Eloy Bejarano

Abstract eration is not well understood, recent findings

Connexins (Cx) are a family of transmem-
brane proteins that form gap junction intercel-
lular channels that connect neighboring cells.
These channels allow the passage of ions and
other biomolecules smaller than 1 kDa,
thereby synchronizing the cells both electri-
cally and metabolically. Cxs are expressed in
all retinal cell types and the diversity of Cx
isoforms involved in the assembly of the chan-
nels provides a functional syncytium required
for visual transduction. In this chapter, we
summarize the status of current knowledge
regarding Cx biology in retinal tissues and
discuss how Cx dysfunction is associated with
retinal disease pathophysiology. Although the
contribution of Cx deficiency to retinal degen-
A. Ponce-Mora · A. Yuste · M. Miranda
E. Bejarano (*)
School of Health Sciences and Veterinary School,
Universidad CEU Cardenal Herrera, CEU
Universities, Valencia, Spain
e-mail: eloy.bejaranofernandez@uchceu.es
G. Perini-Villanueva
Laboratory for Nutrition and Vision Research, USDA
Human Nutrition Research Center on Aging, Tufts
University, Boston, MA, USA
present Cx as a potential therapeutic target.
Therefore, we will briefly discuss pharmaco-
logical approaches and gene therapies that are
being explored to modulate Cx function and
fight sight-threatening eye diseases.
Keywords
Connexins · Retina · Gapjunctions ·
Intercellular communication · Retinal
degeneration
1 Connexin Biology
in Different Retinal
Components
Connexins (Cx) are a large family of membrane
proteins that form clustered intercellular chan-
nels known as gap junctions (GJ). The human Cx
family comprises 21 genes and the expression of
the different members is cell-type dependent.
This allows heterogeneity in direct intercellular
interactions in our tissues, and gap junctional
intercellular communication (GJIC) is key for
maintaining organismal homeostasis [1].
The retina is a light-sensitive tissue located in
the innermost part of the eye. Due to its special-
ization, it is characterized as a high-level, struc-
turally complex, neural tissue representing one of

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 229
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_33
230
the most intricate cellular circuits in our body. In
the retina, neurons, glial cells, retinal pigment
epithelial cells, and vascular cells form different
layers whose functional synchronization is nec-
essary to preserve visual signal processing and
transduction [2–4].
All components of the vertebrate retina
express Cx, allowing for rapid, bidirectional
communication between retinal cell types, and
contributing to multiple physiological roles [5,
6]. The communication is enabled by GJ chan-
nels, which are formed by two different, six-­
subunit hemichannels from adjacent cells. Each
hemichannel can be constituted of the same
(homomeric) or different (heteromeric) type of
Cx. The channel itself can be built by two identi-
cal (homotypic) or non-identical (heterotypic)
hemichannels, and cell-to-cell communication
can be established between identical (homolo-
gous) or different (heterologous) cell types.
Given that the biophysical properties of intercel-
lular channels rely on the differential composi-
tion of Cx, the expression of these Cx isoforms
represents a key factor for determining the selec-
tive intercellular passage of biomolecules in reti-
nal cell types.
Increasingly, new literature demonstrates that
cell-to-cell communication plays a major role in
neuronal electrical coupling in the retina,
because, unlike neurotransmitters, Cx-based
channels allow for rapid neuronal transmission.
GJIC not only participates in the transduction of
the visual signal from photoreceptors to ganglion
retinal cells but information can also be spread
laterally, allowing temporal and spatial control of
the visual signal transduction. Cx-mediated elec-
trical coupling virtually forms a fine-tuned, func-
tional syncytium that is modulated by light
adaptation and circadian rhythm [7]. GJIC plays
a major role in photoreceptors—retinal cells
responsible for transforming light stimuli into
electric signals. While Cx interaction involved in
A. Ponce-Mora et al.
rod-rod communication remains unclear, Cx36 is
expressed by cones and is involved in homolo-
gous cone-cone synapses and heterologous rod-­
cone synapses [8–10]. Bipolar cells, specialized
glutamatergic neurons that transmit rod or cone-­
generated signals to retinal ganglion cells,
express Cx36 and Cx45 [8]. Homologous bipolar
cell coupling and bipolar to amacrine cell cou-
pling also rely on Cx36 and Cx45 [11]. Retinal
ganglion cells integrate vertebrate retina infor-
mation and transmit the visual signal to higher
visual areas. This cell type forms homologous
gap junctional channels using Cx30.2, Cx36, and
Cx45 subunits, as well as heterologous connec-
tions with amacrine cells that show dependence
on Cx36 and Cx30.2 subunits [10]. Finally,
within the neuronal electrical circuit, horizontal
cells form homologous coupling based on Cx50
and Cx57, Cx that provide high conductance lev-
els [11]. Retinal glial cells are also connected
through Cx-based channels, including the two
retinal macroglia cell types. Several Cxs have
been reported in Müller cells, although Cx43
appears to be the major isoform for homologous
GJIC [10]. Astrocytes form functional syncytia
through homologous intercellular channels
mostly comprised of Cx43 subunits [12]. Other
studies reported the presence of Cx26, Cx30, and
Cx45 in astrocytic gap junction channels [13,
14]. Compelling literature also shows that the
establishment and correct functioning of cell-to-­
cell communication is key for vascular homeo-
stasis. Cx43 is the most abundant subunit in
endothelial cells and pericytes, but Cx30.2, Cx37,
and Cx40 are also expressed [15]. Even retinal
pigment epithelium cells require GJIC, and those
interactions rely on Cx43.
In summary, Cx isoforms are expressed in a
cell-dependent manner in the retina, and
Cx-mediated cell-to-cell communication plays a
crucial role in the neuronal network and in vision
function.
Connexins Biology in the Pathophysiology of Retinal Diseases
2 Connexin Biology in Retinal
Pathophysiology
GJ channels are not static cellular structures,
instead, they are renewed several times a day. Cx
turnover requires a precise balance among differ-
ent molecular steps including transcription, intra-
cellular trafficking, membrane assembly,
docking, and degradation. Although Cxs exhibit a
short lifespan, the half-life is isoform-dependent
and changes associated with Cx turnover are
dependent on physiological stimuli [16, 17].
Thus, the Cx turnover rate seems to be a vital
component in the regulation of Cx function.
Altered expression of Cx is reported in both
oxygen-­restricted and high glucose conditions,
contributing to loss of the BRB and vascular
abnormalities [18–21]. Data also indicate that
dysfunctional GJIC plays a significant role in the
progression of retinal pathological conditions,
presenting Cx as putative targets for the treat-
ment of multiple retinal diseases, including DR,
myopia, glaucoma, and AMD [4, 14, 22–25]. It is
controversial whether disturbed Cx turnover is an
etiological agent of disease. However, it is
accepted that GJIC transmits intracellular cas-
cades related to pathophysiological processes
involved in secondary cell death [26]. This phe-
nomenon, called bystander effect, claims that
after the first cellular aggression, death signals
can be transmitted through the retinal cell net-
work, leading to secondary cell loss. Therefore,
degenerating retinal cells can spread damage to
the surrounding healthy environment [27]. For
this reason, modulation of Cx pattern expression
under pathological conditions might offer a
potential target to fight retinal diseases (Fig. 1).
Pharmacological blockade of Cx function is
being explored as a therapeutic alternative. For
example, oral administration of a Cx43 hemi-
channel blocker preserved photoreceptor activity
231
in the light-damaged retina of an animal model of
dry AMD. Additionally, Cx43 mimetic blocking
peptides decreased vascular leakage and
increased retinal ganglion cell survival after reti-
nal ischemia—protecting against retinal pigment
epithelial cell barrier breakdown [18, 28]. A non-­
specific gap junction antagonist was also shown
to increase retinal ganglion cell and amacrine cell
surveillance in glaucoma models [23]. To avoid
off-target effects of pharmacological blockers,
gene therapy has emerged as a potential promis-
ing alternative. Also, it could be relevant due to
limited ability of pharmacological blockers to
cross the BRB. Cx43 antisense oligodeoxynucle-
otide treatment demonstrated improved vascular
integrity and decreased astrocyte and microglia
activation in an ischemic optic nerve organotypic
model [29]. In addition, lentivirus-mediated
delivery of siRNA against Cx43 after angioplasty
injury in rats attenuated vascular restenosis and
intimal hyperplasia [30].
3 Concluding Remarks
Cx dysfunction is an emerging molecular target
in the pathological processes of different retinal
diseases with promising potential for neuromod-
ulation and retinal regeneration. Despite the sur-
facing of pharmacological and gene therapy
interventions, a better understanding of Cx biol-
ogy in retinal pathophysiology is necessary to
design therapeutic tools that avoid the unspecific
and off-target effects of traditional approaches.
Differential Cx expression in the retinal compo-
nents should be explored and taken into consider-
ation for the development of new tools to combat
retinal and eye-related disorders.
Acknowledgments This manuscript has been supported
by grants RYC2018-024434-I, MINECO PID2020-
119466RB-I00, FUSP-PPC-19-B53C4C64.
232 A. Ponce-Mora et al.

Fig. 1 A vast amount of

experimental evidence
supports the role of
connexin dysfunction in
several eye-related
disorders including
diabetic retinopathy
(DR), age-related
macular degeneration
(AMD), glaucoma, and
myopia. Different
therapeutic strategies
(highlighted in green)
are being explored as
potential interventional
approaches
(pharmacological
blockers of Cx function,
gene therapy, and
electrical/light
stimulation)

central visual processing and relies on Cx36-­

References
1. Söhl G, Willecke K. Gap junctions and the connexin
protein family. Cardiovasc Res. 2004;62:228–32.
https://doi.org/10.1016/j.cardiores.2003.11.013.
2. Ivanova E, Yee CW, Baldoni R Jr, Sagdullaev
BT. Aberrant activity in retinal degeneration impairs
containing gap junctions. Exp Eye Res. 2016;150:81–
9. https://doi.org/10.1016/j.exer.2015.05.013.
3. Roy K, Kumar S, Bloomfield SA. Gap junctional
coupling between retinal amacrine and ganglion cells
underlies coherent activity integral to global object
perception. Proc Natl Acad Sci. 2017;114:E10484–
93. https://doi.org/10.1073/pnas.1708261114.
Connexins Biology in the Pathophysiology of Retinal Diseases
4. Banerjee S, Wang Q, Zhao F, Tang G, So C, Tse D, To,
C.-H, Feng Y, Zhou X, Pan F. Increased Connexin36
phosphorylation in AII Amacrine cell coupling of the
mouse myopic retina. Front Cell Neurosci. 2020;14
https://doi.org/10.3389/fncel.2020.00124.
5. Güldenagel M, Söhl G, Plum A, Traub O, Teubner
B, Weiler R, Willecke K. Expression patterns of
connexin genes in mouse retina. J Comp Neurol.
2000;425:193–201.
6. Jin NG, Chuang AZ, Masson PJ, Ribelayga CP. Rod
electrical coupling is controlled by a circadian
clock and dopamine in mouse retina. J Physiol.
2015;593:1597–631. https://doi.org/10.1113/
jphysiol.2014.284919.
7. Cao J, Ribelayga CP, Mangel SC. A circadian
clock in the retina regulates rod-cone gap junc-
tion coupling and neuronal light responses via acti-
vation of adenosine A(2A) receptors. Front Cell
Neurosci. 2020;14:605067. https://doi.org/10.3389/
fncel.2020.605067.
8. Kántor O, Varga A, Nitschke R, Naumann A,
Énzsöly A, Lukáts Á, Szabó A, Németh J, Völgyi
B. Bipolar cell gap junctions serve major signal-
ing pathways in the human retina. Brain Struct
Funct. 2017;222:2603–24. https://doi.org/10.1007/
s00429-­016-­1360-­4.
9. Asteriti S, Gargini C, Cangiano L. Connexin 36
expression is required for electrical coupling between
mouse rods and cones. Vis Neurosci. 2017;34:E006.
https://doi.org/10.1017/s0952523817000037.
10. González-Casanova J, Schmachtenberg O, Martínez
AD, Sanchez HA, Harcha PA, Rojas-Gomez D. An
update on connexin gap junction and hemichannels
in diabetic retinopathy. Int J Mol Sci. 2021;22:3194.
https://doi.org/10.3390/ijms22063194.
11. Deans MR, Volgyi B, Goodenough DA, Bloomfield
SA, Paul DL. Connexin36 is essential for transmis-
sion of rod-mediated visual signals in the ­mammalian
retina. Neuron. 2002;36:703–12. https://doi.
org/10.1016/s0896-­6273(02)01046-­2.
12. Zahs KR, Newman EA. Asymmetric gap junctional
coupling between glial cells in the rat retina. Glia.
1997;20:10–22.
13. Mansour H, McColm JR, Cole L, Weible M 2nd,
Korlimbinis A, Chan-Ling T. Connexin 30 expres-
sion and frequency of connexin heterogeneity in
astrocyte gap junction plaques increase with age in
the rat retina. PLoS One. 2013;8:e57038. https://doi.
org/10.1371/journal.pone.0057038.
14. Danesh-Meyer HV, Zhang J, Acosta ML, Rupenthal
ID, Green CR. Connexin43 in retinal injury and dis-
ease. Prog Retin Eye Res. 2016;51:41–68. https://doi.
org/10.1016/j.preteyeres.2015.09.004.
15. Roy S, Kim D, Lim R. Cell-cell communication in
diabetic retinopathy. Vis Res. 2017;139:115–22.
https://doi.org/10.1016/j.visres.2017.04.014.
16. Bejarano E, Girao H, Yuste A, Patel B, Marques C,
Spray DC, Pereira P, Cuervo AM. Autophagy mod-
ulates dynamics of connexins at the plasma mem-
brane in a ubiquitin-dependent manner. Mol Biol
233
Cell. 2012;23:2156–69. https://doi.org/10.1091/mbc.
E11-­10-­0844.
17. Solan JL, Lampe PD. Specific Cx43 phosphorylation
events regulate gap junction turnover in vivo. FEBS
Lett. 2014;588:1423–9. https://doi.org/10.1016/j.
febslet.2014.01.049.
18. Danesh-Meyer HV, Kerr NM, Zhang J, Eady EK,
O’Carroll SJ, Nicholson LF, Johnson CS, Green
CR. Connexin43 mimetic peptide reduces vascular
leak and retinal ganglion cell death following retinal
ischaemia. Brain J Neurol. 2012;135:506–20. https://
doi.org/10.1093/brain/awr338.
19. Tien T, Muto T, Zhang J, Sohn EH, Mullins RF, Roy
S. Association of reduced Connexin 43 expression
with retinal vascular lesions in human diabetic reti-
nopathy. Exp Eye Res. 2016;146:103–6. https://doi.
org/10.1016/j.exer.2015.12.011.
20. Ivanova E, Kovacs-Oller T, Sagdullaev BT. Vascular
pericyte impairment and connexin43 gap junction
deficit contribute to vasomotor decline in diabetic
retinopathy. J Neurosci. 2017;37:7580–94. https://doi.
org/10.1523/jneurosci.0187-­17.2017.
21. Kovacs-Oller T, Ivanova E, Bianchimano P,
Sagdullaev BT. The pericyte connectome: spatial pre-
cision of neurovascular coupling is driven by selective
connectivity maps of pericytes and endothelial cells
and is disrupted in diabetes. Cell Discov. 2020;6:39.
https://doi.org/10.1038/s41421-­020-­0180-­0.
22. Szarka G, Balogh M, Tengölics ÁJ, Ganczer A,
Völgyi B, Kovács-Öller T. The role of gap junc-
tions in cell death and neuromodulation in the retina.
Neural Regen Res. 2021;16:1911–20. https://doi.
org/10.4103/1673-­5374.308069.
23. Akopian A, Kumar S, Ramakrishnan H, Roy K,
Viswanathan S, Bloomfield SA. Targeting neuronal
gap junctions in mouse retina offers neuroprotec-
tion in glaucoma. J Clin Invest. 2017;127:2647–61.
https://doi.org/10.1172/jci91948.
24. Yang GY, Liu FY, Li X, Zhu QR, Chen BJ, Liu
LQ. Decreased expression of gap junction delta-2
(GJD2) messenger RNA and connexin 36 protein
in form-deprivation myopia of guinea pigs. Chin
Med J. 2019;132:1700–5. https://doi.org/10.1097/
cm9.0000000000000319.
25. Slavi N, Toychiev AH, Kosmidis S, Ackert J,
Bloomfield SA, Wulff H, Viswanathan S, Lampe
PD, Srinivas M. Suppression of connexin 43 phos-
phorylation promotes astrocyte survival and vascular
regeneration in proliferative retinopathy. Proc Natl
Acad Sci U S A. 2018;115:E5934–e5943. https://doi.
org/10.1073/pnas.1803907115.
26. Ripps H. Cell death in retinitis pigmentosa: gap
junctions and the ‘bystander’ effect. Exp Eye
Res. 2002;74:327–36. https://doi.org/10.1006/
exer.2002.1155.
27. Ma Y, Han X, de Castro RB, Zhang P, Zhang K, Hu
Z, Qin L. Analysis of the bystander effect in cone
photoreceptors via a guided neural network platform.
Sci Adv. 2018;4:eaas9274. https://doi.org/10.1126/
sciadv.aas9274.
234
28. Kuo C, Green CR, Rupenthal ID, Mugisho
OO. Connexin43 hemichannel block protects against
retinal pigment epithelial cell barrier breakdown. Acta
Diabetol. 2020;57:13–22. https://doi.org/10.1007/
s00592-­019-­01352-­3.
29. Danesh-Meyer HV, Huang R, Nicholson LF, Green
CR. Connexin43 antisense oligodeoxynucleotide
treatment down-regulates the inflammatory response
in an in vitro interphase organotypic culture
A. Ponce-Mora et al.
model of optic nerve ischaemia. J Clin Neurosci.
2008;15:1253–63. https://doi.org/10.1016/j.
jocn.2008.08.002.
30. Han XJ, Chen M, Hong T, Zhu LY, He D, Feng JG,
Jiang LP. Lentivirus-mediated RNAi knockdown of
the gap junction protein, Cx43, attenuates the devel-
opment of vascular restenosis following balloon
injury. Int J Mol Med. 2015;35:885–92. https://doi.
org/10.3892/ijmm.2015.2078.
 Role of Nuclear NAD+ in Retinal
Homeostasis

Emily E. Brown, Michael J. Scandura,

and Eric Pierce

Abstract Keywords

NAD+ · Retinal homeostasis · NMNAT1 ·

The retina is one of the most metabolically
active tissues and maintenance of metabolic
homeostasis is critical for retinal function.
Nicotinamide adenine dinucleotide (NAD+) is
a cofactor that is required for key processes,
including the electron transport chain, glycol-
ysis, fatty acid oxidation, and redox reactions.
NAD+ also acts as a co-substrate for enzymes
involved in maintaining genomic DNA integ-
rity and cellular homeostasis, including poly-­
ADP ribose polymerases (PARPs) and
Sirtuins. This review highlights the impor-
tance of NAD+ in the retina, including the role
of enzymes involved in NAD+ production in
the retina and how NAD+-consuming enzymes
may play a role in disease pathology. We also
suggest a cell death pathway that may be com-
mon in multiple models of photoreceptor
degeneration and highlight the role that NAD+
likely plays in this process. Finally, we explore
future experimental approaches to enhance
our understanding of the role of NAD+ in the
retina.
E. E. Brown · M. J. Scandura · E. Pierce (*)
Ocular Genomics Institute, Massachusetts Eye and
Ear, Boston, MA, USA
Department of Ophthalmology, Harvard Medical
School, Boston, MA, USA
e-mail: eric_pierce@meei.harvard.edu
DNA damage · PARP · Genotoxicity · Retinal
metabolism
1 Introduction
In mammalian cells, NAD+ can be synthesized in
three different pathways. These include the kyn-
urenine pathway, in which NAD+ is synthesized
de novo from tryptophan, the Preiss-Handler
pathway, in which NAD+ is synthesized from
NA, and the salvage pathway, which is most of
the NAD+ is recycled from nicotinamide (NAM),
the byproduct produced in reactions that con-
sume NAD+. NAD+-consuming enzymes include
poly (ADP-ribose) polymerases (PARPs) and
Sirtuins. NAM can then be converted back into
the NAD+ precursor, NMN, by nicotinamide
phosphoribosyltransferase (NAMPT) in the sal-
vage pathway. The conversion of NAM to NMN
by NAMPT is the rate-limiting step of NAD+
synthesis in this pathway. Nicotinamide mono-
nucleotide adenylyltransferases (NMNATs) then
convert NMN into NAD+.
Loss of NAD+-producing enzymes, activation
of NAD+-consuming enzymes, and reduced lev-
els of NAD+ are all associated with retinal degen-
eration. These studies, which will be discussed in
greater detail in this review, indicate that NAD+ is

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 235
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_34
236
essential for proper retinal function, and perhaps
that the photoreceptors specifically have a unique
requirement for NAD+. These findings also sug-
gest that NAD+ reduction may be a common
pathogenic mechanism in several different mod-
els of retinal degeneration. This review will dis-
cuss these studies in greater detail and will
conclude with a discussion of the potential next
directions to develop a better understanding of
the role NAD+ plays in retinal homeostasis and
disease.
2 Enzymes Involved in NAD+
Synthesis Are Essential
in the Retina
The enzymes in the salvage pathway are essential
for retinal function, suggesting the importance of
NAD+ in maintaining retinal homeostasis.
Ablation of NAMPT activity specifically in the
rod or cone photoreceptors leads to retinal degen-
eration in mice [16], suggesting that NAD+ is
critical for both rod and cone photoreceptor sur-
vival. Small molecule inhibition of NAMPT has
been shown to lead to vision, but not hearing loss,
in a zebrafish model [3], suggesting that the ret-
ina is uniquely susceptible to reduced levels of
NAD+. In the retinal pigment epithelium (RPE)
of mice, expression of NAMPT and the levels of
NAD+ were both shown to decline with age,
while pharmacological inhibition of NAMPT in
RPE cells resulted in reduced Sirtuin expression
and activity and increased levels of inflammation
[13]. These findings suggest that NAD+ is critical
for the maintenance of cellular homeostasis in
the RPE and neural retina.
Several studies have also shown that NMNAT1
is required for normal retinal function. NMNATs
are ubiquitously expressed, and there are
three NMNAT1 isoforms, which are encoded by
different genes. The NMNAT isoforms are distin-
guished based on their subcellular localization.
NMNAT1 is found in the nucleus, NMNAT2 is
found in the cytoplasm, and NMNAT3 is found in
the mitochondria. Mutations in NMNAT1, the
nuclear isoform, lead to inherited retinal degen-
eration [1, 4, 7, 15, 20], with few reports of sys-
E. E. Brown et al.
temic effects. There are at least 34 mutations in
NMNAT1 that lead to retinal degeneration, and
many of these mutations result in decreased
enzymatic function of NMNAT1[7]. These find-
ings further support the hypothesis that NAD+ is
essential for retinal function and that its depletion
uniquely affects the retina. Knockout of Nmnat1
in mice is embryonic lethal, suggesting that at
least some enzymatic function is required for
proper development [5]. Mice harboring the p.
V9M mutation in Nmnat1 recapitulate many fea-
tures of NMNAT1-associated disease that occur
in humans, including early onset retinal degen-
eration, optic atrophy, and RPE cell loss [12].
Reduced enzymatic activity of NMNAT1 in this
model is also associated with reduced levels of
NAD+ in the retina, but not other tissues [11].
Other studies have shown that conditional knock-
out of Nmnat1 in the mouse retina results in rapid
retinal degeneration [24]. Interestingly, cell type-­
specific knockout of Nmnat1 either in the rods or
cones is sufficient to cause retinal degeneration
[24], suggesting a photoreceptor-specific role for
the enzyme or a photoreceptor-specific require-
ment for nuclear NAD+.
3 Role of NAD+ Consumers
and NAD+ Depletion
in Retinal Degeneration
NAD+-consuming enzymes have also been shown
to play an important role in disease pathogenesis
in a variety of models of retinal degeneration. In
the nucleus, the primary NAD+-consuming
enzymes are PARPs and Sirtuins. There are 18
different PARP enzymes, which are encoded by
different genes. Most of these have poly-ADP
ribosyltransferase activity. Parthanatos, a PARP-­
dependent mode of cell death [6], has been pro-
posed as a mechanism of photoreceptor
degeneration [23]. PARP overactivation has been
shown to lead to photoreceptor cell death in the
rd1 mouse model of inherited retinal degenera-
tion, in the RHO P23H mouse model of retinitis
pigmentosa (RP), and in the RHO S334ter rat
model of RP [14, 19]. Our group has also sug-
gested that PARP overactivation and PAR-­
Role of Nuclear NAD+ in Retinal Homeostasis
mediated cell death play a role in
NMNAT1-associated disease. Nmnat1V9M/V9M mice
exhibit photoreceptor-specific increases in PAR
expression, which is associated with a retina-­
specific decline in the levels of NAD+ [11]. In
addition to PARP overactivation contributing to
disease pathogenesis, studies have also shown
that inhibition of PARP can prevent photorecep-
tor degeneration. Knockout of PARP1 does not
significantly affect retinal structure or function in
wild-type mice [22]. However, knockout of
PARP1 in the Rd1 mouse model significantly
reduced the rate of retinal degeneration [22] and
the PARP inhibitor, Olaparib, has been shown to
delay cell death in this model [21].
Other studies suggest that sterile alpha and
TIR motif containing 1 (SARM1), a NADase that
depletes NAD+ levels in axons in response to
injury [10], plays a role in retinal degeneration.
Activation of SARM1 NADase activity results in
the loss of NAD+ pools and energy depletion,
which ultimately results in cell death [10, 27]. In
the axons of retinal ganglion cells, activation of
SARM1 has been shown to promote degenera-
tion, but not cell death in models of optic crush-­
induced injury and toxicity induced by kainic
acid [8, 17]. NMNAT1 has been shown to play an
essential role in blocking SARM1-dependent
NAD+ consumption in the axons of injured mouse
dorsal root ganglion cells [26] and overexpres-
sion of NMNAT1 or expression of a mutant
NMNAT1 fusion protein are protective against
axonal injury in other models [2, 9, 25]. These
findings suggest that pathology due to loss of
NMNAT1 activity is the result of indirect NAD+
depletion from lack of inhibition of SARM1,
rather than a reduction NAD+ as a direct cause of
reduced NMNAT1 enzymatic activity.
Consistent with this hypothesis, recent work
suggests that the essential role of NMNAT1 in
the retina is to inhibit SARM1. Knockout of
Sarm1 in addition to Nmnat1 was shown to pre-
vent retinal degeneration [24]. Using the Rho
knockout model of inherited retinal degeneration,
another study showed that knocking out Sarm1
resulted in delayed photoreceptor cell death [18].
These findings suggest that the key function of
NMNAT1 in the retina is to inhibit SARM1 activ-
237
ity. However, the mechanisms underlying this
phenomenon are still poorly understood. This
hypothesis also fails to explain why the retina is
uniquely affected in NMNAT1-associated dis-
ease, as NMNAT1-mediated SARM1 inhibition
should be affected in other neurons. Although the
precise mechanisms underlying these processes
remain to be fully understood, depletion of NAD+
appears to be a common feature in many of these
models with retinal degeneration, suggesting its
importance in disease pathogenesis.
Interestingly, depletion of NAD+ occurs early
in the retinal dysfunction process in several
mouse models of retinal degeneration, including
light-induced retinal degeneration, aging-­
associated retinal dysfunction, and in diabetic
retinopathy induced by streptozotocin [16]. Our
group has also shown that in the Nmnat1V9M/V9M
mouse model of NMNAT1-associated retinal
degeneration, NAD+ depletion occurs prior to
retinal degeneration [11]. These findings indicate
that reduced levels of NAD+ are a common fea-
ture in early disease, suggesting that NAD+ deple-
tion may be driving retinal pathology in a wide
range of retinal degenerative diseases.
4 Conclusions
The studies discussed in this review indicate the
importance of NAD+ for retinal homeostasis.
Future studies should aim to develop a better
understanding of the role of NAD+ depletion in
the pathogenesis of inherited retinal degenera-
tions, the role of nuclear vs cytosolic or mito-
chondrial NAD+ pools in this process, and the
role NAD+ consuming enzymes play in disease
etiology.
References
1. Abad-Morales V, Wert A, Ruiz Gomez MA, Navarro
R, Pomares E. New insights on the genetic basis
underlying SHILCA syndrome: characterization
of the NMNAT1 pathological alterations due to
compound heterozygous mutations and identifica-
tion of a novel alternative isoform. Int J Mol Sci.
2021;22(5):2262.
238
2. Araki T, Sasaki Y, Milbrandt J. Increased nuclear
NAD biosynthesis and SIRT1 activation prevent axo-
nal degeneration. Science. 2004;305(5686):1010–3.
3. Cassar S, Dunn C, Olson A, Buck W, Fossey S,
Ramos MF, Sancheti P, Stolarik D, Britton H, Cole
T, Bratcher N, Huang X, Peterson R, Longenecker K,
LeRoy B. From the cover: inhibitors of nicotinamide
phosphoribosyltransferase cause retinal damage in
larval zebrafish. Toxicol Sci. 2018;161(2):300–9.
4. Chiang PW, Wang J, Chen Y, Fu Q, Zhong J, Chen
Y, Yi X, Wu R, Gan H, Shi Y, Chen Y, Barnett C,
Wheaton D, Day M, Sutherland J, Heon E, Weleber
RG, Gabriel LA, Cong P, Chuang K, Ye S, Sallum JM,
Qi M. Exome sequencing identifies NMNAT1 muta-
tions as a cause of Leber congenital amaurosis. Nat
Genet. 2012;44(9):972–4.
5. Conforti L, Janeckova L, Wagner D, Mazzola F,
Cialabrini L, Di Stefano M, Orsomando G, Magni G,
Bendotti C, Smyth N, Coleman M. Reducing expres-
sion of NAD+ synthesizing enzyme NMNAT1 does
not affect the rate of Wallerian degeneration. FEBS J.
2011;278(15):2666–79.
6. David KK, Andrabi SA, Dawson TM, Dawson
VL. Parthanatos, a messenger of death. Front Biosci
(Landmark Ed). 2009;14:1116–28.
7. Falk MJ, Zhang Q, Nakamaru-Ogiso E, Kannabiran
C, Fonseca-Kelly Z, Chakarova C, Audo I, Mackay
DS, Zeitz C, Borman AD, Staniszewska M, Shukla
R, Palavalli L, Mohand-Said S, Waseem NH, Jalali S,
Perin JC, Place E, Ostrovsky J, Xiao R, Bhattacharya
SS, Consugar M, Webster AR, Sahel JA, Moore AT,
Berson EL, Liu Q, Gai X, Pierce EA. NMNAT1 muta-
tions cause Leber congenital amaurosis. Nat Genet.
2012;44(9):1040–5.
8. Fernandes KA, Mitchell KL, Patel A, Marola OJ,
Shrager P, Zack DJ, Libby RT, Welsbie DS. Role of
SARM1 and DR6 in retinal ganglion cell axonal and
somal degeneration following axonal injury. Exp Eye
Res. 2018;171:54–61.
9. Fernando FS, Conforti L, Tosi S, Smith AD, Coleman
MP. Human homologue of a gene mutated in the
slow Wallerian degeneration (C57BL/Wld(s)) mouse.
Gene. 2002;284(1–2):23–9.
10. Gerdts J, Brace EJ, Sasaki Y, DiAntonio A,
Milbrandt J. SARM1 activation triggers axon degen-
eration locally via NAD(+) destruction. Science.
2015;348(6233):453–7.
11. Greenwald SH, Brown EE, Scandura MJ, Hennessey
E, Farmer R, Du J, Wang Y, Pierce EA. Mutant
Nmnat1 leads to a retina-specific decrease of NAD+
accompanied by increased poly(ADP-ribose) in a
mouse model of NMNAT1-associated retinal degen-
eration. Hum Mol Genet. 2021;30(8):644–57.
12. Greenwald SH, Charette JR, Staniszewska M, Shi LY,
Brown SDM, Stone L, Liu Q, Hicks WL, Collin GB,
Bowl MR, Krebs MP, Nishina PM, Pierce EA. Mouse
models of NMNAT1-Leber Congenital Amaurosis
(LCA9) recapitulate key features of the human dis-
ease. Am J Pathol. 2016;186(7):1925–38.
E. E. Brown et al.
13. Jadeja RN, Powell FL, Jones MA, Fuller J, Joseph
E, Thounaojam MC, Bartoli M, Martin PM. Loss of
NAMPT in aging retinal pigment epithelium reduces
NAD(+) availability and promotes cellular senescence.
Aging (Albany NY). 2018;10(6):1306–23.
14. Kaur J, Mencl S, Sahaboglu A, Farinelli P, van Veen
T, Zrenner E, Ekstrom P, Paquet-Durand F, Arango-­
Gonzalez B. Calpain and PARP activation during pho-
toreceptor cell death in P23H and S334ter rhodopsin
mutant rats. PLoS One. 2011;6(7):e22181.
15. Koenekoop RK, Wang H, Majewski J, Wang X, Lopez
I, Ren H, Chen Y, Li Y, Fishman GA, Genead M,
Schwartzentruber J, Solanki N, Traboulsi EI, Cheng
J, Logan CV, McKibbin M, Hayward BE, Parry DA,
Johnson CA, Nageeb M, C. Finding of Rare Disease
Genes Canada, Poulter JA, Mohamed MD, Jafri H,
Rashid Y, Taylor GR, Keser V, Mardon G, Xu H,
Inglehearn CF, Fu Q, Toomes C, Chen R. Mutations
in NMNAT1 cause Leber congenital amaurosis and
identify a new disease pathway for retinal degenera-
tion. Nat Genet. 2012;44(9):1035–9.
16. Lin JB, Kubota S, Ban N, Yoshida M, Santeford A,
Sene A, Nakamura R, Zapata N, Kubota M, Tsubota
K, Yoshino J, Imai SI, Apte RS. NAMPT-mediated
NAD(+) biosynthesis is essential for vision in mice.
Cell Rep. 2016;17(1):69–85.
17. Massoll C, Mando W, Chintala SK. Excitotoxicity
upregulates SARM1 protein expression and pro-
motes Wallerian-like degeneration of retinal ganglion
cells and their axons. Invest Ophthalmol Vis Sci.
2013;54(4):2771–80.
18. Ozaki E, Gibbons L, Neto NG, Kenna P, Carty
M, Humphries M, Humphries P, Campbell M,
Monaghan M, Bowie A, Doyle SL. SARM1 defi-
ciency promotes rod and cone photoreceptor cell
survival in a model of retinal degeneration. Life Sci
Alliance. 2020;3:5.
19. Paquet-Durand F, Silva J, Talukdar T, Johnson LE,
Azadi S, van Veen T, Ueffing M, Hauck SM, Ekstrom
PA. Excessive activation of poly(ADP-ribose)
polymerase contributes to inherited photoreceptor
degeneration in the retinal degeneration 1 mouse. J
Neurosci. 2007;27(38):10311–9.
20. Perrault I, Hanein S, Zanlonghi X, Serre V, Nicouleau
M, Defoort-Delhemmes S, Delphin N, Fares-Taie
L, Gerber S, Xerri O, Edelson C, Goldenberg A,
Duncombe A, Le Meur G, Hamel C, Silva E, Nitschke
P, Calvas P, Munnich A, Roche O, Dollfus H, Kaplan
J, Rozet JM. Mutations in NMNAT1 cause Leber con-
genital amaurosis with early-onset severe macular and
optic atrophy. Nat Genet. 2012;44(9):975–7.
21. Sahaboglu A, Barth M, Secer E, Amo EM, Urtti
A, Arsenijevic Y, Zrenner E, Paquet-Durand
F. Olaparib significantly delays photoreceptor loss in
a model for hereditary retinal degeneration. Sci Rep.
2016;6:39537.
22. Sahaboglu A, Tanimoto N, Kaur J, Sancho-Pelluz
J, Huber G, Fahl E, Arango-Gonzalez B, Zrenner
E, Ekstrom P, Lowenheim H, Seeliger M, Paquet-­
Role of Nuclear NAD+ in Retinal Homeostasis
Durand F. PARP1 gene knock-out increases resistance
to retinal degeneration without affecting retinal func-
tion. PLoS One. 2010;5(11):e15495.
23. Sancho-Pelluz J, Arango-Gonzalez B, Kustermann S,
Romero FJ, van Veen T, Zrenner E, Ekstrom P, Paquet-­
Durand F. Photoreceptor cell death mechanisms
in inherited retinal degeneration. Mol Neurobiol.
2008;38(3):253–69.
24. Sasaki Y, Kakita H, Kubota S, Sene A, Lee TJ, Ban
N, Dong Z, Lin JB, Boye SL, DiAntonio A, Boye
SE, Apte RS, Milbrandt J. SARM1 depletion rescues
NMNAT1-dependent photoreceptor cell death and
retinal degeneration. elife. 2020;9:20201001.
239
25. Sasaki Y, Milbrandt J. Axonal degeneration is blocked
by nicotinamide mononucleotide adenylyltransferase
(Nmnat) protein transduction into transected axons. J
Biol Chem. 2010;285(53):41211–5.
26. Sasaki Y, Nakagawa T, Mao X, DiAntonio A,
Milbrandt J. NMNAT1 inhibits axon degeneration
via blockade of SARM1-mediated NAD(+) depletion.
elife. 2016;5:20161001.
27. Summers DW, Gibson DA, DiAntonio A, Milbrandt
J. SARM1-specific motifs in the TIR domain
enable NAD+ loss and regulate injury-induced
SARM1 activation. Proc Natl Acad Sci U S A.
2016;113(41):E6271–80.
 Retinal Pigmented
Epithelium-­Derived Ectopic Norrin
Does Not Promote Intraretinal
Angiogenesis in Transgenic Mice

Andrea E. Dillinger and Ernst R. Tamm

Abstract 1 Introduction

Formation of intraretinal capillaries and inner
blood-retinal barrier during development
requires norrin, a ligand of the canonical
wingless/integrated (Wnt)/β-catenin signaling
pathway. Here we addressed the question
whether retinal pigmented epithelium (RPE)-
derived overexpression of norrin in transgenic
mice rescues the vascular phenotype caused
by norrin deficiency. To this end, we generated
NdpKO/Rpe65-Norrin mice and analyzed the
activation of β-catenin signaling, the develop-
ment of intraretinal capillaries, and the expres-
sion of blood-retinal barrier marker molecules.
RPE-derived norrin induced retinal β-catenin
signaling but failed to rescue the vascular
developmental defects and the breakdown of
the blood-retinal barrier in norrin-deficient
mice. Sites of ectopic norrin expression and
the amounts of secreted transgenic protein are
critical factors to enable the angiogenic prop-
erties of norrin.
Keywords
Norrin · Retinal vascular development ·
Blood-retinal barrier · β-catenin
A. E. Dillinger (*) · E. R. Tamm
Institute of Human Anatomy and Embryology,
University of Regensburg, Regensburg, Germany
e-mail: andrea.dillinger@ur.de
Development of the intraretinal vasculature starts
with the radial outgrowth of vessels from the
optic nerve, followed by the sprouting of endo-
thelial cells into the retina to form the deep and
intermediate vascular plexuses with multiple
interconnected vessels [3]. The endothelial cells
form a continuous, non-fenestrated vascular net-
work, with distinct molecular characteristics to
form the inner blood-retinal barrier (BRB). The
processes prevent the flux of unneeded molecules
and cells, while providing enough oxygen and
nutrients for the neuronal environment. High and
specialized expression of tight junction proteins,
like claudins, causes reduced paracellular trans-
port, and low rates of transcytosis lead to limited
transcellular transport [4]. Intraretinal angiogen-
esis and formation of the inner BRB critically
require the signaling molecule norrin which is
secreted by Müller cells [6, 10, 12, 13]. Norrin
belongs to the cysteine-knot growth factor super-
family and is a ligand of the canonical wingless/
integrated (Wnt) signaling pathway. Norrin binds
as a dimer to the N-terminal extracellular
cysteine-­rich domain of frizzled class receptor 4
(FZD4) and to the low-density lipoprotein
receptor-­related protein 5/6 (LRP5/6) co-receptor
and activates canonical β-catenin signaling.
Norrin-induced β-catenin signaling is enhanced
by the stabilization of FZD4 at the cell membrane
through the co-activator tetraspanin 12. Upon

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 241
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_35
242 A. E. Dillinger and E. R. Tamm

Norrin-FZD4 binding, the APC-destruction com- 2.2 Immunohistochemistry

plex which leads to β-catenin phosphorylation and Retinal Flat Mount
and degradation is inactivated and therefore Preparation
β-catenin is stabilized and promotes gene tran-
scription [5, 11, 13]. Mutations in the Ndp gene For blood vessel presentation, mice were anes-
which encodes norrin lead to the rare X-linked thetized with CO2, euthanized by atlanto-­
genetic disorder Norrie disease (OMIM occipital dislocation, and perfused through
#310600). The clinical features in patients suffer- the left ventricle with 1 mL of PBS that con-
ing from Norrie disease, like retinal dysplasia/ tained 50 mg high molecular weight
pseudoglioma, retinal detachment, vitreous hem- (MW = 2,000,000 g/mol) FITC-dextran (TdB
orrhages, and cataract inevitably cause blindness. Consultancy, Uppsala, Sweden). For retinal flat
Mutant Ndp-deficient mice exhibit a lack of intra- mounts, eyes were enucleated and placed in
retinal capillaries, glomeruloid-like vascular 4% paraformaldehyde for 1 h. Retinae were
malformations near the inner retinal surface, and dissected and flat mounted with Mowiol
high vascular leakage due to an impaired BRB [6, mounting medium. For immunohistochemis-
10]. Previous studies showed that a retinal pig- try, eyes with and without FITC-dextran perfu-
mented epithelium (RPE) derived overexpression sion were enucleated and fixed in 10% glacial
of norrin protects photoreceptors after light-­ acetic acid, 60% methanol, and 30% chloro-
induced cell death [2] and accelerates vascular form for 4 h at RT, transferred to 50% and 25%
repair following oxygen-induced damage [9]. In methanol 10 min each, washed in 0.1 M phos-
this study, we investigated whether ectopic RPE-­ phate buffer, equilibrated in 10%, 20%, and
derived norrin secretion to the inner retina pro- 30% sucrose, embedded in Tissue-Tek optimal
motes intraretinal angiogenesis, the formation of cooling temperature compound (Sakura
an intact inner BRB, and overall rescues the reti- Finetek Europe B. V., Zoeterwounde,
nal phenotype of norrin-deficient mutant mice. Netherlands) and stored at −20 °C. Frozen sec-
tions were cut on a cryostat, incubated with 2%
bovine serum albumin, 0.2% cold water fish
2 Material and Methods gelatin, 0.1% Triton X-100 in 0.1 M phosphate
buffer, and stained with specific antibodies as
2.1 Animals follows: rat anti-­PLVAP (1:50; Santa Cruz,
Santa Cruz, USA), rabbit anti-caveolin1
Ndptm2Nat (The Jackson Laboratory Stock No. (1:100; Cell Signaling Technology, Danvers,
012287 [12]) and Rpe65-Norrin [9] mice were USA), rabbit anti-claudin5 (1:100; Invitrogen,
crossed. Resulting Ndpy/−/Rpe65-Norrin and Carlsbad, USA), rabbit anti-­β-­catenin (1:100,
Ndp−/−/Rpe65-Norrin were used as experimental Cell signaling), rabbit anti-­ RPE65 (1:100,
mice, and Ndpy/+/Rpe65-Norrin, Ndpy/−, Ndp−/− Abcam, Cambridge, UK), donkey anti-rabbit
and wild-type mice were referred to as controls. IgG (H+L) Alexa Fluor 647 (1:200, Thermo
Mice were housed under standardized conditions Fisher Scientific, Waltham, USA), Cy™3 goat
of 62% air humidity and 21 °C room temperature anti-rabbit IgG (H+L) (1:2000, Jackson
(RT). Feeding was ad libitum. Animals were kept Immuno Research, Cambridgeshire, UK) and
at a 12 h light/dark cycle (6:00–18:00). All proce- Cy™3 donkey anti-rat IgG (H+L) (1:2000;
dures conformed to the tenets of the National Jackson Immuno Research). To control for
Institutes of Health Guidelines on the Care and unspecific binding of the secondary antibody,
Use of Animals in Research, the EU Directive negative controls were performed in which pri-
2010/63/E and the ARVO Statement for the Use mary antibodies had been omitted. Finally,
of Animals in Ophthalmic and Vision Research, 4,6-diamidino-2-phenylindole (DAPI, Vector
and were approved by local authorities (54-­ Laboratories) was added to counterstain
2532.1-44/12; Regierung Oberpfalz, Germany). nuclear DNA.
Retinal Pigmented Epithelium-Derived Ectopic Norrin Does Not Promote Intraretinal Angiogenesis… 243

2.3 Fluorescence Microscopy suited to detect norrin by immunohistochemis-

try, we used an indirect approach and analyzed
Specimens were analyzed using a Zeiss Axio first the neonatal expression of RPE65 in wild-
Imager microscope (Carl Zeiss AG, Jena, type mice (Fig. 1a). Intense and specific immu-
Germany). noreactivity for RPE65 was detected throughout
the entire RPE at postnatal day (P)14 and
6 weeks of age. In contrast, at P7 no or only
3 Results very weak staining for RPE65 was detectable.
Next, we wanted to know if the RPE65 pro-
For simplicity, we will refer to Ndpy/−and Ndp−/− moter fragment is driving the expression of
mice as NdpKO control mice; however, Ndpy/−/ norrin. To this end, we analyzed the expression
Rpe65-Norrin and Ndp−/−/Rpe65-Norrin mice of β-catenin, a downstream molecule of norrin
are referred to as experimental NdpKO/Rpe65-­ signaling and key mediator of canonical Wnt-
Norrin mice. In addition, data from wild-type and signaling. We performed immunohistochemis-
Ndpy/+/Rpe65-Norrin mice will be presented. try in the retina of 6-week-old control and
experimental mice (Fig. 1b). Wild-type and
Ndpy/+/Rpe65-Norrin mice showed an intense
3.1 Canonical Wnt/β-Catenin signal for β-catenin which preferentially accu-
Signaling Is Activated mulated in the nuclei of neurons in the inner
in NdpKO/Rpe65-Norrin Mice nuclear and ganglion cell layer. In contrast, in
Norrin-­deficient control mice, the β-catenin
We first wanted to learn if the RPE65 minimal signal was dramatically reduced. Remarkably,
promoter [1] that was used to drive norrin in NdpKO/Rpe65-Norrin mice the β-catenin sig-
expression in our mouse model would be active nal intensity was enhanced when compared to
during the norrin-mediated formation of retinal that of NdpKO mice. The finding clearly indi-
capillaries. Because of the lack of an antibody cated that RPE-­ derived transgenic norrin is

Fig. 1 (a) Immunohistochemistry of RPE65 (magenta) in NdpKO/Rpe65-Norrin mice. Nuclei were counterstained
the wildtype retina at P7, P14, and at 6 weeks of age. (b) with Dapi. GCL ganglion cell layer, INL inner plexiform
Immunohistochemistry of β-catenin (red) in the retina of layer, ONL outer plexiform layer, RPE retinal pigmented
6-week-old wildtype, Ndpy/+/Rpe65-Norrin, NdpKO, and epithelium; n = 3
244
secreted to the sensory retina and activates
there the Wnt/β-catenin pathway.
3.2 RPE-Derived Norrin Does Not
Promote Retinal Angiogenesis
Intraretinal capillary development was analyzed
on cross sections and flat mounts of FITC-­
Dextran-­ perfused retina of 6-week-old mice.
Images of retinal flat mounts are presented as
merged picture: the superficial plexus is depicted
in magenta, the intermediate plexus in gray and
the deep plexus in cyan (Fig. 2a). Wildtype and
Ndpy/+/Rpe65-Norrin mice showed normal devel-
opment of the retinal vascular network. The three
retinal plexuses were fully developed and the
interconnected capillaries of all three plexuses
were visible (Fig. 2a). In contrast, in NdpKO mice
retinal vessels were restricted to the superficial
plexus. The retinae showed lack of capillaries in
the deep and intermediate plexuses and
glomeruloid-­like or club-like malformations of
the superficial vasculature (Fig. 2a, arrow), both
characteristic findings in norrin-deficient animals
[6, 8, 10]. The analysis of NdpKO/Rpe65-Norrin
mice showed that RPE-derived norrin did not res-
Fig. 2 FITC-dextran perfused retinae of 6-week-old
wild-type, Ndpy/+/Rpe65-Norrin, NdpKO, and NdpKO/
Rpe65-Norrin mice. (a) The three vascular plexuses of the
retina are overlaid in one image. SP superficial plexus
A. E. Dillinger and E. R. Tamm
cue the retinal phenotype of norrin-deficient
mice. The mice showed a lack of intraretinal cap-
illaries, with glomeruloid-like malformations
extending into the deeper layers of the retina
(Fig. 2a). The findings were confirmed by FITC-­
dextran-­perfused retinal cross sections (Fig. 2b).
3.3 Analysis of Blood-Retinal
Barrier Integrity
Next, we analyzed by immunohistochemistry
the tight-junction protein claudin5 (CLN5), the
marker of fenestrated capillaries PLVAP, and the
caveolae protein caveolin1 (CAV1) (Figs. 3, 4
and 5). In wildtype and Ndpy/+/Rpe65-Norrin
mice staining for PLVAP was detected in the
choriocapillaris (arrowhead) but was completely
missing in the intraretinal capillaries (Fig. 3). In
contrast, in NdpKO mice, PLVAP was localized
both to the choriocapillaris (arrowhead) and the
intraretinal vessels (arrow), indicating the for-
mation of fenestrated capillaries and the pres-
ence of an impaired BRB (Fig. 3). Finally, the
analysis of NdpKO/Rpe65-Norrin mice showed a
similar staining pattern for PLVAP as the signal
was detected in the choriocapillaris (arrowhead)
(magenta), IP intermediate plexus (gray), DP deep plexus
(cyan). Arrow: glomerular-like malformations (b) Retinal
cross sections. GCL ganglion cell layer, INL inner nuclear
layer, ONL outer nuclear layer. n ≥ 3
Retinal Pigmented Epithelium-Derived Ectopic Norrin Does Not Promote Intraretinal Angiogenesis…
Fig. 3 Immunohistochemistry of PLVAP (red) in the ret-
ina of 6-week-old wildtype, Ndpy/+/Rpe65-Norrin, NdpKO,
and NdpKO/Rpe65-Norrin mice. Arrowhead: PLVAP sig-
nal in the choriocapillaris. Arrow: PLVAP signal in intra-
and intraretinal capillaries (arrow). CAV1 is a
marker for vesicle trafficking, and thereby its
expression in vascular endothelial cells indi-
cates transcytosis. In wildtype and Ndpy/+/
Rpe65-Norrin mice, CAV1 showed a moderate
immunohistochemical signal in the retina that
was mostly located in endothelial cells. In con-
trast, in NdpKO mice the signal for CAV1 in
endothelial cells of the superficial plexus was
245
retinal capillaries. GCL ganglion cell layer, INL inner
nuclear layer, ONL outer nuclear layer, CC choriocapil-
laris; nuclei were counterstained with Dapi. n = 3
highly enriched (Fig. 4, arrow). Interestingly, in
NdpKO/Rpe65-Norrin mice the intensity of the
CAV1 signal was slightly reduced when com-
pared to NdpKO mice (Fig. 4, arrowhead).
Finally, we analyzed the tight-junction protein
CLN5 (Fig. 5). In the two control groups, wild-
type and Ndpy/+/Rpe65-Norrin mice CLN5 was
located predominantly in endothelial cells
(Fig. 5, arrow). CLN5 intensity was dramati-
246
Fig. 4 Immunohistochemistry of caveolin1 (magenta) in
the retina of 6-week-old wildtype, Ndpy/+/Rpe65-Norrin,
NdpKO, and NdpKO/Rpe65-Norrin mice. Arrow: intense
signal of CAV1 in capillaries of the superficial plexus of
cally reduced in NdpKO mice, which additionally
showed the features of an impaired BRB.
Remarkably, in the NdpKO/Rpe65-Norrin ani-
mals a slight fluorescence signal of CLN5 in
endothelial cells of the superficial plexus was
detectable (Fig. 5). All in all, the activation of
the Wnt/β-­catenin signaling by the RPE-derived
Norrin lead to a slight, but not sufficient
improvement of the BRB, at least for CLN5 and
CAV1.
A. E. Dillinger and E. R. Tamm
the NdpKO mice. Arrowhead: moderate CAV1 signal in
NdpKO/Rpe65-Norrin mice. GCL ganglion cell layer, INL
inner nuclear layer, ONL outer nuclear layer, CC chorio-
capillaris; nuclei were counterstained with Dapi. n = 3
4 Discussion
The results of this study show that ectopic, RPE-­
derived transgenic norrin is not sufficient to pro-
mote the formation of retinal capillaries in
norrin-deficient mice. Possible explanations are
that (1) norrin was not secreted in high-enough
amounts, (2) did not reach the newly formed ves-
sels of the inner retina, or (3) was not available at
a time when the vessels are competent to react to
Retinal Pigmented Epithelium-Derived Ectopic Norrin Does Not Promote Intraretinal Angiogenesis…
Fig. 5 Immunohistochemistry of claudin5 (magenta) in
the retina of 6-week-old wildtype, Ndpy/+/Rpe65-Norrin,
NdpKO, and NdpKO/Rpe65-Norrin mice. Arrow: localiza-
tion of CLN5 in retinal endothelial cells. Asterisk: absence
norrin. We regard explanation (2) as unlikely,
since ectopic norrin broadly induced β-catenin in
cells of the inner retina in norrin-deficient ani-
mals, an observation that indicates the presence
of transgenic norrin. We also rule out explanation
(3) as we observed high expression of Rpe65 at a
time when intraretinal capillaries are formed. Our
findings in the mouse eye correlate with those
observed in rat eyes in which mRNA expression
of Rpe65 was first detected at embryonic day 18,
247
of CLN5 in retinal endothelial cells. GCL ganglion cell
layer, INL inner nuclear layer, ONL outer nuclear layer,
CC choriocapillaris; Nuclei were counterstained with
Dapi. n = 3
followed by an increase from P1-P15 and a sta-
bile expression in adulthood [7]. We therefore
conclude that transgenic norrin was not present in
high enough amounts in the inner retina (expla-
nation 1). This finding is surprising as we
observed in a previous study that Rpe65-Norrin
mice have substantially higher amounts of reti-
nal norrin than their wildtype littermates.
Furthermore, transgenic norrin in these
animals promotes vascular repair following
248
­oxygen-­induced retinopathy [9] and protects
photoreceptors against light-induced damage [2]. 6.
Apparently very high amounts of ectopic norrin
are required in the inner retina to augment capil-
larization [8]. This observation should be taken
into account in scenarios in which recombinant
Norrin is planned to be used as a therapeutic 7.
agent to treat retinal vascular abnormalities.
Acknowledgments We thank Eva Wirkert for expert
technical assistance.
8.
References
1. Boulanger A, Liu S, Henningsgaard AA, Yu S,
9.
Redmond TM. The upstream region of the Rpe65
gene confers retinal pigment epithelium-specific
expression in vivo and in vitro and contains criti-
cal octamer and E-box binding sites. J Biol Chem.
10.
2000;275:31274–82.
2. Braunger BM, Ohlmann A, Koch M, Tanimoto N,
Volz C, Yang Y, Bösl MR, Cvekl A, Jägle H, Seeliger
MW, Tamm ER. Constitutive overexpression of
11.
Norrin activates Wnt/β-catenin and endothelin-2 sig-
naling to protect photoreceptors from light damage.
Neurobiol Dis. 2013;50:1–12.
3. Connolly SE, Hores TA, Smith L, D’Amore
12.
PA. Characterization of vascular development in the
mouse retina. Microvasc Res. 1988;36:275–90.
4. Díaz-Coránguez M, Ramos C, Antonetti DA. The
inner blood-retinal barrier: cellular basis and develop-
ment. Vis Res. 2017;139:123–37.
13.
5. Junge HJ, Yang S, Burton JB, Paes K, Shu X, French
DM, Costa M, Rice DS, Ye W. TSPAN12 regulates
retinal vascular development by promoting Norrin-
A. E. Dillinger and E. R. Tamm
but not Wnt-induced FZD4/beta-catenin signaling.
Cell. 2009;139:299–311.
Luhmann UFO, Lin J, Acar N, Lammel S, Feil
S, Grimm C, Seeliger MW, Hammes H-P, Berger
W. Role of the Norrie disease pseudoglioma gene
in sprouting angiogenesis during development of
the retinal vasculature. Invest Ophthalmol Vis Sci.
2005;46:3372–82.
Manès G, Leducq R, Kucharczak J, Pagès A, Schmitt-­
Bernard CF, Hamel CP. Rat messenger RNA for the
retinal pigment epithelium-specific protein RPE65
gradually accumulates in two weeks from late embry-
onic days 1. FEBS Lett. 1998;423:133–7.
Ohlmann A, Scholz M, Goldwich A, Chauhan BK,
Hudl K, Ohlmann AV, Zrenner E, Berger W, Cvekl
A, Seeliger MW, Tamm ER. Ectopic norrin induces
growth of ocular capillaries and restores normal reti-
nal angiogenesis in Norrie disease mutant mice. J
Neurosci. 2005;25:1701–10.
Ohlmann A, Seitz R, Braunger B, Seitz D, Bösl MR,
Tamm ER. Norrin promotes vascular regrowth after
oxygen-induced retinal vessel loss and suppresses
retinopathy in mice. J Neurosci. 2010;30:183–93.
Richter M, Gottanka J, May CA, Welge-Lüssen U,
Berger W, Lütjen-Drecoll E. Retinal vasculature
changes in Norrie disease mice. Invest Ophthalmol
Vis Sci. 1998;39(12):2450–7.
Xu Q, Wang Y, Dabdoub A, Smallwood PM, Williams
J, Woods C, Kelley MW, Jiang L, Tasman W, Zhang
K, Nathans J. Vascular development in the retina and
inner ear. Cell. 2004;116:883–95.
Ye X, Wang Y, Cahill H, Yu M, Badea TC, Smallwood
PM, Peachey NS, Nathans J. Norrin, frizzled-4,
and Lrp5 signaling in endothelial cells controls a
genetic program for retinal vascularization. Cell.
2009;139:285–98.
Ye X, Smallwood P, Nathans J. Expression of the
Norrie disease gene (Ndp) in developing and adult
mouse eye, ear, and brain. Gene Expr Patterns.
2011;11:151–5.
 Caveolin-1 in Müller Glia Exists
as Heat-Resistant, High Molecular
Weight Complexes

Eric N. Enyong, Jami Gurley, Virginie Sjoelung,

and Michael H. Elliott

Abstract revealed an interactome network of intermedi-

Caveolin-1 (Cav1), the core structural and
scaffolding protein of caveolae membrane
domains, is highly expressed in many retinal
cells and is associated with ocular diseases.
Cav1 regulates innate immune responses and
is implicated in neuroinflammatory and neu-
roprotective signaling in the retina. We have
shown that Cav1 expression in Müller glia
accounts for over 70% of all retinal Cav1
expression. However, the proteins interacting
with Cav1 in Müller glia are not established.
Here, we show that immortalized MIO-M1
Müller glia, like endogenous Müller glia,
highly express Cav1. Surprisingly, we found
that Cav1 in MIO-M1 cells exists as heat-­
resistant, high molecular weight complexes
that are stable after immunoprecipitation (IP).
Mass spectrometric analysis of high molecu-
lar weight Cav1 complexes after Cav1 IP
E. N. Enyong · J. Gurley · M. H. Elliott (*)
Department of Physiology, Dean A. McGee Eye
Institute, University of Oklahoma Health Sciences
Center, Oklahoma City, OK, USA
Department of Ophthalmology, Dean A. McGee Eye
Institute, University of Oklahoma Health Sciences
Center, Oklahoma City, OK, USA
e-mail: Michael-Elliott@ouhsc.edu
V. Sjoelung
Department of Cell Biology, University of Oklahoma
Health Sciences Center, Oklahoma City, OK, USA
ate filament, desmosomes, and actin-, and
microtubule-based cytoskeleton. These results
suggest Cav1 domains in Müller glia act as a
scaffolding nexus for the cytoskeleton.
Keywords
Caveolin-1 · Caveolae · Müller glia ·
Immunoprecipitation · Mass spectrometry ·
Cav1 complexes · Cavin1/PTRF
1 Introduction
Caveolin-1 (Cav1), the signature structural pro-
tein of caveolae is known to play a role in cell
signaling, lipid metabolism, endocytosis, and
mechanotransduction [3, 24, 25]. Cav1 has been
associated with ocular neuroinflammation, age-­
related macular degeneration, diabetic retinopa-
thy, blood-retinal barrier function, and primary
open-angle glaucoma [7, 9–11, 30]. It is expressed
in a variety of cell types including retinal pig-
ment epithelium (RPE) and choroidal and retinal
vascular endothelium [8, 11]. Furthermore, Cav1
is highly expressed in Müller glia [11, 21, 26],
and its expression correlates with Müller glia dif-
ferentiation [8, 23]. We have shown that neuro-
retinal Cav1 expression overwhelmingly accounts
for the majority of Cav1 expression in the retina,
with most Cav1 being localized to Müller glia

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 249
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_36
250
[11]. While Cav1 is highly expressed in Müller
glia, its function in these cells is only beginning
to be appreciated. Cav1 regulates cytokine secre-
tion and immune cell influx into the retina, as
global Cav1 knockout (KO) simultaneously sup-
presses cytokine secretion and increases immune
cell influx into the retina [19]. Neuroretinal dele-
tion of Cav1 suppresses both proinflammatory
cytokine secretion and immune cell infiltration
into the retina [11], further confirming a role for
Müller glial Cav1 in innate immune responses.
Cav1 is significantly upregulated in Müller glia
in autoimmune uveitis [12]. The role of Cav1 as
an immune modulator is likely cell-context
dependent as it can either promote or suppress
the inflammatory response depending on the cell
type examined [19, 31, 32]. Müller glia express
toll-like receptors (TLRs), whose activities can
be enhanced or suppressed by interaction with
Cav1 [22, 31]. Further, we and others have shown
Cav1 to be an important regulator of blood-­retinal
barrier (BRB) function [2, 18, 19, 33].
While Müller glia abundantly express Cav1, it
is unclear what proteins interact with Cav1 in
these cells. The aim of this study was to identify
the Cav1 interactome in MIO-M1 Müller glia by
immunoprecipitating Cav1 and analyzing
immune complexes by mass spectrometry. We
show that Cav1 in MIO-M1 Müller glia exists as
high molecular weight aggregates, which are
resistant to heating in reducing SDS-PAGE buf-
fer. Mass spectrometric analysis of Cav1 com-
plexes revealed a network of cytoskeletal proteins
that interact with Cav1.
2 Materials and Methods
2.1 Cell Lines and Culture
Conditions
Immortalized MIO-M1 Müller glia were cultured
in DMEM (1X) + GlutaMax™-I (ThermoFisher
Scientific) supplemented with 10% fetal bovine
serum (FBS), and 1% penicillin-streptomycin.
Prostate cancer cells (PC3s) were cultured in
F-12K medium (ATCC Cat#: 30-2004). Retinal
E. N. Enyong et al.
microvascular endothelial cells (RMECs) were
cultured in Endothelial Cell Basal Medium-2
(Lonza Cat#: CC-3156), supplemented with 2%
FBS, human fibroblast growth factor, vascular
endothelial growth factor, insulin-like growth
factor-1, ascorbic acid, gentamicin-amphotericin
B hydroxycortisone, and human endothelial
growth factor. Cells were maintained in a humidi-
fied atmosphere of 5% CO2, at 37 °C.
2.2 Western Blotting
Cells were lysed in buffer containing 120 mM
octylglucoside, 150 mM NaCl, 10 mM Tris–HCl
pH 7.4, 0.5 mM EDTA, 0.1% Triton X-100 and
protease inhibitor cocktail. Lysates were cleared
by centrifugation and protein concentration was
determined using a BCA reagent (ThermoFisher
Scientific). Equal amounts of proteins were sepa-
rated by reducing SDS-PAGE and were trans-
ferred to nitrocellulose membranes. Membranes
were blocked for 1 h in 5% BSA and were probed
with primary antibodies of choice: rabbit anti-­
Cav1 (Cell Signaling Technology, cat. #3267,
1:1000), rabbit anti-PTRF (Abcam, 1:1000) and
mouse anti-β-actin (Abcam, 1:5000). Primary
antibodies were detected using Horseradish per-
oxidase (HRP)-conjugated secondary antibodies.
To visualize protein bands after SDS-PAGE elec-
trophoresis, gels were stained for 1 h with
SimplyBlue™ Safestain (Thermofisher
Scientific). Western blot images were captured
using the In Vivo F-Pro imaging system.
2.3 Immunoprecipitation
Immunoprecipitation was performed using the
Dynabeads™ Protein G Immunoprecipitation Kit
(ThermoFisher Scientific) according to the man-
ufacturer’s instructions. Briefly, Cav1 primary
antibody (Cell Signaling Technology, cat. #3267)
was conjugated to magnetic beads for 20 min at
room temperature (RT). Then, the beads-­antibody
conjugate was incubated with equal amounts of
protein lysates for 20 min at RT. After several
Caveolin-1 in Müller Glia Exists as Heat-Resistant, High Molecular Weight Complexes 251

rounds of washing, beads were resuspended in
Laemmli buffer and the immunoprecipitates were
separated by reducing SDS-PAGE without heat-
ing. The gel was stained for 1 h using
SimplyBlue™ SafeStain and washed several
times with water. Visible Cav1 complexes were
excised and used for mass spectrometry analysis
(Fig. 1). A portion of the immune complexes was
boiled in Laemmli buffer, separated by reducing
SDS-PAGE, and transferred to nitrocellulose
membranes for Western blotting.
2.4 Mass Spectrometry
Cav1 immunoprecipitates were separated by
SDS-PAGE, gel-stained, and visible high molec-
ular weight Cav1 complexes excised for mass
spectrometry (Fig. 2d). Proteins were subjected
to the FASP (filter-aided sample preparation)
protocol [34] and digested overnight with
Sequencing Grade Modified Trypsin (Promega,
V5111) at 37 °C in 40 mM NH4HCO3. Peptides
were desalted, concentrated, and loaded onto
C18 sequencing columns (AcclaimTM PepMapTM
100 C18, ThermoFisher). Peptide elution was
performed using a 90-min acetonitrile gradient
for label-free quantification. Eluted peptides
were analyzed by LC-MS/MS analysis using a
Thermo Lumos Fusion tribrid Orbitrap mass
spectrometer, coupled to an Ultimate 3000 RSLC
nano ultra-high-performance liquid chromatog-
raphy (UHPLC) system. Proteins were identified
by Proteome Discoverer 2.4, with SEQUEST as
the search engine. Protein identification required
the detection of at least two peptides per protein.
STRING open-source software was used to iden-
tify protein networks.

Gel staining and excision

Mass spectrometry
of Cav1 complexes
Protein
extraction Stained gel
80000
Cav1 70000
Complexes
60000
IgG
Protein 50000
40000
mixture 30000
20000
10000
0
1014 1016 1018 1020 1022 1024 1026
Mock

MIO-M1

SDS-PAGE
Cav1 IP electrophoresis
Western blotting
Cav1 blot Data analysis
Cav1
(STRING)
Complexes

IgG

Cav1
monomer
Mock

MIO-M1

Fig. 1 Schematic overview of Cav1 immunoprecipitation
and mass spectrometry workflow. Proteins were extracted
from untreated MIO-M1 Müller glia and were immuno-
precipitated using Cav1 primary antibodies. Cav1 immu-
noprecipitates were separated by reducing SDS-PAGE
without heating. Gels were stained for 1 h and visible
Cav1 complexes were excised and analyzed by mass spec-
trometry. A portion of the immunoprecipitate was trans-
ferred to nitrocellulose membranes to evaluate interactions
by Western blotting
252 E. N. Enyong et al.

3 Results mass spectrometry. Interestingly, the majority of

these proteins including β-actin (ACTB), myosin,
3.1 Cav1 in MIO-M1 Müller Glia vimentin (VIM), plectin (PLEC), and nestin
Exist as High Molecular (NES) have been shown to play a role in the cyto-
Weight Complexes skeleton and cell-cell junction structure [4].

To determine the protein composition of Cav1

complexes, we first evaluated the expression of 4 Discussion
Cav1 in authenticated MIO-Müller glia and com-
pared the expression to retinal microvascular In this study, we sought to identify the protein
endothelial cells (RMEC), which also abundantly composition of Cav1 complexes in MIO-M1
express Cav1 [29]. Our results show that MIO-­ cells. We show for the first time that Cav1 in
M1 cells, like endogenous Müller glia, abun- MIO-M1 cells exists as heat-resistant, high
dantly express Cav1 (Fig. 2). To our surprise, we molecular weight aggregates, which interact
observed that the majority of Cav1 in MIO-M1 with important cytoskeletal proteins. Cav1 is the
cells exist as high molecular weight complexes major protein component of caveolae [5, 6, 27],
(Fig. 2a) which are resistant to heating in reduc- flask-­
shaped plasma membrane invaginations
ing SDS-PAGE buffer (Fig. 2b). However, upon whose formation requires another protein called
heating at 98 °C for 10 min, Cav1 complexes dis- Cavin1 or PTRF (Polymerase I and Transcript
sociate and migrate as monomers on reducing Release Factor) [14, 20]. It is currently unclear
SDS-PAGE (Fig. 2c). High molecular weight why Cav1 exist in this aggregated form in MIO-
Cav1 complexes in MIO-M1 cells remain rela- M1 cells, as opposed to the monomeric form in
tively stable after Cav1 immunoprecipitation RMEC cells. However, we speculate that the
(Fig. 2d). On the contrary, Cav1 in RMECs absence of Cavin1/PTRF expression in MIO-
migrates predominantly as monomers on SDS-­ M1 cells may provide an explanation for this
PAGE gels without heating. While most Cav1 phenomenon. Cavin1/PTRF stabilizes Cav1 in
complexes in MIO-M1s remain stable after heat- multiple tissues, as Cavin1/PTRF deficiency
ing at 70 °C for 10 min, the small fraction of downregulates Cav1 protein expression [20].
aggregated Cav1 in RMECs dissociates to mono- However, Cav1 is stably expressed in prostate
mers after heating at 70 °C. These data suggest cancer (PC3) cells without Cavin1/PTRF [1, 14,
that different proteins may be interacting with and15] in functional domains described as “Cav1
stabilizing Cav1 complexes in MIO-M1 cells. scaffolds” [16, 17]. Further, multiple studies
have shown that approximately 150 Cav1 mol-
ecules are required per caveola formed [25].
3.2 Proteins Associated with Cav1 However, during caveolae biogenesis, Cav1
Complexes Are Involved form oligomers of 12–16 Cav1 molecules,
with the Cell Cytoskeleton which associate with lipid rafts in the Golgi and
adopt detergent-resistant properties [13, 28],
Next, we were interested in identifying the pro- similar to Cav1 on the plasma membrane. Thus,
teins that interact with Cav1 complexes in MIO-­ it is intriguing to speculate that in the absence of
M1 cells. To identify the protein composition of Cavin1/PTRF in MIO-M1 Müller glial cells,
Cav1 complexes, we immunoprecipitated Cav1 these Cav1 high molecular weight oligomers
from MIO-M1 cells and analyzed the high molec- represent non-caveolar Cav1 scaffolds previ-
ular weight complexes by mass spectrometry. We ously described [16, 17]. Therefore, the expres-
analyzed the same complexes from three repli- sion of Cavin1/PTRF in MIO-M1 cells likely
cate samples (Fig. 2d). Thirty-three proteins were provides a mechanism to biochemically resolve
found to associate with Cav1 complexes after Cav1 scaffolds (Fig. 3).
Caveolin-1 in Müller Glia Exists as Heat-Resistant, High Molecular Weight Complexes 253

A B C

D Stained Gel Cav1 blot

Mock Mock
IP 1 2 3 IP 1 2 3

B1
B2 Cav1
190 B3 complexes
120
85 IgG
60
50
40

25 Cav1
monomer
20
15

10

Fig. 2 Cav1 in MIO-M1 cells exists in heat-resistant,
high molecular weight complexes. (a) Representative
Western blots showing expression of Cav1 in MIO-M1
and RMEC cells. MIO-M1 cells, like endogenous Müller
glia, abundantly expresses Cav1. Interestingly, Cav1 in
these cells exists in high molecular weight complexes. (b)
Cav1 complexes are resistant to heating at 70 °C for
10 min in reducing SDS-PAGE. On the contrary, Cav1 in
RMEC cells was mostly monomeric both at RT and after
heating at 70 °C for 10 min. (c) Representative Western
blots showing that Cav1 migrates as a monomer in reduc-
ing SDS-PAGE buffer only after rigorous heating at 98 °C
for 10 min. (d) Stained gel and representative Western blot
showing stable Cav1 complexes after Cav1 immunopre-
cipitation. Bands from the stained gel (B1, B2, and B3
indicated by arrows) were excised and analyzed by mass
spectrometry
254
Fig. 3 Proteins that interact with Cav1 complexes are
associated with the cell cytoskeleton. Cav1 protein-­
protein interaction by STRING analysis. Cav1 complexes
were analyzed by mass spectrometry and STRING open-­
source database was used to identify protein-protein inter-
Acknowledgments This work was supported by NIH
Grants R01EY019494 (MHE) and NEI Core Grant
P30EY021725, by Presbyterian Health Foundation
Research Scholar Award to Eric Enyong, and by an unre-
stricted grant to the OUHSC Department of
Ophthalmology from Research to Prevent Blindness, Inc.
E. N. Enyong et al.
actions. A total of 33 proteins were found to interact with
Cav1 complexes, most of which play a role in the cell
cytoskeletal architecture and include β-actin (ACTB),
myosin (MYO5A), vimentin (VIM) plectin (PLEC), and
nectin (NEC)
Virginie Sjoelund was supported in part by the National
Institute of General Medical Sciences of the National
Institutes of Health under award number P20GM103447.
We thank the Laboratory for Molecular Biology and
Cytometry Research at OUHSC for the use of the Core
Facility, which provided the proteomics services.
Caveolin-1 in Müller Glia Exists as Heat-Resistant, High Molecular Weight Complexes 255

References cholesterol dynamics and the actin cytoskeleton

impacting secretion pathways. Mol Cell Proteom.
2012;11:M111012245.
1. Aung CS, Hill MM, Bastiani M, Parton RG, Parat
16. Khater IM, Aroca-Ouellette ST, Meng F, Nabi IR,
MO. PTRF-cavin-1 expression decreases the migra-
Hamarneh G. Caveolae and scaffold detection from
tion of PC3 prostate cancer cells: role of matrix metal-
single molecule localization microscopy data using
loprotease 9. Eur J Cell Biol. 2011;90:136–42.
deep learning. PLoS One. 2019a;14:e0211659.
2. Chow BW, Gu C. Gradual suppression of transcyto-
17. Khater IM, Liu Q, Chou KC, Hamarneh G, Nabi
sis governs functional blood-retinal barrier formation.
IR. Super-resolution modularity analysis shows poly-
Neuron. 2017;93:1325–1333 e1323.
hedral caveolin-1 oligomers combine to form scaf-
3. Cohen AW, Hnasko R, Schubert W, Lisanti MP. Role
folds and caveolae. Sci Rep. 2019b;9:9888.
of caveolae and caveolins in health and disease.
18. Klaassen I, Hughes JM, Vogels IM, Schalkwijk CG,
Physiol Rev. 2004;84:1341–79.
Van Noorden CJ, Schlingemann RO. Altered expres-
4. Fletcher DA, Mullins RD. Cell mechanics and the
sion of genes related to blood-retina barrier disrup-
cytoskeleton. Nature. 2010;463:485–92.
tion in streptozotocin-induced diabetes. Exp Eye Res.
5. Glenney JR Jr. Tyrosine phosphorylation of a 22-kDa
2009;89:4–15.
protein is correlated with transformation by Rous sar-
19. Li X, Gu X, Boyce TM, Zheng M, Reagan AM, Qi
coma virus. J Biol Chem. 1989;264:20163–6.
H, Mandal N, Cohen AW, Callegan MC, Carr DJ,
6. Glenney JR Jr, Soppet D. Sequence and expression
Elliott MH. Caveolin-1 increases proinflammatory
of caveolin, a protein component of caveolae plasma
chemoattractants and blood-retinal barrier breakdown
membrane domains phosphorylated on tyrosine in
but decreases leukocyte recruitment in inflammation.
Rous sarcoma virus-transformed fibroblasts. Proc
Invest Ophthalmol Vis Sci. 2014;55:6224–34.
Natl Acad Sci U S A. 1992;89:10517–21.
20. Liu L, Brown D, McKee M, Lebrasseur NK, Yang D,
7. Gu X, Fliesler SJ, Zhao YY, Stallcup WB, Cohen AW,
Albrecht KH, Ravid K, Pilch PF. Deletion of Cavin/
Elliott MH. Loss of caveolin-1 causes blood-retinal
PTRF causes global loss of caveolae, dyslipidemia,
barrier breakdown, venous enlargement, and mural
and glucose intolerance. Cell Metab. 2008;8:310–7.
cell alteration. Am J Pathol. 2014a;184:541–55.
21. Macosko EZ, Basu A, Satija R, Nemesh J, Shekhar
8. Gu X, Reagan A, Yen A, Bhatti F, Cohen AW, Elliott
K, Goldman M, Tirosh I, Bialas AR, Kamitaki N,
MH. Spatial and temporal localization of caveolin-1
Martersteck EM, Trombetta JJ, Weitz DA, Sanes JR,
protein in the developing retina. Adv Exp Med Biol.
Shalek AK, Regev A, McCarroll SA. Highly parallel
2014b;801:15–21.
genome-wide expression profiling of individual cells
9. Gu X, Reagan AM, McClellan ME, Elliott
using nanoliter droplets. Cell. 2015;161:1202–14.
MH. Caveolins and caveolae in ocular physiol-
22. Mirza MK, Yuan J, Gao XP, Garrean S, Brovkovych
ogy and pathophysiology. Prog Retin Eye Res.
V, Malik AB, Tiruppathi C, Zhao YY. Caveolin-1 defi-
2017;56:84–106.
ciency dampens Toll-like receptor 4 signaling through
10. Gurley JM, Elliott MH. The role of caveolin-
eNOS activation. Am J Pathol. 2010;176:2344–51.
1 in retinal inflammation. Adv Exp Med Biol.
­
23. Nelson BR, Ueki Y, Reardon S, Karl MO, Georgi S,
2019;1185:169–73.
Hartman BH, Lamba DA, Reh TA. Genome-wide
11. Gurley JM, Gmyrek GB, McClellan ME, Hargis
analysis of Muller glial differentiation reveals a
EA, Hauck SM, Dozmorov MG, Wren JD, Carr DJJ,
requirement for Notch signaling in postmitotic cells
Elliott MH. Neuroretinal-derived caveolin-1 promotes
to maintain the glial fate. PLoS One. 2011;6:e22817.
endotoxin-induced inflammation in the murine retina.
24. Parton RG. Caveolae: structure, function, and
Invest Ophthalmol Vis Sci. 2020;61:19.
relationship to disease. Annu Rev Cell Dev Biol.
12. Hauck SM, Dietter J, Kramer RL, Hofmaier F,
2018;34:111–36.
Zipplies JK, Amann B, Feuchtinger A, Deeg CA,
25. Parton RG, del Pozo MA. Caveolae as plasma mem-
Ueffing M. Deciphering membrane-associated molec-
brane sensors, protectors and organizers. Nat Rev Mol
ular processes in target tissue of autoimmune uveitis
Cell Biol. 2013;14:98–112.
by label-free quantitative mass spectrometry. Mol
26. Roesch K, Jadhav AP, Trimarchi JM, Stadler
Cell Proteom. 2010;9:2292–305.
MB, Roska B, Sun BB, Cepko CL. The transcrip-
13. Hayer A, Stoeber M, Bissig C, Helenius A. Biogenesis
tome of retinal Muller glial cells. J Comp Neurol.
of caveolae: stepwise assembly of large caveolin and
2008;509:225–38.
cavin complexes. Traffic. 2010;11:361–82.
27. Rothberg KG, Heuser JE, Donzell WC, Ying YS,
14. Hill MM, Bastiani M, Luetterforst R, Kirkham M,
Glenney JR, Anderson RG. Caveolin, a protein
Kirkham A, Nixon SJ, Walser P, Abankwa D, Oorschot
component of caveolae membrane coats. Cell.
VM, Martin S, Hancock JF, Parton RG. PTRF-Cavin,
1992;68:673–82.
a conserved cytoplasmic protein required for caveola
28. Sargiacomo M, Scherer PE, Tang Z, Kubler E, Song
formation and function. Cell. 2008;132:113–24.
KS, Sanders MC, Lisanti MP. Oligomeric structure of
15. Inder KL, Zheng YZ, Davis MJ, Moon H, Loo D,
caveolin: implications for caveolae membrane organi-
Nguyen H, Clements JA, Parton RG, Foster LJ, Hill
zation. Proc Natl Acad Sci U S A. 1995;92:9407–11.
MM. Expression of PTRF in PC-3 Cells modulates
256
29. Stitt AW, Burke GA, Chen F, McMullen CB, Vlassara
H. Advanced glycation end-product receptor interac-
tions on microvascular cells occur within caveolin-­
rich membrane domains. FASEB J. 2000;14:2390–2.
30. Thorleifsson G, Walters GB, Hewitt AW, Masson G,
Helgason A, DeWan A, Sigurdsson A, Jonasdottir
A, Gudjonsson SA, Magnusson KP, Stefansson H,
Lam DS, Tam PO, Gudmundsdottir GJ, Southgate
L, Burdon KP, Gottfredsdottir MS, Aldred MA,
Mitchell P, St Clair D, Collier DA, Tang N, Sveinsson
O, Macgregor S, Martin NG, Cree AJ, Gibson J,
Macleod A, Jacob A, Ennis S, Young TL, Chan JC,
Karwatowski WS, Hammond CJ, Thordarson K,
Zhang M, Wadelius C, Lotery AJ, Trembath RC, Pang
CP, Hoh J, Craig JE, Kong A, Mackey DA, Jonasson
F, Thorsteinsdottir U, Stefansson K. Common variants
near CAV1 and CAV2 are associated with primary
open-angle glaucoma. Nat Genet. 2010;42:906–9.
E. N. Enyong et al.
31. Wang XM, Kim HP, Nakahira K, Ryter SW, Choi
AM. The heme oxygenase-1/carbon monoxide
pathway suppresses TLR4 signaling by regulating
­
the interaction of TLR4 with caveolin-1. J Immunol.
2009;182:3809–18.
32. Wang XM, Kim HP, Song R, Choi AM. Caveolin-1
confers antiinflammatory effects in murine macro-
phages via the MKK3/p38 MAPK pathway. Am J
Respir Cell Mol Biol. 2006;34:434–42.
33. Wang Z, Liu CH, Huang S, Fu Z, Tomita Y, Britton
WR, Cho SS, Chen CT, Sun Y, Ma JX, He X, Chen
J. Wnt signaling activates MFSD2A to suppress vas-
cular endothelial transcytosis and maintain blood-­
retinal barrier. Sci Adv. 2020;6:eaba7457.
34. Wisniewski JR. Filter-aided sample prepara-
tion for proteome analysis. Methods Mol Biol.
2018;1841:3–10.
 Role of VLC-PUFAs in Retinal
and Macular Degeneration

Aruna Gorusupudi, Uzoamaka Nwagbo,

and Paul S. Bernstein

Abstract 1 Introduction

Very-long-chain polyunsaturated fatty acids Very-long-chain polyunsaturated fatty acids

(VLC-PUFAs) are a special class of fatty acids
that are present in the retina and a few other
human tissues. They cannot be synthesized de
novo and are rarely present in dietary sources.
Structurally, these lipids are composed of a
proximal end with a typical saturated fatty
acid character and a distal end more character-
istic of common PUFAs. They have not been
studied in detail until recently due to their low
abundance in these tissues and technical diffi-
culties in assaying these lipids by conven-
tional chromatography. This unique class of
lipids has chain lengths greater than 24 car-
bons, with the longest typically 38 carbons
long. There is increasing interest in under-
standing their roles in the maintenance of reti-
nal membrane integrity and the prevention of
macular degeneration and inherited retinal
diseases.
Keywords
VLC-PUFAs · STGD3 · AMD · ELOVL4 ·
32:6 n-3
A. Gorusupudi · U. Nwagbo · P. S. Bernstein (*)
Department of Ophthalmology and Visual Sciences,
John A. Moran Eye Center, University of Utah
School of Medicine, Salt Lake City, UT, USA
e-mail: paul.bernstein@hsc.utah.edu
(VLC-PUFAs) are a special class of fatty acids
present in mammalian retina and a few other tis-
sues. The rod outer segments (ROS) of the retina
contain a stack of closed membranous compart-
ments known as disks encased by plasma mem-
brane connected to the inner segment by a
modified cilium [19]. ROS membranes are
enriched in phospholipids with DHA and VLC-­
PUFAs at the sn-2 and sn-1 positions, respec-
tively [2]. Lipids in disk membranes of ROS not
only serve as structural support for rhodopsin [3]
and for maintenance of ROS disk morphology,
but they also play a critical role in maintaining
the activity of other receptor proteins [12, 14].
In 1987, Aveldano described the presence of
unusually long polyenoic fatty acids in mamma-
lian retina [4]. Later studies revealed the structure
and number of double bonds and the n-3 and n-6
variations of these VLC-PUFAs in retina [4]. The
synthetic pathway of VLC-PUFAs was first
investigated by Rotstein and Aveldano in 1987
using C14-acetate [21, 22]. After incubation of
bovine retinal tissue with labeled 20:4 n-6 (AA),
22:5 n-3 (DPA) and 22:6 n-3 (DHA), the authors
observed efficient uptake and esterification into
phospholipids. They also found that radiolabel-
ing predominated in VLC-PUFAs in microsomal
fractions of photoreceptor membranes, and they
observed that the selective absorption was

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 257
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_37
258
Fig. 1 Biosynthetic
pathway of VLC-PUFAs
22:5 > 22:6 > 20:4. In vivo retinal injections of
labeled LC-PUFAs in murine models also
revealed that EPA gets elongated to VLC-PUFAs,
whereas DHA does not [25]. After the discovery
of the ELOVL4 elongase enzyme, responsible for
the biosynthesis of VLC-PUFA in retina (Fig. 1),
transduction experiments in PC-12 cells con-
firmed that EPA and DPA can act as direct pre-
cursors for the biosynthesis of n-3 VLC-PUFAs,
while DHA cannot [1].
2 ELOVL4 and STGD3
Three independent mutations of the ELOVL4
gene are associated with dominant Stargardt-3
macular dystrophy (STGD3) in humans [6, 16,
30]. All three mutations lead to premature termi-
nation of the protein and removal of the signal
sequence for post-translational modification in
the endoplasmic reticulum. As a result, the
A. Gorusupudi et al.
mutant protein mislocalizes, or it co-aggregates
with wild-type protein and then mislocalizes,
thereby leading to disruption of VLC-PUFA bio-
synthesis [13, 28]. Mice with homozygous
knockout of Elovl4 [27] or knock-in of human
ELOVL4 mutations [17] exhibit neonatal lethal-
ity due to disruption of the skin permeability bar-
rier, while heterozygous mutations in mice show
lipofuscin accumulation in the retina [5, 20], loss
of VLC-PUFAs [5], and RPE atrophy similar to
human STGD3 and AMD [13], but at a slow
pace. STGD3 disease in humans is characterized
by progressive loss of central vision starting dur-
ing adolescence accompanied by foveal atrophy
and butterfly pattern fleck-like deposits at the
level of the retinal pigment epithelium. The
severity of human STGD3 disease is inversely
correlated with the dietary intake of VLC-PUFA
precursors [11], and since there are no reasonable
dietary sources of VLC-PUFAs, we recommend
the intake of fish oil VLC-PUFA precursors
Role of VLC-PUFAs in Retinal and Macular Degeneration
from diet or supplements for this patient
­population [7].
3 ELOVL4 and AMD
Age-related macular degeneration (AMD) is the
leading cause of vision loss among the elderly.
Epidemiological studies have shown an inverse
correlation of n-3 PUFA dietary intake from fish
oil or fish consumption with AMD disease pro-
gression [18, 23, 24], and previous studies from
our laboratory have reported significantly lower
DHA and VLC-PUFA levels in AMD eyes in
comparison to age-matched controls [15]. In
another study, although we did not observe a sig-
nificant change in ELOVL4 expression among
the subjects, we found a significant decrease in
serum EPA/AA and retinal n3/n6 LC-PUFA and
VLC-PUFA ratios in AMD donor punches in
comparison to age-matched controls [8]. We also
showed that retinal VLC-PUFA and n-3/n-6
ratios were correlated with systemic biomarkers
of dietary intake of VLC-PUFA precursors. This
suggests that AMD could be due in part to age-­
related ELOVL4 dysfunction and/or inadequate
intake of VLC-PUFA precursors and that inter-
ventions to increase retinal VLC-PUFA levels
might be protective against AMD [8]. Therefore,
we have hypothesized that if STGD3 or AMD
patients were to consume an adequate supply of
VLC-PUFAs that could be directly used in the
retina, it may be possible to bypass the steps of
elongation mediated by ELOVL4 and delay or
prevent degeneration; however, until recently,
there have been no adequate natural or commer-
cial sources of high purity natural or synthetic
VLC-PUFAs for laboratory or clinical studies to
test their value for treating or preventing eye
disease.
4 Synthesis of VLC-PUFAs
In collaboration with members of the Department
of Chemistry at the University of Utah, we have
synthesized a >98% pure VLC-PUFA (32:6 n-3)
at nearly a one-gram scale, a sufficient quantity
259
to perform mouse feeding studies [29]. We chose
this particular VLC-PUFA because it is present in
both mouse and human retinas, and it could still
be elongated further by endogenous ELOVL4. In
our studies, we observed rapid and selective reti-
nal bioavailability of our synthetic VLC-PUFA in
mice, and we documented improvement in visual
acuity and photopic and scotopic ERG measure-
ments in both wild-type and Elovl4 conditional
knockout mice [9]. Although mouse models of
human retinal diseases like STGD3 and AMD are
available, mice do not have maculas, and Elovl4
conditional knockouts do not show as severe a
retinal degeneration as humans with STGD3.
Additionally, standard laboratory mouse diets are
surprisingly healthy with regard to n-3 LC-PUFA
levels and n-3/n-6 ratios relative to typical human
diets [10], so creating substantial deficiencies of
VLC-PUFAs in mouse retinas can be quite chal-
lenging. Therefore, our laboratory continues to
seek out alternatives to current mouse models of
Elovl4 dysfunction and VLC-PUFA deficiency.
5 Future Directions
In the past decade, there have been great advances
in cell culture models of retinal degeneration
using patient-derived induced pluripotent stem
cells (iPSCs) and retinal organoids (“disease in a
dish”), and we think such techniques could have
value in ELOVL4 and VLC-PUFA research as
well. In collaboration with Drs. Martin
Friedlander and Kevin Eade at The Scripps
Research Institute, we have knocked out ELOVL4
in human retinal organoids, and we are currently
studying the developmental and metabolic effects
of complete VLC-PUFA deficiency and potential
rescue by supplementation with exogenous syn-
thetic VLC-PUFAs. We have also successfully
created a germline total knockout of the zebrafish
enzyme responsible for VLC-PUFA synthesis in
the retina to study physiological and morphologi-
cal effects of the complete absence of VLC-­
PUFAs in the living vertebrate eye. Zebrafish are
an attractive alternative to mice because they live
in an aqueous environment, and they are not
susceptible to integumentary drying seen in
­
260
t­errestrial animals with a total knockout of
ELOVL4. Finally, with our potential ability to
scale up our organic synthetic scheme to make a
wide variety of VLC-PUFAs in kilogram quanti-
ties, it is time to revisit AREDS2’s previous nega-
tive results for EPA and DHA supplementation
for AMD prevention [26]. It is possible that fish
oil supplementation with VLC-PUFA precursors
in AREDS2 was not sufficient to counteract age-­
related declines in ELOVL4 activity in the human
retina. Oral administration of pre-formed syn-
thetic VLC-PUFAs would bypass the need for
ELOVL4-mediated elongation and could directly
raise retinal VLC-PUFA levels just as we did in
mice, so VLC-PUFAs should be considered as a
component of a supplement formulation to be
tested in a future AREDS3 clinical trial.
Conflict of Interest AG, PSB, and the University
of Utah have filed for a patent on the synthesis of
VLC-PUFAs to treat eye disease.
Grant Support Foundation Fighting Blindness;
NIH EY-14800; Research to Prevent Blindness.
References
1. Agbaga M-P, Brush RS, Mandal MNA, Henry K,
Elliott MH, Anderson RE. Role of Stargardt-3 macu-
lar dystrophy protein (ELOVL4) in the biosynthesis
of very long chain fatty acids. Proc Natl Acad Sci.
2008;105(35):12843–8.
2. Agbaga MP, Mandal MN, Anderson RE. Retinal very
long-chain PUFAs: new insights from studies on
ELOVL4 protein. J Lipid Res. 2010;51(7):1624–42.
3. Aveldano MI. Phospholipid species containing long
and very long polyenoic fatty acids remain with rho-
dopsin after hexane extraction of photoreceptor mem-
branes. Biochemistry. 1988;27(4):1229–39.
4. Aveldano MI, Sprecher H. Very long chain (C24 to
C36) polyenoic fatty acids of the n-3 and n-6 series in
dipolyunsaturated phosphatidylcholines from bovine
retina. J Biol Chem. 1987;262(3):1180–6.
5. Barabas P, Liu A, Xing W, Chen CK, Tong Z,
Watt CB, Jones BW, Bernstein PS, Križaj D. Role
of ELOVL4 and very long-chain polyunsaturated
fatty acids in mouse models of Stargardt type 3
retinal degeneration. Proc Natl Acad Sci U S A.
2013;110(13):5181–6.
A. Gorusupudi et al.
6. Bernstein PS, Tammur J, Singh N, Hutchinson A,
Dixon M, Pappas CM, Zabriskie NA, Zhang K,
Petrukhin K, Leppert M, Allikmets R. Diverse macu-
lar dystrophy phenotype caused by a novel complex
mutation in the ELOVL4 gene. Invest Ophthalmol Vis
Sci. 2001;42(13):3331–6.
7. Choi R, Gorusupudi A, Bernstein PS. Long-term
follow-up of autosomal dominant Stargardt macular
dystrophy (STGD3) subjects enrolled in a fish oil
supplement interventional trial. Ophthalmic Genet.
2018;39(3):307–13.
8. Gorusupudi A, Liu A, Hageman GS, Bernstein
PS. Associations of human retinal very long-chain
polyunsaturated fatty acids with dietary lipid bio-
markers. J Lipid Res. 2016;57(3):499–508.
9. Gorusupudi A, Rallabandi R, Li B, Arunkumar R,
Blount JD, Rognon GT, Chang FY, Wade A, Lucas
S, Conboy JC, Rainier JD, Bernstein PS. Retinal bio-
availability and functional effects of a synthetic very-­
long-­chain polyunsaturated fatty acid in mice. Proc
Natl Acad Sci U S A. 2021;118(6):e2017739118.
10. Hasegawa Y, Chen S-Y, Sheng L, Jena PK, Kalanetra
KM, Mills DA, Wan Y-JY, Slupsky CM. Long-term
effects of western diet consumption in male and
female mice. Sci Rep. 2020;10(1):14686.
11. Hubbard AF, Askew EW, Singh N, Leppert M,
Bernstein PS. Association of adipose and red blood
cell lipids with severity of dominant Stargardt macu-
lar dystrophy (STGD3) secondary to an ELOVL4
mutation. Arch Ophthalmol. 2006;124(2):257–63.
12. Jastrzebska B, Tsybovsky Y, Palczewski
K. Complexes between photoactivated rhodopsin
and transducin: progress and questions. Biochem J.
2010;428(1):1–10.
13. Karan G, Lillo C, Yang Z, Cameron DJ, Locke KG,
Zhao Y, Thirumalaichary S, Li C, Birch DG, Vollmer-­
Snarr HR, Williams DS, Zhang K. Lipofuscin
accumulation, abnormal electrophysiology, and pho-
toreceptor degeneration in mutant ELOVL4 transgenic
mice: a model for macular degeneration. Proc Natl
Acad Sci U S A. 2005;102(11):4164–9.
14. Litman BJ, Niu S-L, Polozova A, Mitchell DC. The
role of docosahexaenoic acid containing phospholip-
ids in modulating G protein-coupled signaling path-
ways. J Mol Neurosci. 2001;16(2):237–42.
15. Liu A, Chang J, Lin Y, Shen Z, Bernstein PS. Long-­
chain and very long-chain polyunsaturated fatty acids
in ocular aging and age-related macular degeneration.
J Lipid Res. 2010;51(11):3217–29.
16. Maugeri A, Meire F, Hoyng CB, Vink C, Van
Regemorter N, Karan G, Yang Z, Cremers FP, Zhang
K. A novel mutation in the ELOVL4 gene causes
autosomal dominant Stargardt-like macular dystro-
phy. Invest Ophthalmol Vis Sci. 2004;45(12):4263–7.
17. McMahon A, Butovich IA, Mata NL, Klein M,
Ritter R 3rd, Richardson J, Birch DG, Edwards AO,
Kedzierski W. Retinal pathology and skin barrier
defect in mice carrying a Stargardt disease-3 mutation
in elongase of very long chain fatty acids-4. Mol Vis.
2007;13:258–72.
Role of VLC-PUFAs in Retinal and Macular Degeneration
18. Merle BM, Benlian P, Puche N, Bassols A, Delcourt
C, Souied EH, Nutritional AMDTSG. Circulating
omega-3 Fatty acids and neovascular age-related
macular degeneration. Invest Ophthalmol Vis Sci.
2014;55(3):2010–9.
19. Nechipurenko IV. The enigmatic role of lipids in cilia
signaling. Front Cell Dev Biol. 2020;8:777.
20. Raz-Prag D, Ayyagari R, Fariss RN, Mandal
MN, Vasireddy V, Majchrzak S, Webber AL,
Bush RA, Salem N Jr, Petrukhin K, Sieving
PA. Haploinsufficiency is not the key mechanism
of pathogenesis in a heterozygous Elovl4 knockout
mouse model of STGD3 disease. Invest Ophthalmol
Vis Sci. 2006;47(8):3603–11.
21. Rotstein NP, Aveldano MI. Labeling of lipids of retina
subcellular fractions by [1-14C]eicosatetraenoate
(20:4(n-6)) docosapentaenoate (22:5(n-3)) and doco-
sahexaenoate (22:6(n-3)). Biochim Biophys Acta.
1987a;921(2):221–34.
22. Rotstein NP, Aveldano MI. Labeling of phosphati-
dylcholines of retina subcellular fractions by [1-14C]
eicosatetraenoate (20:4(n-6)), docosapentaeno-
ate (22:5(n-3)) and docosahexaenoate (22:6(n-3)).
Biochim Biophys Acta. 1987b;921(2):235–44.
23. SanGiovanni JP, Chew EY. The role of omega-3 long-­
chain polyunsaturated fatty acids in health and disease
of the retina. Prog Retin Eye Res. 2005;24(1):87–138.
24. Souied E, Delcourt C, Querques G, Merle B, Smith
T, Benlian P, N. S. Group. NAT2 study: OMEGA-3
levels in red blood cells membranes correlates
the preventive effect. Invest Ophthalmol Vis Sci.
2013;54(15):3277–7.
261
25. Suh M, Clandinin MT. 20:5n-3 but not 22:6n-3 is a
preferred substrate for synthesis of n-3 very-long-
chain fatty acids (C24-C36) in retina. Curr Eye Res.
2005;30(11):959–68.
26. The Age-Related Eye Disease Study 2 Research,
G. Lutein + zeaxanthin and Omega-3 fatty acids for
age-related macular degeneration: the age-related eye
disease study 2 (AREDS2) randomized clinical trial.
JAMA. 2013;309(19):2005–15.
27. Vasireddy V, Uchida Y, Salem N Jr, Kim SY, Mandal
MNA, Reddy GB, Bodepudi R, Alderson NL, Brown
JC, Hama H, Dlugosz A, Elias PM, Holleran WM,
Ayyagari R. Loss of functional ELOVL4 depletes
very long-chain fatty acids (≥C28) and the unique
ω-O-acylceramides in skin leading to neonatal death.
Hum Mol Genet. 2007;16(5):471–82.
28. Vasireddy V, Jablonski MM, Khan NW, Wang XF,
Sahu P, Sparrow JR, Ayyagari R. Elovl4 5-bp dele-
tion knock-in mouse model for Stargardt-like macular
degeneration demonstrates accumulation of ELOVL4
and lipofuscin. Exp Eye Res. 2009;89(6):905–12.
29. Wade A, Rallabandi R, Lucas S, Oberg C, Gorusupudi
A, Bernstein PS, Rainier JD. The synthesis of the very
long chain polyunsaturated fatty acid (VLC-PUFA)
32:6 n-3. Org Biomol Chem. 2021;19(25):5563–6.
30. Zhang K, Kniazeva M, Han M, Li W, Yu Z, Yang
Z, Li Y, Metzker ML, Allikmets R, Zack DJ, Kakuk
LE, Lagali PS, Wong PW, MacDonald IM, Sieving
PA, Figueroa DJ, Austin CP, Gould RJ, Ayyagari R,
Petrukhin K. A 5-bp deletion in ELOVL4 is associ-
ated with two related forms of autosomal dominant
macular dystrophy. Nat Genet. 2001;27(1):89–93.
 Ocular Amyloid, Condensates,
and Aggregates – Higher-Order
Protein Assemblies Participate
in Both Retinal Degeneration
and Function

Michael H. Hayes, DaNae R. Woodard,

and John D. Hulleman

Abstract form higher-order assemblies under normal

The formation of higher-order protein assem-
blies (commonly called protein aggregates)
has long been associated with disease states,
particularly in neurodegenerative disorders.
Within the eye, protein aggregation has also
been implicated in various retinal degenera-
tive diseases ranging from retinitis pigmen-
tosa (RP) to Malattia Leventinese/Doyne
Honeycomb Retinal Dystrophy (ML/DHRD)
to age-related macular degeneration (AMD).
Yet, many essential cellular processes includ-
ing transcription, translation, and the forma-
tion of non-membrane bound organelles
require the formation of functional, non-­
pathologic protein aggregates to maintain cel-
lular homeostasis. Thus, functional protein
aggregates, also called condensates, likely
play essential roles in maintaining normal 1 Introduction
retina function. However, currently, there is a
critical gap in our knowledge: What proteins The coalescence of proteins, nucleic acids, and
M. H. Hayes · D. R. Woodard
Department of Ophthalmology, University of Texas
Southwestern Medical Center, Dallas, TX, USA
J. D. Hulleman (*)
Department of Ophthalmology, University of Texas
Southwestern Medical Center, Dallas, TX, USA
Department of Pharmacology, University of Texas
Southwestern Medical Center, Dallas, TX, USA
e-mail: John.Hulleman@UTSouthwestern.edu
conditions within the retina and what function
do these structures serve? Herein, we present
data suggesting that protein aggregation is
identifiable in multiple retinal layers of nor-
mal, healthy murine retina, and briefly discuss
the potential contributions of aggregated pro-
teins to normal retinal function, with a focus
on the photoreceptor inner and outer
segment.
Keywords
Higher-order assembly · Protein aggregation ·
Condensate · Amyloid · Thioflavin T · Retinal
degeneration
other biomolecules into a recognizable higher-­
order assembly called an aggregate is most com-
monly associated with disease states [1, 2].
However, similar structures, commonly called
condensates, have been shown to contribute to a
variety of cellular functions [1, 2]. Experimentally
differentiating between these structures can be
difficult, partially a result of confusing nomen-
clature that has recently been clarified by Alberti

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 263
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_38
264
and Hyman [2]. For brevity and ease of under-
standing, throughout this book chapter we will
use the term “aggregate” to describe functional
condensates as well as disease-associated aggre-
gates. In this context, aggregates form a spectrum
of assemblies ranging from soluble oligomeric
structures to phase-separated liquid droplets, gel-­
like condensates, and solid-like aggregates [1].
These physical properties are determined by how
ordered the interactions are between components
and determine where along this spectrum an
aggregate lies [3]. Additionally, aggregates can
be heterogeneous, forming multiple phases
within a single structure [3, 4]. Within an aggre-
gate, some proteins act as scaffolds that stabi-
lize the aggregate and the environment it
creates, whereas other proteins freely diffuse into
and out of the aggregate at will [5]. The scaffold-
ing proteins likely display a more solid-like phe-
notype, potentially due to a higher-order structure
called amyloid [4]. Many proteins can form the
underlying cross-ß structure of amyloid, which
can be detected by fluorescent dyes, such as thio-
flavin T, or antibodies against oligomeric or
fibrillar amyloid species [6, 7]. The presence of
amyloid (which has typically been associated
only with disease states) within normal retina tis-
sue highlights a need to understand how some
aggregates are functional, pathological, or
both depending on the environmental context
[1, 3, 4, 8].
2 Methods
2.1 Thioflavin T
and Immunofluorescence
Staining
Wild-type C57BL/6J mice were raised for
12 months under standard conditions, eutha-
nized, and their eyes enucleated. The anterior
chamber, lens, and vitreous were immediately
dissected away and unfixed eye cups were
embedded into optimal cutting temperature
compound and frozen in liquid nitrogen. 12 μm
cryosections were collected and briefly permea-
M. H. Hayes et al.
bilized with 0.1% Triton-X100, washed with
PBS, and stained. Thioflavin T (ThT) staining
was performed while the sample was on the
microscope stage (50 μM in PBS, Sigma,
T3516). Immunofluorescent labeling was per-
formed by blocking permeabilized slides in PBS
with 1% goat serum and incubating in blocking
buffer or blocking buffer supplemented with
primary amyloid oligomer antibody (A11,
1:500, EMD Millipore, AB9234) overnight.
Sections were washed and incubated with sec-
ondary antibody (AlexaFluor 546, 1:1000,
Invitrogen, A-11037) for 3 h, stained with DAPI,
washed, and mounted with Fluoromount G
(Invitrogen, 00-4959-52). Images were acquired
with a Zeiss Observer microscope at 10x magni-
fication. All experiments were conducted ethi-
cally in accordance with the ARVO Statement of
the Use of Animals in Ophthalmic and Vision
Research and the UT Southwestern Medical
Center Institutional Animal Care and Use
Committee guidelines.
3 Results
3.1 Aggregates Are Identifiable
in Multiple Retinal Layers
Functional protein aggregation is implicated in
essential universal cellular functions – for
example, transcription, translation, centrosome
formation, and control of nucleo-cytoplasmic
flux as well as cell-type specific functions [1, 2,
9, 10]. Cell-type specific functions of aggre-
gated proteins include participation in synaptic
vesicle and peptide hormone clustering and
storage, post-­synaptic signaling, cell-cell inter-
actions, and maintenance of long-term memory
[1, 2]. Because diverse functions of aggregated
proteins are observed in other tissues and cell
types, we hypothesized that commercially avail-
able stains and antibodies used for protein
aggregation could identify the presence and
location of aggregates in the retina. To test this
hypothesis, we isolated retinal tissue from
healthy 12-month-old wild-­type mice and per-
Ocular Amyloid, Condensates, and Aggregates – Higher-Order Protein Assemblies Participate in Both…
formed cryosectioning of unfixed tissue. We did
not fix the tissue in order to better preserve
native amyloid and to avoid fixative-induced
protein aggregation. Robust ThT positive stain-
ing was observed in multiple retinal layers
(Fig. 1c). Of note, increased ThT signal was
observed at the juncture of the inner and outer
segment (Fig. 1c, arrowhead), suggesting the
presence of robust amyloid-containing struc-
tures at this location. We further corroborated
this result by staining similar unfixed sections
with an antibody that recognizes peptides in an
oligomeric form of amyloid, which also recog-
nized multiple retinal layers (Fig. 1g).
Differences in the ThT and antibody-based
detection of aggregates are likely due to tissue
penetration (small molecule vs. large antibody)
and specificity differences. Nonetheless, these
results demonstrate protein aggregation within
normal murine retina, raising the question: what
are the functions of these aggregated proteins
within retinal tissues?
Fig. 1 Thioflavin T (ThT) and anti-oligomeric amyloid
antibodies react with distinct retinal layers. (a) Phase con-
trast image of a unfixed cryosection from a 12-month-old
wild-type C57BL/6J mouse. (b) Lack of fluorescence sig-
nal immediately before staining the cryosection with
50 μM ThT (c). Staining was performed on the micro-
scope stage with images in (b) and (c) taken seconds
apart. White arrowhead highlights increased staining of
photoreceptor inner segments. Similarly treated unfixed
cryosections were stained with DAPI (d, f) to stain nuclei,
265
4 Discussion
4.1 Do Aggregates Contribute
to the Structure and Function
of the Basal Body
and Permeability Barrier
of the Connecting Cilium?
Arguably, the most important structure of the
retina is the photoreceptor (PR) outer segment –
which is connected to the inner segment by the
connecting cilium, a modified primary cilium.
Sitting at its base is the basal body, a structure
remarkably similar to the centrosome and likely
relies upon a similar mechanism for assembly
and maintenance. Centrosomes are microtubule
organizing centers formed by the coalescence,
phase separation, and aggregation of pericentrio-
lar matrix around centrioles [11]. Thus, aggrega-
tion and phase separation likely play a role in the
assembly and maintenance of the structure and
function of the connecting cilium. In addition,
(e) anti-rabbit secondary antibody, or (g) A11 anti-oligo-
meric amyloid antibody and secondary antibody.
Magnification and exposure are identical between corre-
sponding panels. NFL nerve fiber layer, ILM inner limit-
ing membrane, RGC retinal ganglion cell layer, IPL inner
plexiform layer, INL inner nuclear layer, OPL outer plexi-
form layer, ONL outer nuclear layer, IS inner segment, OS
outer segment, RPE retinal pigmented epithelium. Scale
bars = 100 μm
266
the membrane and intracellular contents of the
outer segment are unique, the result of a selective
permeability barrier – the “gates” to the outer
segment. These gates form at the transition zone,
the area just distal to the basal body in the proxi-
mal axoneme [11, 12]. Initiation of transition
zone assembly requires CEP290, a protein that is
mutated in Leber Congenital Amaurosis and
Bardet-Beidel syndrome – both of which are
associated with retinal degenerative diseases
[12]. The prototypical permeability barrier of an
incompletely membrane-bound organelle is that
of the nucleus. The nuclear membrane is studded
with pore complexes that are freely permeable to
small molecules but restrict larger molecules in a
size- and shape-dependent manner, properties
nearly identical to the permeability barrier pres-
ent between the inner and outer segment [13]. In
fact, the ciliary permeability barrier contains
nucleoporins. Nucleoporins contain FG repeats –
intrinsically disordered regions rich in phenylala-
nine and glycine dipeptides. These proteins have
been shown to phase separate to form ThT-­
positive hydrogels suggesting amyloid plays a
role in their function [9]. Interestingly, when we
stained cryosections of the unfixed healthy
murine retina with ThT we see increased staining
at the junction of the inner and outer segment
(Fig. 1c, arrowhead). These observations may
suggest that the PR ciliary permeability barrier
also relies on amyloid containing structures for
its barrier function. Identifying which proteins
aggregate within the basal body, transition zone,
and if the PR ciliary permeability barrier is
dependent on amyloid-containing aggregates will
provide insight into normal retinal physiology
and routes for potential novel therapeutic
intervention.
4.2 Do Aggregates Participate
in the Structure
and Organization
of the Photoreceptor Disc?
The PR disc membrane is a highly organized
structure. The light-sensing pigment rhodopsin
is located in the center with peripherin and
M. H. Hayes et al.
RIM proteins lining the disc rim. This organi-
zation could be attributed to the formation of
lipid raft structures. Membrane lipids are
known to separate into liquid-ordered (Lo) and
liquid-­disordered (Ld) phases. However, pro-
tein aggregation and phase separation can
occur on the surface of membranes, and these
2-­dimensional protein aggregates can have a
significant influence on membrane shape –
including membrane curvature [8].
Interestingly, the lipid species present within
the membrane can influence the oligomeriza-
tion and aggregation of proteins [14]. Do mem-
brane-to-protein aggregate interactions
influence the organization of PR discs?
Peripherin is known to form homo- or hetero-­
oligomers, and peripherin oligomerization
controls disc enclosure, though it is not
required for it [15]. Furthermore, aggregation-­
prone mutant forms of rhodopsin have been
shown to destabilize the PR disc membrane
[16]. Thus, it is imperative to identify
aggregation-­prone proteins that associate with
the disc membrane within the PR. Doing so
would provide an avenue to further understand
how aggregation-­prone proteins interact with
membrane components – such as lipid compo-
sition and transmembrane proteins – to influ-
ence membrane structure and function.
5 Summary and Future
Directions
Despite a long history of being associated with
disease, aggregated proteins are known contribu-
tors to cellular function. Our initial experiments
with ThT and A11 antibody staining suggest
aggregated proteins are commonplace through-
out the retina. Identifying the proteins that aggre-
gate, in both normal and diseased retina, is the
first step in understanding the contribution of
aggregated proteins to normal retinal function,
the pathophysiology of retinal degenerative dis-
eases, and how functional aggregates relate to
their disease-associated brethren. Furthermore,
differentiating between functional and disease-­
associated protein aggregation provides an
Ocular Amyloid, Condensates, and Aggregates – Higher-Order Protein Assemblies Participate in Both…
opportunity to develop novel therapeutic
approaches. A plethora of strategies have been
pursued for the treatment of aggregation-­
associated neurological diseases. This includes
anti-aggregation drugs, therapeutic proteases,
immunomodulatory drugs, and small molecule
inhibitors [17]. Dyes such as Congo Red, ThT,
and Nile Red have been shown to have therapeu-
tic potential in decreasing amyloid content [17].
However, unlike the brain, the eye is uniquely
accessible. Thus, in addition to the potential ther-
apeutic benefit, applying these dyes to ocular tis-
sue provides an opportunity to identify, and thus
potentially treat retinal pathology prior to the
onset of devastating symptoms such as irrevers-
ible vision loss. 10. De Joukov N. The centrosome and the primary cil-
Acknowledgments This work was funded by the Roger
and Dorothy Hirl Endowed Research Fund and the NEI
Core Grant for Vision Research (P30-EY030413).
References
1. Fassler JS, Skuodas S, Weeks DL, Phillips BT. Protein
aggregation and disaggregation in cells and develop-
ment. J Mol Biol. 2021;433(21):167215.
2. Alberti S, Hyman AA. Biomolecular condensates
at the nexus of cellular stress, protein aggrega-
tion disease and ageing. Nat Rev Mol Cell Biol.
2021;22(3):196–213.
3. Shin Y, Brangwynne CP. Liquid phase conden-
sation in cell physiology and disease. Science.
2017;357(6357):eaaf4382.
4. Hayes MH, Weeks DL. Amyloids assemble as part of
recognizable structures during oogenesis in Xenopus.
Biol Open. 2016;5(6):801–6.
5. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S,
Parker R, et al. Compositional control of phase-­
separated cellular bodies. Cell. 2016;166(3):651–63.
267
6. Biancalana M, Koide S. Molecular mechanism of
Thioflavin-T binding to amyloid fibrils. Biochim
Biophys Acta (BBA) – Protein Proteomics.
2010;1804(7):1405–12.
7. Kayed R, Head E, Sarsoza F, Saing T, Cotman CW,
Necula M, et al. Fibril specific, conformation depen-
dent antibodies recognize a generic epitope com-
mon to amyloid fibrils and fibrillar oligomers that is
absent in prefibrillar oligomers. Mol Neurodegener.
2007;2(1):18.
8. Nesterov SV, Ilyinsky NS, Uversky VN. Liquid-liquid
phase separation as a common organizing principle
of intracellular space and biomembranes providing
dynamic adaptive responses. Biochim Biophys Acta
(BBA) – Mol Cell Res. 1868;2021(11):119102.
9. Schmidt HB, Görlich D. Nup98 FG domains from
diverse species spontaneously phase-separate into
particles with nuclear pore-like permselectivity. elife.
2015;4:e04251.
ium: the yin and Yang of a hybrid organelle. Cell.
2019;8(7):701.
11. Raff JW. Phase separation and the centrosome: a fait
accompli? Trends Cell Biol. 2019;29(8):612–22.
12. Wu Z, Pang N, Zhang Y, Chen H, Peng Y, Fu
J, et al. CEP290 is essential for the initiation
of ciliary transition zone assembly. PLoS Biol.
2020;18(12):e3001034.
13. Verhey KJ, Yang W. Permeability barriers for gener-
ating a unique ciliary protein and lipid composition.
Curr Opin Cell Biol. 2016;41:109–16.
14. Amaro M, Šachl R, Aydogan G, Mikhalyov II, Vácha
R, Hof M. GM 1 ganglioside inhibits β-amyloid
oligomerization induced by sphingomyelin. Angew
Chem Int Ed. 2016;55(32):9411–5.
15. Lewis TR, Makia MS, Castillo CM, Al-Ubaidi MR,
Naash MI, Arshavsky VY. Photoreceptor disc enclo-
sure is tightly controlled by Peripherin-2 oligomeriza-
tion. J Neurosci. 2021;41(16):3588–96.
16. Haeri M, Knox BE. Rhodopsin mutant P23H destabi-
lizes rod photoreceptor disk membranes. PLoS One.
2012;7(1):e30101.
17. Chen G-F, Xu T-H, Yan Y, Zhou Y-R, Jiang Y,
Melcher K, et al. Amyloid beta: structure, biology
and structure-­ based therapeutic development. Acta
Pharmacol Sin. 2017;38(9):1205–35.
 Photoreceptor Ion Channels
in Signaling and Disease
Shivangi M. Inamdar, Colten K. Lankford,
and Sheila A. Baker
Abstract
Photoreceptors (PRs) in the neural retina con-
vert photon capture into an electrical signal
that is communicated across a chemical syn-
apse to second-order neurons in the retina and
on through the rest of the visual pathway. This
information is decoded in the visual cortex to
create images. The activity of PRs depends on
the concerted action of several voltage-gated
ion channels that will be discussed in this
chapter.
Keywords
Photoreceptors · Ion channels · CNG · Cav1.4
· HCN1 · Kv2.1 · Kv8.2 · Retinal
degeneration
1 Introduction
The human genome encodes a superfamily of
voltage-gated ion channels (VGICs) that conduct
the cations sodium, potassium, or calcium. This
superfamily consists of ten distinct families of
S. M. Inamdar (*) · C. K. Lankford · S. A. Baker
Department of Biochemistry and Molecular Biology,
University of Iowa,
Iowa City, IA, USA
e-mail: shivangi-inamdar@uiowa.edu;
lankfordcolten@ufl.edu; sheila-baker@uiowa.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_39
ion channels. Members of four of these families
(CNG, HCN, Kv, and Cav) are expressed in PRs
and are key to communicating light detection.
The structure of rods and cones can be most
simply divided into three compartments; outer
segment (OS), inner segment (IS), and synaptic
terminal (ST). Each of the ion channels we dis-
cuss here has a distinct expression pattern along
the PRs compartments. The OS houses the photo-
transduction cascade in the disc membranes and
CNG channels in the OS plasma membrane that
carry the inward dark current [1]. The IS or
“housekeeping” part of the cell contains the ion
channels responsible for shaping light responses,
HCN1, and Kv2.1/Kv8.2. HCN1 is found
throughout the IS plasma membrane, axon, and
synapse. Kv2.1/Kv8.2 is restricted to the apical
portion of the IS plasma membrane. How that
restriction is accomplished is unknown. The ST
is where neurotransmitter release to communi-
cate the light/dark state to second-order neurons
in the retina occurs and is characterized by a syn-
aptic ribbon beneath which Cav1.4 channels are
clustered [2, 3].
2 CNG Channels Respond
to Light
Cyclic nucleotide-gated (CNG) channels are
responsible for carrying the inward flowing dark
current (IDARK). IDARK is a depolarizing mixed Na+/
269
270
Ca2+ current that maintains PR depolarization (at
~ −35 to −40 mV). These channels are not prom-
inently gated by voltage but are held in the open
state when cGMP is bound [4, 5]. CNG channels
in rods and cones have distinct biophysical prop-
erties due to their composition. Rod CNG is a 3:1
assembly of A1 and B1 subunits. Cone CNG is
composed of A3 and B3 subunits at a stoichiom-
etry that has been reported to be either 3:1 or 2:2
[6–11].
The levels of cGMP that gate CNG channels
are controlled by the phototransduction pathway
such that levels are high in the dark but drop pre-
cipitously in response to light [12]. CNG chan-
nels do not desensitize to cGMP binding allowing
CNG channels to be continuously open in the
dark, a feature necessary for maintaining the dark
resting potential of PRs [13]. When CNG chan-
nels close in response to light, the loss of the Na+
influx hyperpolarizes the PR membrane. Loss of
the Ca2+ influx serves a more important role in
regulation. Ca2+ entering the OS is extruded by
Na+/Ca2+, K+ exchangers that are physically cou-
pled to CNG channels [14–16]. This extrusion
does not stop in the light so Ca2+ levels inside the
OS decrease in the light which is read by calcium-­
binding proteins that regulate several compo-
nents of the phototransduction cascade including
CNG channels themselves [17].
Mutations in rod-specific CNGA1 and
CNGB1 cause autosomal recessive retinitis pig-
mentosa (arRP) [4, 18, 19]. In arRP, rods are dys-
functional, so patients present as night blind. In
the absence of either of the subunits, functional
CNG channels fail to be expressed at the plasma
membrane resulting in photoreceptor death [20–
22]. As rods die, secondary death of cones takes
place further reducing the visual field and ulti-
mately leading to complete blindness [18]. Gene
replacement in CNGB1 knockout (KO) mice
using adeno-associated viral (AAV) vectors have
been shown to be effective in restoring rod CNG
and halting degeneration, but this approach has
not yet been translated into clinical trials of a
therapy for adRP patients [18, 23].
Mutations in cone-specific CNGA3 and
CNGB3 cause recessive achromatopsia or reces-
sive cone-rod dystrophy. Mutations in CNGB3
S. M. Inamdar et al.
are additionally linked to Leber congenital amau-
rosis (LCA), and Oligocone trichomacy [24].
Achromatopsia is diagnosed early in childhood
with severe cone dysfunction with patients report-
ing color vision problems, reduced visual acuity,
and photophobia. Patients show loss of PR in the
foveal region and thinning of the macula [25].
Studies using mouse models have shown that loss
of CNGA3 disrupts the targeting of the cone opsin
to the OS and cones undergo apoptosis without
affecting rod function and viability [26, 27]. In
mice with loss of CNGB3, there is reduced cone
function with slow but progressive cone degener-
ation that is attributed to the expression of homo-
meric CNGA3 channels with altered gating
properties [28]. Recombinant AAV vector-­
mediated delivery of CNGA3 in CNGA3 KO
mice has shown recovery of cone function and
delayed cone death [29]. Similarly, AAV-­mediated
delivery of CNGB3 in KO mice showed success-
ful and long-term restoration of cone function
[30]. Excitingly, clinical trials of AAV-­CNGB3
gene therapy for achromatopsia patients have
completed two phases of testing and are showing
promising results ([28, 31], clinicaltrials.gov).
3 Cav1.4 Channels Respond to
CNG-Regulated Membrane
Potential
Cav1.4 channels in the synapse respond to the
membrane potential set by the light-regulated
opening or closing of CNG channels to control
communication to the inner retina. Cav1.4 chan-
nels consist of three subunits, the pore-forming
α1F, an intracellular β2 that provides an indirect
link between the channel and the synaptic ribbon
complex, and an extracellular α2δ4 that is thought
to be involved in transsynaptic adhesion [32–37].
The β2 and α2δ4 subunits also participate in traf-
ficking and stability of the channel and can modu-
late the biophysical properties of the pore-forming
subunit [38]. Additional regulation of Cav1.4 is
provided by the expression of alternative splicing
products or interaction with the calcium-binding
protein, CaBP4 [39, 40]. Cav1.4 channels are
expressed in both rods and cones [3, 41–43].
Photoreceptor Ion Channels in Signaling and Disease
Synaptic vesicle fusion with the plasma mem-
brane and release of glutamate is triggered by the
binding of Ca2+ to synaptotagmin proteins. The
synaptic ribbon complex ensures that a large num-
ber of synaptic vesicles are docked and primed in
close association with Cav1.4 channels which
carry 95% of the current that brings Ca2+ into the
synapse at the active zone (Ica) [3, 44]. Unlike most
neurons, PRs do not fire all-or-none-­action poten-
tials but respond to light by graded decreases in
glutamate release which allows for responses to
fine increases or decreases in light intensity [45].
Two features of Cav1.4 that supports the unique
needs of PR neurotransmitter release are that these
channels activate at more negative potentials than
other synaptic Cav channels so that they are open
in dark-adapted PRs. Second, Cav1.4 channels are
resistant to calcium-­dependent inhibition so can
stay open longer [46].
Mutations in CACNA1F, encoding the α1F
subunit of Cav1.4 are most frequently diagnosed
as incomplete congenital stationary night blind-
ness (CSNB2). CSNB2 is like complete CSNB,
which results from mutations in the bipolar den-
dritic signaling complex, in that patients present
with symptoms that include night blindness, pho-
tophobia, color vision abnormalities, and
decreased visual acuity [47]. However, CSNB2 is
more variable [47, 48]. The most helpful diag-
nostic feature of CSNB is the lack of a b-wave in
the scotopic ERG. In complete CSNB, the b-wave
is completely flat while in CSNB2 there is a small
b-wave that is never large enough to cross the
baseline so is termed electronegative [47]. The
stationary part of CSNB2 is often true although
some CACNA1F mutations cause degeneration
in the form of cone-rod dystrophy 3 [49, 50].
Further exemplifying the variability of Cav1.4-­
associated disease is that mutations in the auxil-
iary α2δ4 subunit (CACNA2D4) cause retinal
cone dystrophy 4 [51].
4 HCN1 Channels Shape Light
Responses
Two channels residing in the IS that function in
shaping the visual responses initiated in the OS
and communicate to the inner retina at the
271
ST include – HCN1 and Kv2.1/Kv8.2. Of these
channels, HCN1 is the best studied. The local-
ization of the channel is primarily IS, but it
also labels the soma, axon, and synapse [52–
58]. HCN1 channels belong to the
hyperpolarization-­activated cyclic nucleotide-
gated (HCN) family of ion channels which are
structurally similar to CNG channels. However,
HCN1 channels are primarily driven by volt-
age-gating which can be regulated by
cAMP. There is one family member insensitive
to cAMP regulation and that is HCN1, which is
the HCN family member expressed in both
rods and cones [59]. HCN channels are unique
in that they open in response to hyperpolariza-
tion, [60]. The mechanism that allows these
channels to open at especially negative poten-
tials is unknown.
HCN1 in PRs carries the hyperpolarization-­
activated current (Ih) which is required to control
response timing. As light-triggered closure of
CNG channels drives the membrane potential
more and more negative HCN1 channels will
open and the influx of mixed Na+ and K+ ions
depolarize the membrane, thus acting as a reset,
particularly following brighter flashes of light.
Pharmacological experiments have shown the
importance of this function with rod voltage
recovery being up to two-fold slower in the pres-
ence of Ih blockers [52, 61, 62].
The role of HCN1 has also been described
using ERG recording of KO mice. In response to
a brief flash, HCN1 knockout mice exhibit a pro-
longed rod-driven b-wave indicative of prolonged
activation of neurons downstream from rods [57,
63–66]. Interestingly, altered rod function in the
HCN1 knockout mice allows rods to continue
signaling even under photopic conditions when
rods would normally be shut off. This excessive
rod signaling ends up preventing the transmission
of cone signals [65, 67]. Strangely, we did not
observe any negative consequences to ablating
HCN1 specifically from cones [67].
Understanding why cones express HCN1 is a
question that needs further investigation.
HCN1 is widely expressed throughout the
brain and plays a well-characterized role in regu-
lating neuronal excitability [68–70]. As such it is
not surprising that people with HCN1 mutations
272
have epilepsy. Sometimes the disease is severe
resulting in childhood mortality, while other
mutations are benign [71, 72]. People with HCN1
mutations have not reported visual problems but
that does not necessarily undercut the important
role HCN1 plays in the retina. Instead consider
that people with mutations causing very mild
symptoms may have unrecognized visual dys-
function and those with mutations that cause
early mortality would not have had an opportu-
nity to notice and report visual abnormalities [71,
73, 74]. In animal models, HCN1 loss is insuffi-
cient to drive retinal degeneration; however,
CNGB KO mice are a model for retinitis pigmen-
tosa, and it was found that double KO of CNGB
and HCN1 accelerated rod loss, likely by altered
calcium homeostasis and aberrant calpain activ-
ity [75]. Therefore, seemingly mild mutations in
HCN1 should be considered as possible genetic
modifiers in inherited retinal degeneration.
5 Kv2.1/Kv8.2 Channels
Kv2.1/Kv8.2 is a heterotetrameric channel that is
found in the IS of both rod and cone PRs [76, 77].
The Kv2 family of delayed outwardly rectifying
potassium channels consists of two members,
Kv2.1 and Kv2.2, that form homomeric channels
[78]. Kv2.1 channels are expressed in the rods
and cones of rodents and primates. Primate cones
additionally express Kv2.2 although the signifi-
cance of that is currently unknown [76]. Kv2.1
homotetrameric channels activate just outside the
normal operational range of PRs but can incorpo-
rate a so-called “electrically silent” or KvS sub-
unit that alters the activity of the channel [76, 77].
The KvS protein expressed in PRs is Kv8.2
which co-localizes with Kv2.1 [76]. Both Kv
subunits, and Na+/K+ ATPase (NKA), are present
in the apical portion of the IS plasma membrane,
which is adjacent to the mitochondria-rich
ellipsoid.
There are two lines of evidence that heterotet-
rameric Kv2.1/Kv8.2 channels carry IKx – one of
the principal currents that describe basic PR sig-
naling. The first co-expression of Kv8.2 with
Kv2.1 in Xenopus oocytes can create a channel
S. M. Inamdar et al.
that activates at more negative potentials and
inactivates more slowly than Kv2.1 homotetra-
meric channels. The biophysical properties of the
hybrid channel match those of IKx recorded from
either amphibian or rodent PRs [61, 76, 77].
Second, there have been several recent knockout
mouse studies confirming that loss of either
Kv2.1 or Kv8.2 causes phenotypes consistent
with loss of IKx, this will be discussed in more
detail in the context of disease associated with
this channel [79–82].
The primary function of IKx is to set the mem-
brane resting potential [61]. In the dark, the
inward flow of current through outer segment
CNG channels is balanced by a standing out-
ward current originating from the inner seg-
ment. Kv2.1/Kv8.2 accounts for 70–80% of this
standing outward dark current [77, 81]. The
constant flow of K+ ions out of the PR in the
dark is only possible because of the constant
activity of NKA which burns ATP to simultane-
ously transport two K+ ions into the cell and
three Na+ ions out. Because of this imbalance in
total charge being transported across the mem-
brane, NKA is electrogenic and accounts for the
remaining portion of the standing outward dark
current [81]. Note, the abundance and constant
activity of NKA in PRs contribute to these cells
being often cited as the most metabolically
demanding [83]. Upon light stimulation,
Kv2.1/Kv8.2 channels slowly inactivate which
is important for increasing sensitivity to chang-
ing illumination. As the PR further undergoes
hyperpolarization, Kv2.1/8.2 channels close and
HCN1 channels open to reset the membrane
back towards the resting potential [2].
Mutations in KCNB1 (encoding Kv2.1) are
associated with developmental and epileptic
encephalopathy [84, 85] but vision defects have
not been reported for these patients. On the other
hand, mutations in KCNV2 (encoding Kv8.2) do
cause an autosomal recessive retinal degenerative
disease called cone dystrophy with supernormal
rod response (CDSRR) or KCNV2 retinopathy.
Patients are usually diagnosed with CDSRR early
in adolescence with the symptoms common to
cone dystrophies [86]. The characteristic feature
of CDSRR is the unusual electrical activity of the
Photoreceptor Ion Channels in Signaling and Disease
retina which is diagnosed primarily by the ampli-
tude of the ERG b-wave. The amplitude of the
rod-driven b-wave under the dimmest illumina-
tion is reduced but becomes supernormal as the
light intensity increases, the amplitude of the
cone-driven b-wave is consistently reduced.
Recent mouse studies have provided models for
further study of this disease.
The Kv8.2 KO mice have abnormal ERG
responses that phenocopy CDSRR [79, 80, 82].
Consistent with the loss of IKx and the need to
rely primarily on NKA to provide the outward
arm of the standing dark current, isolated PR
responses are reduced by 20%. In Kv2.1 KO
mice a reduction in the extracellular K+ concen-
tration was documented and both Kv2.1 and
Kv8.2 KO mice have greatly reduced ERG
c-waves indicating the same is happening in the
Kv8.2 KO retina [79, 81]. A better understanding
of how potassium homeostasis is altered in
CDSRR will require a closer examination of the
expression levels and activity of K+ channels and
exchangers in the RPE and Muller glia since
those two cells are essential to so many aspects of
PR biology.
Loss of Kv8.2 should leave homotetrameric
Kv2.1 channels, which normally function outside
of the physiological range of the PRs. That means
Kv8.2 and Kv2.1 KO phenotypes should be the
same, which is what is mostly observed in ERG
(except for one report of young Kv2.1 KO mice,
the rod-driven supernormal b-wave is unique to
Kv8.2 KO) and double Kv2.1/Kv8.2 KO mice
are similar to the single KOs [79–82]. For Kv2.1
homotetrameric channels to compensate for the
loss of Kv8.2, it is expected that the resting mem-
brane potential would have to be more depolar-
ized than normal. This has been documented in
the Kv2.1 KO but not directly tested in the Kv8.2
KO [77, 81].
The Kv8.2 KO mice do not adequately pheno-
copy CDSRR when it comes to neurodegenera-
tion. In humans, progressive cell loss is restricted
to the macula which leads one to expect wide-
spread cone degeneration in mice even though
the human macula contains a high density of rods
and cones surrounding the cone-pure fovea.
Kv8.2 KO mice have a mild rod degeneration and
273
one study reported cone loss, but this was not
replicated in a subsequent study [79, 82].
However, rapid cone loss was observed in the lat-
ter study after crossing the Kv8.2 KO mice to a
strain with an all-cone retina [82]. This implies
that both loss of Kv8.2 and an environmental
stress, that is, loss of rods in mice, or perhaps
highlight exposure in the case of the human mac-
ula, are needed to trigger cone death.
While there are no current treatment options
available, the size of KCNV2 is amenable to
packaging in AAV so even though it is a rare dis-
ease, one expects gene replacement therapy is a
viable treatment strategy.
6 Future Directions
Here we have presented an overview of our cur-
rent state of knowledge regarding four ion chan-
nels that are integral to PR signaling. A pressing
need in this field that we did not touch on is
understanding how the activity of these channels
is influenced by other ion channels and exchang-
ers. Such knowledge may be used to supplement
current gene replacement strategies to help
patients with vision loss due to alteration of ion
channel function.
References
1. Pearring JN, Salinas RY, Baker SA, Arshavsky
VY. Protein sorting, targeting and trafficking in pho-
toreceptor cells. Prog Retin Eye Res. 2013;36:24–51.
2. Lankford CK, Laird JG, Inamdar SM, Baker
SA. A comparison of the primary sensory neurons
used in olfaction and vision. Front Cell Neurosci.
2020;14:595523.
3. Van Hook MJ, Nawy S, Thoreson WB. Voltage- and
calcium-gated ion channels of neurons in the verte-
brate retina. Prog Retin Eye Res. 2019;72:100760.
4. Biel M, Michalakis S. Cyclic nucleotide-gated chan-
nels. Handb Exp Pharmacol. 2009;191:111–36.
5. Craven KB, Zagotta WN. CNG and HCN chan-
nels: two peas, one pod. Annu Rev Physiol.
2006;68:375–401.
6. Zheng J, Trudeau MC, Zagotta WN. Rod cyclic
nucleotide-­gated channels have a stoichiometry of
three CNGA1 subunits and one CNGB1 subunit.
Neuron. 2002;36(5):891–6.
274
7. Zhong H, Molday LL, Molday RS, Yau KW. The
heteromeric cyclic nucleotide-gated channel adopts a
3A:1B stoichiometry. Nature. 2002;420(6912):193–8.
8. Weitz D, Ficek N, Kremmer E, Bauer PJ, Kaupp
UB. Subunit stoichiometry of the CNG channel of rod
photoreceptors. Neuron. 2002;36(5):881–9.
9. Peng C, Rich ED, Varnum MD. Subunit configuration
of heteromeric cone cyclic nucleotide-gated channels.
Neuron. 2004;42(3):401–10.
10. Matveev AV, Quiambao AB, Browning Fitzgerald
J, Ding XQ. Native cone photoreceptor cyclic
nucleotide-­gated channel is a heterotetrameric com-
plex comprising both CNGA3 and CNGB3: a study
using the cone-dominant retina of Nrl−/− mice. J
Neurochem. 2008;106(5):2042–55.
11. Ding XQ, Matveev A, Singh A, Komori N, Matsumoto
H. Biochemical characterization of cone cyclic
nucleotide-gated (CNG) channel using the infrared
fluorescence detection system. Adv Exp Med Biol.
2012;723:769–75.
12. Burns ME, Arshavsky VY. Beyond counting photons:
trials and trends in vertebrate visual transduction.
Neuron. 2005;48(3):387–401.
13. Kaupp UB, Seifert R. Cyclic nucleotide-gated ion
channels. Physiol Rev. 2002;82(3):769–824.
14. Bauer PJ, Drechsler M. Association of cyclic GMP-­
gated channels and Na(+)-Ca(2+)-K+ exchangers in
bovine retinal rod outer segment plasma membranes.
J Physiol. 1992;451:109–31.
15. Schwarzer A, Schauf H, Bauer PJ. Binding of the
cGMP-gated channel to the Na/Ca-K exchanger in rod
photoreceptors. J Biol Chem. 2000;275(18):13448–54.
16. Poetsch A, Molday LL, Molday RS. The cGMP-­
gated channel and related glutamic acid-rich pro-
teins interact with peripherin-2 at the rim region of
rod photoreceptor disc membranes. J Biol Chem.
2001;276(51):48009–16.
17. Vinberg F, Chen J, Kefalov VJ. Regulation of calcium
homeostasis in the outer segments of rod and cone
photoreceptors. Prog Retin Eye Res. 2018;67:87–101.
18. Koch S, Sothilingam V, Garcia Garrido M, Tanimoto
N, Becirovic E, Koch F, et al. Gene therapy restores
vision and delays degeneration in the CNGB1(−/−)
mouse model of retinitis pigmentosa. Hum Mol
Genet. 2012;21(20):4486–96.
19. Michalakis S, Becirovic E, Biel M. Retinal cyclic
nucleotide-gated channels: from pathophysiology to
therapy. Int J Mol Sci. 2018;19(3).
20. Dryja TP, Finn JT, Peng YW, McGee TL, Berson EL,
Yau KW. Mutations in the gene encoding the alpha
subunit of the rod cGMP-gated channel in autosomal
recessive retinitis pigmentosa. Proc Natl Acad Sci U
S A. 1995;92(22):10177–81.
21. Liu Y, Wang Y, Xiao Y, Li X, Ruan S, Luo X, et al.
Retinal degeneration in mice lacking the cyclic
nucleotide-gated channel subunit CNGA1. FASEB J.
2021;35(9):e21859.
22. Huttl S, Michalakis S, Seeliger M, Luo DG, Acar N,
Geiger H, et al. Impaired channel targeting and retinal
degeneration in mice lacking the cyclic nucleotide-­
S. M. Inamdar et al.
gated channel subunit CNGB1. J Neurosci.
2005;25(1):130–8.
23. Michalakis S, Koch S, Sothilingam V, Garcia Garrido
M, Tanimoto N, Schulze E, et al. Gene therapy restores
vision and delays degeneration in the CNGB1(−/−)
mouse model of retinitis pigmentosa. Adv Exp Med
Biol. 2014;801:733–9.
24. Sun W, Zhang Q. Diseases associated with muta-
tions in CNGA3: genotype-phenotype correlation
and diagnostic guideline. Prog Mol Biol Transl Sci.
2019;161:1–27.
25. Remmer MH, Rastogi N, Ranka MP, Ceisler
EJ. Achromatopsia: a review. Curr Opin Ophthalmol.
2015;26(5):333–40.
26. Michalakis S, Geiger H, Haverkamp S, Hofmann F,
Gerstner A, Biel M. Impaired opsin targeting and
cone photoreceptor migration in the retina of mice
lacking the cyclic nucleotide-gated channel CNGA3.
Invest Ophthalmol Vis Sci. 2005;46(4):1516–24.
27. Biel M, Seeliger M, Pfeifer A, Kohler K, Gerstner A,
Ludwig A, et al. Selective loss of cone function in mice
lacking the cyclic nucleotide-gated channel CNG3.
Proc Natl Acad Sci U S A. 1999;96(13):7553–7.
28. Michalakis S, Schon C, Becirovic E, Biel M. Gene
therapy for achromatopsia. J Gene Med. 2017;19(3).
29. Michalakis S, Muhlfriedel R, Tanimoto N,
Krishnamoorthy V, Koch S, Fischer MD, et al.
Restoration of cone vision in the CNGA3−/− mouse
model of congenital complete lack of cone photore-
ceptor function. Mol Ther. 2010;18(12):2057–63.
30. Carvalho LS, Xu J, Pearson RA, Smith AJ,
Bainbridge JW, Morris LM, et al. Long-term and
age-dependent restoration of visual function in
a mouse model of CNGB3-associated achroma-
topsia following gene therapy. Hum Mol Genet.
2011;20(16):3161–75.
31. Koch M, Scheel C, Ma H, Yang F, Stadlmeier M,
Gluck AF, et al. The cGMP-dependent protein kinase
2 contributes to cone photoreceptor degeneration in
the Cnga3-deficient mouse model of achromatopsia.
Int J Mol Sci. 2020;22(1).
32. Wang Y, Fehlhaber KE, Sarria I, Cao Y, Ingram
NT, Guerrero-Given D, et al. The auxiliary calcium
channel subunit alpha2delta4 is required for axonal
elaboration, synaptic transmission, and wiring of rod
photoreceptors. Neuron. 2017;93(6):1359–74.e6.
33. Dembla E, Dembla M, Maxeiner S, Schmitz
F. Synaptic ribbons foster active zone stability and
illumination-dependent active zone enrichment of
RIM2 and Cav1.4 in photoreceptor synapses. Sci Rep.
2020;10(1):5957.
34. Hagiwara A, Kitahara Y, Grabner CP, Vogl C, Abe M,
Kitta R, et al. Cytomatrix proteins CAST and ELKS
regulate retinal photoreceptor development and main-
tenance. J Cell Biol. 2018;217(11):3993–4006.
35. Hibino H, Pironkova R, Onwumere O, Vologodskaia
M, Hudspeth AJ, Lesage F. RIM binding pro-
teins (RBPs) couple Rab3-interacting molecules
(RIMs) to voltage-gated Ca(2+) channels. Neuron.
2002;34(3):411–23.
Photoreceptor Ion Channels in Signaling and Disease
36. Lee A, Wang S, Williams B, Hagen J, Scheetz TE,
Haeseleer F. Characterization of Cav1.4 complexes
(alpha11.4, beta2, and alpha2delta4) in HEK293T cells
and in the retina. J Biol Chem. 2015;290(3):1505–21.
37. Zabouri N, Haverkamp S. Calcium channel-­dependent
molecular maturation of photoreceptor synapses.
PLoS One. 2013;8(5):e63853.
38. Dolphin AC, Lee A. Presynaptic calcium channels:
specialized control of synaptic neurotransmitter
release. Nat Rev Neurosci. 2020;21(4):213–29.
39. Haeseleer F, Imanishi Y, Maeda T, Possin DE, Maeda
A, Lee A, et al. Essential role of Ca2+−binding pro-
tein 4, a Cav1.4 channel regulator, in photoreceptor
synaptic function. Nat Neurosci. 2004;7(10):1079–87.
40. Koschak A, Fernandez-Quintero ML, Heigl T, Ruzza
M, Seitter H, Zanetti L. Cav1.4 dysfunction and con-
genital stationary night blindness type 2. Pflugers
Arch. 2021;473(9):1437–54.
41. Bader CR, Bertrand D, Schwartz EA. Voltage-­
activated and calcium-activated currents studied in
solitary rod inner segments from the salamander ret-
ina. J Physiol. 1982;331:253–84.
42. Yagi T, Macleish PR. Ionic conductances of mon-
key solitary cone inner segments. J Neurophysiol.
1994;71(2):656–65.
43. Zamponi GW, Striessnig J, Koschak A, Dolphin
AC. The physiology, pathology, and pharmacology of
voltage-gated calcium channels and their future thera-
peutic potential. Pharmacol Rev. 2015;67(4):821–70.
44. Xu JW, Slaughter MM. Large-conductance calcium-­
activated potassium channels facilitate transmit-
ter release in salamander rod synapse. J Neurosci.
2005;25(33):7660–8.
45. Pangrsic T, Singer JH, Koschak A. Voltage-gated
calcium channels: key players in sensory cod-
ing in the retina and the inner ear. Physiol Rev.
2018;98(4):2063–96.
46. Joiner ML, Lee A. Voltage-gated Cav1 channels in
disorders of vision and hearing. Curr Mol Pharmacol.
2015;8(2):143–8.
47. Waldner DM, Bech-Hansen NT, Stell WK. Channeling
vision: CaV1.4-a critical link in retinal signal trans-
mission. Biomed Res Int. 2018;2018:7272630.
48. Stone EM, Andorf JL, Whitmore SS, DeLuca AP,
Giacalone JC, Streb LM, et al. Clinically focused
molecular investigation of 1000 consecutive fami-
lies with inherited retinal disease. Ophthalmology.
2017;124(9):1314–31.
49. Mantyjarvi M, Nurmenniemi P, Partanen J, Myohanen
T, Peippo M, Alitalo T. Clinical features and a fol-
low-­up study in a family with X-linked progres-
sive cone-rod dystrophy. Acta Ophthalmol Scand.
2001;79(4):359–65.
50. Jalkanen R, Mantyjarvi M, Tobias R, Isosomppi J,
Sankila EM, Alitalo T, et al. X linked cone-rod dys-
trophy, CORDX3, is caused by a mutation in the
CACNA1F gene. J Med Genet. 2006;43(8):699–704.
51. Wycisk KA, Zeitz C, Feil S, Wittmer M, Forster
U, Neidhardt J, et al. Mutation in the auxiliary
calcium-­ channel subunit CACNA2D4 causes auto-
275
somal recessive cone dystrophy. Am J Hum Genet.
2006;79(5):973–7.
52. Barrow AJ, Wu SM. Low-conductance HCN1
ion channels augment the frequency response
of rod and cone photoreceptors. J Neurosci.
2009;29(18):5841–53.
53. Fain GL, Quandt FN, Bastian BL, Gerschenfeld
HM. Contribution of a caesium-sensitive conduc-
tance increase to the rod photoresponse. Nature.
1978;272(5652):466–9.
54. Fain GL, Sampath AP. Light responses of mammalian
cones. Pflugers Arch. 2021.
55. Hestrin S. The properties and function of inward recti-
fication in rod photoreceptors of the tiger salamander.
J Physiol. 1987;390:319–33.
56. Ingram NT, Sampath AP, Fain GL. Membrane con-
ductances of mouse cone photoreceptors. J Gen
Physiol. 2020;152(3).
57. Knop GC, Seeliger MW, Thiel F, Mataruga A,
Kaupp UB, Friedburg C, et al. Light responses in
the mouse retina are prolonged upon targeted dele-
tion of the HCN1 channel gene. Eur J Neurosci.
2008;28(11):2221–30.
58. Muller F, Scholten A, Ivanova E, Haverkamp
S, Kremmer E, Kaupp UB. HCN channels are
expressed differentially in retinal bipolar cells and
concentrated at synaptic terminals. Eur J Neurosci.
2003;17(10):2084–96.
59. Zong X, Krause S, Chen CC, Kruger J, Gruner C,
Cao-­Ehlker X, et al. Regulation of hyperpolarization-­
activated cyclic nucleotide-gated (HCN) channel activ-
ity by cCMP. J Biol Chem. 2012;287(32):26506–12.
60. Lee CH, MacKinnon R. Structures of the human
HCN1 hyperpolarization-activated channel. Cell.
2017;168(1–2):111–20 e11.
61. Beech DJ, Barnes S. Characterization of a voltage-­
gated K+ channel that accelerates the rod response to
dim light. Neuron. 1989;3(5):573–81.
62. Barnes S. After transduction: response shaping
and control of transmission by ion channels of
the photoreceptor inner segments. Neuroscience.
1994;58(3):447–59.
63. Della Santina L, Piano I, Cangiano L, Caputo A,
Ludwig A, Cervetto L, et al. Processing of retinal sig-
nals in normal and HCN deficient mice. PLoS One.
2012;7(1):e29812.
64. Gargini C, Demontis GC, Bisti S, Cervetto L. Effects
of blocking the hyperpolarization-activated cur-
rent (Ih) on the cat electroretinogram. Vis Res.
1999;39(10):1767–74.
65. Seeliger MW, Brombas A, Weiler R, Humphries
P, Knop G, Tanimoto N, et al. Modulation of rod
photoreceptor output by HCN1 channels is essen-
­
tial for regular mesopic cone vision. Nat Commun.
2011;2:532.
66. Sothilingam V, Michalakis S, Garcia Garrido M,
Biel M, Tanimoto N, Seeliger MW. HCN1 chan-
nels enhance rod system responsivity in the retina
under conditions of light exposure. PLoS One.
2016;11(1):e0147728.
276
67. Lankford C, Umino Y, Poria D, Kefalov V, Solessio E,
Baker S. Cone-driven retinal responses are shaped by
rod but not cone HCN1. bioRxiv; 2021.
68. Moosmang S, Stieber J, Zong X, Biel M, Hofmann F,
Ludwig A. Cellular expression and functional char-
acterization of four hyperpolarization-activated pace-
maker channels in cardiac and neuronal tissues. Eur J
Biochem. 2001;268(6):1646–52.
69. Notomi T, Shigemoto R. Immunohistochemical local-
ization of Ih channel subunits, HCN1-4, in the rat
brain. J Comp Neurol. 2004;471(3):241–76.
70. Shah MM. Cortical HCN channels: function, traffick-
ing and plasticity. J Physiol. 2014;592(13):2711–9.
71. Marini C, Porro A, Rastetter A, Dalle C, Rivolta I,
Bauer D, et al. HCN1 mutation spectrum: from neo-
natal epileptic encephalopathy to benign generalized
epilepsy and beyond. Brain. 2018;141(11):3160–78.
72. Nava C, Dalle C, Rastetter A, Striano P, de Kovel CG,
Nabbout R, et al. De novo mutations in HCN1 cause
early infantile epileptic encephalopathy. Nat Genet.
2014;46(6):640–5.
73. Bonzanni M, DiFrancesco JC, Milanesi R,
Campostrini G, Castellotti B, Bucchi A, et al. A novel
de novo HCN1 loss-of-function mutation in genetic
generalized epilepsy causing increased neuronal
excitability. Neurobiol Dis. 2018;118:55–63.
74. Tang B, Sander T, Craven KB, Hempelmann A,
Escayg A. Mutation analysis of the hyperpolarization-­
activated cyclic nucleotide-gated channels HCN1 and
HCN2 in idiopathic generalized epilepsy. Neurobiol
Dis. 2008;29(1):59–70.
75. Schon C, Asteriti S, Koch S, Sothilingam V, Garcia
Garrido M, Tanimoto N, et al. Loss of HCN1
enhances disease progression in mouse models of
CNG channel-­linked retinitis pigmentosa and achro-
matopsia. Hum Mol Genet. 2016;25(6):1165–75.
76. Gayet-Primo J, Yaeger DB, Khanjian RA, Puthussery
T. Heteromeric KV2/KV8.2 channels mediate delayed
rectifier potassium currents in primate photorecep-
tors. J Neurosci. 2018;38(14):3414–27.
77. Czirjak G, Toth ZE, Enyedi P. Characterization of
the heteromeric potassium channel formed by kv2.1
S. M. Inamdar et al.
and the retinal subunit kv8.2 in Xenopus oocytes. J
Neurophysiol. 2007;98(3):1213–22.
78. Bocksteins E, Snyders DJ. Electrically silent Kv sub-
units: their molecular and functional characteristics.
Physiology (Bethesda). 2012;27(2):73–84.
79. Hart NS, Mountford JK, Voigt V, Fuller-Carter
P, Barth M, Nerbonne JM, et al. The role of the
voltage-­gated potassium channel proteins Kv8.2 and
Kv2.1 in vision and retinal disease: insights from the
study of mouse gene knock-out mutations. eNeuro.
2019;6(1).
80. Jiang X, Rashwan R, Voigt V, Nerbonne J, Hunt
DM, Carvalho LS. Molecular, cellular and functional
changes in the retinas of young adult mice lacking the
voltage-gated K(+) channel subunits Kv8.2 and K2.1.
Int J Mol Sci. 2021;22(9).
81. Fortenbach C, Peinado Allina G, Shores CM, Karlen
SJ, Miller EB, Bishop H, et al. Loss of the K+ chan-
nel Kv2.1 greatly reduces outward dark current and
causes ionic dysregulation and degeneration in rod
photoreceptors. J Gen Physiol. 2021;153(2).
82. Inamdar SM, Lankford CK, Poria D, Laird JG,
Solessio E, Kefalov VJ, et al. Differential impact of
Kv8.2 loss on rod and cone signaling and degenera-
tion. Hum Mol Genet. 2021;
83. Viegas FO, Neuhauss SCF. A metabolic landscape for
maintaining retina integrity and function. Front Mol
Neurosci. 2021;14:656000.
84. Shieh CC, Coghlan M, Sullivan JP, Gopalakrishnan
M. Potassium channels: molecular defects, dis-
eases, and therapeutic opportunities. Pharmacol Rev.
2000;52(4):557–94.
85. Speca DJ, Ogata G, Mandikian D, Bishop HI, Wiler
SW, Eum K, et al. Deletion of the Kv2.1 delayed
rectifier potassium channel leads to neuronal and
behavioral hyperexcitability. Genes Brain Behav.
2014;13(4):394–408.
86. Rashwan R, Hunt DM, Carvalho LS. The role of
voltage-gated ion channels in visual function and
disease in mammalian photoreceptors. Pflugers Arch.
2021;473(9):1455–68.
 The Role of Peripherin-2/ROM1
Complexes in Photoreceptor Outer
Segment Disc Morphogenesis

Tylor R. Lewis, Muayyad R. Al-Ubaidi,

Muna I. Naash, and Vadim Y. Arshavsky

Abstract loop mediates well-established intermolecular

The light-sensitive outer segment organelle of
photoreceptor cells contains a stack of hun-
dreds of flat, disc-shaped membranes called
discs. The rims of these discs contain a
photoreceptor-­specific tetraspanin protein
peripherin-2 (also known as rds or PRPH2).
Mutations in the PRPH2 gene lead to a wide
variety of inherited retinal degenerations in
humans. The vast majority of these mutations
occur within a large, intradiscal loop of
peripherin-2, known as the D2 loop. The D2
T. R. Lewis (*)
Department of Ophthalmology, Duke University
Medical Center,
Durham, NC, USA
e-mail: tylor.lewis@duke.edu
M. R. Al-Ubaidi · M. I. Naash
Department of Biomedical Engineering, College of
Engineering, University of Houston, Houston, TX,
USA
College of Optometry, University of Houston,
Houston, TX, USA
e-mail: malubaid@central.uh.edu;
mnaash@central.uh.edu
V. Y. Arshavsky
Department of Ophthalmology, Duke University
Medical Center,
Durham, NC, USA
Department of Pharmacology and Cancer Biology,
Duke University Medical Center, Durham, NC, USA
e-mail: vadim.arshavsky@duke.edu
interactions of peripherin-2 molecules among
themselves and a homologous protein ROM1.
These interactions lead to the formation of
large, highly ordered oligomers. In this chap-
ter, we discuss the supramolecular organiza-
tion of peripherin-2/ROM1 complexes and
their contribution to the process of outer seg-
ment disc morphogenesis and enclosure.
Keywords
Peripherin-2 · Photoreceptor · Outer Segment
· Disc · PRPH2 · RDS · ROM1 · Disc Rim ·
Disc Enclosure · Retina
1 Peripherin-2 Is a Tetraspanin
Protein Whose Mutations
Cause Retinal Degeneration
1.1 Molecular Structure
of Peripherin-2 and ROM1
Peripherin-2 is a glycosylated photoreceptor-­
specific tetraspanin protein [1, 2]. Both N- and
C-termini of peripherin-2 reside on the cytoplas-
mic face of the membrane, while there are two
intradiscal loops (termed D1 and D2 loops) that
face the interior of the outer segment discs [1, 2].
The conserved site for glycosylation is in the
intradiscal D2 loop [2]. Notably, another highly

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 277
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_40
278
homologous tetraspanin, ROM1, also localizes to
outer segment disc rims [3]. ROM1 shares 35%
conservation at the amino acid level with periph-
erin-­2 and has a similar membrane topology [3],
but is not glycosylated [4].
1.2 Mutations in Peripherin-2 Are
Associated with Retinal
Degeneration
Since the initial identification of PRPH2 muta-
tions in patients with autosomal dominant reti-
nitis pigmentosa in 1991 [5], over 200 PRPH2
mutations have been identified that lead to a het-
erogenous set of inherited retinal diseases
including retinitis pigmentosa, cone-rod dystro-
phy, and macular dystrophies [6]. While most of
these PRPH2 mutations lead to disease in an
autosomal dominant fashion, autosomal reces-
sive cases have also been reported [7, 8], as well
as mutations that combine with mutations in
ROM1 to cause digenic retinitis pigmentosa [9,
10]. Yet, it is unclear whether mutations in
ROM1 alone are pathogenic [11–13].
Interestingly, the vast majority of disease-asso-
ciated mutations in PRPH2 exist in the intradis-
cal D2 loop [6], which is involved in the
well-established interactions of peripherin-2
with either ROM1 or other peripherin-­2 mole-
cules [14–16]. This suggests that the intermo-
Fig. 1 Supramolecular organization of peripherin-2 and
ROM1. Peripherin-2/ROM1 can form homo- and hetero-­
tetramers through non-covalent interactions. Covalent
T. R. Lewis et al.
lecular interactions of peripherin-2 are critical
to its biological function.
1.3 Supramolecular Organization
of Peripherin-2/ROM1
As illustrated in Fig. 1, peripherin-2 can interact
non-covalently with other peripherin-2 molecules
and with ROM1 to form either homomeric or het-
eromeric tetramers that are considered the “core”
units of peripherin-2/ROM1 supramolecular
organization [3, 17–19]. These non-covalent tet-
ramers can interact covalently among themselves
through the formation of disulfide bonds at the
C150 residue of peripherin-2 to form large oligo-
meric complexes [14, 20–22]. In vitro analysis
showed that ROM1 was absent from the large
oligomeric complexes of peripherin-2, although
it was found in smaller, intermediate-sized oligo-
mers [20]. Whether the latter is also the case
in vivo remains to be determined.
2 The Function of Peripherin-2
Peripherin-2 has two critical functions, each per-
formed by different parts of its molecule. The
first, performed by the C-terminus, is the reten-
tion of membranes at the photoreceptor cilium to
enable the formation of outer segment discs. The
disulfide bonds can lead to the formation of large, high-­
order oligomers of peripherin-2 that reportedly exclude
ROM1, at least in vitro
The Role of Peripherin-2/ROM1 Complexes in Photoreceptor Outer Segment Disc Morphogenesis
second, performed by the tetraspanin core, is the
formation of the highly curved disc rim.
2.1 Discs Are Formed through
Peripherin-2-Dependent
Suppression of Ciliary
Ectosome Release
Loss of peripherin-2 in the rds mouse completely
prevents outer segment formation and causes the
subretinal space to be packed with extracellular
vesicles [23, 24] containing rhodopsin [25, 26].
Recently, it has been shown that these vesicles
are released from the photoreceptor cilium [27]
and, therefore, are ciliary ectosomes, i.e., extra-
cellular vesicles ubiquitously released by many
types of primary cilia [28]. The function of
peripherin-2 is to prevent the release of ecto-
somes from the photoreceptor cilium, thereby
allowing the retention of these membranes and
their transformation into outer segment discs
[27]. This function is performed by the C-terminus
of peripherin-2 [27].
2.2 The Role of Peripherin-2
in Disc Rim Formation
and Enclosure
The second function of peripherin-2 is to fortify
the rims of mature photoreceptor discs separated
from the outer segment plasma membrane. This
separation occurs during a complex membrane
remodeling process called disc enclosure [29].
Given that peripherin-2 redistributes along the
disc rim during the process of disc enclosure [30,
31], it seems likely that peripherin-2 plays an
active role driving the disc enclosure process.
Consistent with this notion, peripherin-2 induces
Fig. 2 Model of peripherin-2 supramolecular organization at the disc rim. Three interconnected chains of peripherin-2
tetramers run parallel along the circumference of the disc rim
279
membrane curvature when reconstituted into
liposomes [32] and leads to the formation of
highly curved intracellular membranes when
expressed in mammalian cells [27, 33, 34]. These
properties of peripherin-2 are conveyed by its tet-
raspanin core, which is sufficient for generating
membrane curvature in both living animals and
cell culture [27]. Other experiments showed that
the replacement of the tetraspanin core of periph-
erin-­2 with that of ROM1 in mice affects the cur-
vature of disc rims [35].
These studies eventually led to a model in
which long oligomeric chains of peripherin-2 and
ROM1 run around the entire circumference of an
enclosed disc to generate and maintain the shape
of its rim. It was first suggested that there are two
of these long oligomeric chains surrounding each
disc [33], but a recent study utilizing cryo-­
electron tomography revised this model by dem-
onstrating that the disc rim is fortified by three
parallel interconnected oligomeric chains of
peripherin-2/ROM1 [36], as illustrated in Fig. 2.
In support of the need for disulfide bonds
among individual tetramers to form long oligo-
meric chains of peripherin-2/ROM1, the inability
to form these disulfide bonds by the C150S
peripherin-2 mutant in a knockin mouse yielded
highly dysmorphic outer segment ultrastructure
[22]. A subsequent study revealed that even
minor defects in the ability of peripherin-2 to
oligomerize lead to defects in the fidelity of disc
enclosure [37]. Yet, surprisingly, the C150S
knockin mouse still exhibited some degree of
disc rim formation and enclosure, despite the
grossly aberrant outer segment structure [38].
Most likely, this is explained by the intrinsic abil-
ity of peripherin-2/ROM1 oligomers to non-­
covalently interact, although not nearly as
efficiently as when reinforced by disulfide
bridges.
280
3 Concluding Remarks
and Future Avenues of Study
In this short chapter, we briefly highlighted the
involvement of peripherin-2/ROM1 oligomeriza-
tion in outer segment disc morphogenesis (see
other recent reviews for more details about periph-
erin-2/ROM1 [39, 40] or disc morphogenesis
[29]). Yet, a lot remains unknown about these pro-
teins. For example, human mutations in the
PRPH2 gene lead to a wide variety of retinal
degenerations. What is the basis for such a diver-
sity of disease, from retinitis pigmentosa to cone-­
rod dystrophy, as well as several macular
dystrophies? What is the exact contribution of
ROM1 to outer segment development and mainte-
nance? Can mutations in the ROM1 gene alone
underlie retinal disease or do they simply modu-
late PRPH2 mutations? Lastly, what is the precise
state of peripherin-2/ROM1 supramolecular orga-
nization that occurs in vivo in the disc rim and how
exactly does peripherin-2/ROM1 oligomerization
regulate the dynamics of disc rim assembly and
disc enclosure? Further research into each of these
areas is warranted for a complete understanding of 11. Bascom RA, Liu L, Heckenlively JR, Stone EM,
the function of ­peripherin-­2 and ROM1 and their
involvement in human visual disease.
Acknowledgments This work was supported by
National Institutes of Health Grants EY012859,
EY030451, and EY005722 to VYA, Grant EY010609 to
MIN and MRA-U, and Grant EY033763 to TRL and
Research to Prevent Blindness Inc. Unrestricted Award 13. Reig C, Martinez-Gimeno M, Carballo M. A het-
(Duke University).
References
1. Connell GJ, Molday RS. Molecular cloning, primary
structure, and orientation of the vertebrate photore-
ceptor cell protein peripherin in the rod outer segment 15. Kedzierski W, Weng J, Travis GH. Analysis of the
disk membrane. Biochemistry. 1990;29(19):4691–8.
2. Travis GH, Sutcliffe JG, Bok D. The retinal degen-
eration slow (rds) gene product is a photoreceptor
disc membrane-associated glycoprotein. Neuron. 16. Ding XQ, Stricker HM, Naash MI. Role of the second
1991;6(1):61–70.
3. Bascom RA, Manara S, Collins L, Molday RS,
Kalnins VI, McInnes RR. Cloning of the cDNA for a 17. Goldberg AF, Molday RS. Subunit composition of
novel photoreceptor membrane protein (rom-1) iden-
tifies a disk rim protein family implicated in human
retinopathies. Neuron. 1992;8(6):1171–84.
T. R. Lewis et al.
4. Moritz OL, Molday RS. Molecular cloning, mem-
brane topology, and localization of bovine rom-1 in
rod and cone photoreceptor cells. Invest Ophthalmol
Vis Sci. 1996;37(2):352–62.
5. Kajiwara K, Hahn LB, Mukai S, Travis GH, Berson
EL, Dryja TP. Mutations in the human retinal degen-
eration slow gene in autosomal dominant retinitis pig-
mentosa. Nature. 1991;354(6353):480–3.
6. Peeters M, Khan M, Rooijakkers A, Mulders T, Haer-­
Wigman L, Boon CJF, et al. PRPH2 mutation update:
in silico assessment of 245 reported and 7 novel vari-
ants in patients with retinal disease. Hum Mutat. 2021.
7. Wang X, Wang H, Sun V, Tuan HF, Keser V, Wang
K, et al. Comprehensive molecular diagnosis of 179
Leber congenital amaurosis and juvenile retinitis pig-
mentosa patients by targeted next generation sequenc-
ing. J Med Genet. 2013;50(10):674–88.
8. Khan AO, Al Rashaed S, Neuhaus C, Bergmann C,
Bolz HJ. Peripherin mutations cause a distinct form of
recessive Leber congenital amaurosis and dominant
phenotypes in asymptomatic parents heterozygous for
the mutation. Br J Ophthalmol. 2016;100(2):209–15.
9. Kajiwara K, Berson EL, Dryja TP. Digenic reti-
nitis pigmentosa due to mutations at the unlinked
peripherin/RDS and ROM1 loci. Science.
1994;264(5165):1604–8.
10. Dryja TP, Hahn LB, Kajiwara K, Berson
EL. Dominant and digenic mutations in the periph-
erin/RDS and ROM1 genes in retinitis pigmentosa.
Invest Ophthalmol Vis Sci. 1997;38(10):1972–82.
McInnes RR. Mutation analysis of the ROM1
gene in retinitis pigmentosa. Hum Mol Genet.
1995;4(10):1895–902.
12. Sakuma H, Inana G, Murakami A, Yajima T, Weleber
RG, Murphey WH, et al. A heterozygous putative null
mutation in ROM1 without a mutation in peripherin/
RDS in a family with retinitis pigmentosa. Genomics.
1995;27(2):384–6.
erozygous novel C253Y mutation in the highly con-
served cysteine residues of ROM1 gene is the cause of
retinitis pigmentosa in a Spanish family? Hum Mutat.
2000;16(3):278.
14. Goldberg AF, Loewen CJ, Molday RS. Cysteine resi-
dues of photoreceptor peripherin/rds: role in subunit
assembly and autosomal dominant retinitis pigmen-
tosa. Biochemistry. 1998;37(2):680–5.
rds/peripherin.rom1 complex in transgenic photore-
ceptors that express a chimeric protein. J Biol Chem.
1999;274(41):29181–7.
intradiscal loop of peripherin/rds in homo and hetero
associations. Biochemistry. 2005;44(12):4897–904.
the peripherin/rds-rom-1 disk rim complex from
rod photoreceptors: hydrodynamic evidence for
a tetrameric quaternary structure. Biochemistry.
1996;35(19):6144–9.
The Role of Peripherin-2/ROM1 Complexes in Photoreceptor Outer Segment Disc Morphogenesis
18. Goldberg AF, Moritz OL, Molday RS. Heterologous
expression of photoreceptor peripherin/rds and
Rom-1 in COS-1 cells: assembly, interactions, and
localization of multisubunit complexes. Biochemistry.
1995;34(43):14213–9.
19. Goldberg AF, Molday RS. Defective subunit assem-
bly underlies a digenic form of retinitis pigmentosa
linked to mutations in peripherin/rds and rom-1. Proc
Natl Acad Sci U S A. 1996;93(24):13726–30.
20. Loewen CJ, Molday RS. Disulfide-mediated oligomer-
ization of Peripherin/Rds and Rom-1 in photoreceptor
disk membranes. Implications for p­ hotoreceptor outer
segment morphogenesis and degeneration. J Biol
Chem. 2000;275(8):5370–8.
21. Chakraborty D, Ding XQ, Conley SM, Fliesler SJ,
Naash MI. Differential requirements for retinal
degeneration slow intermolecular disulfide-linked
oligomerization in rods versus cones. Hum Mol
Genet. 2009;18(5):797–808.
22. Zulliger R, Conley SM, Mwoyosvi ML, Al-Ubaidi
MR, Naash MI. Oligomerization of Prph2 and Rom1
is essential for photoreceptor outer segment forma-
tion. Hum Mol Genet. 2018;27(20):3507–18.
23. Cohen AI. Some cytological and initial biochemical
observations on photoreceptors in retinas of rds mice.
Invest Ophthalmol Vis Sci. 1983;24(7):832–43.
24. Jansen HG, Sanyal S. Development and degeneration
of retina in rds mutant mice: electron microscopy. J
Comp Neurol. 1984;224(1):71–84.
25. Nir I, Papermaster DS. Immunocytochemical localiza-
tion of opsin in the inner segment and ciliary plasma
membrane of photoreceptors in retinas of rds mutant
mice. Invest Ophthalmol Vis Sci. 1986;27(5):836–40.
26. Usukura J, Bok D. Changes in the localization and
content of opsin during retinal development in the rds
mutant mouse: immunocytochemistry and immunoas-
say. Exp Eye Res. 1987;45(4):501–15.
27. Salinas RY, Pearring JN, Ding JD, Spencer WJ, Hao
Y, Arshavsky VY. Photoreceptor discs form through
peripherin-dependent suppression of ciliary ectosome
release. J Cell Biol. 2017;216(5):1489–99.
28. Wood CR, Huang K, Diener DR, Rosenbaum JL. The
cilium secretes bioactive ectosomes. Curr Biol.
2013;23(10):906–11.
29. Spencer WJ, Lewis TR, Pearring JN, Arshavsky
VY. Photoreceptor discs: built like Ectosomes. Trends
Cell Biol. 2020;30(11):904–15.
281
30. Arikawa K, Molday LL, Molday RS, Williams
DS. Localization of peripherin/rds in the disk mem-
branes of cone and rod photoreceptors: relationship to
disk membrane morphogenesis and retinal degenera-
tion. J Cell Biol. 1992;116(3):659–67.
31. Ding JD, Salinas RY, Arshavsky VY. Discs of
mammalian rod photoreceptors form through the
membrane evagination mechanism. J Cell Biol.
2015;211(3):495–502.
32. Kevany BM, Tsybovsky Y, Campuzano ID, Schnier
PD, Engel A, Palczewski K. Structural and func-
tional analysis of the native peripherin-ROM1 com-
plex isolated from photoreceptor cells. J Biol Chem.
2013;288(51):36272–84.
33. Milstein ML, Cavanaugh BL, Roussey NM, Volland S,
Williams DS, Goldberg AFX. Multistep peripherin-2/
rds self-assembly drives membrane curvature for outer
segment disk architecture and photoreceptor viability.
Proc Natl Acad Sci U S A. 2020;117(8):4400–10.
34. Milstein ML, Kimler VA, Ghatak C, Ladokhin AS,
Goldberg AFX. An inducible amphipathic helix
within the intrinsically disordered C terminus can par-
ticipate in membrane curvature generation by periph-
erin-­2/rds. J Biol Chem. 2017;292(19):7850–65.
35. Conley SM, Stuck MW, Watson JN, Zulliger R, Burnett
JL, Naash MI. Prph2 initiates outer segment morpho-
genesis but maturation requires Prph2/Rom1 oligo-
merization. Hum Mol Genet. 2019;28(3):459–75.
36. Pöge M, Mahamid J, Imanishi SS, Plitzko JM,
Palczewski K, Baumeister W. Determinants shaping
the nanoscale architecture of the mouse rod outer seg-
ment. bioRxiv. 2021:2021.08.18.456753.
37. Lewis TR, Makia MS, Castillo CM, Al-Ubaidi MR,
Naash MI, Arshavsky VY. Photoreceptor disc enclo-
sure is tightly controlled by peripherin-2 oligomeriza-
tion. J Neurosci. 2021;41(16):3588–96.
38. Lewis TR, Makia MS, Kakakhel M, Al-Ubaidi MR,
Arshavsky VY, Naash MI. Photoreceptor disc enclo-
sure occurs in the absence of normal peripherin-2/rds
oligomerization. Front Cell Neurosci. 2020;14:92.
39. Stuck MW, Conley SM, Naash MI. PRPH2/RDS and
ROM-1: historical context, current views and future
considerations. Prog Retin Eye Res. 2016;52:47–63.
40. Tebbe L, Kakakhel M, Makia MS, Al-Ubaidi MR,
Naash MI. The interplay between peripherin 2 com-
plex formation and degenerative retinal diseases. Cell.
2020;9(3).
 Human Mutations in Arl3, a Small
GTPase Involved in Lipidated
Cargo Delivery to the Cilia, Cause
Retinal Dystrophy

Amanda M. Travis and Jillian N. Pearring

Abstract 1 Arl3 Unloads Lipidated

Cargo onto Ciliary
Photoreceptors are highly polarized sensory Membranes
neurons. Precise localization of signaling mol-
ecules within the ciliary outer segment is criti-
cal for photoreceptor function and viability.
The small GTPase Arl3 plays a particularly
important role in photoreceptors as it regulates
outer segment enrichment of lipidated pro-
teins essential for the visual response:
transducin-α, transducin-γ, PDEα, PDE β, and
Grk1. Recently, mutations in Arl3 have been
identified in human patients with nonsyn-
dromic autosomal recessive and dominant
inherited retinal degenerations as well as syn-
dromic Joubert syndrome including retinal
dystrophy.
Keywords
Arl3 · Photoreceptors · Arl13B · RP2 · Retinal
dystrophy
A. M. Travis
Department of Ophthalmology and Visual Science,
University of Michigan, Ann Arbor, MI, USA
e-mail: amtr@umich.edu
J. N. Pearring (*)
Department of Ophthalmology and Visual Science,
University of Michigan, Ann Arbor, MI, USA
Department of Cell and Developmental Biology,
University of Michigan, Ann Arbor, MI, USA
e-mail: pearring@umich.edu
Arl3 is a member of the ADP-ribosylation fac-
tor (Arf) family of small GTPases that are
important for membrane trafficking [3]. Arl3
is ubiquitously expressed in ciliated cells
where it regulates the ciliary enrichment of
lipidated proteins. The GDI-like chaperones
PDEδ [9] and UNC119A/B [23] are Arl3
effectors that bind to prenylated and myris-
toylated proteins, respectively, by hiding the
lipid moiety within an intramolecular cavity
that solubilizes the lipid cargo and enables its
free diffusion (Fig. 1a). The lipid cargo is
eventually released in the cilium through
interactions with active GTP-bound Arl3 [12,
13]. Arl3 is specifically activated in the cilium
by its guanine exchange factor (GEF) Arl13B
and is stabilized in a GTP-bound state by its
effector, BART [4, 7] (Fig. 1a). Hydrolysis of
GTP to GDP in Arl3 is facilitated by its
GTPase-­ activating protein (GAP) RP2 [20,
21]. RP2 is a lipidated protein frequently
mutated in X-linked retinitis pigmentosa
patients [17] and found enriched at the base of
the cilium although also present at other loca-
tions in the cell [5, 10]. Inactivation of Arl3
causes it to dissociate from its chaperone
effectors, which are freed to start another
cycle by binding lipidated cargo.

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 283
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_41
284
Fig. 1 Arl3 is important for enrichment of lipidated pro-
teins to the ciliary outer segment of rod photoreceptors.
(a)Model showing Arl3’s role in lipidated protein trans-
port. GDI-like chaperone proteins sequester the lipid moi-
ety of cargo proteins allowing for cytoplasmic diffusion.
In the box, the Arl3 GTPase cycle is highlighted. Arl3 is
activated by its guanine nucleotide exchange factor
(GEF), Arl13B, in the cilium. Active GTP-bound Arl3 is
stabilized by BART so it can then bind chaperones, releas-
ing lipidated cargo on ciliary membranes (outer segment
Arl3 is expressed throughout all layers of the
retina [22], but studies have focused on its
­localization and function in photoreceptor cells
as their light-sensitive outer segment compart-
ment is a modified primary cilium. Endogenous
Arl3 antibody staining shows that Arl3 is local-
ized throughout the photoreceptor layer from the
synapse to the outer segment [22]. This staining
pattern was confirmed in a transgenic mouse
expressing HA-tagged wild-type mouse Arl3
[22] as well as in our own experiments express-
ing a FLAG-tagged human Arl3 in rod photore-
ceptors by in vivo electroporation [24] (Fig. 1b).
A previous publication shows EGFP-tagged Arl3
localized to the inner segment and cell body of
rods [8]; however, this staining pattern is likely
due to steric volume exclusion from the
membrane-­dense outer segment as a result of the
addition of the comparatively large fluorescent
tag [14].
A. M. Travis and J. N. Pearring
membranes in photoreceptors). Arl3 is inactivated by the
GAP, RP2, at inner segment membranes. (b) Cartoon
schematic of mouse photoreceptor with specific compart-
ments labeled to the left. The light-sensitive outer segment
is a modified primary cilium and site for lipidated protein
delivery by Arl3. In vivo electroporation of FLAG-tagged
human Arl3 in mouse rod photoreceptors shows Arl3 is
localized throughout the photoreceptor cell body and
outer segment
2 Mouse Models of Arl3
The importance of Arl3 for ciliary function
in vivo is demonstrated clearly by mouse models
of Arl3 knockout or disfunction. Mice with no
Arl3 expression due to a gene trap within the first
intron of Arl3 are born at non-Mendelian ratios
and phenocopy the loss of other important ciliary
proteins, specifically cysts in the kidney, liver,
and pancreas commonly found in models of the
ciliopathy polycystic kidney disease [16]. In the
retina, the absence of Arl3 strongly affects rod
photoreceptors, which are unable to form outer
segments. Cone photoreceptors do form outer
segments, but they are abnormally short at P13.
Photoreceptor cell death is observed as early as
P13 in these mice, but the precise course of pho-
toreceptor cell loss is unknown since the Arl3−/−
mice fail to thrive and die by 3 weeks of age.
Human Mutations in Arl3, a Small GTPase Involved in Lipidated Cargo Delivery to the Cilia, Cause Retinal…
Arl3’s function in the retina was further stud-
ied in two different conditional Arl3 floxed mice:
(1) an early Arl3 knockout in all retinal cells
driven by Six3-Cre and (2) a late Arl3 knockout
in rod photoreceptors driven by iCre75 [8].
Because Six3-Cre causes recombination embry-
onically, the early Arl3-KO (called retArl3−/− in
the original publication) also showed that Arl3 is
critical for the initial building of the ciliary outer
segment. In these mice, no ciliary axoneme
formed and photoreceptor degeneration was
completed by 1 month. In contrast, in the late
Arl3-KO (called rodArl3−/− in the original publica-
tion), iCre75 causes recombination postnatally
(P4-P7), allowing rods to form outer segments
before Arl3 is knocked out. Despite forming
outer segments, the late Arl3-KO also shows
rapid rod cell degeneration that was completed
by 2 months. In these mice, there is a mislocal-
ization of lipidated outer segment-specific pro-
teins like myristoylated transducin-α, farnesylated
rhodopsin kinase (GRK1), transducin-γ and
Rab28, and prenylated PDE6α/β to the inner seg-
ments of rods as early as P15 [8]. As expected,
outer segment transmembrane proteins were
unaffected by the loss of Arl3. By allowing the
formation of normal outer segments, the authors
were able to confirm a role for Arl3 in trafficking
lipidated proteins to the outer segment [8]. From
these mouse studies, it is clear that Arl3 is impor-
tant for both building outer segments and main-
taining outer segment composition.
The nucleotide cycle of Arl3 as a small
GTPase protein is also critical for the health of
photoreceptors. Transgenic expression of Arl3-­
Q71L, a GTP-locked Arl3 mutant, in rod photo-
receptors (using the same rhodopsin promoter
used to drive Cre expression in late Arl3-KO
mouse) results in rod photoreceptors that build
light-responsive outer segments of normal length,
similar to the late Arl3-KO mice. These outer
segments do show subtle defects in the packing
of the outer segment discs at P20 and rod degen-
eration ultimately occurs by 2 months [22].
Comparing the Arl3-Q71L mouse to the late
Arl3-KO mouse reveals important differences
despite the similar degeneration timeline.
Although Arl3-KO mice show lipidated outer
285
segment proteins spilling into the inner segment
plasma membrane [8], many of these lipidated
proteins behave differently in the Arl3-Q71L
transgenic mouse [22]. Transducin-α is normal in
both expression and localization, while GRK1 is
downregulated but remains exclusively in the
outer segments. Two lipidated protein complexes,
PDE6α/β and transducin-β/γ, are found in the
inner segment in both the Arl3-Q71L transgenic
and late Arl3-KO mouse; however, their location
in the presence of Arl3-Q71L appears to be pri-
marily in large inner segment puncta rather than
the diffuse membrane localization seen for mis-
localized lipidated proteins in the late Arl3-KO
mouse. These data imply that although both
knockout and constitutively active expression of
Arl3 cause rod photoreceptor degeneration, the
underlying mechanism behind the degeneration
could be different. Interestingly, the Arl3-Q71L
transgenic mouse also has a layer of rod nuclei
mislocalized to the inner nuclear layer [22], a
phenotype not associated with any of the Arl3
knockout mice. A recent study from our lab con-
firmed that expression of the constitutively active
Arl3-Q71L variant in wild type mouse rods
causes a rod nuclear migration defect [24].
3 Human Mutations in Arl3
In the last few years, human mutations in the
small GTPase Arl3 have been linked to various
forms of retinal degeneration. All the published
data on Arl3 human disease show early involve-
ment of both rod and cone photoreceptors that are
affected across the retina and macula. Therefore,
we will discuss the known Arl3 variants based on
the broader classification of nonsyndromic domi-
nant retinal degeneration, nonsyndromic reces-
sive retinal degeneration, and syndromic
recessive Joubert syndrome. For a thorough dis-
cussion of the clinical phenotypes presented for
each Arl3 variant, please refer to Ratnapriya et al.
[15].
Arl3 was first associated with inherited reti-
nal degeneration when a missense Arl3 variant,
c.269A > G (p.Tyr90Cys), was reported as a
possible cause of nonsyndromic dominant reti-
286
nal degeneration in a family of European
Caucasian decent and then in a Norwegian fam-
ily [11, 19]. Tyr90 is an evolutionarily con-
served residue that resides at the center of the
Arl3 structure where it makes interactions with
a neighboring β-sheet and central α-helix of
Arl3 (Fig. 2). The central location of the human
Tyr90Cys mutation could have a destabilizing
effect on Arl3 structure; however, protein stabil-
ity was not assessed. Another missense Arl3
variant, c.200A > T (p.Asp67Val), was then
identified in a fourth-­ generation family with
nonsyndromic dominant retinal degeneration
[15]. The Asp67 residue resides near the nucle-
otide-binding pocket and is highly conserved
across evolution and the small GTPase family
(Fig. 2). In silico analysis predicts the Asp67Val
substitution will disrupt Arl3 interactions with
Fig. 2 Location of human Arl3 variants. (a) Protein
alignment of multiple Arl3 from different species, human
Arl2 and human Arf1. Known disease causing human
Arl3 variants are highlighted (cyan for dominant, magenta
for recessive) showing these residues are highly con-
served. (b) Secondary linear structure and (c) 3D crystal
A. M. Travis and J. N. Pearring
its effectors, RP2, Arl13B, and UNC119A [15].
For both of these Arl3 variants, only a single
copy is required to cause retinal disease, so it is
likely that the mutation behaves in dominant-
negative manner. Recently, we published a
study that investigated the biochemical and cel-
lular consequences of dominant mutations in
Arl3 [24]. We found that the two dominant Arl3
variants, Arl3-Y90C and Arl3-D67V, pheno-
copied the constitutively active Arl3-Q71L by
causing mislocalization of rod nuclei basally
within ONL and even displaced into the INL. We
went on to show that aberrant activity of Arl3 in
rods caused the developmental nuclear migra-
tion defect; however, each dominant muta-
tion had a different GTPase behavior: D67V
behaved as a constitutively active GTPase and
Y90C functioned as a fast cycling GTPase.
structure of mouse Arl3 (yellow; [21] bound to GTP (red)
and Mg2+ (gray). The residues T31A, D67V, and Y90C
linked to nonsyndromic dominant retinal degeneration are
shown in cyan. The residues R99I, C118F, and R149H/C
linked to nonsyndromic recessive retinal degeneration and
recessive Joubert Syndrome are shown in magenta
Human Mutations in Arl3, a Small GTPase Involved in Lipidated Cargo Delivery to the Cilia, Cause Retinal…
Variants in Arl3 have also been associated
with nonsyndromic recessive retinal degenera-
tion. A homozygous c.296G > T (p. Arg99Ile)
was identified in two large consanguineous
Pakistani families with autosomal recessive
­retinal degeneration [18]. The Arg99 residue is
highly conserved in the small GTPase family as it
forms ionic bonds to stabilize the canonical small
GTPase phosphate-binding loop (aka P-loop,
Fig. 2). Bacterial expression of the Arl3-Arg99Ile
mutant resulted in an insoluble protein, while
exogenous expression in cell culture resulted in a
Arl3 protein that was smaller in size with multi-
ple degradative products; together suggesting
Arl3-Arg99Ile protein is instable and prone to
proteolytic cleavage [18]. Both inheritance pat-
tern and molecular instability are consistent with
the Arg99Ile variant behaving as a loss of
function.
Two missense variants, c.445C > T (p.
Arg149Cys) and c.446G > A (p.Arg149His),
were identified in two unrelate families with
Joubert syndrome, a genetically heterogeneous
neurodevelopmental ciliopathy [1]. Clinical phe-
notypes of these patients were typical for Joubert
syndrome including molar tooth sign on brain
MRI and retinal dystrophy. The Arg149 residue is
highly conserved through evolution as well as
within the small GTPase Arf family (Fig. 2). This
residue is present at the interface between Arl3
and Arl13B where it is involved in ionic interac-
tions with a highly conserved Glu88 residue on
Arl13B [1, 7]. Further experiments revealed that
the Arl3-Arg149His mutant is stable but unable
to bind Arl13B, essentially making this Arl3 vari-
ant inactive. This was further supported when the
ciliary localization of two lipidated proteins,
INPP5E and NPHP3, was shown to be reduced in
patient-derived fibroblast cells compared to con-
trols [1]. Consistent with these findings, a patho-
genic variant in Arl13B (c.236G>, p.Arg79Gln)
that causes Joubert syndrome was also shown to
have reduced GEF activity toward Arl3 [2, 7].
In a Finnish family, two compound heterozy-
gous variants, c.91A > G (p.Thr31Ala) and
287
c.353G > T (p.Cys118Phe), were identified in
Arl3 [6]. The male proband with both variants
had early onset autosomal recessive retinal
degeneration, while his father only had the
c.91A > G (p.Thr31Ala) variant and presented
with late-onset dominant retinal degeneration.
The Thr31 residue is within the nucleotide-­
binding pocket of Arl3 where it forms interac-
tions with the Mg2+ ion necessary for nucleotide
exchange. Mutating the threonine to asparagine
results in an inactive GDP-bound Arl3 protein;
however, the authors suggest that the smaller ala-
nine residue would destabilize nucleotide bind-
ing. Similarly, the Cys118Phe mutation
introduces a large, hydrophobic residue that
would destabilize Arl3 structure. Cycloheximide
chase assays performed on recombinant protein
showed that both Thr31Ala and Cys118Phe vari-
ants had decreased protein stability compared to
wild-type Arl3 [6]. The authors also report that
RP2 binding is reduced with the Cys118Phe
mutations even though this cystine residue
resides on the opposite side of the RP2 inter-
phase, further suggesting overall instability of the
Arl3 protein and a loss of function phenotype.
Arl3 is not a common cause of retinal degen-
eration in humans; however, the recent flurry of
papers showing multiple variants causing domi-
nant, recessive, and syndromic retinal disease
show the necessity of Arl3 for photoreceptor
health. These studies also raised the possibly that
different biochemical alterations in Arl3, whether
the variant is inactivating, destabilizing, or acting
as a dominant negative, could produce divergent
pathobiological mechanisms. Our study
showed that dominant mutations of Arl3 result in
a rod nuclear migration defect not seen with Arl3
loss of function mutations, highlighting that these
patients will likely require different approaches
for treatment [24]. Going forward, it will be
important to understand how dominant human
Arl3 variants alter photoreceptor composition
during development and whether mislocalized
rod nuclei directly cause photoreceptor dysfunc-
tion or degeneration.
288 A. M. Travis and J. N. Pearring

References 13. Linari M, Hanzal-Bayer M, Becker J. The delta sub-

unit of rod specific cyclic GMP phosphodiesterase,
PDE δ, interacts with the Arf-like protein Arl3 in a
1. Alkanderi S, Molinari E, Shaheen R, Elmaghloob Y,
GTP specific manner. FEBS Lett. 1999;458:55–9.
Stephen LA, Sammut V, Ramsbottom SA, Srivastava
14. Najafi M, Maza NA, Calvert PD. Steric volume
S, Cairns G, Edwards N, Rice SJ, Ewida N, Alhashem
exclusion sets soluble protein concentrations in pho-
A, White K, Miles CG, Steel DH, Alkuraya FS, Ismail
toreceptor sensory cilia. Proc Natl Acad Sci U S A.
S, Sayer JA. ARL3 mutations cause Joubert syndrome
2012;109:203–8.
by disrupting ciliary protein composition. Am J Hum
15. Ratnapriya R, Jacobson SG, Cideciyan AV, English
Genet. 2018;103:612–20.
MA, Roman AJ, Sumaroka A, Sheplock R, Swaroop
2. Cantagrel V, et al. Mutations in the cilia gene ARL13B
A. A novel ARL3 gene mutation associated with auto-
lead to the classical form of Joubert syndrome. Am J
somal dominant retinal degeneration. Front Cell Dev
Hum Genet. 2008;83:170–9.
Biol. 2021;9:720782.
3. Cavenagh MM, Breiner M, Schurmann A, Rosenwald
16. Schrick JJ, Vogel P, Abuin A, Hampton B, Rice
AG, Terui T, Zhang C, Randazzo PA, Adams M, Joost
DS. ADP-ribosylation factor-like 3 is involved in
HG, Kahn RA. ADP-ribosylation factor (ARF)-like
kidney and photoreceptor development. Am J Pathol.
3, a new member of the ARF family of GTP-binding
2006;168:1288–98.
proteins cloned from human and rat tissues. J Biol
17. Schwahn U, Lenzner S, Dong J, Feil S, Hinzmann
Chem. 1994;269:18937–42.
B, van Duijnhoven G, Kirschner R, Hemberger M,
4. ElMaghloob Y, Sot B, McIlwraith MJ, Garcia E,
Bergen AA, Rosenberg T, Pinckers AJ, Fundele
Yelland T, Ismail S. ARL3 activation requires the
R, Rosenthal A, Cremers FP, Ropers HH, Berger
co-GEF BART and effector-mediated turnover. elife.
W. Positional cloning of the gene for X-linked retini-
2021;10
tis pigmentosa 2. Nat Genet. 1998;19:327–32.
5. Evans RJ, Schwarz N, Nagel-Wolfrum K, Wolfrum U,
18. Sheikh SA, Sisk RA, Schiavon CR, Waryah YM,
Hardcastle AJ, Cheetham ME. The retinitis pigmen-
Usmani MA, Steel DH, Sayer JA, Narsani AK,
tosa protein RP2 links pericentriolar vesicle transport
Hufnagel RB, Riazuddin S, Kahn RA, Waryah AM,
between the Golgi and the primary cilium. Hum Mol
Ahmed ZM. Homozygous variant in ARL3 causes
Genet. 2010;19:1358–67.
autosomal recessive cone rod dystrophy. Invest
6. Fu L, Li Y, Yao S, Guo Q, You Y, Zhu X, Lei
Ophthalmol Vis Sci. 2019;60:4811–9.
B. Autosomal recessive rod-cone dystrophy associ-
19. Strom SP, Clark MJ, Martinez A, Garcia S, Abelazeem
ated with compound heterozygous variants in. Front
AA, Matynia A, Parikh S, Sullivan LS, Bowne SJ,
Cell Dev Biol. 2021;9:635424.
Daiger SP, Gorin MB. De novo occurrence of a variant
7. Gotthardt K, Lokaj M, Koerner C, Falk N, Gießl A,
in ARL3 and apparent autosomal dominant transmis-
Wittinghofer A. A G-protein activation cascade from
sion of retinitis pigmentosa. PLoS One. 2016;11:1–9.
Arl13B to Arl3 and implications for ciliary targeting
20. Veltel S, Kravchenko A, Ismail S, Wittinghofer
of lipidated proteins. elife. 2015;4:1–16.
A. Specificity of Arl2/Arl3 signaling is mediated by
8. Hanke-Gogokhia C, Wu Z, Gerstner CD, Frederick
a ternary Arl3-effector-GAP complex. FEBS Lett.
JM, Zhang H, Baehr W. Arf-lik8e protein 3 (ARL3)
2008a;582:2501–7.
regulates protein trafficking and Ciliogenesis in mouse
21. Veltel S, Gasper R, Eisenacher E, Wittinghofer A. The
photoreceptors. J Biol Chem. 2016;291:7142–55.
retinitis pigmentosa 2 gene product is a GTPase-­
9. Hanzal-Bayer M, Renault L, Roversi P, Wittinghofer
activating protein for Arf-like 3. Nat Struct Mol Biol.
A, Hillig RC. The complex of Arl2-GTP and
2008b;15:373–80.
PDE delta: from structure to function. EMBO J.
22. Wright ZC, Singh RK, Alpino R, Goldberg AFX,
2002;21:2095–106.
Sokolov M, Ramamurthy V. ARL3 regulates traffick-
10. Holopainen JM, Cheng CL, Molday LL, Johal
ing of prenylated phototransduction proteins to the rod
G, Coleman J, Dyka F, Hii T, Ahn J, Molday
outer segment. Hum Mol Genet. 2016;25:2031–44.
RS. Interaction and localization of the retinitis pig-
23. Zhang H, Constantine R, Vorobiev S, Chen Y,
mentosa protein RP2 and NSF in retinal photorecep-
Seetharaman J, Huang YJ, Xiao R, Montelione GT,
tor cells. Biochemistry. 2010;49:7439–47.
Gerstner CD, Davis MW, Inana G, Whitby FG,
11. Holtan JP, Teigen K, Aukrust I, Bragadóttir R, Houge
Jorgensen EM, Hill CP, Tong L, Baehr W. UNC119 is
G. Dominant ARL3-related retinitis pigmentosa.
required for G protein trafficking in sensory neurons.
Ophthalmic Genet. 2019;40:124–8.
Nat Neurosci. 2011;14:874–80.
12. Ismail SA, Chen Y-X, Miertzschke M, Vetter IR,
24. Travis AM, Manocha S, Willer JR, Wessler TS, Skiba
Koerner C, Wittinghofer A. Structural basis for Arl3-­
NP, Pearring JN. Disrupting the ciliary gradient of
specific release of myristoylated ciliary cargo from
active Arl3 affects rod photoreceptor nuclear migra-
UNC119. EMBO J. 2012;31:4085–94.
tion eLife. 2023;12:80533.
 Genotype–Phenotype Association
in ABCA4-Associated Retinopathy

Maximilian Pfau, Wadih M. Zein, Laryssa A. Huryn,

Catherine A. Cukras, Brett G. Jeffrey,
Robert B. Hufnagel, and Brian P. Brooks

Abstract Keywords

Stargardt disease (STGD1) is the most com- Stargardt disease · ABCA4-associated

mon inherited retina degeneration. It is caused
by biallelic ABCA4 variants, and no treatment
is available to date. STGD1 shows marked
phenotypic variability, especially regarding
the age of onset. The underlying genotype can
partially explain this variability. Notably, a
subset of ABCA4 variants was previously
associated with an earlier disease onset than
truncating ABCA4 variants, pointing toward
pathogenic mechanisms beyond the loss of
gene function in these patients. On the other
end of the spectrum, variants such as p.
Gly1961Glu were associated with markedly
slower extrafoveal disease progression. Given
that these drastic differences in phenotype are
based on genotype (resulting in important
prognostic implications for patients), this
chapter reviews previous approaches to geno-
type–phenotype correlation analyses in
STGD1.
M. Pfau · W. M. Zein · L. A. Huryn · C. A. Cukras ·
B. G. Jeffrey · R. B. Hufnagel · B. P. Brooks (*)
National Eye Institute, National Institutes of Health,
Bethesda, MD, USA
e-mail: maximilian.pfau@iob.ch; zeinw@nei.nih.gov;
laryssa.huryn@nih.gov; cukrasc@nei.nih.gov;
jeffreybg@mail.nih.gov; robert.hufnagel@nih.gov;
brooksb@nei.nih.gov
retinopathy · Disease Progression · Genotype
· Genotype–Phenotype correlation
1 Introduction
Stargardt disease (STGD1, or ABCA4-­
retinopathy) is caused by biallelic variants in the
ATP Binding Cassette Subfamily A Member 4
(ABCA4) gene and represents the most frequent
inherited retinal degeneration [1]. Dysfunction of
the retinal-specific phospholipid-transporting
ATPase ABCA4 results in lipofuscin accumula-
tion in the retinal pigment epithelium (RPE),
leading to eventual atrophy of the RPE and neu-
rosensory retina [2, 3].
The clinical course of Stargardt disease [4] is
characterized by centrifugally progressing RPE
atrophy [5, 6], centrifugally progressing flecks
[7, 8], and peripapillary sparing [9]. The typical
age of onset (in terms of symptoms) is between
the first and the second decade of life, but there is
a wide variation in the age of onset [10]. Initially,
best-corrected visual acuity may be preserved
due to foveal sparing [11].
Accumulation of lipofuscin in the RPE is the
histopathological hallmark of STGD1 [12] and
can be quantified in vivo using autofluorescence
imaging [13]. Importantly, this increase of

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 289
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_42
290
a­utofluorescence precedes the loss of function,
implying that vision could be preserved if lipo-
fuscin accumulation is slowed [13]. Multiple
therapeutic approaches are being evaluated in
clinical trials or preclinical models [2, 3].
Therapeutic strategies currently include slowing
vitamin A delivery to the retina (e.g., RBP4-
antagonist STG-001 [ClinicalTrials.gov
Identifier: NCT04489511]), slowing the visual
cycle biochemically (e.g., RPE65-inhibitor
Emixustat [NCT03772665]), or slowing the rate
of lipofuscin accumulation (e.g., ALK-001,
NCT04239625). Other currently studied thera-
peutic approaches include the complement factor
C5 inhibitor Zimura (NCT03364153) and oral
metformin (NCT04545736).
Despite marked phenotypic differences among
patients with STGD1, genotypic characteristics
are not considered within inclusion or exclusion
criteria in ongoing trials (beyond the confirma-
tion of the diagnosis). Previously, a subset of
ABCA4 variants was shown to be associated with
an earlier disease onset than truncating ABCA4
variants implying pathogenic mechanisms
beyond the mere loss of function [14]. Potentially,
these variants lead to heterogeneity of treatment
effects (hypothetically, patients with these severe
variants benefit to a lesser degree from gene-­
replacement therapy). On the other end of the
spectrum, patients with mild variants may lead to
underpowered studies due to slow progression
rates, diminishing differences in the treatment
and control group (in the absence of stratified
sampling).
Given the importance of understanding phe-
notypic variability and its underlying genetic cor-
relates to inform patients of their prognosis and
clinical trial design, this chapter reviews previous
approaches to genotype–phenotype correlation
analyses in STGD1.
2 Genotype–Phenotype
Correlation Analyses
Published genotype–phenotype analyses
approaches in ABCA4-associated retinopathy can
be subclassified according to (i) the metric of dis-
ease severity and (ii) the scale of the resulting
M. Pfau et al.
genotype severity estimate. Early genotype–phe-
notype correlation analyses were based on quali-
tative, phenotypic descriptions of disease severity
and reported variant severity in a qualitative man-
ner (cf. Sect. 2.1 below). More recent studies
employed semi-quantitative metrics of disease
severity, such as the Lois electrophysiologic
(ERG) classification [15] or ultra-widefield fun-
dus autofluorescence imaging [16]. However,
these two studies reported the variant severity in
a four- or three-step ordinal scaled manner (cf.
Sect. 2.2 below). Only one study so far applied a
quantitative, interval-scaled metric of disease
severity and reported variant severity in an
interval-­scaled manner (cf. Sect. 2.3) [14].
This review focuses only on clinical geno-
type–phenotype analyses. Besides these clinical
approaches, complemental laboratory studies
have investigated the effect of ABCA4 variants,
including biochemical assays of ATPase activity
[17–19], of protein processing [20], in vitro
splice assays [21], and rodent models [22–24].
2.1 Qualitative Genotype–
Phenotype Correlation
Analyses
Shortly after the identification of ABCA4 as the
causal gene for STGD1 [25–28], qualitative geno-
type–phenotype correlations were reported. These
were based on either self-reported age of onset or
descriptive characterizations of the fundus.
For example, Rozet et al. reported in 1998 that
they could identify truncating and missense vari-
ants in patients with a classical STGD1 phenotype
and only missense variants in patients with a late-
onset STGD1 phenotype (termed FFM in their
publication) [28]. Lewis et al. subsequently pro-
vided the first granular genotype–phenotype anal-
ysis highlighting that variants 5′ to codon 863 tend
to be associated with an earlier onset [29].
2.1.1 Qualitative Descriptions of Mild
Variants
In another early study, Fishman et al. 1999 [30]
reported that the typical phenotype associated
with ABCA4 p.Gly1961Glu was characterized by
central atrophy but preserved retina-wide cone
Genotype–Phenotype Association in ABCA4-Associated Retinopathy 291

and rod function as measured by full-field elec- Fakin et al. reported in 2016 a genotype–phe-
troretinogram (ERG). This association of p. notype correlation analysis based on 82 patients
Gly1961Glu with the absence of severe retina-­ with one of 15 missense variants of interest that
wide cone and rod sensitivity loss was also con- were in trans with an established null variant (i.e.,
firmed by Gerth et al. using dark-adapted compound heterozygous for a null and missense
two-color perimetry [31]. ABCA4 p.Gly1961Glu variant; referred to “hemizygous” by Fakin et al.)
has also been linked to the “optical gap pheno- [38]. Further patients homozygous for a subset of
type,” characterized by disruption of the ellipsoid these missense variants (N = 10) and patients with
zone at the fovea, suggesting that the p. biallelic null variants (N = 10) served as compara-
Gly1961Glu variant selectively affects foveal tors. In a first step, the Lois ERG classification
cones. This variant was also shown to lead to a was applied to the data of the “hemizygous”
lesser degree of lipofuscin accumulation using patients. If a given variant in trans with a null vari-
quantitative autofluorescence imaging [32, 33]. ant was always associated with a Lois ERG group
Further, the ABCA4 variant p.Asn1868Ile, 1 phenotype (pattern ERG abnormality, but nor-
which has a minor allele frequency of ~7% in the mal full-field ERG), it was classified as mild (e.g.,
general population, was linked to a mild pheno- p.Gly1961Glu and p.R2030Q). Variants in trans
type [34]. It is characterized by a late age of onset
with a null variant, which were predominantly
and foveal sparing, as well as an overall lower associated with a Lois ERG group 3 phenotype
degree of lipofuscin accumulation [32–34]. (abnormal pattern ERG, abnormal photopic, and
scotopic full-field ERG), were classified as “null-
2.1.2 Qualitative Descriptions like.” Variants in trans with null variants associ-
of Severe Variants ated with a range of ERG phenotypes were
Fukui et al. further extended the spectrum of classified as intermediate. In a second step, the
STGD1 with the description of two brothers phenotype of the “hemizygous” patients was
homozygous for c.1760 + 2 T > G with severe compared to the linear slope of the dark-adapted
pan-retinal degeneration and bone-spicule-like A-wave amplitude in patients with biallelic null
hyperpigmentary changes [35]. Further variants variants. Specifically, the number of eyes that fell
have been linked to a severe STGD1 manifesta- within or outside of the 95% prediction interval
tion with an early onset, including the complex for patients with biallelic null variants was evalu-
allele p.[Leu541Pro;Ala1038Val] and the intronic ated. Based on this ERG analysis, the intermedi-
variant c.5461-10 T > C [36]. ate variants were stratified as “intermediate +”
More recently, more severe forms of early-­ (variants in trans with null that were mostly asso-
onset STGD1 have also been referred to as ciated with a dark-adapted A-wave amplitude out-
“Generalized Choriocapillaris Dystrophy,” [37] side of the 95% prediction interval for biallelic
and “Rapid-Onset Chorioretinopathy” [36]. null variants) and “intermediate-” (dark-adapted
However, clear-cut genetic or phenotypic charac- A-wave amplitude within of the 95% prediction
teristics that differentiate these severe forms of interval for biallelic null variants) [38]. Last, the
STGD1 from the overall spectrum of STGD1 are authors compared patients with variants that led
lacking to date. in trans with null variants to a severe ERG pheno-
type, to patients that were homozygous for these
missense variants. Patients homozygous for some
2.2 Semi-quantitative Genotype– of these variants (p.Arg212Cys, p.Arg1108Cys,
Phenotype Correlation and p.Pro1380Leu) had significantly better ampli-
Analyses tudes compared to their “hemizygous” counter-
parts. Accordingly, these variants were classified
Few studies have summarized the severity of as “intermediate -” [38]. In a later publication,
ABCA4 variants based on interval-scaled metrics deep-intronic ­mutation c.5196 + 1137G > A vari-
of disease severity but reported the results as an ant was added to the classification as “intermedi-
ordinal-scaled, four-step ranking of severity [38]. ate” based on the same approach [39].
292
This approach separated previously consid-
ered mild variants (e.g., p.Gly1961Glu) from
those previously reported as severe (e.g., p.
Cys2150Tyr, or p.[Leu541Pro;Ala1038Val]).
However, the proposed classification approach
has several limitations: (i) the approach always
necessitates data from patients with a known null
or “null-like” variant in trans, (ii) does not allow
to identify variants that are more severe than null-­
variants, and (iii) provides only ordinal-scaled
estimates of variant severity [38].
Recently, Heath Jeffery and coworkers
expanded on this classification based on a large
cohort of patients imaged using the total lesion
size (defined by the outer boundary of flecks)
measured from ultra-widefield fundus autofluo-
rescence imaging. Specifically, the authors eval-
uated 81 STGD1 patients from 65 families.
Patients were either classified based on prior
estimates for variant severity (group A: biallelic
null variants; group B1: with a mild variant [p.
Gly1961Glu, p.Asn1868Ile]; group B2: with an
intermediate variant [p.Leu2027Phe, or the
complex allele p.[Gly863Ala,Gly863del;Asn18
68Ile]), or an uncertain severity (group C).
Then, patients in group C with a self-reported
age of onset <14 years were assigned into the
null/severe variant cohort and patients with a
total lesion size of <200 mm2 as group B1 and
with a total lesion size >200 mm2 as group B2.
Based on this approach, Heath Jeffery and
coworkers estimated the severity for 32
variants.
Like the previous approach, the analysis did
not fully account for the age-dependent nature of
the applied severity metric (total lesion size).
These ordinal-scaled estimates of variant severity
result in a significant loss of information.
2.3 Quantitative Genotype–
Phenotype Correlation
Analyses
Only one previous study employed an interval-­
scaled metric as the criterion for genotype–pheno-
type correlation analysis and reported an
interval-scaled metric for the variant severity [14].
M. Pfau et al.
Cideciyan and coworkers evaluated 66 patients
with STGD1 using light-adapted and dark-­
adapted perimetry [14]. According to the authors,
sensitivity loss could be described by a central,
centrifugally progressing component and a
retina-­wide component (mean retina-wide sensi-
tivity loss for loci at ≥30° eccentricity from the
fovea). In 36 patients, abnormal extramacular rod
or cone sensitivity was evident at one or more
visits. It progressed at an average rate of 1.1 log/
decade (rod sensitivity loss) and 0.45 log/decade
(cone sensitivity loss). Based on these slope esti-
mates, the patient’s age, and the respective retinal
sensitivity, the authors computed for each patient
the age of retina-wide disease initiation (ADI).
For patients with two truncating variants, the ADI
was 10.6 years. Subsequently, the authors esti-
mated for each variant the severity (in terms of
the delay of retina-wide disease initiation) assum-
ing an additive contribution of each variant.
Notably, one-third of the nontruncating variants
were found to cause earlier onset disease than
truncating variants. This was considered as an
evidence for pathogenic pathways beyond the
mere loss of biallelic function [14]. In a later
report by the same group, it was quantitatively
shown using this approach that the complex vari-
ant p.[Leu541Pro;Ala1038Val] is associated with
an earlier disease onset than the p.Ala1038Val
variant [22].
The disadvantages of their approach were that
all analyses were based on the assumption of an
invariant slope of sensitivity loss across patients
[14]. However, the raw data are suggestive of
some between-patient variability in the slope
(Figure 3 in Cideciyan et al.) [14]. Further, the
model of an additive association of variant sever-
ity with the ADI is most likely an oversimplifica-
tion of the underlying biology.
3 Future Directions
Severity estimates based on clinical characteris-
tics are available for many ABCA4 variants.
Importantly, these estimates of variant severity
are mostly congruent. However, four gaps in the
literature are evident that could be addressed.
Genotype–Phenotype Association in ABCA4-Associated Retinopathy 293

3.1 Interval-Scaled Severity 3.3 Differentiating Age-­

Measures as Input
Previous studies have summarized continuous
data as an ordinal-scaled measure of severity.
However, dichotomizing (or discretizing) a con-
tinuous variable will result in a considerable loss
of power [40]. The one study that applied an
interval-scaled measure of disease severity in
terms of the ADI (based on the sensitivity loss
and patient’s age) did so assuming an invariant
slope of sensitivity loss across subjects [14].
Using linear mixed model analysis, it would be
possible to derive slope estimates for patients
with multiple measurements as well as for
patients with only a single measurement (through
“pooling”) [41].
Dependent Severity
from Genuine Phenotypic
Differences
Third, the age-dependent nature of disease sever-
ity metrics has not always been (explicitly)
accounted for in the genotype–phenotype analy-
ses. The framework outlined by Cideciyan and
coworkers, which defined a fixed criterion age for
each patient based on the (estimated) age of
retina-­wide disease initiation, provides a severity
metric independent of the patient’s age of presen-
tation [14].
3.4 Latent Variable Methods

Last, measures for disease severity for STGD1

3.2 Interval-Scaled Reporting have not been assessed systematically using
of Variant Severity latent variable methods. Outside of “station-
ary” dystrophies (e.g., congenital stationary
Second, for most ABCA4 variants, only ordinal-­ night blindness or achromatopsia), the degree
scaled (four- or three-step) data have been pub- of rod and cone degeneration tends to be cor-
lished, even though interval-scaled measures of related in most IRDs. While the commonly
disease severity constituted the starting point for applied Lois ERG classification for STGD1
these analyses. This drastic reduction in granular- treats photopic and scotopic B-wave ampli-
ity complicates the comparison of estimates of tudes as differential information [15], these
allele severity across studies. It also hinders the measures are partially redundant in STGD1.
comparison to in vitro splice assay data, which is On the other hand, BCVA appears to be reflec-
typically reported in an interval-scaled manner tive of an unrelated latent process in STGD1.
[21]. Moreover, ABCA4 variants more severe than As a result, the common ABCA4 p.Gly1961Glu
truncating and frameshift variants have been variant has been reported to be “mild” (based
described (e.g., the complex variant p. on full-field ERG, peripheral perimetric sensi-
[Leu541Pro;Ala1038Val]) [14, 22]. However, the tivity) [38], but as “moderate” (based on the
above-mentioned ordinal-scaled classification age of onset [i.e., BCVA]) [42]. Thus, the
does not provide a distinct class for more severe application of latent variable methods (e.g.,
variants than “null-like” variants. From a clinical principal component analysis or factor analy-
trial perspective, identifying variants more severe sis) is warranted to pool redundant visual func-
than “null-like” variants is a priority since disease tion metrics (improving the signal-to-noise
mechanisms beyond the mere loss of function ratio) and identify nonredundant (low covari-
could contribute to treatment effect heterogeneity. ance) metrics of disease severity.
294 M. Pfau et al.

4 Summary 7. Cukras CA, Wong WT, Caruso R, Cunningham D,

Zein W, Sieving PA. Centrifugal expansion of fundus
autofluorescence patterns in Stargardt disease over
Previous studies have reported qualitative pheno- time. Arch Ophthalmol. 2012 Feb;130(2):171–9.
type–genotype correlations at the level of indi- 8. Cideciyan AV, Swider M, Schwartz SB, Stone EM,
vidual variants and few in a semi-quantitative or Jacobson SG. Predicting progression of ABCA4-­
associated retinal degenerations based on longitudinal
quantitative manner [14, 16, 38]. Only one previ- measurements of the leading disease front. Investig
ous publication has accounted for the time-­ Ophthalmol Vis Sci. 2015 Sep;56(10):5946–55.
dependent nature of disease severity metrics and 9. Cideciyan AV, Swider M, Aleman TS, Sumaroka A,
reported a genotype–phenotype analysis with Schwartz SB, Roman MI, et al. ABCA4-associated
retinal degenerations spare structure and function of
interval-scaled estimates of variant severity [14]. the human parapapillary retina. Investig Ophthalmol
Besides larger sample sizes, future genotype– Vis Sci. 2005 Dec;46(12):4739–46.
phenotype analyses in STGD1 could be improved 10. Lambertus S, van Huet RAC, Bax NM, Hoefsloot LH,
by employing interval-scaled measures of dis- Cremers FPM, Boon CJF, et al. Early-onset stargardt
disease: phenotypic and genotypic characteristics.
ease severity, reporting interval-scaled measures Ophthalmology. 2015 Feb;122(2):335–44.
of allele severity, using age-independent disease 11. van Huet RAC, Bax NM, Westeneng-Van Haaften
severity metrics (instead of disease severity at SC, Muhamad M, Zonneveld-Vrieling MN, Hoefsloot
patient’s age of presentation) and applying latent LH, et al. Foveal sparing in Stargardt disease. Invest
Ophthalmol Vis Sci. 2014 Oct;55(11):7467–78.
variable methods to separate redundant informa- 12. Bonilha VL, Rayborn ME, Bell BA, Marino MJ,
tion from genuine phenotypic characteristics. Fishman GA, Hollyfield JG. Retinal histopathology
in eyes from a patient with Stargardt disease caused
Conflict of Interest Statement The authors have by compound heterozygous ABCA4 mutations.
declared that no conflict of interest exists. Ophthalmic Genet. 2016 June;37(2):150–60.
13. Cideciyan AV, Aleman TS, Swider M, Schwartz SB,
Steinberg JD, Brucker AJ, et al. Mutations in ABCA4
result in accumulation of lipofuscin before slowing of
References the retinoid cycle: a reappraisal of the human disease
sequence. Hum Mol Genet. 2004 Mar;13(5):525–34.
1. Hanany M, Rivolta C, Sharon D. Worldwide carrier 14. Cideciyan AV, Swider M, Aleman TS, Tsybovsky Y,
frequency and genetic prevalence of autosomal reces- Schwartz SB, Windsor EAMM, et al. ABCA4 disease
sive inherited retinal diseases. Proc Natl Acad Sci U S progression and a proposed strategy for gene therapy.
A. 2020 Feb;117(5):2710–6. Hum Mol Genet. 2009 Mar;18(5):931–41.
2. Huang D, Heath Jeffery RC, Aung-Htut MT, 15. Lois N, Holder GE, Bunce C, Fitzke FW, Bird
McLenachan S, Fletcher S, Wilton SD, et al. Stargardt AC. Phenotypic subtypes of Stargardt macular:
disease and progress in therapeutic strategies. dystrophy-fundus flavimaculatus. Arch Ophthalmol
Ophthalmic Genet. 2021 Aug;1–26. [Internet]. 2001 Mar;119(3):359–369. Available from:
3. Cremers FPM, Lee W, Collin RWJ, Allikmets http://www.ncbi.nlm.nih.gov/pubmed/11231769
R. Clinical spectrum, genetic complexity and thera- 16. Heath Jeffery RC, Thompson JA, Lamey TM,
peutic approaches for retinal disease caused by McLaren TL, McAllister IL, Constable IJ, et al.
ABCA4 mutations. Prog Retin Eye Res. 2020 Classifying ABCA4 mutation severity using age-­
Nov;79:100861. dependent ultra-widefield fundus autofluorescence-­
4. Stargardt K. Über familiäre, progressive Degeneration derived total lesion size. Retina 2021 Jun;
in der Maculagegend des Auges. Albr von Graefes 17. Sun H, Smallwood PM, Nathans J. Biochemical defects
Arch für Ophthalmol [Internet]. 1909;71(3):534–550. in ABCR protein variants associated with human reti-
Available from:https://doi.org/10.1007/BF01961301. nopathies. Nat Genet. 2000 Oct;26(2):242–6.
5. Strauss RW, Kong X, Ho A, Jha A, West S, Ip M, 18. Shroyer NF, Lewis RA, Yatsenko AN, Wensel TG,
et al. Progression of Stargardt disease as determined Lupski JR. Cosegregation and functional analy-
by fundus autofluorescence over a 12-month period: sis of mutant ABCR (ABCA4) alleles in families
ProgStar report no. 11. JAMA Ophthalmol. 2019 that manifest both Stargardt disease and age-related
Aug;137(10):1134–45. macular degeneration. Hum Mol Genet. 2001
6. Müller PL, Pfau M, Treis T, Pascual-Camps I, Birtel Nov;10(23):2671–8.
J, Lindner M, et al. Progression of Abca4-related 19. Biswas-Fiss EE. Functional analysis of genetic muta-
retinopathy—prognostic value of demographic, func- tions in nucleotide binding domain 2 of the human
tional, genetic, and imaging parameters. Retina. 2020 retina specific ABC transporter. Biochemistry. 2003
Jan;1. Sep;42(36):10683–96.
Genotype–Phenotype Association in ABCA4-Associated Retinopathy
20. Wiszniewski W, Zaremba CM, Yatsenko AN, Jamrich
M, Wensel TG, Lewis RA, et al. ABCA4 mutations
causing mislocalization are found frequently in
patients with severe retinal dystrophies. Hum Mol
Genet. 2005 Oct;14(19):2769–78.
21. Sangermano R, Khan M, Cornelis SS, Richelle V,
Albert S, Garanto A, et al. ABCA4 midigenes reveal 32.
the full splice spectrum of all reported noncanonical
splice site variants in Stargardt disease. Genome Res.
2018 Jan;28(1):100–10.
22. Zhang N, Tsybovsky Y, Kolesnikov AV, Rozanowska
M, Swider M, Schwartz SB, et al. Protein misfold- 33.
ing and the pathogenesis of ABCA4-associated
retinal degenerations. Hum Mol Genet. 2015
Jun;24(11):3220–37.
23. Weng J, Mata NL, Azarian SM, Tzekov RT, Birch
DG, Travis GH. Insights into the function of rim pro-
tein in photoreceptors and etiology of Stargardt’s dis-
ease from the phenotype in abcr knockout mice. Cell. 34.
1999;98(1):13–23.
24. Charbel Issa P, Barnard AR, Singh MS, Carter E,
Jiang Z, Radu RA, et al. Fundus autofluorescence in
the Abca4(−/−) mouse model of Stargardt disease—
correlation with accumulation of A2E, retinal func- 35.
tion, and histology. Invest Ophthalmol Vis Sci. 2013
Aug;54(8):5602–12.
25. Allikmets R, Singh N, Sun H, Shroyer NF, Hutchinson
A, Chidambaram A, et al. A photoreceptor cell-­
specific ATP-binding transporter gene (ABCR) is 36.
mutated in recessive Stargardt macular dystrophy. Nat
Genet [Internet]. 1997 Mar;15(3):236–246. Available
from: http://www.ncbi.nlm.nih.gov/pubmed/9054934
26. Gerber S, Rozet JM, van de Pol TJ, Hoyng CB, 37.
Munnich A, Blankenagel A, et al. Complete exon-­
intron structure of the retina-specific ATP binding
transporter gene (ABCR) allows the identification
of novel mutations underlying Stargardt disease.
Genomics. 1998 Feb;48(1):139–42. 38.
27. Nasonkin I, Illing M, Koehler MR, Schmid M,
Molday RS, Weber BH. Mapping of the rod photo-
receptor ABC transporter (ABCR) to 1p21-p22.1 and
identification of novel mutations in Stargardt’s dis-
ease. Hum Genet. 1998 Jan;102(1):21–6.
28. Rozet JM, Gerber S, Souied E, Perrault I, Châtelin S, 39.
Ghazi I, et al. Spectrum of ABCR gene mutations in
autosomal recessive macular dystrophies. Eur J Hum
Genet. 1998;6(3):291–5.
29. Lewis RA, Shroyer NF, Singh N, Allikmets R,
Hutchinson A, Li Y, et al. Genotype/phenotype analy- 40.
sis of a photoreceptor-specific ATP-binding cassette
transporter gene, ABCR. Stargardt disease Am J Hum
Genet. 1999 Feb;64(2):422–34. 41.
30. Fishman GA, Stone EM, Grover S, Derlacki DJ,
Haines HL, Hockey RR. Variation of clinical expres-
sion in patients with Stargardt dystrophy and sequence
variations in the ABCR gene. Arch Ophthalmol. 1999 42.
Apr;117(4):504–10.
31. Gerth C, Andrassi-Darida M, Bock M, Preising
MN, Weber BHF, Lorenz B. Phenotypes of 16
295
Stargardt macular dystrophy/fundus flavimacu-
latus patients with known ABCA4 mutations and
evaluation of genotype-­ phenotype correlation.
Graefe’s Arch Clin Exp Ophthalmol = Albr von
Graefes Arch fur Klin und Exp Ophthalmol. 2002
Aug;240(8):628–38.
Duncker T, Stein GE, Lee W, Tsang SH, Zernant
J, Bearelly S, et al. Quantitative fundus autofluo-
rescence and optical coherence tomography in
ABCA4 carriers. Investig Ophthalmol Vis Sci. 2015
Nov;56(12):7274–85.
Müller PL, Gliem M, McGuinnes M, Birtel J, Holz
FG, Charbel IP. Quantitative fundus autofluores-
cence in ABCA4-related retinopathy -functional rel-
evance and genotype-phenotype correlation. Am J
Ophthalmol [Internet]. 2021;222:340–50. Available
from: https://www.sciencedirect.com/science/article/
pii/S0002939420304797
Zernant J, Lee W, Collison FT, Fishman GA, Sergeev
YV, Schuerch K, et al. Frequent hypomorphic alleles
account for a significant fraction of ABCA4 disease
and distinguish it from age-related macular degenera-
tion. J Med Genet. 2017 Jun;54(6):404–12.
Fukui T, Yamamoto S, Nakano K, Tsujikawa M,
Morimura H, Nishida K, et al. ABCA4 gene muta-
tions in Japanese patients with Stargardt disease and
retinitis pigmentosa. Invest Ophthalmol Vis Sci. 2002
Sep;43(9):2819–24.
Tanaka K, Lee W, Zernant J, Schuerch K, Ciccone L,
Tsang SH, et al. The rapid-onset Chorioretinopathy
phenotype of ABCA4 disease. Ophthalmology. 2018
Jan;125(1):89–99.
Bertelsen M, Zernant J, Larsen M, Duno M, Allikmets
R, Rosenberg T. Generalized choriocapillaris dystro-
phy, a distinct phenotype in the spectrum of ABCA4-­
associated retinopathies. Investig Ophthalmol Vis Sci.
2014 May;55(4):2766–76.
Fakin A, Robson AG, Chiang JPW, Fujinami K,
Moore AT, Michaelides M, et al. The effect on reti-
nal structure and function of 15 specific ABCA4
mutations: a detailed examination of 82 Hemizygous
patients. Investig Ophthalmol Vis Sci. 2016
Nov;57(14):5963–73.
Khan M, Arno G, Fakin A, Parfitt DA, Dhooge PPA,
Albert S, et al. Detailed phenotyping and thera-
peutic strategies for intronic ABCA4 variants in
Stargardt disease. Mol Ther Nucleic Acids. 2020
Sep;21:412–27.
Royston P, Altman DG, Sauerbrei W. Dichotomizing
continuous predictors in multiple regression: a bad
idea. Stat Med. 2006 Jan;25(1):127–41.
Bates D, Mächler M, Bolker BM, Walker SC. Fitting
linear mixed-effects models using lme4. J Stat Softw
[Internet]. 2015 Oct 7;67(1). Available from: https://
www.jstatsoft.org/v067/i01
Simonelli F, Testa F, Zernant J, Nesti A, Rossi S,
Allikmets R, et al. Genotype-phenotype correlation
in Italian families with Stargardt disease. Ophthalmic
Res. 2005;37(3):159–67.
 Retinal Pathoconnectomics:
A Window into Neurodegeneration
Rebecca L. Pfeiffer and Bryan W. Jones
Abstract
Over the past decade, the field of retinal con­
nectomics has made huge strides in describing
the precise topologies underlying retinal
visual processing. The same techniques that
allowed these advancements are also appli­
cable to understanding the progression of
rewiring in retinal remodeling: retinal patho­
connectomics. Pathoconnectomics is unique
in its unbiased approach to understanding the
impacts of deafferentation on the remaining
network components and identifying aberrant
connectivities leading to visual processing
defects. Pathoconnectomics also paves the
way for identifying underlying rules of rewir­
ing that may be recapitulated throughout the
nervous system in other neurodegenerative
diseases.
Keywords
Retinal remodeling · Connectomics ·
Pathoconnectome · Ultrastructure · Early
retinal degeneration · Neurodegeneration ·
Neural networks
R. L. Pfeiffer (*) · B. W. Jones
John A. Moran Eye Center, Department of
Ophthalmology, University of Utah,
Salt Lake City, UT, USA
e-mail: r.pfeiffer@utah.edu; bryan.jones@m.cc.utah.
edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_43
1 Introduction
The idea of distributed networks underlying ner­
vous system function dates back to the Roman
physician Galen. As our knowledge of neuroanat­
omy has progressed, understanding neuronal and
glial diversity, along with the molecular contribu­
tions underlying neural networks has proven
invaluable. Yet, a precise understanding of how
neurons are connected to one another, and their
relationships with glia, is an ideal application for
connectomics approaches. Detailing neuronal
class membership and their precise synaptic con­
nections with one another is the basis for the field
of ultrastructural connectomics [1].
A connectome is an audacious undertaking,
requiring the expertise of a team skilled in anat­
omy, histology, electron microscopy, chemistry,
and computational resources to capture, assem­
ble, annotate, and analyze the resulting large data
sets required to encode canonical volumes of
neural tissue [2]. Connectomics approaches
reveal the network architecture ground truth that
have remained hidden to prior techniques.
Connectomics initiatives have revealed numer­
ous specific cell classes possessing greater diver­
sity and network complexity than expected, with
retina leading the way in describing precise net­
work topologies [3–12].
The retina presents a unique opportunity to
explore neuronal networks of the central ner­
vous system (CNS). Retina is compact, highly
297
298
organized, and consists of complex, yet com­
plete, networks that perform all of the algorith­
mic computations associated with visual
primitives, organized in a matrix of repeating
motifs allowing for robust exploration and
quantification. Within the past 10 years, retinal
connectomics has identified novel circuits
including ON-OFF bipolar cell crossover motifs
[4], crossover motifs involving rod and cone
vision [5], nested amacrine cell networks [6],
novel network topologies between amacrine
cells and ganglion cells [7], and numerous gap
junctional coupling motifs below light micros­
copy resolutions [8] that are highly conserved
across the retina. All these network architec­
tures underly components of retinal visual pro­
cessing, illustrating connectomics approaches
for understanding how networks takes seem­
ingly simple input (photons) and transforms it
via neuronal and glial networks into the compo­
nents necessary for interpreting the visual world
around us.
2 Remodeling
Because neural systems are interrelated net­
works, damage to one cell type or region does
not occur without wider network consequences.
This phenomenon was coined “diaschisis” by
von Monakow in 1914 [13] by describing
affected remote regions connected in some way
to the region of injury. Today, noninvasive imag­
ing methods including diffusion tensor imaging
(DTI) and functional magnetic resonance imag­
ing (fMRI) demonstrate pathological disease
spread following injury (e.g., stroke, seizures,
and concussion) and in neurodegenerative dis­
ease (e.g., Alzheimer’s disease, Parkinson’s dis­
ease, and Huntington’s disease) [14].
Redundancy in parallel neural networks com­
pensates for losses to some degree, but the fun­
damental question is: How much damage can
neural networks take before failing?
Understanding the underlying components con­
tributing to disease spread and how the affected
networks breakdown is fundamental to develop­
ing therapies, and we propose that retina is an
R. L. Pfeiffer and B. W. Jones
ideal model to explore network and molecular
components of neural injury.
Negative plasticity has long been known in the
hippocampus and other regions of CNS [15, 16],
and retina is no different in its response to deaf­
ferentation, exhibiting remodeling processes in
trauma or diseases that compromise photorecep­
tors. Remodeling is not restricted to photorecep­
tors in outer retina that comprise the sensory
retina. Following injury (e.g., retinal detachment,
light-induced retinal degeneration) [17–19] or
disease (e.g., retinitis pigmentosa, age-related
macular degeneration) [20–26], the retina under­
goes a progressive series of revisions including
neuritic sprouting, alterations in glutamate chan­
nel expression, aberrant synaptogenesis, and glial
responses [27–29]. Of particular interest to con­
nectomics is the neurite sprouting and aberrant
synaptogenesis underlying rewiring.
Early investigations of retinal remodeling and
rewiring were accomplished through immunohis­
tochemical analyses [29]. These studies demon­
strated a robust, reproducible progression
associated with the severity of photoreceptor
degeneration, regardless of initial insult. Retinal
remodeling is phased revision; in phase 1, rod
photoreceptors become stressed and extend neu­
rite sprouts beyond their normal synaptic part­
ners (rod-contacting horizontal cells (HCs) and
rod bipolar cells (RodBCs) [24, 26, 30].
Simultaneously, RodBCs and HCs begin den­
dritic retraction from the rod photoreceptors with
a subset aberrantly contacting cone photorecep­
tors [31]. In phase 2, photoreceptors (including
cones) continue to degenerate and undergo cell
death. As photoreceptors degenerate, bipolar
cells (BCs) and HCs continue to lose synaptic
input, with BCs becoming completely deaffer­
ented following the complete loss of photorecep­
tors [21, 22]. HCs extend processes deep into
inner retina, though what contacts they make is
unknown [21–23]. Also, during phase 2, ama­
crine cells (ACs) and ganglion cells (GCs) begin
to sprout anomalous neurites that extend outside
of their normal patterns, and make new synapses,
though up to this point precise network motifs
were unknown [20, 25, 28]. Phase 3 remodeling
is characterized by a complete absence of photo­
Retinal Pathoconnectomics: A Window into Neurodegeneration
receptors. At this point, all cell classes have initi­
ated neurite sprouting, coalescing into synaptic
groupings termed “microneuromas” [25]. Within
these microneuromas, ultrastructural anatomy is
consistent with the presence of functional syn­
apses as is evident by the presence of ribbons,
vesicle clouds, and associated post-synaptic
densities.
Combined, these studies demonstrated the
clear presence of network altering morphologies
and individual synapses, but are insufficient to
fully describe the precise ways in which the net­
works as a whole are altered.
3 Pathoconnectomics
and RPC1
Connectomics has demonstrated that complete
network diagrams are required to understand
neural circuitry. A building literature illustrates
that we cannot guess at topologies, we have to
map them [1]. Because networks are altered in
disease, connectomes of pathological tissue, or
“pathoconnectomes,” are therefore necessary to
determine how network topologies are changed,
and rules that underly rewiring. Just as retinas
were ideal for constructing the first connectome,
they also make an ideal platform for creating and
exploring the first pathoconnectomes, retinal
pathoconnectome 1 (RPC1) [32].
RPC1 was constructed from a 10-month-old
transgenic rabbit model of autosomal dominant
human retinitis pigmentosa, originally created in
the Kondo laboratory with a rhodopsin proline
347 to leucine mutation [33]. We previously
detailed progression of degeneration in this rab­
bit [34] and found that it progresses through
cone-sparing retinal degeneration analogous to
that seen in humans [27, 35, 36]. RPC1 was
selected for a reduced photoreceptor layer thick­
ness and shortened rod outer segments, but is
prior to complete rod outer segment loss. This
early time point of retinal degeneration allows
the description of partial deafferentation of rod
connected HCs, RodBCs, and what effects this
has on the downstream neurons in the network.
299
4 Early Findings
Analysis of RPC1 began by examining RodBCs
as they are the source of the first synapse in the
visual system and function as the interneuron
connecting sensory to neural retina, via rod syn­
apses. As predicted from earlier studies, RodBCs
extend processes toward cone axon terminals.
However, in RPC1, we not only confirmed the
presence of synaptic contacts from RodBCs onto
cone pedicles but also demonstrated some cone
inputs were not from the conventional cone ped­
icle, but rather from secondary terminals found
on sprouts off of cones not normally observed in
healthy retina. We also found these novel con­
nections with cones occur prior to complete
deafferentation of RodBCs from rod photorecep­
tors, meaning that at least for part of retinal
degeneration, there is mixed input from both
rods and cones. Next, we evaluated RodBC con­
nections in inner retina and were surprised to
find that although chemical synapse number and
partnerships appear unchanged, gap junctions
emerged between RodBCs and the Aii amacrine
cell [32]. Gap junctions are electrical synapses
coupling many neuronal classes in retina. Within
retina, gap junctions convey polarization state
between Aii amacrine cells and ON-type cone
bipolar cells, allowing RodBCs making chemi­
cal synapses onto Aii amacrine cells to inject
their signals to GCs. The emergence of gap junc­
tional coupling directly between RodBCs and
Aii amacrine cells is a network corruption caus­
ing a feedback loop never found in healthy ret­
ina, likely impacting the duration and timing of
glutamate release by RodBCs. More altered cir­
cuit topologies are currently under investigation
as understanding the complete network and how
it fails in retinal degenerative disease is our goal.
We have continued exploration of the Aii ama­
crine cell and discovering alterations in synapse
partners and numbers as degeneration pro­
gresses. In addition, RPC1 contains numerous
copies of ACs and GCs that are demonstrating
neurite sprouting, indicating this process initi­
ates earlier in retinal degeneration than was pre­
viously predicted.
300
5 Future
of Pathoconnectomics
The next steps are clear as we continue this work
in later stages of retinal degeneration in the next
two pathoconnectomes produced from retinas in
later stages of degeneration: RPC2 and RPC3.
These next pathoconnectomes will reveal how
the network is altered at more advanced stages of
disease progression. In a more global sense, we
believe pathoconnectomics as a field will inform
the wider neuroscience community not only on
the progression of specific neurological diseases
but will also demonstrate specific stereotyped
rules in the way networks change in disease and
will play a crucial role due to the difficulties in
doing whole-brain ultrastructural connectomics.
We have detailed in previous sections, the
advantages of the size, organization, and repeated
motifs of the retina lending it to ultrastructural
connectomics. In addition, our recent work sug­
gests the retina recapitulates neurodegeneration
by entering a stage of progressive neurodegener­
ation following prolonged remodeling, which
appears to only end once all of the neurons of the
retina have degenerated [29]. We further find
similarities between retinal degeneration and
some of the classic neurodegenerative diseases
(Parkinson’s disease and Alzheimer’s disease)
through alterations in α-synuclein and phosphor­
ylated α-synuclein expression [29]. These fea­
tures make the retina ideal to observe how
proteinopathies spread from neuron to neuron as
a potential driving component of neurodegenera­
tion. Lastly, the detailed network topographies
already mapped from retina make it unique in our
ability to identify and track network changes ini­
tiated during rewiring, potentially revealing new,
fundamental mechanisms of neurodegeneration.
Acknowledgments This work was supported by the
National Institutes of Health R01 Grant EY015128(BWJ),
R01 Grant EY02576(BWJ), T32 Grant EY024234 (RLP),
P30 Grant EY014800(Core), the National Science
Foundation Grant (2014862), and an Unrestricted
Research Grant from Research to Prevent Blindness,
New York, NY to the Department of Ophthalmology &
Visual Sciences, University of Utah.
R. L. Pfeiffer and B. W. Jones
References
1. Marc RE, Jones BW, Watt CB, Anderson JR,
Sigulinsky C, Lauritzen S. Retinal connectomics:
towards complete, accurate networks. Prog Retin Eye
Res. 2013;37:141–62.
2. Marc RE, Jones BW, Lauritzen JS, Watt CB,
Anderson JR. Building retinal connectomes. Curr
Opin Neurobiol. 2012;22(4):568–74.
3. Anderson JR, Jones BW, Watt CB, Shaw MV, Yang
JH, Demill D, et al. Exploring the retinal connectome.
Mol Vis. 2011;17:355–79.
4. Lauritzen JS, Anderson JR, Jones BW, Watt CB,
Mohammed S, Hoang JV, et al. ON cone bipolar cell
axonal synapses in the OFF inner plexiform layer of the
rabbit retina. J Comp Neurol. 2013;521(5):977–1000.
5. Lauritzen JS, Sigulinsky CL, Anderson JR, Kalloniatis
M, Nelson NT, Emrich DP, et al. Rod-cone crossover
connectome of mammalian bipolar cells. J Comp
Neurol. 2019;527(1):87–116.
6. Marc RE, Anderson JR, Jones BW, Sigulinsky CL,
Lauritzen JS. The AII amacrine cell connectome: a
dense network hub. Front Neural Circuits. 2014;8:104.
7. Marc RE, Sigulinsky CL, Pfeiffer RL, Emrich D,
Anderson JR, Jones BW. Heterocellular coupling
between Amacrine cells and ganglion cells. Front
Neural Circuits. 2018;12:90.
8. Sigulinsky CL, Anderson JR, Kerzner E, Rapp CN,
Pfeiffer RL, Rodman TM, et al. Network architecture
of gap junctional coupling among parallel process­
ing channels in the mammalian retina. J Neurosci.
2020;40(23):4483–511.
9. Diamond JS. Inhibitory interneurons in the retina:
types, circuitry, and function. Annu Rev Vis Sci.
2017;3:1–24.
10. Thoreson WB, Dacey DM. Diverse cell types, cir­
cuits, and mechanisms for color vision in the verte­
brate retina. Physiol Rev. 2019;99(3):1527–73.
11. Patterson SS, Bordt AS, Girresch RJ, Linehan CM,
Bauss J, Yeo E, et al. Wide-field amacrine cell inputs
to ON parasol ganglion cells in macaque retina. J
Comp Neurol. 2020;528(9):1588–98.
12. Dunn FA, Wong RO. Wiring patterns in the mouse
retina: collecting evidence across the connec­
tome, physiology and light microscopy. J Physiol.
2014;592(22):4809–23.
13. Feeney DM, Baron JC. Diaschisis. Stroke.
1986;17(5):817–30.
14. Fornito A, Zalesky A, Breakspear M. The con­
nectomics of brain disorders. Nat Rev Neurosci.
2015;16(3):159–72.
15. de Lanerolle NC, Kim JH, Robbins RJ, Spencer
DD. Hippocampal interneuron loss and plastic­
ity in human temporal lobe epilepsy. Brain Res.
1989;495(2):387–95.
16. Morimoto K, Fahnestock M, Racine RJ. Kindling and
status epilepticus models of epilepsy: rewiring the
brain. Prog Neurobiol. 2004;73(1):1–60.
Retinal Pathoconnectomics: A Window into Neurodegeneration
17. Fisher SK, Lewis GP, Linberg KA, Verardo
MR. Cellular remodeling in mammalian retina: results
from studies of experimental retinal detachment. Prog
Retin Eye Res. 2005;24(3):395–431.
18. Lewis GP, Fisher SK. Retinal plasticity and interac­
tive cellular remodeling in retinal detachment and
reattachment. In: Pinaud R, Tremere LA, De Weerd P,
editors. Plasticity in the visual system: from genes to
circuits. New York: Springer; 2005. p. 55–78.
19. Lewis GP, Linberg KA, Fisher SK. Neurite outgrowth
from bipolar and horizontal cells after experimen­
tal retinal detachment. Invest Ophthalmol Vis Sci.
1998;39(2):424–34.
20. Marc RE, Jones BW, Watt CB, Strettoi E. Neural
remodeling in retinal degeneration. Prog Retin Eye
Res. 2003;22(5):607–55.
21. Strettoi E, Pignatelli V. Modifications of retinal neu­
rons in a mouse model of retinitis pigmentosa. Proc
Natl Acad Sci U S A. 2000;97(20):11020–5.
22. Strettoi E, Pignatelli V, Rossi C, Porciatti V, Falsini
B. Remodeling of second-order neurons in the retina
of rd/rd mutant mice. Vis Res. 2003;43(8):867–77.
23. Strettoi E, Porciatti V, Falsini B, Pignatelli V, Rossi
C. Morphological and functional abnormalities
in the inner retina of the rd/rd mouse. J Neurosci.
2002;22(13):5492–504.
24. Fariss RN, Li ZY, Milam AH. Abnormalities in rod
photoreceptors, amacrine cells, and horizontal cells
in human retinas with retinitis pigmentosa. Am J
Ophthalmol. 2000;129(2):215–23.
25. Jones BW, Watt CB, Frederick JM, Baehr W, Chen
CK, Levine EM, et al. Retinal remodeling triggered
by photoreceptor degenerations. J Comp Neurol.
2003;464(1):1–16.
26. Li ZY, Kljavin IJ, Milam AH. Rod photoreceptor
neurite sprouting in retinitis pigmentosa. J Neurosci.
1995;15(8):5429–38.
301
27. Jones BW, Kondo M, Terasaki H, Lin Y, McCall M,
Marc RE. Retinal remodeling. Jpn J Ophthalmol.
2012;56(4):289–306.
28. Marc RE, Jones BW. Retinal remodeling in inher­
ited photoreceptor degenerations. Mol Neurobiol.
2003;28(2):139–47.
29. Pfeiffer RL, Marc RE, Jones BW. Persistent remodel­
ing and neurodegeneration in late-stage retinal degen­
eration. Prog Retin Eye Res. 2020;74:100771.
30. Sethi CS, Lewis GP, Fisher SK, Leitner WP, Mann
DL, Luthert PJ, et al. Glial remodeling and neural
plasticity in human retinal detachment with prolif­
erative vitreoretinopathy. Invest Ophthalmol Vis Sci.
2005;46(1):329–42.
31. Peng YW, Hao Y, Petters RM, Wong F. Ectopic syn­
aptogenesis in the mammalian retina caused by rod
photoreceptor-specific mutations. Nat Neurosci.
2000;3(11):1121–7.
32. Pfeiffer RL, Anderson JR, Dahal J, Garcia JC, Yang
JH, Sigulinsky CL, et al. A pathoconnectome of early
neurodegeneration: network changes in retinal degen­
eration. Exp Eye Res. 2020;199:108196.
33. Kondo M, Sakai T, Komeima K, Kurimoto Y, Ueno S,
Nishizawa Y, et al. Generation of a transgenic rabbit
model of retinal degeneration. Invest Ophthalmol Vis
Sci. 2009;50(3):1371–7.
34. Jones BW, Kondo M, Terasaki H, Watt CB, Rapp K,
Anderson J, et al. Retinal remodeling in the Tg P347L
rabbit, a large-eye model of retinal degeneration. J
Comp Neurol. 2011;519(14):2713–33.
35. Jones BW, Pfeiffer RL, Ferrell WD, Watt CB, Marmor
M, Marc RE. Retinal remodeling in human retinitis
pigmentosa. Exp Eye Res. 2016;150:149–65.
36. Jones BW, Pfeiffer RL, Ferrell WD, Watt CB, Tucker
J, Marc RE. Retinal remodeling and metabolic
alterations in human AMD. Front Cell Neurosci.
2016;10:103.
 The Role of Ceramide in Inherited
Retinal Disease Pathology

Xinye Qian, Tanmay Srinivasan, Jessica He,

and Rui Chen

Abstract underlying molecular basis for clinical pheno-

Ceramide (Cer) plays an essential role in pho-
toreceptor cell death in the retina. On the one
hand, Cer accumulation emerges as a common
feature during retina neurodegeneration, lead-
ing to the death of photoreceptors. On the
other hand, Cer deficiency has also recently
been associated with retinal dysfunction and
degeneration. Although more and more evi-
dence supports the importance of maintaining
Cer homeostasis in the retina, mechanistic
explanations of the observed phenotypes,
especially in the context of Cer deficiency, are
still lacking. An enhanced understanding of
Cer’s role in the retina will help us explore the
X. Qian (*)
Verna and Marrs McLean Department of
Biochemistry and Molecular Biology, Baylor College
of Medicine, Houston, TX, USA
Human Genome Sequencing Center, Baylor College
of Medicine, Houston, TX, USA
e-mail: xinye.qian@bcm.edu
T. Srinivasan · J. He
Rice University, Houston, TX, USA
e-mail: ts59@rice.edu; jh134@rice.edu
R. Chen
Human Genome Sequencing Center, Baylor College
of Medicine, Houston, TX, USA
Department of Molecular and Human Genetics,
Baylor College of Medicine, Houston, TX, USA
e-mail: ruichen@bcm.edu
types of retinal dystrophies and provide us
with potential therapeutic targets.
Keywords
Inherited retinal diseases · Photoreceptor ·
Ceramide · Ceramide synthase · Retinal
degeneration · Sphingolipid metabolism ·
Apoptosis
1 Introduction
Apoptosis of photoreceptors leads to retinal dys-
function in inherited retinal diseases (IRDs), a
complex heterogeneous group of diseases that
can cause severe vision loss or even blindness.
Although individually rare, retinal degeneration
in IRD patients leads to the irreversible death of
photoreceptors. IRDs are genetically heteroge-
neous, with more than 270 disease genes discov-
ered to date [1]. Currently, a variety of therapeutic
approaches to treat IRDs are under development,
with some success of neurotrophic factor therapy
and gene therapies reported from clinical trials
[4–8, 18, 25, 31, 44].
For years, many have searched for common
intracellular second messengers for these many
forms of cell death that can be targeted for ther-
apy. Despite the exciting progress in IRD therapy,
the heterogeneity of IRDs hampers the develop-

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 303
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_44
304
ment of a common treatment for a large number
of patients, calling for the need for some com-
mon intracellular second messenger, which could
be targeted for therapy. Understanding of which
mediators participate in the induction of photore-
ceptor cell death is still limited. Ceramide (Cer),
a class of sphingolipid which is abundant in cell
membranes, is a bioactive lipid proposed to be a
cellular second messenger that signals for apop-
tosis [22, 23, 36]. This chapter will address the
role of Cers in the pathogenic pathways of retinal
degenerative diseases.
2 Ceramide Metabolism
Cers, as the central molecule of the highly inter-
connected sphingolipid metabolic pathways,
forms the backbone of all complex sphingolipids
and is an essential player in key cellular func-
tions. There are three different pathways for the
biological generation of Cers. De novo synthesis
pathway takes place in the endoplasmic reticu-
lum through reactions catalyzed by different
enzymes, including serine palmitoyltransferase
(SPT), ceramide synthase (CerS), and dihydroc-
eramide desaturase [10, 28, 32]. The sphingomy-
elinase pathway is carried out through the
degradation of sphingomyelin by sphingomye-
linase (SMase)​​ [21, 26, 45]. In the salvage path-
way, complex sphingolipids are broken down by
different hydrolases, leading to the recycling of
sphingosines and complex sphingolipids [15,
35].
Ceramide Accumulation: A Common
Activator in Photoreceptor Degeneration
During the past decade, more and more evidence
supports a role for Cer as a mediator of photore-
ceptor death. In rat retina neuronal culture, exog-
enous addition of C2-Cer triggered photoreceptor
apoptosis, whereas inhibition of Cer synthesis by
CerS or SMase inhibitor protected photorecep-
tors from oxidative stress-induced apoptosis [19,
40], suggesting a role of Cer in oxidative stress
induced-photoreceptor cell death. Additionally,
treatment of C8-Cer and C16-Cer in 661 W cells
X. Qian et al.
led to cell death [14], providing additional sup-
port of CerS’s role as a death mediator in retinal
cells.
In addition to the discoveries made in vitro,
in vivo studies also support Cer involvement in
photoreceptor cell death. The correlation between
Cer and death of retinal neurons was first found
in a Drosophila model [2, 3]. Cers has also been
associated with retinal apoptosis following reti-
nal detachment in a rabbit model [37]. Increased
retinal Cer levels accompanied by photoreceptor
death were observed in rd10 mice, while photore-
ceptors were rescued by myriocin, a powerful
SPT inhibitor [43]. Intravitreal injection of C2-
Cer causes significant vision loss and blood-­
retinal barrier breakdown in rats [30]. In both the
P23H-1 and light-damaged rat models, the inhi-
bition of Cer synthesis with FTY720, a CerS
inhibitor, protected photoreceptors from degen-
eration [13, 42].
Interestingly, beyond the realm of IRDs, reti-
nal impairment and vision loss accompanied by
Cer accumulation have also been observed in
patients with several types of ‘lipid storage dis-
eases,’ which are characterized by inherited
sphingolipid metabolism defects, such as
Krabbe’s disease [11], Niemann-Pick disease
[38], Sandhoff disease [39], and Gaucher disease
[41].
3 Ceramide Depletion by CerSs
Deletion Also Has
Deleterious Effects
on the Retina
In mammals, de novo Cer synthesis is catalyzed
by six CerSs: CerS1–6 [34]. Each CerS regulates
the formation of a specific set of Cers with vari-
able chain lengths and mediates distinct func-
tions. There is redundancy in the Cers synthesized
by each synthase, but no CerS can completely
compensate for another. CerS1 specifically syn-
thesizes C18 Cers [20, 33], while CerS4 prefers
C20 acyl-CoAs [16]. CerS2 generates longer
chain, C22–24 Cers [24], whereas CerS3 synthe-
sizes Cers with ultra-long-chain lengths, up to
The Role of Ceramide in Inherited Retinal Disease Pathology
C36 [27]. CerS5 and CerS6 synthesize C14 to References
C16 Cers [17, 29]. Retinal functions were previ-
ously examined in CerS1-, CerS2-, and CerS4-­ 1. RetNet. Available at: http://www.sph.uth.tmc.edu/
deficient mice [12]. Although retinal dysfunction
was detected by electroretinograms, no signifi-
cant morphological defects were detected in
these three mouse models [12]. In addition to the
canonical CerSs, it has been reported in an
in vitro study that the protein encoded by the
TLCD3B gene also has CerS activity [46].
TLCD3B is responsible for the synthesis of C16-,
C18-, and C20-Cers in vitro [46] and was
­confirmed by an in vivo study on Tlcd3b−/− mouse
model (Qian et al. unpublished). Patients with
TLCD3B mutations are diagnosed with cone-rod
dystrophy or maculopathy. Their phenotypes are
restricted to the retina [9], while 7-month-old
Tlcd3b−/− mice demonstrate both retinal dysfunc-
tion and degeneration [9].
TLCD3B has been proven to have a much
higher expression level than the other 6 canonical
CerSs in the retina [9], which may explain why
so far only TLCD3B mutations have been associ-
ated with retinopathies.
4 Conclusion
Cer is known to act as a key player in various
forms of photoreceptor cell death, and recent
studies also demonstrated the importance of
maintaining the overall Cer homeostasis in the
retina. The discovery of Cer as a key mediator in
photoreceptor degeneration has a significant
impact on the development of IRD therapies. As
a common arbitrator in the photoreceptor apopto-
sis and pathogenicity, Cer is a perfect target for
the development of therapeutic approaches
designed for IRDs. Nevertheless, Cer metabo-
lism is inherently complex, and it is highly
involved with other sphingolipids like sphingo-
sine and dihydroceramide, or bioactive Cer
metabolites, such as S1P and C1P. Therefore,
careful investigations need to be done on other
players in the sphingolipid metabolic pathways
to determine how their interactions affect photo-
receptor degeneration.
305
RetNet/ Accessed 9 July 2018.
2. Acharya JK, Dasgupta U, Rawat SS, Yuan C,
Sanxaridis PD, Yonamine I, Karim P, Nagashima K,
Brodsky MH, Tsunoda S. Cell-nonautonomous func-
tion of ceramidase in photoreceptor homeostasis.
Neuron. 2008;57:69–79.
3. Acharya U, Patel S, Koundakjian E, Nagashima K,
Han X, Acharya JK. Modulating sphingolipid biosyn-
thetic pathway rescues photoreceptor degeneration.
Science. 2003;299:1740–3.
4. Bainbridge JW, Smith AJ, Barker SS, Robbie S,
Henderson R, Balaggan K, Viswanathan A, Holder
GE, Stockman A, Tyler N, Petersen-Jones S,
Bhattacharya SS, Thrasher AJ, Fitzke FW, Carter BJ,
Rubin GS, Moore AT, Ali RR. Effect of gene therapy
on visual function in Leber's congenital amaurosis. N
Engl J Med. 2008;358:2231–9.
5. Bainbridge JW, et al. Long-term effect of gene ther-
apy on Leber's congenital amaurosis. N Engl J Med.
2015;372:1887–97.
6. Bennett J, et al. Safety and durability of effect of
contralateral-­eye administration of AAV2 gene ther-
apy in patients with childhood-onset blindness caused
by RPE65 mutations: a follow-on phase 1 trial.
Lancet. 2016;388:661–72.
7. Berson EL, Rosner B, Sandberg MA, Hayes KC,
Nicholson BW, Weigel-DiFranco C, Willett W. A
randomized trial of vitamin A and vitamin E supple-
mentation for retinitis pigmentosa. Arch Ophthalmol.
1993;111:761–72.
8. Berson EL, Rosner B, Sandberg MA, Weigel-­
DiFranco C, Moser A, Brockhurst RJ, Hayes KC,
Johnson CA, Anderson EJ, Gaudio AR, Willett WC,
Schaefer EJ. Clinical trial of docosahexaenoic acid in
patients with retinitis pigmentosa receiving vitamin A
treatment. Arch Ophthalmol. 2004;122:1297–305.
9. Bertrand RE, Wang J, Xiong KH, Thangavel C, Qian
X, Ba-Abbad R, Liang Q, Simões RT, Sampaio SAM,
Carss KJ, Lucy Raymond F, Robson AG, Webster
AR, Arno G, Porto FBO, Chen R. Ceramide synthase
TLCD3B is a novel gene associated with human reces-
sive retinal dystrophy. Genet Med. 2021;23:488–97.
10. Bose R, Verheij M, Haimovitz-Friedman A, Scotto
K, Fuks Z, Kolesnick R. Ceramide synthase medi-
ates daunorubicin-induced apoptosis: an alterna-
tive mechanism for generating death signals. Cell.
1995;82:405–14.
11. Brownstein S, Meagher-Villemure K, Polomeno
RC, Little JM. Optic nerve in globoid leukodystro-
phy (Krabbe's disease): ultrastructural changes. Arch
Ophthalmol. 1978;96:864–70.
12. Brüggen B, Kremser C, Bickert A, Ebel P, vom
Dorp K, Schultz K, Dörmann P, Willecke K, Dedek
K. Defective ceramide synthases in mice cause
reduced amplitudes in electroretinograms and altered
306
sphingolipid composition in retina and cornea. Eur J
Neurosci. 2016;44:1700–13.
13. Chen H, Tran J-TA, Eckerd A, Huynh T-P, Elliott MH,
Brush RS, Mandal NA. Inhibition of de novo ceramide
biosynthesis by FTY720 protects rat retina from light-­
induced degeneration. J Lipid Res. 2013;54:1616–29.
14. Chen H, Tran J-TA, Brush RS, Saadi A, Rahman
AK, Yu M, Yasumura D, Matthes MT, Ahern K,
Yang H, LaVail MM, Mandal MNA. Ceramide sig-
naling in retinal degeneration. Adv Exp Med Biol.
2012;723:553–8.
15. Dbaibo GS, El-Assaad W, Krikorian A, Liu B, Diab
K, Idriss NZ, El-Sabban M, Driscoll TA, Perry DK,
Hannun YA. Ceramide generation by two distinct
pathways in tumor necrosis factor alpha-induced cell
death. FEBS Lett. 2001;503:7–12.
16. Ebel P, Imgrund S, Vom Dorp K, Hofmann K, Maier
H, Drake H, Degen J, Dörmann P, Eckhardt M, Franz
T, Willecke K. Ceramide synthase 4 deficiency in
mice causes lipid alterations in sebum and results in
alopecia. Biochem J. 2014;461:147–58.
17. Ebel P, Vom Dorp K, Petrasch-Parwez E, Zlomuzica A,
Kinugawa K, Mariani J, Minich D, Ginkel C, Welcker
J, Degen J, Eckhardt M, Dere E, Dörmann P, Willecke
K. Inactivation of ceramide synthase 6 in mice results
in an altered sphingolipid metabolism and behavioral
abnormalities. J Biol Chem. 2013;288:21433–47.
18. Edwards TL, Jolly JK, Groppe M, Barnard AR,
Cottriall CL, Tolmachova T, Black GC, Webster
AR, Lotery AJ, Holder GE, Xue K, Downes SM,
Simunovic MP, Seabra MC, MacLaren RE. Visual
acuity after retinal gene therapy for choroideremia. N
Engl J Med. 2016;374:1996–8.
19. German OL, Miranda GE, Abrahan CE, Rotstein
NP. Ceramide is a mediator of apoptosis in ret-
ina photoreceptors. Invest Ophthalmol Vis Sci.
2006;47:1658–68.
20. Ginkel C, Hartmann D, vom Dorp K, Zlomuzica
A, Farwanah H, Eckhardt M, Sandhoff R, Degen
J, Rabionet M, Dere E, Dörmann P, Sandhoff K,
Willecke K. Ablation of neuronal ceramide synthase
1 in mice decreases ganglioside levels and expression
of myelin-associated glycoprotein in oligodendro-
cytes. J Biol Chem. 2012;287:41888–902.
21. Hannun YA. The sphingomyelin cycle and the sec-
ond messenger function of ceramide. J Biol Chem.
1994;269:3125–8.
22. Hannun YA. Functions of ceramide in coordinating cel-
lular responses to stress. Science. 1996;274:1855–9.
23. Hannun YA, Obeid LM. The ceramide-cen-
tric universe of lipid-mediated cell regulation:
stress encounters of the lipid kind. J Biol Chem.
2002;277:25847–50.
24. Imgrund S, Hartmann D, Farwanah H, Eckhardt M,
Sandhoff R, Degen J, Gieselmann V, Sandhoff K,
Willecke K. Adult ceramide synthase 2 (CERS2)-
deficient mice exhibit myelin sheath defects, cerebel-
lar degeneration, and hepatocarcinomas. J Biol Chem.
2009;284:33549–60.
X. Qian et al.
25. Jacobson SG, et al. Gene therapy for leber congeni-
tal amaurosis caused by RPE65 mutations: safety and
efficacy in 15 children and adults followed up to 3
years. Arch Ophthalmol. 2012;130:9–24.
26. Jarvis WD, Kolesnick RN, Fornari FA, Traylor RS,
Gewirtz DA, Grant S. Induction of apoptotic DNA
damage and cell death by activation of the sphin-
gomyelin pathway. Proc Natl Acad Sci U S A.
1994;91:73–7.
27. Jennemann R, Rabionet M, Gorgas K, Epstein S,
Dalpke A, Rothermel U, Bayerle A, van der Hoeven F,
Imgrund S, Kirsch J, Nickel W, Willecke K, Riezman
H, Gröne HJ, Sandhoff R. Loss of ceramide synthase
3 causes lethal skin barrier disruption. Hum Mol
Genet. 2012;21:586–608.
28. Kalén A, Borchardt RA, Bell RM. Elevated ceramide
levels in GH4C1 cells treated with retinoic acid.
Biochim Biophys Acta. 1992;1125:90–6.
29. Levy M, Futerman AH. Mammalian ceramide syn-
thases. IUBMB Life. 2010;62:347–56.
30. Lou H, Kang D, Yang Q, Lian C, Zhang C, Li Z, Tian
H, Lu L, Xu GT, Xu G, Zhang J. Erythropoietin pro-
tects retina against ceramide 2-induced damage in rat.
Curr Mol Med. 2017;17:699–706.
31. MacLaren RE, Groppe M, Barnard AR, Cottriall
CL, Tolmachova T, Seymour L, Clark KR, During
MJ, Cremers FP, Black GC, Lotery AJ, Downes SM,
Webster AR, Seabra MC. Retinal gene therapy in
patients with choroideremia: initial findings from a
phase 1/2 clinical trial. Lancet. 2014;383:1129–37.
32. Mandon EC, Ehses I, Rother J, van Echten G, Sandhoff
K. Subcellular localization and membrane topology
of serine palmitoyltransferase, 3-­dehydrosphinganine
reductase, and sphinganine N-acyltransferase in
mouse liver. J Biol Chem. 1992;267:11144–8.
33. Mizutani Y, Kihara A, Igarashi Y. Mammalian Lass6
and its related family members regulate synthesis of
specific ceramides. Biochem J. 2005;390:263–71.
34. Mullen TD, Hannun YA, Obeid LM. Ceramide syn-
thases at the centre of sphingolipid metabolism and
biology. Biochem J. 2012;441:789–802.
35. Novgorodov SA, Wu BX, Gudz TI, Bielawski J,
Ovchinnikova TV, Hannun YA, Obeid LM. Novel
pathway of ceramide production in mitochondria:
thioesterase and neutral ceramidase produce ceramide
from sphingosine and acyl-CoA. J Biol Chem.
2011;286:25352–62.
36. Pettus BJ, Chalfant CE, Hannun YA. Ceramide in
apoptosis: an overview and current perspectives.
Biochim Biophys Acta. 2002;1585:114–25.
37. Ranty M-L, Carpentier S, Cournot M, Rico-Lattes
I, Malecaze F, Levade T, Delisle M-B, Quintyn
J-C. Ceramide production associated with retinal
apoptosis after retinal detachment. Graefes Arch Clin
Exp Ophthalmol. 2009;247:215.
38. Robb RM, Kuwabara T. The ocular pathology of
type A Niemann-Pick disease: a light and elec-
tron microscopic study. Invest Ophthalmol Vis Sci.
1973;12:366–77.
The Role of Ceramide in Inherited Retinal Disease Pathology
39. Sango K, Yamanaka S, Ajiki K, Arai N, Takano
M. Involvement of retinal neurons and pigment epi-
thelial cells in a murine model of sandhoff disease.
Ophthalmic Res. 2008;40:241–8.
40. Sanvicens N, Cotter TG. Ceramide is the key mediator
of oxidative stress-induced apoptosis in retinal photo-
receptor cells. J Neurochem. 2006;98:1432–44.
41. Seidova S-F, Kotliar K, Foerger F, Klopfer M, Lanzl
I. Functional retinal changes in Gaucher disease. Doc
Ophthalmol. 2009;118:151–4.
42. Stiles M, Qi H, Sun E, Tan J, Porter H, Allegood
J, Chalfant CE, Yasumura D, Matthes MT, LaVail
MM. Sphingolipid profile alters in retinal dystrophic
P23H-1 rats and systemic FTY720 can delay retinal
degeneration [S]. J Lipid Res. 2016;57:818–31.
43. Strettoi E, Gargini C, Novelli E, Sala G, Piano I,
Gasco P, Ghidoni R. Inhibition of ceramide biosyn-
thesis preserves photoreceptor structure and function
in a mouse model of retinitis pigmentosa. Proc Natl
Acad Sci. 2010;107:18706–11.
307
44. Weleber RG, Pennesi ME, Wilson DJ, Kaushal
S, Erker LR, Jensen L, McBride MT, Flotte TR,
Humphries M, Calcedo R, Hauswirth WW, Chulay
JD, Stout JT. Results at 2 years after gene therapy
for RPE65-deficient Leber congenital Amaurosis
and severe early-childhood-onset retinal dystrophy.
Ophthalmology. 2016;123:1606–20.
45. Wiesner DA, Dawson G. Staurosporine induces
programmed cell death in embryonic neurons and
activation of the ceramide pathway. J Neurochem.
1996;66:1418–25.
46. Yamashita-Sugahara Y, Tokuzawa Y, Nakachi Y,
Kanesaki-Yatsuka Y, Matsumoto M, Mizuno Y,
Okazaki Y. Fam57b (family with sequence similar-
ity 57, member B), a novel peroxisome proliferator-­
activated receptor γ target gene that regulates
adipogenesis through ceramide synthesis. J Biol
Chem. 2013;288:4522–37.
 Extracellular Matrix:
The Unexplored Aspects of Retinal
Pathologies and Regeneration

Dmitri Serjanov and David R. Hyde

Abstract Membrane · Bruch’s Membrane ·

Interphotoreceptor Matrix · Collagen ·
Nearly a billion people worldwide are affected Laminin · Integrin
by vision-impairing conditions, with retinal
degenerative diseases being a major cause of
blindness. Unfortunately, such diseases are
often permanent and progressive, resulting in Abbreviations
further degeneration and loss of sight, due to
the human retina possessing little, if any, AMD Acute Macular Degeneration
regenerative capacity. Despite numerous BM Basement Membrane
efforts and great progress being made to BrM Bruch’s Membrane
understand the molecular mechanisms of ECM Extracellular Matrix
these diseases and possible therapies, the ILM Inner-Limiting Membrane
majority of investigations focused on cell-­ IPM Interphotoreceptor Matrix
intrinsic factors. However, the microenviron- IRBP Interphotoreceptor Retinoid-Binding
ment surrounding retinal cells throughout Protein
these processes also plays an important role, SM Synaptic Matrix
though our current understanding of its
involvement remains limited. Here we present
a brief overview of the current state of the field 1 Introduction
of extracellular matrix studies within the ret-
ina and its potential roles in retinal diseases The CNS of most vertebrates, including humans,
and potential therapeutic approaches. has very limited regenerative capacity. The ret-
ina, an accessible part of the CNS, is no excep-
Keywords tion. Injuries or degenerative diseases often lead
to impaired retinal function and reduced visual
Extracellular Matrix · Retinal Degeneration ·
ability of the affected person. Unfortunately, reti-
Retinal Regeneration · Inner-Limiting
nal injuries and degenerative diseases leading to
vision loss are permanent and often progressive,
D. Serjanov · D. R. Hyde (*) resulting in further degeneration and loss of sight.
Department of Biological Sciences, University of However, some organisms, such as zebrafish,
Notre Dame, Notre Dame, IN, USA possess the ability to regenerate any retinal
e-mail: dserjano@nd.edu; dhyde@nd.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 309
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_45
310
n­ eurons that are lost and restore visual behaviors
through the reprogramming of Muller glia and
their asymmetric cell division to produce neuro-
nal progenitor cells [1]. Elucidating what con-
trols Muller glia reprogramming, neuronal
progenitor cell production, and neuronal differ-
entiation during regeneration may provide
insights in how to induce a regeneration response
in mammals.
Despite great advances in our understanding
of the processes governing retinal regeneration,
the investigations of these mechanisms were con-
centrated mainly on intrinsic factors, while our
understanding of the role of the microenviron-
ment remains limited. Indeed, characterizing the
extracellular matrix (ECM) and its role in retinal
degenerative diseases and as a possible target for
regeneration strategies has been understudied.
The ECMs in the eye are abundant and diverse in
their location, composition, and function. They
include the basement membranes (BMs), such as
the inner limiting membrane (ILM) and Bruch’s
membrane (BrM). Numerous studies demon-
strated the importance of ILM and BrM signaling
and composition in retinal development and tis-
sue architecture [2, 3]. Non-BM matrices include
the interphotoreceptor matrix (IPM) surrounding
the photoreceptor outer segments and filling the
subretinal space and the synaptic matrices (SM),
which surround the synapses connecting the reti-
nal cells. Their composition is highly dynamic
and changes dramatically over the course of ret-
inogenesis and disease progression.
For many years, ECM was only considered for
its structural role in tissue maintenance, but grad-
ually, its role in molecular signaling has been rec-
ognized and appreciated. In recent years, the
biochemical aspects of the ECM and its role in
organizing and polarizing the cytoskeleton, as
well as guiding its tension forces, were identified.
Despite the many advances in our understanding
of ECM biology in other tissues, investigations
into its involvement in retinal morphogenesis,
pathogenesis, and regeneration are severely lag-
ging behind. The following review aims to give a
brief overview of these structures and their
involvement in neurodegenerative diseases of the
retina.
D. Serjanov and D. R. Hyde
2 ECM in the Retina
In general, the ECM may be divided into two cat-
egories based on its location and composition: a
collagen and fibronectin-rich interstitial matrix,
which surrounds the cells; and highly organized
BMs, which separate the epithelial cells from the
stroma and provide a vast range of molecular
cues necessary for proper tissue development and
maintenance [4]. There are two different base-
ment membranes in the retina – the ILM, separat-
ing the neural retina from the vitreous, which is
mainly composed of multiple laminins, collagens
type IV and XVIII, perlecan, agrin, and nidogen
[5]; and the BrM, underlying the RPE, which is
mainly composed of laminins, multiple colla-
gens, fibronectin, elastin, and endostatin [3]. It
should also be noted that in humans and other
species with a vascularized retina, the BMs of the
blood vessels play important structural and bio-
molecular roles [6–9]. Despite its name, the
external limiting membrane is not a BM, but
rather a confluence of cellular junctions between
the Müller glia and photoreceptors.
3 Inner-Limiting Membrane
The ILM plays a crucial role in retinal develop-
ment and homeostasis. The incredible complexity
of the ILM composition and development is high-
lighted by the findings that the lens and the ciliary
body produce the main components required for
ILM assembly, such as laminins and type IV col-
lagen, and secrete them into the vitreous body.
The vitreous body acts, at least in part, as a source
of these proteins for ILM assembly during devel-
opment [10]. The ILM is rapidly synthesized dur-
ing development with dynamic composition
changes, while during postnatal and throughout
adulthood, it is maintained with a slow turnover of
components. Indeed, in humans, the matrix com-
ponent synthesis declines as early as the first
month after birth and nearly stops by the second
year of life. Similar observations were made in
other animal models, such as chick and mouse [5].
In contrast, the ILM composition remains dynamic
within the proliferative niches in retinas of the
Extracellular Matrix: The Unexplored Aspects of Retinal Pathologies and Regeneration
animals capable of retinal regeneration [10]. This
correlation between the slowing down of the syn-
thesis and slow turnover of the composition of the
retinal matrix and the loss of proliferative and
regenerative capacity of the retinal cells presents
this ECM as a very attractive target for studies to
reverse progressive neurodegenerative diseases,
especially in the context of cell replacement thera-
pies. Unfortunately, there have been very few
studies to these ends thus far.
The role of the ILM in degenerative retinal
pathologies is currently poorly understood. Other
than suggestions of the ILM involvement in glau-
coma progression [11], the role of the ILM in
retinal pathologies was mainly a result of the
ILM peeling technique. The idea that the ILM
was simply a scaffold on which glial cells migrate
and proliferate and to create a contractile force
led to the widespread use of this clinical approach
for the treatment and closure of full-thickness
macular holes [12, 13]. Since then, it became
apparent that the ILM serves much more impor-
tant functions. It is now recognized that ILM
peeling results not only in the loss of the struc-
tural support for the Müller glia but also in the
removal of their endfeet [14]. Furthermore, ILM
peeling results in serious ultrastructural damage
to the retinal surface, contributing to pathological
conditions such as swelling of the nerve fiber
layer [15], dissociation of the optic nerve fiber
layer [16], inner retinal dimpling [17], nerve fiber
layer thickening [18], macular thinning [19], and
ganglion cell complex thinning [17]. This grow-
ing body of evidence suggests that the ILM plays
a crucial role in blinding retinal pathologies;
however, in-depth assessment and studies into
this topic remain lacking.
4 Bruch’s Membrane
Perhaps the best-studied ECM within the eye is
Bruch’s membrane. Crucial developmental
importance aside, BrM serves two main func-
tions – structural support for the RPE cell adhe-
sion and migration and regulation of molecular
transportation between the choroid and the RPE.
311
Structurally, it is highly elastic and can expand
and contract in response to changes in intraocular
pressure (IOP) and choroidal blood volume [20],
serving as an attachment and migration platform
for the RPE cells during development and wound
healing [21–25], which anchor to its basal lamina
via integrin receptors [26]. Interestingly, the
anchoring properties of the membrane change
with age [27], a phenomenon thought to be asso-
ciated with age-related thickening and calcifica-
tion. Additionally, not all its layers demonstrate
the same attachment properties, with the basal
lamina having the highest anchoring properties
[21]. During mechanical or light-induced dam-
age to the RPE, the RPE cells divide and migrate
to repair the wounds. This process is more effi-
cient in the presence of the basal lamina rather
than cases where it is damaged or absent [28].
For example, these processes are disrupted in
AMD patients, presumably due to impaired
RPE–BrM interactions [29].
Since BrM is located between the choroid and
the RPE, it also serves as a bidirectional molecu-
lar transport and filtration instrument, servicing
the molecular trafficking between the two com-
partments. Given its acellular nature, these pro-
cesses are passive and depend on the hydrostatic
pressure on either side of the membrane, its
porosity, and molecular composition. From the
choroid vasculature, RPE receives nutrients, vita-
min A, pigment precursors, oxygen, and other
components [30–32]. At the same time, the RPE
exports CO2, water, metabolic waste, and waste
products from the shed photoreceptor outer seg-
ments through the BrM into the choroid vascula-
ture [30–33]. Both processes are necessary for
proper function and survival of the RPE and the
visual cycle, and it stands to reason that age-­
related structural changes within the BrM would
affect these functions. Indeed, the water permea-
bility of the BrM changes due to age-related col-
lagen crosslinking and the buildup of lipid and
debris [34]. It was noted that the hydraulic per-
meability loss progresses exponentially with age
and is most pronounced in the macular rather
than peripheral regions [35–38]. Since these
changes detrimentally affect the functionality of
312
the RPE, understanding the molecular processes
behind them is of great importance.
5 Interphotoreceptor Matrix
The interphotoreceptor matrix serves important
functions in mediating the communication
between the photoreceptors, the Müller glia, the
RPE, and the underlying choroid vasculature
[39]. Curiously, the IPM itself is quite complex
and not homogenous in its composition, contain-
ing distinct structural regions. The soluble frac-
tion is mainly composed of the interphotoreceptor
retinoid-binding protein (IRBP) with the addition
of a broad repertoire of other components [40,
41]. Most of the soluble IPM components are
secreted by the RPE [42]. Additionally, there are
structurally distinct entities, secreted by the pho-
toreceptors and the Müller glia, such as the cone
matrix, also referred to as cone sheaths, which
surround the cone outer segments, and the rod-­
associated matrix [41, 43–46]. The makeup of
these matrices and the interactions between their
components and the surrounding cells has been
the subject of some studies, but remains largely
ambiguous.
The IPM was noted to be involved in several
degenerative diseases. For example, RBP3,
encoding the IRBP protein, and IMPG2, encod-
ing the SPACRCAN protein, are associated with
autosomal-recessive retinitis pigmentosa [47,
48], IMPG1, encoding the SPACR protein, has
been associated with autosomal dominant and
recessive forms of Best’s disease [49], TIMP3 is
associated with Sorby’s fundus dystrophy [50],
and EFEMP1, encoding the Fibulin 3 protein,
with Doyne honeycomb retinal dystrophy [51].
Though mutations in these genes were found in
patients with these diseases, the molecular mech-
anisms by which they are involved remain unclear
and poorly studied. Recently, numerous studies
noted the possible involvement of the IPM in
AMD [52]. It was demonstrated that RPE cul-
tures from AMD patients exhibit robust changes
in the expression of these components compared
to healthy donors. For example, matrix metallo-
protease 2 (MMP2), a protease responsible for
D. Serjanov and D. R. Hyde
the degradation of ECM components, is expressed
at a much higher level in AMD patient cultures
[52]. Also, the expression of αβ crystallin, another
soluble IPM component whose increased expres-
sion has been detected in early AMD and which
was linked to wet AMD pathogenesis, was found
to be upregulated in AMD patient cultures [53].
Moreover, degradation of the RPE barrier that is
associated with oxidative stress has been linked
to aggregation of αβ crystallin at the basal side of
the RPE, promoting drusen formation [53, 54].
Clearly, further studies into the role of the IPM in
pathogenesis and possible therapeutic IPM-­
targeted therapies are warranted.
6 ECM Composition
The ECM in the retina is composed of a wide
array of proteins and complex carbohydrates,
secreted by cells and organized into complex
structures. The main ECM components include
proteoglycans, such as heparan and chondroitin
sulfates, and polysaccharides, such as hyaluronin,
various collagens, fibronectin and laminins,
growth factors, extracellular proteases, and their
regulators [55]. The complexity of studying the
ECM and its molecular mechanisms is partly due
to the protein–protein interactions within the
matrix. ECM components do not necessarily
interact with cell-surface receptors, but bind
other ECM components, modifying their molec-
ular and biochemical properties. Currently, the
role of the ECM and its components is much bet-
ter understood in development. However, given
the current interest in regenerative approaches as
a therapy for degenerative diseases, it is impor-
tant to understand the role of ECM in both these
aspects. As the process of regeneration in lower,
vertebrates recapitulate the process of develop-
ment in several ways [56], and it stands to reason
that the ECM molecules that play a role in retino-
genesis would also be involved in tissue repair.
Though there are over 300 components that make
up the ECM in various tissues, including the eye,
we will briefly describe some of the main struc-
tural building blocks and how they interact with
retinal cells.
Extracellular Matrix: The Unexplored Aspects of Retinal Pathologies and Regeneration
7 Collagens
Collagens are one of the most abundant proteins
present in mammals and are a major ECM com-
ponent. As with other matrix proteins, it was ini-
tially viewed as only a structural molecule, but is
now recognized for its involvement in molecular
signaling, including cell adhesion, survival,
­differentiation, and secreted signaling molecule
diffusion [4, 57–62]. In the neural retina, colla-
gens are found within the ILM at the vitreal sur-
face, basement membranes of the blood vessels,
BrM, and in the synaptic layers of the tissue [63].
The role of collagens in retinal pathogenesis is
also becoming recognized. Recent evidence sug-
gests that collagen abnormalities within the tra-
becular meshwork lead to elevated IOP [64–66]
and pathogenesis of primary open-angle glau-
coma [64, 67, 68]. Collagens have also been
implicated in ganglion cell survival following
optic nerve transection and ILM removal [69,
70]. Together these findings clearly demonstrate
the crucial importance of collagens, though our
understanding of the molecular mechanisms they
govern in the retina remains unclear.
8 Laminins
Laminins are a major ECM component and a
critical building block of the basement mem-
brane. Indeed, without laminins, no basement
membrane can persist. There are 11 mammalian
laminin subunits, 5-α, 3-β, and 3-γ, which com-
bine into 16 distinct heterotrimers composed of
one α, one β, and one γ chains. Each laminin tri-
mer possesses distinct biological properties based
on the composition and molecular interactions
between the subunits [71]. The importance of
laminins and their potential therapeutic use was
clearly demonstrated in organoid cultures. While
the effort to grow retinal organoid has been ongo-
ing for some time, it was not until it was discov-
ered that the addition of laminins to the culture
medium resulted in consistent laminated retina
formation [72]. This highlights the potential for
the use of laminins in cell replacement therapies
and tissue engineering.
313
9 ECM Receptors
One of the most studied receptor families is the
integrins. Their ligands include a wide array of
ECM molecules, including laminins, collagens,
and fibronectin [73]. They function as heterodi-
mers that are composed of an α and a β subunit.
These α-β combinations dictate the ligand speci-
ficity. Integrin-mediated signaling was shown to
be important for a multitude of cellular functions,
including cell attachment, migration, prolifera-
tion, and normal homeostatic function [74–79].
Though integrins were the subject of numerous
studies, there are other receptors interacting with
the surrounding microenvironment that have not
been as extensively studied, especially in the eye.
Such receptors include dystroglycan, syndecans,
lectins, CD44, lutheran, discoidin domain recep-
tors, and others.
10 Dynamic Reciprocity
An additional confounding aspect of matrix biol-
ogy is known as the concept of dynamic reciproc-
ity, describing a combination of outside-in and
inside-out signaling cascades, which continu-
ously modify each other [80–92]. In short, the
cells create the ECM with which they interact,
which in turn governs the behavior and gene
expression of the cells, which in turn modify the
composition of the matrix around them. This
concept was best demonstrated and studied in the
mammary epithelium. Culturing mammary epi-
thelial cells on 3D laminin-rich matrices results
in actin cytoskeleton polarization configuration
similar to that observed in vivo, as opposed to the
stress fiber formation in conventional 2D sys-
tems. Inhibition of actin polymerization leads to
changes in cell shape and histone deacetylation,
suggesting that ECM-cytoskeleton signaling reg-
ulates chromosome organization and gene
expression as a result [83]. Additionally, manipu-
lating ECM stiffness in vitro changes gene
expression and cell fate. Mesenchymal stem cells
grown on matrices with stiffness comparable to
that of the brain, muscle, or bone leads to differ-
entiation into respective neuronal, myoblastic, or
314
osteoblastic cells [84]. Yet another example of
dynamic reciprocity was observed in cancer.
Normally, the ECM alone is sufficient to inhibit
tumorigenesis [87]. Conversely, misexpression of
ECM genes such as collagen IV creates microen-
vironment that is permissive to tumor metastasis
in the liver [89, 90]. The studies of dynamic reci-
procity in the eye, however, have proven
extremely difficult to do, and our understanding
of these processes in the eye remains essentially
nonexistent.
11 Concluding Remarks
and Future Perspectives
Here we reviewed only a small fraction of the
retinal ECMs, their components, and how they
interact with retinal cells. Despite all the evi- 12. Gass JDM. Idiopathic senile macular hole: its early
dence gathered in other systems, the ECM
remains largely unexplored in the eye and is
almost entirely overlooked when it comes to
developing regenerative strategies. It is abun-
dantly clear at this point that understanding ECM
biology in the context of retinal development and 14. Wolf S, Schnurbusch U, Wiedemann P, Grosche J,
pathogenesis is crucial to the development of
therapeutics that would allow us to prevent, halt,
or even reverse degenerative conditions.
References
1. Nagashima M, Barthel LK, Raymond PA. A self-­
renewing division of zebrafish Müller glial cells gen-
erates neuronal progenitors that require N-cadherin
to regenerate retinal neurons. Development. 2013 17. Spaide RF. “Dissociated optic nerve fiber layer
Nov;140(22):4510–21.
2. Zhang KY, Johnson TV. The internal limiting mem-
brane: roles in retinal development and implications
for emerging ocular therapies. Exp Eye Res. 2021 18. Yamashita T, Uemura A, Kita H, Sakamoto
May;206:108545.
3. Booij JC, Baas DC, Beisekeeva J, Gorgels TGMF,
Bergen AAB. The dynamic nature of Bruch’s mem-
brane. Prog Retin Eye Res. 2010 Jan;29(1):1–18.
4. Yurchenco PD. Basement membranes: cell scaf-
foldings and signaling platforms. Cold Spring Harb
Perspect Biol. 2011 Feb 1;3(2):a004911–1.
5. Halfter W, Dong S, Schurer B, Ring C, Cole GJ, Eller
A. Embryonic synthesis of the inner limiting mem-
brane and vitreous body. Investigative Ophthalmology 20. Johnson M, Curcio CA. Structure, function and
& Visual Science. The Association for Research in
Vision and Ophthalmology. 2005 Jun;46(6):2202–9.
D. Serjanov and D. R. Hyde
6. Roy S, Kim D. Retinal capillary basement membrane
thickening: role in the pathogenesis of diabetic reti-
nopathy. Prog Retin Eye Res. 2021 May;82:100903.
7. Trost A, Bruckner D, Rivera FJ, Reitsamer
HA. Pericytes in the retina. Adv Exp Med Biol.
2019;1122:1–26.
8. Edwards MM, Lefebvre O. Laminins and reti-
nal vascular development. Cell Adhes Migr. 2013
Jan;7(1):82–9.
9. Miller CG, Budoff G, Prenner JL, Schwarzbauer
JE. Minireview: fibronectin in retinal disease. Exp
Biol Med (Maywood). 2017 Jan;242(1):1–7.
10. Halfter W, Dong S, Dong A, Eller AW, Nischt
R. Origin and turnover of ECM proteins from the
inner limiting membrane and vitreous body. Eye
(Lond). 2008 Oct;22(10):1207–13.
11. Prager AJ, Blumberg D, Zeng Q, Chang S, Tezel
TH. Internal limiting membrane Peel is associated
with increased ganglion cell loss and poor visual
outcome in patients with primary open angle glau-
coma. Invest Ophthalmol Vis Sci. The Association
for Research in Vision and Ophthalmology; 2015 Jun
11;56(7):4571–1.
stages and pathogenesis. Arch Ophthalmol. American
Medical Association. 1988 May 1;106(5):629–39.
13. Kelly NE, Wendel RT. Vitreous surgery for idio-
pathic macular holes: results of a pilot study. Arch
Ophthalmol. American Medical Association. 1991
May 1;109(5):654–9.
Reichenbach A, Wolburg H. Peeling of the basal
membrane in the human retina: ultrastructural effects.
Ophthalmology. 2004 Feb;111(2):238–43.
15. Clark A, Balducci N, Pichi F, Veronese C, Morara
M, Torrazza C, et al. Swelling of the arcuate nerve
fiber layer after internal limiting membrane peeling.
Retina. 2012 Sep;32(8):1608–13.
16. Tadayoni R, Paques M, Massin P, Mouki-Benani S,
Mikol J, Gaudric A. Dissociated optic nerve fiber
layer appearance of the fundus after idiopathic
epiretinal membrane removal. Ophthalmology. 2001
Dec;108(12):2279–83.
appearance” after internal limiting membrane
removal is inner retinal dimpling. Retina. 2012
Oct;32(9):1719–26.
T. Analysis of the retinal nerve fiber layer after indo-
cyanine green-assisted vitrectomy for idiopathic mac-
ular holes. Ophthalmology. 2006 Feb;113(2):280–4.
19. Treumer F, Wacker N, Junge O, Hedderich J, Roider
J, Hillenkamp J. Foveal structure and thickness of
retinal layers long-term after surgical peeling of
idiopathic epiretinal membrane. Invest Ophthalmol
Vis Sci. The Association for Research in Vision and
Ophthalmology. 2011 Feb 9;52(2):744–50.
pathology of Bruch’s membrane. In: Retina. Elsevier;
2017. pp. 522–543.
Extracellular Matrix: The Unexplored Aspects of Retinal Pathologies and Regeneration
21. Del Priore LV, Tezel TH. Reattachment rate of human
retinal pigment epithelium to layers of human Bruch’s
membrane. Arch Ophthalmol American Medical
Association. 1998 Mar;116(3):335–41.
22. Del Priore LV, Geng L, Tezel TH, Kaplan
HJ. Extracellular matrix ligands promote RPE
attachment to inner Bruch’s membrane. Current Eye
Research. Taylor & Francis; 2009 July 2.
23. Gong J, Sagiv O, Cai H, Tsang SH, Del Priore
LV. Effects of extracellular matrix and neighboring
cells on induction of human embryonic stem cells into
retinal or retinal pigment epithelial progenitors. Exp
Eye Res. 2008 Jun;86(6):957–65.
24. Tezel TH, Del Priore LV. Repopulation of different
layers of host human Bruch’s membrane by retinal
pigment epithelial cell grafts. Invest Ophthalmol
Vis Sci. The Association for Research in Vision and
Ophthalmology. 1999 Mar 1;40(3):767–74.
25. Tezel TH, Del Priore LV, Kaplan HJ. Reengineering
of aged Bruch’s membrane to enhance retinal pig-
ment epithelium repopulation. Invest Ophthalmol
Vis Sci. The Association for Research in Vision and
Ophthalmology. 2004 Sep 1;45(9):3337–48.
26. Fang I-M, Yang C-H, Yang C-M, Chen
M-S. Overexpression of integrin alpha6 and beta4
enhances adhesion and proliferation of human retinal
pigment epithelial cells on layers of porcine Bruch’s
membrane. Exp Eye Res. 2009 Jan;88(1):12–21.
27. Gullapalli VK, Sugino IK, Van Patten Y, Shah S,
Zarbin MA. Impaired RPE survival on aged submac-
ular human Bruch’s membrane. Exp Eye Res. 2005
Feb;80(2):235–48.
28. Wang H, Ninomiya Y, Sugino IK, Zarbin MA. Retinal
pigment epithelium wound healing in human Bruch’s
membrane explants. Investigative Ophthalmology &
Visual Science The Association for Research in Vision
and Ophthalmology. 2003 May;44(5):2199–210.
29. Binder S, Stanzel BV, Krebs I, Glittenberg
C. Transplantation of the RPE in AMD. Prog Retin
Eye Res. 2007 Sep;26(5):516–54.
30. Hewitt AT, Nakazawa K, Newsome DA. Analysis
of newly synthesized Bruch’s membrane proteogly-
cans. Invest Ophthalmol Vis Sci. The Association for
Research in Vision and Ophthalmology. 1989 Mar
1;30(3):478–86.
31. Bok D. The retinal pigment epithelium: a versatile
partner in vision. J Cell Sci Suppl. 1993;17:189–95.
32. Strauss O. The retinal pigment epithelium in
visual function. Physiological Reviews American
Physiological Society. 2005 Jul;85(3):845–81.
33. Wimmers S, Karl MO, Strauss O. Ion channels in the
RPE. Prog Retin Eye Res. 2007 May;26(3):263–301.
34. Huang J-D, Presley JB, Chimento MF, Curcio CA,
Johnson M. Age-related changes in human macular
Bruch’s membrane as seen by quick-freeze/deep-etch.
Exp Eye Res. 2007 Aug;85(2):202–18.
35. Moore DJ, Hussain AA, Marshall J. Age-related
variation in the hydraulic conductivity of Bruch’s
membrane. Invest Ophthalmol Vis Sci. 1995
Jun;36(7):1290–7.
315
36. Starita C, Hussain AA, Pagliarini S, Marshall
J. Hydrodynamics of ageing Bruch’s membrane:
implications for macular disease. Exp Eye Res. 1996
May;62(5):565–72.
37. Starita C, Hussain AA, Patmore A, Marshall
J. Localization of the site of major resistance to fluid
transport in Bruch’s membrane. Invest Ophthalmol
Vis Sci. 1997 Mar;38(3):762–7.
38. Hillenkamp J, Hussain AA, Jackson TL, Cunningham
JR, Marshall J. The influence of path length and
matrix components on ageing characteristics of trans-
port between the choroid and the outer retina. Invest
Ophthalmol Vis Sci. 2004 May;45(5):1493–8.
39. Ishikawa M, Sawada Y, Yoshitomi T. Structure and
function of the interphotoreceptor matrix surround-
ing retinal photoreceptor cells. Exp Eye Res. 2015
Apr;133:3–18.
40. Bridges CD. The interphotoreceptor matrix--func-
tions and possible role in hereditary retinal degenera-
tions. Prog Clin Biol Res. 1985;190:195–212.
41. Hageman GS, Johnson LV. Chapter 9 Structure, com-
position and function of the retinal interphotoreceptor
matrix. Progress in Retinal Research Pergamon. 1991
Jan 1;10:207–49.
42. Kay P, Yang YC, Paraoan L. Directional protein secre-
tion by the retinal pigment epithelium: roles in retinal
health and the development of age-related macular
degeneration. J Cell Mol Med. 2013 Jul;17(7):833–43.
43. Acharya S, Foletta VC, Lee JW, Rayborn ME,
Rodriguez IR, Young WS, et al. SPACRCAN, a novel
human interphotoreceptor matrix hyaluronan-binding
proteoglycan synthesized by photoreceptors and pine-
alocytes. J Biol Chem. 2000 Mar 10;275(10):6945–55.
44. Steinberg RH, Wood I, Hogan MJ. Pigment epithelial
ensheathment and phagocytosis of extrafoveal cones
in human retina. Philos Trans R Soc Lond Ser B Biol
Sci. 1977 Mar 28;277(958):459–74.
45. Anderson DH, Fisher SK. The relationship of primate
foveal cones to the pigment epithelium. J Ultrastruct
Res. 1979 Apr;67(1):23–32.
46. Hollyfield JG, Rayborn ME, Landers RA. A tech-
nique for isolation of the photoreceptor layer from
other neurons in the human retina. Exp Eye Res. 1990
Mar;50(3):335–8.
47. Hollander den AI, McGee TL, Ziviello C, Banfi S,
Dryja TP, Gonzalez-Fernandez F, et al. A homozy-
gous missense mutation in the IRBP gene (RBP3)
associated with autosomal recessive retinitis pig-
mentosa. Invest Ophthalmol Vis Sci. The Association
for Research in Vision and Ophthalmology; 2009
Apr;50(4):1864–72.
48. Bandah-Rozenfeld D, Collin RWJ, Banin E, van den
Born LI, Coene KLM, Siemiatkowska AM, et al.
Mutations in IMPG2, encoding interphotoreceptor
matrix proteoglycan 2, cause autosomal-recessive
retinitis pigmentosa. Am J Hum Genet. 2010 Aug
13;87(2):199–208.
49. Manes G, Meunier I, Avila-Fernández A, Banfi S,
Le Meur G, Zanlonghi X, et al. Mutations in IMPG1
316
cause vitelliform macular dystrophies. Am J Hum
Genet. 2013 Sep 5;93(3):571–8.
50. Weber BH, Vogt G, Pruett RC, Stöhr H, Felbor
U. Mutations in the tissue inhibitor of metalloprotein-
ases-­3 (TIMP3) in patients with Sorsby’s fundus dys-
trophy. Nat Genet. 1994 Dec;8(4):352–6.
51. Marmorstein LY, Munier FL, Arsenijevic Y, Schorderet
DF, McLaughlin PJ, Chung D, et al. Aberrant accu-
mulation of EFEMP1 underlies drusen formation in
Malattia Leventinese and age-related macular degen-
eration. Proc Natl Acad Sci USA. National Academy
of Sciences; 2002 Oct 1;99(20):13067–72.
52. An E, Lu X, Flippin J, Devaney JM, Halligan B,
Hoffman EP, et al. Secreted proteome profiling in
human RPE cell cultures derived from donors with age
related macular degeneration and age matched healthy
donors. J Proteome Res. 2006 Oct;5(10):2599–610.
53. De S, Rabin DM, Salero E, Lederman PL, Temple
S, Stern JH. Human retinal pigment epithelium cell
changes and expression of alphaB-crystallin: a bio-
marker for retinal pigment epithelium cell change in
age-related macular degeneration. Arch Ophthalmol.
2007 May;125(5):641–5.
54. Sreekumar PG, Kannan R, Kitamura M, Spee C,
Barron E, Ryan SJ, et al. αB crystallin is apically
secreted within exosomes by polarized human retinal
pigment epithelium and provides neuroprotection to
adjacent cells. PLoS One. 2010 Oct 8;5(10):e12578.
55. Al-Ubaidi MR, Naash MI, Conley SM. A perspective
on the role of the extracellular matrix in progressive
retinal degenerative disorders. Invest Ophthalmol Vis
Sci. 2013 Dec 17;54(13):8119–24.
56. Ahmad I, Teotia P, Erickson H, Xia X. Recapitulating
developmental mechanisms for retinal regeneration.
Prog Retin Eye Res. 2020 May;76:100824.
57. Yurchenco PD, Ruben GC. Basement membrane
structure in situ: evidence for lateral associations
in the type IV collagen network. J Cell Biol. 1987
Dec;105(6 Pt 1):2559–68.
58. Lampe AK, Bushby KMD. Collagen VI related mus-
cle disorders. J Med Genet. 2005 Sep;42(9):673–85.
59. Pöschl E, Schlötzer-Schrehardt U, Brachvogel B,
Saito K, Ninomiya Y, Mayer U. Collagen IV is essen-
tial for basement membrane stability but dispensable
for initiation of its assembly during early develop-
ment. Development. 2004 Apr;131(7):1619–28.
60. Claudepierre T, Manglapus MK, Marengi N,
Radner S, Champliaud M-F, Tasanen K, et al.
Collagen XVII and BPAG1 expression in the
retina: evidence for an anchoring complex in the
central nervous system. J Comp Neurol. 2005 Jun
27;487(2):190–203.
61. Bhattacharya G, Kalluri R, Orten DJ, Kimberling WJ,
Cosgrove D. A domain-specific usherin/collagen IV
interaction may be required for stable integration into
the basement membrane superstructure. J Cell Sci.
2004 Jan 15;117(Pt 2):233–42.
62. Timpl R, Wiedemann H, van Delden V, Furthmayr H,
Kühn K. A network model for the organization of type
IV collagen molecules in basement membranes. Eur J
Biochem. 1981 Nov;120(2):203–11.
D. Serjanov and D. R. Hyde
63. Ponsioen TL, van Luyn MJA, van der Worp RJ, van
Meurs JC, Hooymans JMM, Los LI. Collagen dis-
tribution in the human vitreoretinal interface. Invest
Ophthalmol Vis Sci. The Association for Research in
Vision and Ophthalmology. 2008 Sep;49(9):4089–95.
64. Last JA, Pan T, Ding Y, Reilly CM, Keller K, Acott TS,
et al. Elastic modulus determination of normal and
glaucomatous human trabecular meshwork. Invest
Ophthalmol Vis Sci. The Association for Research in
Vision and Ophthalmology. 2011 Apr;52(5):2147–52.
65. Lütjen-Drecoll E. Functional morphology of the tra-
becular meshwork in primate eyes. Prog Retin Eye
Res. 1999 Jan;18(1):91–119.
66. Fuchshofer R, Tamm ER. Modulation of extracellular
matrix turnover in the trabecular meshwork. Exp Eye
Res. 2009 Apr;88(4):683–8.
67. Aihara M, Lindsey JD, Weinreb RN. Ocular hyper-
tension in mice with a targeted type I collagen
mutation. Investigative Ophthalmology & Visual
Science. The Association for Research in Vision and
Ophthalmology. 2003 Apr;44(4):1581–5.
68. Tektas O-Y, Lütjen-Drecoll E. Structural changes of
the trabecular meshwork in different kinds of glau-
coma. Exp Eye Res. 2009 Apr;88(4):769–75.
69. Rosario CM, Fry KR, Madison R. Rabbit retinal gan-
glion cells survive optic nerve transection and entubu-
lation repair with type I collagen nerve guide tubes.
Restor Neurol Neurosci. 1989 Jan 1;1(1):31–7.
70. Halfter W, Willem M, Mayer U. Basement
membrane-­ dependent survival of retinal gan-
glion cells. Investigative Ophthalmology & Visual
Science. The Association for Research in Vision and
Ophthalmology. 2005 Mar;46(3):1000–9.
71. Domogatskaya A, Rodin S, Tryggvason K. Functional
diversity of laminins. Annu Rev Cell Dev Biol.
2012;28:523–53.
72. Eiraku M, Takata N, Ishibashi H, Kawada M,
Sakakura E, Okuda S, et al. Self-organizing optic-cup
morphogenesis in three-dimensional culture. Nat Publ
Group. 2011 Apr 7;472(7341):51–6.
73. Humphries JD, Byron A, Humphries MJ. Integrin
ligands at a glance. J Cell Sci. 2006 Oct 1;119(Pt
19):3901–3.
74. Hynes RO. Integrins: bidirectional, allosteric signal-
ing machines. Cell. 2002 Sep 20;110(6):673–87.
75. Aszodi A, Hunziker EB, Brakebusch C, Fässler
R. Beta1 integrins regulate chondrocyte rotation, G1
progression, and cytokinesis. Genes & Development.
Cold Spring Harbor Lab. 2003 Oct 1;17(19):2465–79.
76. Gardiner NJ. Integrins and the extracellular matrix:
key mediators of development and regeneration of
the sensory nervous system. Prokop A, Reichardt LF,
editors. Dev Neurobiol. 2011 Oct 11;71(11):1054–72.
77. Lee JL, Streuli CH. Integrins and epithelial cell polar-
ity. J Cell Sci. 2014.
78. Li M, Sakaguchi DS. Inhibition of integrin-mediated
adhesion and signaling disrupts retinal development.
Dev Biol. 2004 Nov 1;275(1):202–14.
79. Manninen A. Epithelial polarity--generating and inte-
grating signals from the ECM with integrins. Exp Cell
Res. 2015 Jun 10;334(2):337–49.
Extracellular Matrix: The Unexplored Aspects of Retinal Pathologies and Regeneration
80. Hetzer MW, Walther TC, Mattaj IW. Pushing the
envelope: structure, function, and dynamics of
the nuclear periphery. Annu Rev Cell Dev Biol.
2005;21(1):347–80.
81. Roskelley CD, Bissell MJ. Dynamic reciprocity revis-
ited: a continuous, bidirectional flow of information
between cells and the extracellular matrix regulates
mammary epithelial cell function. Biochem Cell Biol.
1995 Jul;73(7–8):391–7.
82. Maniotis AJ, Chen CS, Ingber DE. Demonstration
of mechanical connections between integrins, cyto-
skeletal filaments, and nucleoplasm that stabilize
nuclear structure. Proc Natl Acad Sci U S A. 1997 Feb
4;94(3):849–54.
83. Le Beyec J, Xu R, Lee S-Y, Nelson CM, Rizki A,
Alcaraz J, et al. Cell shape regulates global histone
acetylation in human mammary epithelial cells. Exp
Cell Res. 2007 Aug 15;313(14):3066–75.
84. Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix
elasticity directs stem cell lineage specification. Cell.
2006 Aug;126(4):677–89.
85. Kheradmand F, Werner E, Tremble P, Symons M,
Werb Z. Role of Rac1 and oxygen radicals in colla-
genase-­1 expression induced by cell shape change.
Science. 1998 May 8;280(5365):898–902.
86. Apte SS. A disintegrin-like and metalloprotease
(reprolysin-type) with thrombospondin type 1 motif
317
(ADAMTS) superfamily: functions and mechanisms.
J Biol Chem. 2009 Nov 13;284(46):31493–7.
87. Bissell MJ, Hines WC. Why don’t we get more
cancer? A proposed role of the microenvironment
in restraining cancer progression. Nat Med. 2011
Mar;17(3):320–9.
88. Tian X, Azpurua J, Hine C, Vaidya A, Myakishev-­
Rempel M, Ablaeva J, et al. High-molecular-­
mass hyaluronan mediates the cancer resistance
of the naked mole rat. Nat Publ Group. 2013 Jul
18;499(7458):346–9.
89. Burnier JV, Wang N, Michel RP, Hassanain M, Li S,
Lu Y, et al. Type IV collagen-initiated signals provide
survival and growth cues required for liver metastasis.
Oncogene. 2011 Sep 1;30(35):3766–83.
90. Paszek MJ, Zahir N, Johnson KR, Lakins JN,
Rozenberg GI, Gefen A, et al. Tensional homeosta-
sis and the malignant phenotype. Cancer Cell. 2005
Sep;8(3):241–54.
91. Levental KR, Yu H, Kass L, Lakins JN, Egeblad M,
Erler JT, et al. Matrix crosslinking forces tumor pro-
gression by enhancing integrin signaling. Cell. 2009
Nov 25;139(5):891–906.
92. Bergamaschi A, Tagliabue E, Sørlie T, Naume B,
Triulzi T, Orlandi R, et al. Extracellular matrix signa-
ture identifies breast cancer subgroups with different
clinical outcome. J Pathol. 2008 Feb;214(3):357–67.
 Role of TFEB in Diseases
Associated with Lysosomal
Dysfunction

Hsuan-Yeh Pan and Mallika Valapala

Abstract Keywords

Transcription factor EB (TFEB) · Lysosomal

Transcription factor EB (TFEB) plays a very
dysfunction · Retinal pigment epithelium
important role in the maintenance of cellular
(RPE) · Age-related macular degeneration
homeostasis. TFEB is a transcription factor
(AMD) · Neurodegeneration · Reactive
that regulates the expression of several genes
oxygen species (ROS)
in the Coordinated Lysosomal Expression and
Regulation (CLEAR) network. The CLEAR
network genes are known to regulate many
processes associated with the autophagy path-
Abbreviations
way and lysosome biogenesis. Lysosomes,
which are degradative organelles in the cell,
AKT Ak strain transforming protein/­
are associated with several cellular mecha-
protein kinase B
nisms, such as autophagy and phagocytosis.
ALS Amyotrophic lateral sclerosis
Recent studies have shown that TFEB dysreg-
AMD Age-related macular degeneration
ulation and lysosomal dysfunction are associ-
CLEAR Coordinated Lysosomal Expression
ated with several degenerative diseases. Thus,
and Regulation
enhancing TFEB activity and accompanied
CTNS Cystinosin
induction of lysosomal function and autoph-
GBA Glucocerebrosidase
agy can have tremendous therapeutic potential
GCase Glucocerebrosidase enzyme
for the treatment of several degenerative dis-
GSK3β Glycogen synthase kinase-3β
eases including age-related macular degenera-
MCOLN1 Mucolipin TRP cation channel 1
tion (AMD). In this chapter, we briefly
mTORC1 Mammalian target of rapamycin
illustrate the expression and regulation of
(mTOR) complex 1
TFEB in response to several cellular stressors
POS shed outer photoreceptor segments
and discuss the effects of TFEB overexpres-
ROS Reactive oxygen species
sion to induce cellular clearance functions.
TFEB Transcription factor EB
TGF-β1 Transforming growth factor β1
H.-Y. Pan · M. Valapala (*)
School of Optometry, Indiana University,
Bloomington, IN, USA
e-mail: hsupan@iu.edu; mvalapal@iu.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 319
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_46
320 H.-Y. Pan and M. Valapala

1 Introduction results in nuclear translocation of TFEB [12–14].

Inhibition of mTORC1 via mTORC1 inhibitor
Transcriptional factor EB (TFEB) is a helix-loop-­ activates Mucolipin-1 (MCOLN1), a calcium
helix leucine zipper transcription factor belong- channel on lysosome, leading to the release of
ing to microphthalmia-associated transcription calcium from the lysosomes [15]. Increase in cel-
factor/transcription factor E (MiTF/TFE) family lular levels of calcium in cytoplasm results in the
[1, 2]. TFEB expression and activity is regulated activation of a calcium-regulated phosphatase,
by phosphorylation and dephosphorylation calcineurin. Calcineurin further dephosphory-
events at multiple sites on the protein [2, 3]. It lates the S142 and S211 sites in TFEB and pro-
was previously known that phosphorylation of motes nuclear localization of TFEB to trigger
TFEB at two residues, serine 142 (S142) and ser- lysosomal biogenesis and autophagy [13].
ine 211 (S211), by mammalian target of rapamy- Subcellular distribution of TFEB is also regu-
cin complex 1 (mTORC1) influences its nuclear lated by the AKT signaling pathway. TFEB at
localization and activity [2]. In addition to these S467 is phosphorylated by AKT, a serine/threo-
sites, there are other sites that regulate TFEB by nine kinase, further inhibiting TFEB nuclear
phosphorylation, AKT phosphorylates TFEB at translocation [16].
serine 467 (S467), and GSK3β phosphorylates
TFEB at serine 134/138 (S134/S138) [2, 3]. The
regulation of TFEB cytosolic-nucleus transloca- 2 Involvement of Lysosomal
tion is key to manipulate the expression of TFEB-­ Dysfunction
regulated genes and associated cellular functions in the Pathogenesis
[4]. TFEB activation is induced by multiple cell of Several Diseases
stress factors such as nutrient and growth factor
deprivation and mitochondrial stress [5–7]. TFEB Lysosomal dysfunction is implicated in the
has been identified as a master regulator of lyso- pathogenesis of several degenerative diseases
somal function and autophagy, which is an inter- including Parkinson’s disease and amyotrophic
cellular process that promotes degradation of lateral sclerosis [3, 17, 18]. Misfolded
dysfunctional organelles and long-lived proteins α-synuclein, a neuronal protein involved in
and recycles these materials into nutrients during Parkinson’s disease is known to cause an impair-
starvation [3]. TFEB remains in cytoplasm, and ment of the autophagy-lysosomal pathway [19].
autophagy operates at a basal level when cells Studies have shown that loss of activity of the
grow in a nutrient-rich environment [8, 9]. lysosomal enzyme, glucocerebrosidase (GCase),
However, when cells undergo stress, TFEB trans- causes accumulation of α-Synuclein [20, 21]. In
locates to nucleus to enhance autophagy and lys- addition, lysosomal dysfunction is also impli-
osome biogenesis [9, 10]. TFEB regulates cated in the pathogenesis of amyotrophic lateral
autophagy via binding to the promoter regions of sclerosis (ALS) [18]. The presence of GGGGCC
genes in the Coordinated Lysosomal Expression (G4C2) hexanucleotide repeat expansion (HRE)
and Regulation (CLEAR) network to promote in chromosome nine open reading frame 72
autophagy initiation, autophagosome formation, (C9orf72) results in a genetic predisposition to
autophagosome and lysosome fusion, and lyso- ALS [22, 23]. It was reported that C9orf72-HRE
some biogenesis [3, 11]. Subcellular localization interferes with TFEB nuclear transport resulting
of TFEB is regulated by multiple intracellular in TFEB cytosolic retention and failure of lyso-
signaling mediators, such as mTOR and AKT somal acidification [18].
signaling pathways [3]. Subcellular distribution Lysosomal and mitochondrial dysfunction is
and activation of TFEB are regulated by also implicated in the pathogenesis of several dis-
mTORC1; activated mTORC1 phosphorylates eases of the kidney, including diabetic nephropa-
TFEB resulting in cytosolic retention of TFEB. thy and cisplatin-induced acute kidney injury
Nutrient stress-mediated inhibition of mTORC1 [24, 25]. Transforming growth factor β1 (TGF-β1)
Role of TFEB in Diseases Associated with Lysosomal Dysfunction
has been shown to be an essential regulator of
diabetic nephropathy [24]. TGF-β1 induces phos-
phorylation of mothers against decapentaplegic
homolog 3 (SMAD3), which results in lysosome
depletion and inhibition of lysosome biogenesis
in a TFEB-dependent manner [24]. Studies have
shown that cisplatin, an anticancer agent, can
cause mitochondrial dysfunction [25]. Induction
of TFEB expression by overexpression of peroxi-
some Peroxisome proliferator-activated receptor
gamma coactivator 1-alpha (PGC-1α) can protect
against mitochondrial dysfunction in cisplatin-­
treated HK2 cells [25]. Trehalose treatment also
alleviates mitochondrial dysfunction and cispla-
tin-induced acute kidney injury via induction of
TFEB-mediated autophagy in acute kidney injury
mice [26].
Cystinosis, a lysosomal storage disorder,
occurs as a result of mutations in the cystinosin, a
lysosomal cystine transporter (CTNS) gene [27].
Studies have shown reduction of TFEB in CTNS-­
depleted cells [27]. Induction of TFEB in these
cells can reduce cystine stores and rescues abnor-
mal lysosomes cystinotic [28]. Patients with cys-
tinosis also show the deposition of cystine
crystals in the cornea [29, 30]. Gaucher disease
(GD) is a lysosomal storage disease caused by a
loss of lysosomal enzyme glucocerebrosidase
activity, which degrades glucocerebroside to glu-
cose [31, 32]. Patients with Gaucher disease type
3 (GD3) shows several ocular effects of the dis-
ease, including vitreous lesions and drusen-like
deposits in the posterior segment of the eye [33].
Glucocerebrosidase deficiency also results in
TFEB downregulation and loss of TFEB stability
due to increase of proteasomal degradation in
Gaucher disease iPSC-derived neuronal cells
[34].
Several studies have reported that lysosomal
dysfunction is associated with several ocular dis-
eases including glaucoma and age-related macu-
lar degeneration (AMD) [35, 36]. Extracellular
matrix (ECM) deposition in the trabecular mesh-
work (TM) is one of the vital factors leading to
glaucoma [35]. Studies have shown that the activ-
ity of lysosomal enzyme cathepsin B impacts the
amount of extracellular matrix [37, 38]. On the
other hand, oxidative stress in TM cells causes
321
downregulation of cathepsins, lysosomal basifi-
cation, and impairment of autophagy [39].
3 Lysosomes and Its
Importance in the Proper
Functioning of the RPE
The retinal pigment epithelium (RPE) is a signal
layer of cells located at the outer layer of the ret-
ina, between the neuroretina and the choroid.
RPE has multiple functions in the eye; one of the
main functions is to maintain photoreceptor
hemostasis by phagocytizing the shed photore-
ceptor outer segments [40]. RPE also plays an
important role in transportation of the metabo-
lites such as glucose and fatty acids from the cho-
roid capillaries to the photoreceptors [41]. RPE is
also involved in lipid metabolism by producing
the components that are required for lipoprotein
synthesis and secretion [42]. Lysosomes are
extremely important to RPE, because RPE needs
to process not only shed outer photoreceptor seg-
ments (POS) but also reactive oxygen species
(ROS) [43]. The autophagosomes and phago-
somes fuse with lysosomes and degrade cellular
material; hence, lysosomal function in RPE plays
a very important role in autophagy and phagocy-
tosis [44]. Dysfunctional RPE can cause lipid
accumulation within RPE and Bruch’s membrane
leading to pathologies as manifested in AMD
[42, 45].
4 Lysosomal Dysregulation
in the Pathogenesis of AMD
Age-related macular degeneration (AMD) is a
disease that causes loss of central vision in peo-
ple over 60 years [46]. AMD results from pro-
gressive RPE degeneration and cell death, further
leading to impaired cone and rod photoreceptors
[47]. Studies have shown that lysosomal dysfunc-
tion is one of the major features leading to the
progression of AMD [36]. Lipofuscin has been
linked to the pathogenesis of AMD [48]; lipofus-
cin accumulates in the lysosome resulting in
lysosomal dysfunction [49]. Lysosomal dysfunc-
322
tion results in impaired autophagy and further
causes accumulation of incompletely digested
POS-containing phagosomes [50, 51], eventually
leading to RPE dysfunction and AMD. Oxidative
stress has been recognized as one of the major
factors leading to AMD via imbalance between
generation and elimination of reactive oxygen
species (ROS) in RPE [43]. Studies have shown
positive correlation between ROS and lipofuscin
accumulation [52, 53]. It was previously shown
that mitochondrial dysfunction produces massive
ROS leading to lysosomal dysfunction [54, 55].
Increase of ROS can cause loss of lysosome acid-
ification and result in lysosomal dysfunction
[56]. Smoking is one of leading causes of AMD;
it is known to cause an increase in oxidative dam-
age in the RPE [57]. Hydroquinone, a constituent
of cigarette smoke, results in the reduction of
mitochondrial membrane permeabilization and
the induction of oxidative stress in the RPE [58,
59]. Studies have shown that hydroquinone can
cause subretinal deposits, which can lead to
AMD [57]. Studies have shown that
hydroquinone-­induced oxidative damage induces
lysosomal alkalization, downregulation of
lysosome-­ associated membrane protein 2
(LAMP2) and cathepsin D expression in ARPE-­
19 cells [60]. Hydroquinone-induced oxidative
damage in RPE cells can be rescued by induction
of TFEB expression by treatment with trehalose
[61].
5 Enhancing TFEB
as a Strategy to Induce
Lysosomal Function
Previous studies have suggested that overexpres-
sion of TFEB induces autophagy and lysosomal
function and prevents substrate accumulation in
several diseases [4]. In Parkinson’s disease,
induction of TFEB-mediated autophagy through
p38 MAPK-TFEB signaling pathway can protect
against dopaminergic neuronal loss [17]. AAV-­
mediated overexpression of TFEB shows a reduc-
tion of α-synuclein accumulation and restoration
of autophagy-lysosome function [62, 63].
Overexpression of TFEB in cellular and
H.-Y. Pan and M. Valapala
Alzheimer’s disease mouse model also showed a
decrease of membrane-tethered C-terminal frag-
ment C99, which is a β-amyloid precursor [64].
Other studies have shown that induction of TFEB
activity by trehalose treatment decreases
hydroquinone-­induced oxidative damage and cell
death in ARPE-19 cells [61]. Induction of TFEB
expression by trehalose or AKT inhibitor,
mk-2206, could restore autophagy function in
immunoproteasome-deficient retinal cells, which
have impaired autophagy due to the deficiency of
immunoproteasome, a proteasome subtype [65].
6 Conclusion
TFEB is a promising therapeutic target for sev-
eral diseases including cancer, inflammatory dis-
eases, and degenerative diseases because of its
unique function as a master regulator of autoph-
agy and lysosomal function. An increasing num-
ber of studies have shown that induction of TFEB
expression can rescue the symptoms of diseases
in various cell and animal models.
References
1. Steingrímsson E, Copeland NG, Jenkins
NA. Melanocytes and the microphthalmia tran-
scription factor network. Annu Rev Genet.
2004;38(1):365–411.
2. Puertollano R, Ferguson SM, Brugarolas J, Ballabio
A. The complex relationship between TFEB tran-
scription factor phosphorylation and subcellular
localization. EMBO J. 2018;37(11):e98804.
3. Zhu S-Y, Yao R-Q, Li Y-X, Zhao P-Y, Ren C, Du X-H,
et al. The role and regulatory mechanism of transcrip-
tion factor EB in health and diseases. Front Cell Dev
Biol. 2021;9(2278):667750.
4. Napolitano G, Ballabio A. TFEB at a glance. J Cell
Sci. 2016;129(13):2475–81.
5. Pan H-Y, Alamri AH, Valapala M. Nutrient depriva-
tion and lysosomal stress induce activation of TFEB
in retinal pigment epithelial cells. Cell Mol Biol Lett.
2019;24(1):33.
6. Fernández-Mosquera L, Diogo CV, Yambire KF,
Santos GL, Luna Sánchez M, Bénit P, et al. Acute and
chronic mitochondrial respiratory chain deficiency
differentially regulate lysosomal biogenesis. Sci Rep.
2017;7(1):45076.
7. Settembre C, De Cegli R, Mansueto G, Saha PK,
Vetrini F, Visvikis O, et al. TFEB controls cellular
Role of TFEB in Diseases Associated with Lysosomal Dysfunction
lipid metabolism through a starvation-induced auto-
regulatory loop. Nat Cell Biol. 2013;15(6):647–58.
8. Casares-Crespo L, Calatayud-Baselga I, García-­
Corzo L, Mira H. On the role of basal autophagy in
adult neural stem cells and neurogenesis. Front Cell
Neurosci. 2018;12:339.
9. Di Malta C, Cinque L, Settembre C. Transcriptional
regulation of autophagy: mechanisms and diseases.
Front Cell Dev Biol. 2019;7:114.
10. Pan H-Y, Ladd AV, Biswal MR, Valapala M. Role
of nuclear factor of activated T cells (NFAT) path-
way in regulating autophagy and inflammation
in retinal pigment epithelial cells. Int J Mol Sci.
2021;22(16):8684.
11. Palmieri M, Impey S, Kang H, Di Ronza A, Pelz C,
Sardiello M, et al. Characterization of the CLEAR net-
work reveals an integrated control of cellular clearance
pathways. Hum Mol Genet. 2011;20(19):3852–66.
12. Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin
S, Erdin S, et al. A lysosome-to-nucleus signalling
mechanism senses and regulates the lysosome via
mTOR and TFEB. EMBO J. 2012;31(5):1095–108.
13. Medina DL, Di Paola S, Peluso I, Armani A, De
Stefani D, Venditti R, et al. Lysosomal calcium sig-
nalling regulates autophagy through calcineurin and
TFEB. Nat Cell Biol. 2015;17(3):288–99.
14. Martina JA, Puertollano R. TFEB and TFE3: the art of
multi-tasking under stress conditions. Transcription.
2017;8(1):48–54.
15. Wang W, Gao Q, Yang M, Zhang X, Yu L, Lawas M,
et al. Up-regulation of lysosomal TRPML1 channels
is essential for lysosomal adaptation to nutrient starva-
tion. Proc Natl Acad Sci. 2015;112(11):E1373–E81.
16. Palmieri M, Pal R, Nelvagal HR, Lotfi P, Stinnett
GR, Seymour ML, et al. mTORC1-independent
TFEB activation via Akt inhibition promotes cellular
clearance in neurodegenerative storage diseases. Nat
Commun. 2017;8(1):14338.
17. Chen J, Mao K, Yu H, She H, Zhang H, Liu L, et al.
p38-TFEB pathways promote microglia activation
through inhibiting CMA-mediated NLRP3 degrada-
tion in Parkinson’s disease. J. Neuroinflammation.
2021;18:295.
18. Cunningham KM, Maulding K, Ruan K, Senturk M,
Grima JC, Sung H, et al. TFEB/Mitf links impaired
nuclear import to autophagolysosomal dysfunction in
C9-ALS. elife. 2020;9:e59419.
19. Teixeira M, Sheta R, Idi W, Oueslati A. Alpha-­
synuclein and the endolysosomal system in
Parkinson’s disease: guilty by association.
Biomolecules. 2021;11(9):1333.
20. Moors T, Paciotti S, Chiasserini D, Calabresi P,
Parnetti L, Beccari T, et al. Lysosomal dysfunction
and α-Synuclein aggregation in Parkinson’s disease:
diagnostic links. Mov Disord. 2016;31(6):791–801.
21. Cosden M, Jinn S, Yao L, Gretzula CA, Kandebo M,
Toolan D, et al. A novel glucosylceramide synthase
inhibitor attenuates alpha synuclein pathology and
lysosomal dysfunction in preclinical models of synu-
cleinopathy. Neurobiol Dis. 2021;159:105507.
323
22. Dejesus-Hernandez M, Ian RM, Bradley FE, Adam
LB, Baker M, Nicola JR, et al. Expanded GGGGCC
hexanucleotide repeat in noncoding region of
C9ORF72 causes chromosome 9p-linked FTD and
ALS. Neuron. 2011;72(2):245–56.
23. Alan ER, Majounie E, Waite A, Simón-Sánchez J,
Rollinson SJ, et al. A Hexanucleotide repeat expan-
sion in C9ORF72 is the cause of chromosome 9p21-­
linked ALS-FTD. Neuron. 2011;72(2):257–68.
24. Yang C, Chen X-C, Li Z-H, Wu H-L, Jing K-P, Huang
X-R, et al. SMAD3 promotes autophagy dysregula-
tion by triggering lysosome depletion in tubular epi-
thelial cells in diabetic nephropathy. Autophagy.
2021;17(9):2325–44.
25. Yuan L, Yuan Y, Liu F, Li L, Liu J, Chen Y, et al. PGC-1α
alleviates mitochondrial dysfunction via TFEB-­
mediated autophagy in cisplatin-induced acute kidney
injury. Aging (Albany NY). 2021;13(6):8421–39.
26. Zhu L, Yuan Y, Yuan L, Li L, Liu F, Liu J, et al.
Activation of TFEB-mediated autophagy by tre-
halose attenuates mitochondrial dysfunction in
cisplatin-­induced acute kidney injury. Theranostics.
2020;10(13):5829–44.
27. Zhang W, Li X, Wang S, Chen Y, Liu H. Regulation
of TFEB activity and its potential as a therapeutic
target against kidney diseases. Cell Death Discov.
2020;6(1):32.
28. Rega LR, Polishchuk E, Montefusco S, Napolitano G,
Tozzi G, Zhang J, et al. Activation of the transcription
factor EB rescues lysosomal abnormalities in cys-
tinotic kidney cells. Kidney Int. 2016;89(4):862–73.
29. Alsuhaibani AH, Wagoner MD, Khan AO. Confocal
microscopy of the cornea in nephropathic cystinosis.
Br J Ophthalmol. 2005;89(11):1530–1.
30. Biswas S, Gaviria M, Malheiro L, Marques JP,
Giordano V, Liang H. Latest clinical approaches
in the ocular Management of Cystinosis: a review
of current practice and opinion from the oph-
thalmology Cystinosis forum. Ophthalmol Ther.
2018;7(2):307–22.
31. Hruska KS, Lamarca ME, Scott CR, Sidransky
E. Gaucher disease: mutation and polymorphism
spectrum in the glucocerebrosidase gene (GBA). Hum
Mutat. 2008;29(5):567–83.
32. Berg RD, Levitte S, O’Sullivan MP, O’Leary SM,
Cambier CJ, Cameron J, et al. Lysosomal disorders
drive susceptibility to tuberculosis by compromising
macrophage migration. Cell. 2016;165(1):139–52.
33. Hopf S, Pfeiffer N, Liesenfeld M, Mengel K-E,
Hennermann JB, Schmidtmann I, et al. A compre-
hensive monocentric ophthalmic study with Gaucher
disease type 3 patients: vitreoretinal lesions, retinal
atrophy and characterization of abnormal saccades.
Orphanet J Rare Dis. 2019;14(1):257.
34. Awad O, Sarkar C, Panicker LM, Miller D, Zeng X,
Sgambato JA, et al. Altered TFEB-mediated lysosomal
biogenesis in Gaucher disease iPSC-derived neuronal
cells. Hum Mol Genet. 2015;24(20):5775–88.
35. Liton PB, Lin Y, Gonzalez P, Epstein DL. Potential
role of lysosomal dysfunction in the pathogen-
324
esis of primary open angle glaucoma. Autophagy.
2009;5(1):122–4.
36. Cerniauskas E, Kurzawa-Akanbi M, Xie L, Hallam D,
Moya-Molina M, White K, et al. Complement modu-
lation reverses pathology in Y402H -retinal pigment
epithelium cell model of age-related macular degen-
eration by restoring lysosomal function. Stem Cells
Transl Med. 2020;9(12):1585–603.
37. Porter K, Lin Y, Liton PB. Cathepsin B is up-regulated
and mediates extracellular matrix degradation in tra-
becular meshwork cells following phagocytic chal-
lenge. PLoS One. 2013;8(7):e68668.
38. Nettesheim A, Shim MS, Dixon A, Raychaudhuri
U, Gong H, Liton PB. Cathepsin B localizes in the
caveolae and participates in the proteolytic cascade
in trabecular meshwork cells. Potential new drug
target for the treatment of glaucoma. J Clin Med.
2021;10(1):78.
39. Porter K, Nallathambi J, Lin Y, Liton PB. Lysosomal
basification and decreased autophagic flux in oxi-
datively stressed trabecular meshwork cells: impli-
cations for glaucoma pathogenesis. Autophagy.
2013;9(4):581–94.
40. Yang S, Zhou J, Li D. Functions and diseases of
the retinal pigment epithelium. Front Pharmacol.
2021;12(1976):727870.
41. Simó R, Villarroel M, Corraliza L, Hernández C,
Garcia-Ramírez M. The retinal pigment epithelium:
something more than a constituent of the blood-retinal
barrier–implications for the pathogenesis of diabetic
retinopathy. J Biomed Biotechnol. 2010;2010:190724.
42. Jun S, Datta S, Wang L, Pegany R, Cano M, Handa
JT. The impact of lipids, lipid oxidation, and inflam-
mation on AMD, and the potential role of miR-
NAs on lipid metabolism in the RPE. Exp Eye Res.
2019;181:346–55.
43. Zhang Z-Y, Bao X-L, Cong Y-Y, Fan B, Li
G-Y. Autophagy in age-related macular degeneration:
a regulatory mechanism of oxidative stress. Oxidative
Med Cell Longev. 2020;2020:2896036.
44. Sinha D, Valapala M, Shang P, Hose S, Grebe R,
Lutty GA, et al. Lysosomes: regulators of autophagy
in the retinal pigmented epithelium. Exp Eye Res.
2016;144:46–53.
45. Golestaneh N, Chu Y, Xiao Y-Y, Stoleru GL, Theos
AC. Dysfunctional autophagy in RPE, a contribut-
ing factor in age-related macular degeneration. Cell
Death Dis. 2018;8(1):e2537.
46. Gehrs KM, Anderson DH, Johnson LV, Hageman
GS. Age-related macular degeneration—emerging
pathogenetic and therapeutic concepts. Ann Med.
2006;38(7):450–71.
47. Bhutto I, Lutty G. Understanding age-related macu-
lar degeneration (AMD): relationships between the
photoreceptor/retinal pigment epithelium/Bruch’s
membrane/choriocapillaris complex. Mol Asp Med.
2012;33(4):295–317.
48. Blasiak J. Senescence in the pathogenesis of age-­
related macular degeneration. Cell Mol Life Sci.
2020;77(5):789–805.
H.-Y. Pan and M. Valapala
49. Moreno-García A, Kun A, Calero O, Medina M,
Calero M. An overview of the role of lipofuscin in
age-related neurodegeneration. Front Neurosci.
2018;12:464.
50. Valapala M, Wilson C, Hose S, Bhutto IA, Grebe R,
Dong A, et al. Lysosomal-mediated waste clearance
in retinal pigment epithelial cells is regulated by
CRYBA1/βA3/A1-crystallin via V-ATPase-MTORC1
signaling. Autophagy. 2014;10(3):480–96.
51. Escrevente C, Falcão AS, Hall MJ, Lopes-Da-Silva
M, Antas P, Mesquita MM, et al. Formation of
lipofuscin-­like autofluorescent granules in the retinal
pigment epithelium requires lysosome dysfunction.
Investig Opthalmol Vis Sci. 2021;62(9):39.
52. Bayati S, Yazdanparast R. Antioxidant and free radi-
cal scavenging potential of yakuchinone B deriva-
tives in reduction of lipofuscin formation using
H2O2-treated neuroblastoma cells. Iran Biomed J.
2011;15(4):134–42.
53. Terman A, Dalen H, Eaton JW, Neuzil J, Brunk
UT. Aging of cardiac myocytes in culture: oxidative
stress, lipofuscin accumulation, and mitochondrial
turnover. Ann N Y Acad Sci. 2004;1019(1):70–7.
54. Demers-Lamarche J, Guillebaud G, Tlili M, Todkar
K, Bélanger N, Grondin M, et al. Loss of mito-
chondrial function impairs lysosomes. J Biol Chem.
2016;291(19):10263–76.
55. Yuan Y, Chen Y, Peng T, Li L, Zhu W, Liu F, et al.
Mitochondrial ROS-induced lysosomal dysfunction
impairs autophagic flux and contributes to M1 mac-
rophage polarization in a diabetic condition. Clin Sci.
2019;133(15):1759–77.
56. Song SB, Hwang ES. High levels of ROS impair lyso-
somal acidity and autophagy flux in glucose-deprived
fibroblasts by activating ATM and Erk pathways.
Biomol Ther. 2020;10(5):761.
57. Espinosa-Heidmann DG, Suner IJ, Catanuto
P, Hernandez EP, Marin-Castano ME, Cousins
SW. Cigarette smoke–related oxidants and the devel-
opment of Sub-RPE deposits in an experimental ani-
mal model of dry AMD. Investig Opthalmol Vis Sci.
2006;47(2):729.
58. Strunnikova N, Zhang C, Teichberg D, Cousins SW,
Baffi J, Becker KG, et al. Survival of retinal pigment
epithelium after exposure to prolonged oxidative
injury: a detailed gene expression and cellular analy-
sis. Investig Opthalmol Vis Sci. 2004;45(10):3767.
59. Bertram KM, Baglole CJ, Phipps RP, Libby
RT. Molecular regulation of cigarette smoke
induced-oxidative stress in human retinal pig-
ment epithelial cells: implications for age-related
macular degeneration. Am J Physiol Cell Physiol.
2009;297(5):C1200–C10.
60. Abokyi S, Shan S-W, Lam CH-I, Catral KP, Pan F,
Chan HH-L, et al. Targeting lysosomes to reverse
hydroquinone-induced autophagy defects and oxida-
tive damage in human retinal pigment epithelial cells.
Int J Mol Sci. 2021;22(16):9042.
61. Abokyi S, Shan SW, To C-H, Chan HH-L, Tse
DY-Y. Autophagy upregulation by the TFEB
Role of TFEB in Diseases Associated with Lysosomal Dysfunction
inducer Trehalose protects against oxidative dam-
age and cell death associated with NRF2 inhibition
in human RPE cells. Oxidative Med Cell Longev.
2020;2020:1–18.
62. Arotcarena M-L, Bourdenx M, Dutheil N, Thiolat
M-L, Doudnikoff E, Dovero S, et al. Transcription
factor EB overexpression prevents neurodegenera-
tion in experimental synucleinopathies. JCI Insight.
2019;4(16):e129719.
63. Torra A, Parent A, Cuadros T, Rodríguez-Galván B,
Ruiz-Bronchal E, Ballabio A, et al. Overexpression
of TFEB drives a pleiotropic neurotrophic effect and
325
prevents Parkinson’s disease-related neurodegenera-
tion. Mol Ther. 2018;26(6):1552–67.
64. Bécot A, Pardossi-Piquard R, Bourgeois A, Duplan
E, Xiao Q, Diwan A, et al. The transcription factor
EB reduces the intraneuronal accumulation of the
beta-secretase-derived APP fragment C99 in cel-
lular and mouse Alzheimer’s disease models. Cells.
2020;9(5):1204.
65. Karim MR, Fisher CR, Kapphahn RJ, Polanco JR,
Ferrington DA. Investigating AKT activation and
autophagy in immunoproteasome-deficient retinal
cells. PLoS One. 2020;15(4):e0231212.
 Retinoic Acid Receptor-Related
Orphan Receptors (RORs) in Eye
Development and Disease
Felix Yemanyi, Kiran Bora, Alexandra K. Blomfield,
and Jing Chen
Abstract
The retinoic acid receptor-related orphan
receptors (RORs) are ligand-mediated tran-
scription factors with important biological
roles in regulating circadian rhythms, metabo-
lism, immunity, angiogenesis, inflammation,
and development. They belong to the super-
family of nuclear receptors and include three
family members: RORα, RORβ, and RORγ.
Currently identified ROR ligands include cho-
lesterol and cholesterol derivatives for RORα
and RORγ, and stearic acid and all-trans reti-
noic acid for RORβ. Aberrant signaling of the
RORs is involved in the pathogenesis of sev-
eral human diseases including autoimmune
diseases, metabolic disorders, and certain can-
cers. In the eye, RORs regulate normal devel-
opment of the lens and the retina, and also
contribute to potentially blinding eye diseases,
especially retinal vascular diseases. Here, we
review the role of RORs in eye development
and disease to highlight their potential as
druggable targets for therapeutic development
in retinal vascular and degenerative diseases.
F. Yemanyi · K. Bora · A. K. Blomfield · J. Chen (*)
Department of Ophthalmology, Boston Children’s
Hospital, Harvard Medical School, Boston, MA,
USA
e-mail: Jing.Chen@childrens.harvard.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_47
Keywords
Nuclear receptors · Retinoic acid receptor-­
related orphan receptors (RORs) · RORα ·
RORβ · RORγ · Eye development · Eye
diseases · Retinal vascular diseases · Retinal
degenerative diseases
1 Introduction
The retinoic acid receptor-related orphan recep-
tors (RORs) belong to a subfamily of the nuclear
receptor (NR) superfamily and include three
members: RORα (NR1F1), RORβ (NR1F2), and
RORγ (NR1F3) [1]. Like other members of the
NR superfamily, the RORs exhibit a marked
sequence homology and conserved structure to
enable their function as ligand-dependent tran-
scription regulators. RORs harbor a ligand-­
independent activation function-1 (AF-1) domain
in the N-terminus, followed by a DNA-binding
domain (DBD), hinge region, and a ligand-­
binding domain in the C-terminus, with the DBD
being the most conserved region for DNA recog-
nition [2]. Upon ligand-regulated activation,
RORs bind as monomers to DNA at ROR
response elements (RORE) encompassing an
AGGTCA consensus motif preceded by an A/T-­-
rich region [2]. Together with other transcrip-
tional co-regulators, RORs meditate transcription
of many target genes including circadian, meta-
327
328
bolic, and inflammatory genes. They hence play
important physiological roles in regulating circa-
dian rhythm, development, metabolism, angio-
genesis, and immunity [1, 3].
Dysregulation of RORs is implicated in sev-
eral pathologies like cancer, autoimmune, meta-
bolic, and inflammatory diseases [1, 2, 4]. While
the endogenous physiological ligands for RORs
have not been unequivocally confirmed, choles-
terol and cholesterol derivatives have been dis-
covered as ligands for RORα and RORγ, and
stearic acid and all-trans retinoic acid were iden-
tified as RORβ ligands based on structural bind-
ing [3]. Many synthetic ROR agonists and
antagonists have also been developed and are
currently being investigated in experimental
studies of ROR-related diseases [3]. Therefore,
RORs represent attractive druggable targets to
ameliorate several debilitating human diseases
including ocular pathologies. Accordingly, this
mini review summarizes the respective roles of
the RORs in eye development and diseases.
2 RORα Regulates Eye
Development and Vascular
Eye Diseases
2.1 RORα Regulates Lens
and Cone Photoreceptor
Development
RORα is widely expressed in many tissues
including the brain, liver, skeletal muscle, skin,
lung, adipose tissue, and eye [2]. The human
RORα (RORA) gene is located on chromosome
15q22.2. Humans express four RORα isoforms
(RORα1–4) produced by alternative splicing,
whereas two of these isoforms (RORα1 and
RORα4) are also expressed in mice [5]. In the
mouse eye, expression of RORα is found in the
lens, retinal ganglion cells, bipolar cells, photore-
ceptors, and microglia/macrophages [6–9].
RORα is important for the development of the
lens [10], where it is critical for the differentia-
tion of lens epithelial cells into fiber cells by
directly activating expression of γF-crystallin
gene [10]. In addition, RORα is also important
F. Yemanyi et al.
for cone photoreceptor development in the mouse
retina, where it directly regulates a subset of cone
photopigment genes, including S-opsin and
M-opsin, as well as cone arrestin [7].
2.2 Genetic Variations of RORA
Are Linked with Age-Related
Macular Degeneration (AMD)
The importance of RORα in eye diseases is
exemplified by genetic studies linking its genetic
variation with risks of developing AMD, a major
cause of vision impairment in the elderly.
Previous human clinical studies have identified
common variants and haplotypes within intron 1
of the RORA gene and its apparent synergistic
interaction with the ARMS2/HTRA1 locus as
increased risk factors for wet (neovascular) AMD
[11, 12]. A subsequent study suggested interac-
tion between RORA and ROBO1 genes for both
wet and dry (atrophic) AMD risks [13]. Together,
these works highlight an important role of RORα
in AMD pathogenesis. Consequently, an AAV
approach delivering RORA gene (OCU410,
AAV-RORA) is currently being investigated by
Ocugen Inc. as a potential gene therapy for AMD,
and clinical trials are planned.
2.3 RORα Modulates Retinal
Inflammation and
Neurovascular Interaction
in a Mouse Model of Oxygen-­
Induced Retinopathy (OIR)
Additional function of RORα in ocular angiogen-
esis was uncovered by our group using a mouse
model of OIR [14] modeling ischemic prolifera-
tive retinopathy in humans. We found that RORα
is a novel regulator of pathologic retinal neovas-
cularization by directly modulating the transcrip-
tion of suppressor of cytokine signaling 3
(SOCS3), a key inflammatory regulator, in retinal
microglia and macrophages [8]. RORα-deficient
mice exhibit decreased neovascularization in
OIR with dampened inflammatory response,
whereas treatment with RORα synthetic inverse
Retinoic Acid Receptor-Related Orphan Receptors (RORs) in Eye Development and Disease
agonist ameliorated the neovascular lesions in
both OIR mouse retinas and mice deficient in
very low-density lipoprotein receptor (VLDLR),
modeling angiomatous proliferation and macular
telangiectasia [8]. In addition, RORα engenders
pathological retinal angiogenesis in mice by dis-
rupting the physiological interactions between
retinal neurons and the vasculature via negatively
regulating class 3 semaphorin E (SEMA3E), a
neuron-secreted axonal and vascular guidance
factor, in retinal ganglion cells [9]. These works
suggest an angiogenic role of RORα in modulat-
ing pathological neovascularization in experi-
mental retinopathy via regulating both
inflammation and neurovascular interaction
(Fig. 1).
Together, in the eye, RORα is not only impor-
tant for lens and retinal development but also
implicated in clinical AMD and experimental
retinopathy (Fig. 2), suggesting that RORα is a
probable druggable target for these eye
conditions.
Fig. 1 Schematic diagram illustrating regulation of path-
ological retinal angiogenesis by RORα. RORα suppresses
transcription of Socs3 in retinal microglia/macrophage,
thereby increasing inflammation to promote pathological
neovascularization in retinopathy. In addition, RORα
directly suppresses Sema3E gene transcription in RGCs,
329
3 RORβ Regulates Retinal
Neuronal Differentiation
Compared with RORα, expression of RORβ is
more restricted, found exclusively in the brain,
bone, and the eye [2]. The RORβ gene (RORB) is
mapped to human chromosome 9q21.13 [3].
Whereas humans seemingly express only one
RORβ isoform (RORβ1), in mice, two isoforms
(RORβ1 and RORβ2) have been reported [3]. In
the eye, RORβ is expressed in retinal neurons and
is vital for the development of rod and cone pho-
toreceptors [15–17]. During prenatal and postna-
tal development of the mouse retina, RORβ
transcriptionally modulates Blimp1 to induce the
photoreceptor cell fate by suppressing bipolar
cell identity in most of the retinal progenitor cells
[15]. In addition, RORβ directly transactivates
S-opsin in cones during photoreceptor develop-
ment in mice [16]; therefore, loss of function in
RORβ results in S-cone morphological abnor-
malities in addition to rod loss [17]. Moreover,
leading to disrupted neurovascular interaction concomi-
tant with pathological neovascularization in retinopathy.
RORα: retinoic acid receptor-related orphan receptor α,
Socs3: suppressor of cytokine signaling 3, Sema3E: class
3 semaphorin E, RGCs: retinal ganglion cells, RORE:
ROR response elements
330
Fig. 2 Venn diagram
summarizing the
overlapping and distinct
roles of RORs in eye
development and
disease. RORs: retinoic
acid receptor-related
orphan receptors
the RORβ1 isoform is important for differentia-
tion of retinal horizontal and amacrine interneu-
rons through mediating early-acting factors Ptf1a
and Foxn4 [18]. All these studies strongly sug-
gest a transcriptional regulatory role of RORβ in
mediating retinal neuronal differentiation, par-
ticularly photoreceptors and interneu-
rons (Fig. 2). Whereas RORβ has roles in
regulating circadian rhythms (just like RORα)
and bone development [2, 3], and loss of function
in RORB is associated with epilepsy in humans
[19], whether it plays any role in eye diseases is
still unknown.
4 RORγ in Autoimmune
Regulation and Eye Diseases
4.1 RORγt, a Key Regulator
of Th17 Cells, Is Implicated
in Ocular Autoimmunity
The RORγ gene maps to human chromosome
1q21.3 and exists as two isoforms in both humans
and mice: RORγ (RORγ1) and RORγt (RORγ2).
RORγ differs from RORγt only at the first 100
nucleotides at the N-terminus [2]. RORγ is
expressed in muscle tissue, prostate, pancreas,
heart, liver, and testicles, whereas RORγt is
expressed in lymphatic tissues and in the retinal
F. Yemanyi et al.
vasculature [2, 20]. RORγt together with RORα
is a key transcription factor for T helper (Th) 17
cell differentiation and interleukin 17 (IL-17)
production [21, 22]. Whereas enhancement of
this RORγt-mediated regulation of Th17 cells
and IL-17 is a promising immunotherapy for can-
cer [23] and autoimmune diseases [24] and for
preventing corneal infections [25], excessive pro-
duction of Th17 cells and IL17 by RORγt is a
major hallmark of ocular diseases such as dry eye
[26], Graves orbitopathy (the most common
orbital disease causing blindness and disability)
[27, 28], and autoimmune uveitis [29]. Therefore,
in these eye conditions, inhibition of RORγt may
hold promise as a new therapeutic intervention.
Additionally, genetic variations of IL-17 are also
linked with AMD [30], as well as Th17 cells in
AMD-associated inflammation [31], further sug-
gesting a putative role of RORγt in AMD.
4.2 RORγt/IL17 Signaling Axis
in Retinal Vasculature
Recent experimental studies suggest an emerging
role of RORγt in regulating retinal vasculature
under pathological conditions. For example, a
study reported pathologic role of the RORγt/IL17
signaling axis in the retinal vasculature of dia-
betic mice modeling diabetic retinopathy (DR), a
Retinoic Acid Receptor-Related Orphan Receptors (RORs) in Eye Development and Disease
microvascular complication of diabetes which References
affects the working-age population [20].
Consequently, small-molecule inhibitors of
RORγt (including SR1001, the RORα/γ inverse
agonist) ameliorated the vessel loss, neovascular
phenotype, and vascular leakage observed in dia-
betic mice and OIR retinas [20, 29, 32]. Another
study in mice and rats also demonstrated that reti-
nal immunocompetent cells, microglia, could be
an additional source of RORγt and IL17A beyond
Th17 cells, to subsequently trigger production of
vascular endothelial growth factor (VEGF) and
mediate pathological retinal neovascularization
in experimental retinopathy [32].
To recapitulate, aberrant RORγt expression
and signaling are implicated in several eye dis-
eases including dry eye, autoimmune uveitis, as
well as experimental retinopathy (Fig. 2). Small-­
molecule inhibitors of RORγt may offer promis-
ing therapeutic option to curb the visual
impairment associated with these eye and retinal
diseases.
5 Conclusions
While both RORα and RORβ play important
roles in retinal development and neuronal differ-
entiation, both RORα and RORγt are implicated
in retinal vascular diseases and ocular immune
regulation (Fig. 2). Given these roles of RORs in
the eye, targeting them in pathological eye condi-
tions is appealing. Over the past two decades, the
discovery of many endogenous and synthetic
ligands for RORs has instilled hope and garnered
attention for drug development [2–4]. Harnessing
RORs as drug targets could greatly expand cur-
rent treatment options for various eye diseases
including AMD and other retinal vascular and
degenerative diseases [8, 9, 29, 32].
Acknowledgments:
Funding: This work was supported by NIH/NEI R01
grants (EY024963, EY028100, and EY031765) (to J.C.).
Author contributions: F.Y. and J.C. conceived the mini
review and wrote the manuscript; K.B. and J.C. prepared
the figures. F.Y., K.B., A.K.B. and J.C. edited and
approved the manuscript.
331
1. Fan J, et al. Retinoic acid receptor-related orphan
receptors: critical roles in tumorigenesis. Front.
Immunol. 2018;9:1187. https://doi.org/10.3389/
fimmu.2018.01187.
2. Ladurner A, Schwarz PF, Dirsch VM. Natural
products as modulators of retinoic acid recep-
tor-related orphan receptors (RORs). Nat. Prod.
Rep. 2021;38(4):757–81. https://doi.org/10.1039/
d0np00047g.
3. Solt LA, Griffin PR, Burris TP. Ligand regulation
of retinoic acid receptor-related orphan receptors:
implications for development of novel therapeutics.
Curr. Opin. Lipidol. 2010;21(3):204–11. https://doi.
org/10.1097/mol.0b013e328338ca18.
4. Zhang Y, Luo X-Y, Wu D-H, Xu Y. ROR nuclear
receptors: structures, related diseases, and drug dis-
covery. Acta Pharmacol. Sin. 2015;36(1):71–87.
https://doi.org/10.1038/aps.2014.120.
5. Lee JM, Kim H, Baek SH. Unraveling the physi-
ological roles of retinoic acid receptor-related orphan
receptor α. Exp. Mol. Med. 2021;53(9):1278–86.
https://doi.org/10.1038/s12276-­021-­00679-­8.
6. Steinmayr M, et al. Staggerer phenotype in retinoid-­
related orphan receptor-deficient mice. Proc.
Natl. Acad. Sci. 1998;95(7):3960–5. https://doi.
org/10.1073/pnas.95.7.3960.
7. Fujieda H, Bremner R, Mears AJ, Sasaki H. Retinoic
acid receptor-related orphan receptor α regulates a
subset of cone genes during mouse retinal develop-
ment. J. Neurochem. 2009;108(1):91–101. https://doi.
org/10.1111/j.1471-­4159.2008.05739.x.
8. Sun Y, et al. Nuclear receptor RORα regulates patho-
logic retinal angiogenesis by modulating SOCS3-­
dependent inflammation. Proc. Natl. Acad. Sci.
2015;112(33):10401–6. https://doi.org/10.1073/
pnas.1504387112.
9. Sun Y, et al. RORα modulates semaphorin 3E tran-
scription and neurovascular interaction in pathological
retinal angiogenesis. FASEB J. 2017;31(10):4492–
502. https://doi.org/10.1096/fj.201700172r.
10. Tini M, Fraser RA, Giguère V. Functional interac-
tions between retinoic acid receptor-related orphan
nuclear receptor (RORα) and the retinoic acid recep-
tors in the regulation of the γF-crystallin promoter.
J. Biol. Chem. 1995;270(34):20156–61. https://doi.
org/10.1074/jbc.270.34.20156.
11. Silveira AC, et al. Convergence of linkage, gene
expression and association data demonstrates the
influence of the RAR-related orphan receptor alpha
(RORA) gene on neovascular AMD: a systems biol-
ogy based approach. Vision Res. 2010;50(7):698–
715. https://doi.org/10.1016/j.visres.2009.09.016.
12. Schaumberg DA. Prospective study of common vari-
ants in the retinoic acid receptor–related orphan recep-
tor α gene and risk of neovascular age-related macular
degeneration. Arch. Ophthalmol. 2010;128(11):1462.
https://doi.org/10.1001/archophthalmol.2010.261.
332
13. Jun G, et al. Influence of ROBO1 and RORA on risk of
age-related macular degeneration reveals genetically
distinct phenotypes in disease pathophysiology. PloS
One. 2011;6(10):e25775. https://doi.org/10.1371/
journal.pone.0025775.
14. Smith L, et al. Oxygen-induced retinopa-
thy in the mouse. Invest. Ophthalmol. Vis. Sci.
1994;35(1):101–11.
15. Mills TS, et al. Combinatorial regulation of a Blimp1
(Prdm1) enhancer in the mouse retina. PloS One.
2017;12(8):e0176905. https://doi.org/10.1371/jour-
nal.pone.0176905.
16. Srinivas M, Ng L, Liu H, Jia L, Forrest D. Activation
of the blue opsin gene in cone photoreceptor devel-
opment by retinoid-related orphan receptor β.
Mol. Endocrinol. 2006;20(8):1728–41. https://doi.
org/10.1210/me.2005-­0505.
17. Jia L, et al. Retinoid-related orphan nuclear recep-
tor ROR is an early-acting factor in rod photo-
receptor development. Proc. Natl. Acad. Sci.
2009;106(41):17534–9. https://doi.org/10.1073/
pnas.0902425106.
18. Liu H, et al. An isoform of retinoid-related
orphan receptor β directs differentiation of reti-
nal amacrine and horizontal interneurons. Nat.
Commun. 2013;4(1):1813. https://doi.org/10.1038/
ncomms2793.
19. Rudolf G, et al. Loss of function of the retinoid-­
related nuclear receptor (RORB) gene and epilepsy.
Eur. J. Hum. Genet. 2016;24(12):1761–70. https://
doi.org/10.1038/ejhg.2016.80.
20. Zapadka TE, et al. RORγt inhibitor-SR1001 halts
retinal inflammation, capillary degeneration, and
the progression of diabetic retinopathy. Int. J. Mol.
Sci. 2020;21(10):3547. https://doi.org/10.3390/
ijms21103547.
21. Ivanov II, et al. The orphan nuclear receptor RORγt
directs the differentiation program of proinflamma-
tory IL-17+ T helper cells. Cell. 2006;126(6):1121–
33. https://doi.org/10.1016/j.cell.2006.07.035.
22. Wang R, et al. Genetic and pharmacological inhibition
of the nuclear receptor RORα regulates TH17 driven
inflammatory disorders. Nat. Commun. 2021;12(1)
https://doi.org/10.1038/s41467-­020-­20385-­9.
23. Qiu R, Wang Y. Retinoic acid receptor-related orphan
receptor γt (RORγt) agonists as potential small
F. Yemanyi et al.
molecule therapeutics for cancer immunotherapy.
J. Med. Chem. 2018;61(14):5794–804. https://doi.
org/10.1021/acs.jmedchem.7b01314.
24. Solt LA, et al. Suppression of TH17 differentiation
and autoimmunity by a synthetic ROR ligand. Nature.
2011;472(7344):491–4. https://doi.org/10.1038/
nature10075.
25. Taylor PR, et al. JAK/STAT regulation of Aspergillus
fumigatus corneal infections and IL-6/23-stimulated
neutrophil, IL-17, elastase, and MMP9 activity.
J. Leukoc. Biol. 2016;100(1):213–22. https://doi.
org/10.1189/jlb.4a1015-­483r.
26. Zheng X, De Paiva CS, Li D-Q, Farley WJ,
Pflugfelder SC. Desiccating stress promotion of Th17
differentiation by ocular surface tissues through a
dendritic cell-mediated pathway. Investig Opthalmol
Vis Sci. 2010;51(6):3083. https://doi.org/10.1167/
iovs.09-­3838.
27. Fang S, et al. Evidence for associations between Th1/
Th17 “hybrid” phenotype and altered lipometabolism
in very severe graves orbitopathy. J. Clin. Endocrinol.
Metabol. 2020;105(6):1851–67.
28. Fang S, et al. IL-17A exacerbates fibrosis by pro-
moting the proinflammatory and profibrotic function
of orbital fibroblasts in TAO. J. Clin. Endocrinol.
Metabol. 2016;101(8):2955–65. https://doi.
org/10.1210/jc.2016-­1882.
29. Tan J, et al. Small molecules targeting RORγt inhibit
autoimmune disease by suppressing Th17 cell dif-
ferentiation. Cell Death Dis. 2020;11(8) https://doi.
org/10.1038/s41419-­020-­02891-­2.
30. Zhang S, Liu Y, Lu S, Cai X. Genetic variants of
interleukin 17A are functionally associated with
increased risk of age-related macular degenera-
tion. Inflammation. 2015;38(2):658–63. https://doi.
org/10.1007/s10753-­014-­9973-­3.
31. Chen J, Wang W, Li Q. Increased Th1/Th17
responses contribute to low-grade inflamma-
tion in age-related macular degeneration. Cell.
Physiol. Biochem. 2017;44(1):357–67. https://doi.
org/10.1159/000484907.
32. Talia DM, Deliyanti D, Agrotis A, Wilkinson-Berka
JL. Inhibition of the nuclear receptor RORγ and
interleukin-17A suppresses Neovascular retinopathy.
Arterioscler. Thromb. Vasc. Biol. 2016;36(6):1186–
96. https://doi.org/10.1161/atvbaha.115.307080.
 Part VIII
Mechanisms of Degeneration – Animal
Models
 A Novel Mouse Model
for Late-­Onset Retinal
Degeneration (L-ORD) Develops
RPE Abnormalities Due to the Loss
of C1qtnf5/Ctrp5

Shyamanga Borooah, Anil Chekuri,

Shikha Pachauri, Bhubananda Sahu,
Marina Vorochikhina, John J. Suk, Dirk-­
Uwe Bartsch, Venkata R. M. Chavali,
Monica M. Jablonski, and Radha Ayyagari

Abstract nal imaging, light microscopy, and

Late-onset retinal degeneration (L-ORD) is an
autosomal dominant macular dystrophy
resulting from mutations in the gene
CTRP5/C1QTNF5. A mouse model (Ctrp5+/−)
for the most common S163R developed many
features of human clinical disease. We gener-
ated a novel homozygous Ctrp5 gene knock-­
out (Ctrp5−/−) mouse model to further study
the mechanism of L-ORD. The retinal mor-
phology of these mice was evaluated by reti-
Authors Shyamanga Borooah and Anil Chekuri have
equally contributed to this chapter.
transmission electron microscopy (TEM) at 6,
11, and 18.5 mo. Expression of Ctrp5 was
analyzed using immunostaining and qRT-­
PCR. The Ctrp5−/− mice showed lack of both
Ctrp5 transcript and protein. Presence of a
significantly larger number of autofluorescent
spots was observed in Ctrp5−/− mice compared
to the WT (P < 0.0001) at 19 mo. Increased
RPE stress with vacuolization and thinning
was observed as early as 6 mo in Ctrp5−/−
mice. Further, ultrastructural analyses revealed
a progressive accumulation of basal laminar
sub-RPE deposits in Ctrp5−/− mice from 11
mo. The Ctrp5−/− mice shared retinal and RPE

S. Borooah · S. Pachauri · B. Sahu · M. Vorochikhina Department of Ophthalmology, Scheie Eye Institute,

· J. J. Suk · D.-U. Bartsch · V. R. M. Chavali · University of Pennsylvania, Philadelphia, PA, USA
R. Ayyagari (*) e-mail: anil_chekuri@meei.harvard.edu
Shiley Eye Institute, University of California San
M. M. Jablonski
Diego, La Jolla, CA, USA
Department of Ophthalmology, Hamilton Eye
e-mail: sborooah@health.ucsd.edu; spachauri@
Institute, University of Tennessee Health Science
health.ucsd.edu; bsahu@ucsd.edu; jjsuk@ucsd.edu;
Center, Memphis, TN, USA
dbartsch@health.ucsd.edu; vchavali@pennmedicine.
e-mail: mjablon1@uthsc.edu
upenn.edu; rayyagari@health.ucsd.edu
A. Chekuri
Shiley Eye Institute, University of California San
Diego, La Jolla, CA, USA

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 335
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_48
336
pathology that matches with that previously
described for Ctrp5+/− mice suggesting that
pathology in these mice results from the loss
of functional CTRP5 and that the presence of
CTRP5 is critical for normal RPE and retinal
function.
Keywords
Late-onset retinal degeneration (L-ORD) ·
CTRP5/C1QTNF5 · Sub-RPE deposits ·
BLamD · Retinal and RPE pathology · Gene
knock-out mouse model · Fundus autofluo-
rescent spots
1 Introduction
Late-onset retinal degeneration (L-ORD) is an
autosomal dominant phenotype. The presence of
deposits between the retinal pigment epithelium
and Bruch’s membrane has been described as the
hallmark of autosomal dominant L-ORD [1].
Fig. 1 Confirmation of Ctrp5 deletion in Ctrp5−/− mice
(a) The Ctrp5 knock-out allele was generated by excision
of exons 2 and 3 of Ctrp5 by Cre-recombinase. The Ctrp5
knock-out allele possesses only exon 1. The restriction
sites and location of exon1 (box) are also shown. (b)
Expression of Ctrp5 mRNA in WT and Ctrp5−/− mice pos-
S. Borooah et al.
Patients with L-ORD usually develop early-onset
long anterior lens zonules, late-onset dark-­
adaptation abnormalities, pseudodrusen deposits,
geographic atrophy, and visual symptoms begin-
ning in fifth decade of life, with late-stage choroi-
dal neovascular membrane formation in the
macula [2]. Mutations in the gene C1QTNF5/
CTRP5 have been implicated in L-ORD pathol-
ogy [3, 4]. A mouse model with the heterozygous
S163R mutation in Ctrp5 recapitulated the
L-ORD phenotype [5, 6]. Here we describe the
phenotype of a homozygous Ctrp5 gene knock-­
out (KO) mouse (Ctrp5−/−) model to further
understand the mechanism of L-ORD pathology.
2 Results
2.1 Exons 2 and 3 of Ctrp5 Are
Deleted in Ctrp5−/− Mice
The Ctrp5 knock-out allele was generated by
excision of exons 2 and 3 of Ctrp5 and contains
terior eyecup tissue at 2 mo (*** P < 0.001). (c)
Immunostaining of CTRP5 (red) in 2-mo WT and Ctrp5−/−
mouse retina. (d) Western blot analysis of CTRP5 expres-
sion in posterior eye cup lysates from 2-mo-old WT and
Ctrp5−/− mice. β-Actin was used for normalization
A Novel Mouse Model for Late-Onset Retinal Degeneration (L-ORD) Develops RPE Abnormalities…
only exon 1 (Fig. 1.a). Amplification and sequenc-
ing of genomic DNA using primers flanking the
deleted region confirmed the absence of exons 2
and 3 of Ctrp5 in Ctrp5−/− mice.
2.2 Loss of Ctrp5 Expression
in Ctrp5−/− Mice
CTRP5 is expressed predominantly in the RPE
and ciliary body within the eye of normal indi-
viduals [7]. In the ocular tissue of 2-mo Ctrp5−/−
mice, the Ctrp5 transcript and the protein were
undetectable by qRT-PCR, Western blot analysis,
and immunohistochemistry (Fig. 1b, c, d).
2.3 Accumulation
of Autofluorescent Spots
in Ctrp5−/− Mice
Fundus autofluorescent (AF) scanning laser oph-
thalmoscopy was employed for the examination
of the AF spots in the retina of 19-mo WT
C57BL/6 and Ctrp5−/− mice. Ctrp5−/− mice
showed a significantly higher number of AF
spots, i.e., 38.4 ± 11.1 (n = 4) as compared to the
WT mice 5.5 ± 2.2 (n = 5) (P < 0.0001) (Fig. 2).
2.4 Early RPE Stress
and Accumulation of Sub-RPE
Deposits with Age
in Ctrp5−/− Mice
Retinal morphology of Ctrp5−/− mice showed
abnormal retinal and RPE structure as early as 6
Fig. 2 Autofluorescence
imaging of WT and
Ctrp5−/− mice
Representative AF-SLO
images from 19-mo-old
WT and Ctrp5−/− mice
337
mo (Fig. 3), and signs of RPE stress were evident
in Ctrp5−/− mice, with areas of vacuolization and
thinning, allowing photoreceptor outer segments
to protrude into spaces that would ordinarily be
occupied by the RPE. By 11 mo of age, sub-RPE
deposits and swollen photoreceptor inner seg-
ments were present. By 18.5 mo, RPE vacuoles
and sub-RPE deposits were more abundant.
Retinal ultrastructure analysis also showed
similar structural profile of Ctrp5−/− mice
(Fig. 4). The RPE of Ctrp5−/− mice aged 6 mo
or older were filled with vacuoles of varying
sizes. At 11 mo, dense sub-RPE deposits were
present in Bruch’s membrane, and these
increased in size by 18.5 mo. The most promi-
nent feature of the RPE of 18.5-mo Ctrp5−/−
mice was the presence of electron-dense
lipid-based basal laminar deposits. In addition
Bruch’s membrane was periodically disrupted.
In comparison, no aberrant features were noted
in 21-mo WT mice.
3 Materials and Methods
3.1 Generation of Mice
The generation and characterization of the hetero-
zygous knock-in (Ctrp5 +/−) mice has been described
previously [5]. To generate homozygous Ctrp5
knock-out (Ctrp5−/−) mice, Ctrp5+/+ mice were
crossed with global Cre mice on the same
C57BL/6 J background to remove exons 2 and 3 of
the Ctrp5 gene [8]. The Ctrp5−/− genotype was
detected using primers flanking the deleted region
(3329-Ctrp5-F, 5′-GTCTGAGGAAGCCATTCA
AAG-3′, and 3331-Ctrp5-R, 5′-GGT CCTGGG
338 S. Borooah et al.

Fig. 3 Analysis of retinal histology in Ctrp5−/− mice cated with the boxes labeled (E-H). Areas of RPE vacuol-
Retinal architecture was analyzed by LM in 6-, 11-, 18.5- ization are marked with black arrows. Magnification
mo Ctrp5−/− mice and 21-mo WT (A-D). Magnified bars = 200 microns in top panels and 500 nanometers in
images of panel A-D generated from the regions demar- lower panels

TCTTTGTCAGA-3′). The mice were genotyped Cambridge, UK) was used for IHC. The expres-
to ensure that they were clear of the rd8 mutation. sion of Ctrp5 transcript was normalized against
The maintenance and care of mice were in accor- GAPDH [5].
dance with the ARVO statement for the Use of
Animals in Ophthalmic and Vision Research and
with protocols approved by the UCSD Institutional 3.3 Autofluorescence Imaging
Animal Care and Use Committee.
SPECTRALIS HRA + OCT scanning laser oph-
thalmoscopy (Heidelberg Engineering, Inc.) was
3.2 Evaluation of the Expression used to take autofluorescence images of murine
of CTRP5 and the Transcript retina. The method was a modified protocol from
that described previously [5]. To facilitate count-
Expression of Ctrp5 transcript and protein was ing deep retinal AF spots, the initial focus for
studied in 2-mo Ctrp5−/− and WT mice RPE-­ images was just in front of the nerve fiber layer,
choroid tissue by qRT PCR, Western blot analysis, and then images were taken in 0.5 diopter steps
and immunohistochemistry (IHC) as descried until the posterior vessels emerging from the disc
­earlier [5]. The anti-CTRP5 polyclonal antibody were in focus to ensure that deep AF spots would
which was generated in-house (1:500) and has be at their best focus. The autofluorescence image
previously been used for western blotting [7], composed of 10 frame per fundus was taken with
­
while the anti-CTRP5 (1:100, ab36893, Abcam, a 55° angle lens. AF spots were counted from WT
A Novel Mouse Model for Late-Onset Retinal Degeneration (L-ORD) Develops RPE Abnormalities…
Fig. 4 Retinal ultrastructure in Ctrp5−/− mice
In Ctrp5−/− mice, arrows in panels B, C, D, F, G, and H
represent vacuoles in RPE. The pound sign in panels C
and G represent dense sub-RPE deposits in Bruch’s mem-
and Ctrp5−/− mice aged 19 mo (n = 3 for each),
from one field of view centered on the optic disc
by a masked observer.
3.4 Histology and Ultrastructure
Analysis of the Retina
Retinal morphology and ultrastructure of eyes of
6-, 11-, and 18.5-mo-old Ctrp5−/− and 21-mo WT
control mice were analyzed by LM and TEM as
described earlier [5]. For TEM, the sample from
18.5-mo Ctrp5−/− mice was processed using an
osmium–tannic acid–phenylenediamine (OTAP)
method to preserve lipids [9]. All other sections
underwent standard processing.
4 Discussion
A systematic analysis of the ocular phenotype of
the homozygous Ctrp5 gene knock-out model
(Ctrp5−/−) revealed RPE pathology consistent
with the phenotype observed in patients with
339
brane, which increased in size by 18.5 mo (pound signs in
panels D and H). The asterisks in panels D and H repre-
sent the presence of an electron dense lipid-based material
in the RPE of 18.5-mo Ctrp5−/− mice
L-ORD and the previously characterized Ctrp5+/−
mouse model [1, 2, 5, 10]. The Ctrp5−/− mice
developed AF spots which were distributed
throughout the retina, similar to Ctrp5+/− mice.
The number of AF spots increased with age.
The major pathological features of human
L-ORD include the presence of thick sub-RPE
deposits, Bruch’s membrane and RPE abnormal-
ities and neuroretinla atrophy in late-stage dis-
ease [1, 11, 12]. Similarly, the Ctrp5+/− mouse
model also developed sub-RPE deposits and
Bruch’s membrane abnormalities as early as 6
mo and progressive accumulation of focal basal
laminar deposits (BLamD) and basal linear
deposits with age [5, 6]. In the present study,
Ctrp5−/− mice developed dense sub-RPE deposits
in Bruch’s membrane by 11 mo of age, and by
18.5 mo, Ctrp5−/− mice had significant basal lam-
inar deposits. An interesting feature in the
Ctrp5−/− mouse retina was the development of
electron-dense basal laminar deposits (BLamDs).
The presence of BLamDs is also a common find-
ing in early AMD eyes [13]. Formation of these
deposits has been linked to RPE stress both in
340
mouse models and AMD [14–16]. The RPE in
Ctrp5−/− mice showed signs of stress as early 6
mo of age with vacuolization with progressive
RPE abnormalities. These findings in Ctrp5−/−
mice suggest that the presence of CTRP5/
C1QTNF5 is critical for maintaining the normal
structure and function of RPE, particularly at an
older age.
It is interesting to note that the phenotype
observed in both Ctrp5+/− and Ctrp5−/− mouse
models is similar and recapitulates the deposit
forming phenotype with RPE abnormalities
observed in L-ORD patients. The findings in
these mouse models suggest that the disease
pathology of L-ORD in patients and Ctrp5+/−
mice may result from a dominant negative mech-
anism leading to the loss of functional CTRP5.
These models may aid in understanding the
mechanism of L-ORD pathology and serve as
tools for preclinical evaluation of therapeutic
strategies.
Acknowledgments R01-EY030591, RO1-EY21237,
T32-EY026590, P30-EY22589, R01-EY031663,
Foundation Fighting Blindness, Nixon Vision Foundation,
Viterbi Family Fund, Edward N. and Della L. Thome
Memorial Foundation, a Research to Prevent Blindness
Challenge Grant to the Hamilton Eye Institute.
References
1. Kuntz CA, Jacobson SG, Cideciyan AV, Li ZY, Stone
EM, Possin D, et al. Sub-retinal pigment epithelial
deposits in a dominant late-onset retinal degeneration.
Invest Ophthalmol Vis Sci. 1996;37(9):1772–82.
2. Ayyagari R, Griesinger IB, Bingham E, Lark KK,
Moroi SE, Sieving PA. Autosomal dominant hem-
orrhagic macular dystrophy not associated with the
TIMP3 gene. Arch Ophthalmol. 2000;118(1):85–92.
3. Hayward C, Shu X, Cideciyan AV, Lennon A, Barran
P, Zareparsi S, et al. Mutation in a short-chain col-
lagen gene, CTRP5, results in extracellular deposit
formation in late-onset retinal degeneration: a genetic
model for age-related macular degeneration. Hum
Mol Genet. 2003;12(20):2657–67.
4. Ayyagari R, Mandal MN, Karoukis AJ, Chen L,
McLaren NC, Lichter M, et al. Late-onset macular
degeneration and long anterior lens zonules result
S. Borooah et al.
from a CTRP5 gene mutation. Invest Ophthalmol Vis
Sci. 2005;46(9):3363–71.
5. Chavali VR, Khan NW, Cukras CA, Bartsch DU,
Jablonski MM, Ayyagari R. A CTRP5 gene S163R
mutation knock-in mouse model for late-onset retinal
degeneration. Hum Mol Genet. 2011;20(10):2000–14.
6. Sahu B, Chavali VR, Alapati A, Suk J, Bartsch DU,
Jablonski MM, et al. Presence of rd8 mutation does
not alter the ocular phenotype of late-onset retinal
degeneration mouse model. Mol Vis. 2015;21:273–84.
7. Mandal MN, Vasireddy V, Reddy GB, Wang X,
Moroi SE, Pattnaik BR, et al. CTRP5 is a membrane-­
associated and secretory protein in the RPE and
ciliary body and the S163R mutation of CTRP5
impairs its secretion. Invest Ophthalmol Vis Sci.
2006;47(12):5505–13.
8. Zou YR, Müller W, Gu H, Rajewsky K. Cre-­
loxP-­mediated gene replacement: a mouse strain
producing humanized antibodies. Curr Biol.
1994;4(12):1099–103.
9. Curcio CA, Presley JB, Millican CL, Medeiros
NE. Basal deposits and drusen in eyes with age-­
related maculopathy: evidence for solid lipid par-
ticles. Exp Eye Res. 2005;80(6):761–75.
10. Cukras C, Flamendorf J, Wong WT, Ayyagari R,
Cunningham D, Sieving PA. Longitudinal structural
changes in late-onset retinal degeneration. Retina.
2016;36(12):2348–56.
11. Duvall J, McKechnie NM, Lee WR, Rothery S,
Marshall J. Extensive subretinal pigment epithelial
deposit in two brothers suffering from dominant reti-
nitis pigmentosa. A histopathological study. Graefes
Arch Clin Exp Ophthalmol. 1986;224(3):299–309.
12. Milam AH, Curcio CA, Cideciyan AV, Saxena S,
John SK, Kruth HS, et al. Dominant late-onset
retinal degeneration with regional variation of sub-­
retinal pigment epithelium deposits, retinal function,
and photoreceptor degeneration. Ophthalmology.
2000;107(12):2256–66.
13. Curcio CA. Soft drusen in age-related macular degen-
eration: biology and targeting via the oil spill strategies.
Invest Ophthalmol Vis Sci. 2018;59(4):AMD160–81.
14. Sarks S, Cherepanoff S, Killingsworth M, Sarks
J. Relationship of basal laminar deposit and membra-
nous debris to the clinical presentation of early age-­
related macular degeneration. Invest Ophthalmol Vis
Sci. 2007;48(3):968–77.
15. Toomey CB, Kelly U, Saban DR, Bowes
RC. Regulation of age-related macular degeneration-­
like pathology by complement factor H. Proc Natl
Acad Sci U S A. 2015;112(23):E3040–9.
16. Sura AA, Chen L, Messinger JD, Swain TA, McGwin
G Jr, Freund KB, et al. Measuring the contributions of
basal laminar deposit and Bruch’s membrane in age-­
related macular degeneration. Invest Ophthalmol Vis
Sci. 2020;61(13):19.
 Comparison of Mouse Models
of Autosomal Dominant Retinitis
Pigmentosa Due to the P23H
Mutation of Rhodopsin
Shannon R. Barwick and Sylvia B. Smith
Abstract
The need for robust and reliable animal mod-
els is a crucial step in studying any disease.
This certainly applies to inherited retinal
degenerative diseases, in which mutations of
retinal specific genes result in photoreceptor
cell death and subsequent visual loss. Animal
models of retinal gene mutations have proven
valuable to our understanding of disease
mechanisms and as tools to evaluate therapeu-
tic intervention strategies. Notable among
these models are mice with a mutation of the
rhodopsin gene at amino acid 23 in which pro-
line is substituted for histidine (Rho-P23H).
The RHO-P23H mutation is the most common
S. R. Barwick (*)
Department of Cellular Biology and Anatomy,
Medical College of Georgia at Augusta University,
Augusta, GA, USA
The James and Jean Culver Vision Discovery
Institute, Augusta University, Augusta, GA, USA
e-mail: sbarwick@augusta.edu
S. B. Smith
Department of Cellular Biology and Anatomy,
Medical College of Georgia at Augusta University,
Augusta, GA, USA
The James and Jean Culver Vision Discovery
Institute, Augusta University, Augusta, GA, USA
Department of Ophthalmology, Medical College of
Georgia at Augusta University, Augusta, GA, USA
e-mail: sbsmith@augusta.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_49
cause of autosomal dominant retinitis pigmen-
tosa. Here, we provide a brief review of the
Rho-P23H mouse models currently available
for research.
Keywords
Retinitis pigmentosa · Retina · Mouse model ·
Rho-P23H · Photoreceptor
1 Introduction
Many retinal diseases lead to varying degrees of
visual impairment. Mutations in over 330 genes
are currently known to cause some form of reti-
nal disease [15]. One common form of retinal
disease is retinitis pigmentosa (RP), an inherited
retinal degenerative disease (IRD) that leads to
the death of rod photoreceptor cells (PRCs). Its
prevalence worldwide is approximately 1:4000
[19]. RP can be inherited as autosomal dominant
(adRP), autosomal recessive (arRP), or X-linked.
Mutations in proteins, which function or are
expressed primarily in the retina, can lead to non-­
syndromic RP, whereas mutations in genes
encoding proteins found in a diverse number of
cells (and have cellular functions) outside the eye
can result in systemic disease (syndromic RP).
The majority of RP cases are autosomal recessive
(arRP) and are often syndromic. Autosomal dom-
inant cases comprise the second largest group of
341
342 S. R. Barwick and S. B. Smith

inheritance with most mutations occurring in the
gene encoding rhodopsin (RHO (human) Rho
(mouse)). Rhodopsin, the light-sensitive visual
pigment, is located in rod outer segment disks. It
plays a critical role in rod disk morphogenesis
and visual transduction [9]. The most commonly
mutated gene leading to autosomal dominant RP
(adRP) in humans is the proline to histidine sub-
stitution at amino acid 23 of rhodopsin (RHO-­
P23H) [4].
While RP typically leads to the loss of rod
PRCs initially, cone PRC loss follows [10], which
is particularly debilitating since cones mediate
best vision. Clinical features of RP manifest most
often in early adulthood. Patients present with
night blindness and decreased peripheral vision.
Late-stage RP can be identified by fundus exam
that reveals pigmentary deposits (bone spicules)
thought to be formed due to death of PRCs. At
advanced stages of RP, daylight vision becomes
impaired and retinal vessel attenuation is seen
[4]. The progression of RP is typically slow;
however, due to the heterogeneous nature of the
disease, this can be difficult to predict [17].
Patients with the same genetic mutation can vary
in age of disease onset as well as progression
rates. This makes diagnosing and treating patients
with RP challenging. Currently, there is no cure
for patients with RP creating the need for diverse
and reliable models to study RP. A plethora of
models ranging from mouse and rat to rabbit and
pig have been created to study differing causes
and treatments of RP. In this review we describe
several mouse models of the RHO-P23H muta-
tion that are relevant to the study of adRP and
work underway using these models to advance
our understanding and treatment of this disease.
2 Mouse Models of the Rho-­
P23H Mutation
A number of attempts to recapitulate the human
RHO-P23H phenotype have been conducted in
mice [11–13, 16]. Table 1 summarizes the gen-
eration and phenotypical presentation of these
various models, and for clarity of writing, we
refer to the models by the first authors’ last name.
These models have proven useful to study mech-
anisms of adRP. Common methods for creating
these mouse models include transgene and
knock-in technologies. The transgene method
randomly incorporates the gene of interest into
the host genome. In contrast, knock-in methods
specifically target the gene of interest to a spe-
cific locus of the target genome. Each of these
genetic alteration strategies has advantages and
disadvantages that are discussed below.
A groundbreaking discovery by the Berson
lab occurred when the first genetic mutation
directly linked to adRP, RHO-P23H, was reported
[5]. Following this discovery, many labs sought
to study this new mutation. One of the first labs
created a humanized RHO-P23H model utilizing
a mutant allele isolated from a patient known to
have adRP. This model presented with attenuated
retinal vasculature, normal inner retina, and
decreased electrophysiological responses similar
to human but did show irregular pigmentary
deposition. Another feature observed was mislo-
calization of rhodopsin within the rod PRCs lead-
ing to retinal degeneration only when misfolded
protein levels were high [12]. Concurrently, Dr.
Muna Naash and colleagues created a mouse
transgene model utilizing oligonucleotide-­
directed mutagenesis containing three point

Table 1 Summary of Rho-P23H mouse models

Model Type Phenotype Model creation method
Olsson Human Slow degenerative phenotype, variable, Mutant allele from patient cloned,
[12] transgenic transgene expression, irregular pigmentation injected into mouse embryos
Naash Mouse Slow degenerative phenotype, variable, Oligonucleotide-directed mutagenesis
[11] transgenic transgene expression, no pigmentary changes of murine opsin gene
Price Human Slow degenerative phenotype, mislocalized Targeting vector incorporated using
[13] knock-in protein site-directed mutagenesis
Sakami Mouse Slow degenerative phenotype, closely mimics Targeting vector stem cell injected into
[16] knock-in human disease mouse blastocyst
Comparison of Mouse Models of Autosomal Dominant Retinitis Pigmentosa Due to the P23H Mutation…
mutations, including Pro-23-His, in exon 1 of the
germ line mouse opsin gene. This model pre-
sented with gradually declining a/b-wave ampli-
tudes of the scotopic electroretinography (ERG)
s. It also appeared that the rod PRC death pro-
ceeded cone PRC death, much like the human
disease [11]. Interestingly, the RPE did not show
any pigmentary deposition, which is a hallmark
of human RP. This model expressed the normal
and mutant rhodopsin in relatively equal quanti-
ties, but misfolded mutant rhodopsin was mislo-
calized to the outer plexiform layer (OPL) and
outer segments [11]. The lack of pigmentary
deposits and the variable expression of normal
and mutant rhodopsin were considered limita-
tions of these transgene models. To aid in the
ability to understand and study the misfolded
P23H rhodopsin, Dr. Brandee Price and col-
leagues created a humanized knock-in mouse
model containing a RHO-P23H-rhodopsin-­
GFP. This model not only allowed for tracking of
the P23H-rhodopsin but also utilized knock-in
techniques. By so doing, the investigators were
able to directly target the mutant gene to the loca-
tion of interest allowing for the production of a
slow degenerative phenotype without the need
for multiple transgene insertions. This decreased
the variability of normal and mutant rhodopsin
expression [13]. These three models were
groundbreaking for the study of retinal degenera-
tive mechanisms in adRP; however, they still did
not fully recapitulate human disease.
The advent of optical coherence tomography
(OCT), which allows in situ visualization of reti-
nal structure in human patients (as well as animal
models), paved the way for optimizing a mouse
model that more closely reflects human retinal
structure under disease conditions. To better
understand how the P23H mutation of rhodopsin
presents in human patients, Dr. Sanae Sakami
and colleagues from Dr. Krystoff Palczewski’s
laboratory analyzed a cohort of 19 human adRP
patients with the RHO-P23H mutation. The
patients were subjected to scotopic and photopic
ERG analysis and retinal cross-sectional imaging
using OCT. Rod ERGs were abnormally reduced
in all patients, whereas cone responses varied.
Importantly, the in situ assessment of retinal
343
structure showed greater retinal alteration in the
inferior retina compared to the superior retina
[16]. Utilizing this new information, Sakami and
co-workers created a knock-in Rho-P23H mouse
model to improve upon the previous knock-in
model created by Price and colleagues. The
Sakami mouse model demonstrates a slow pro-
gressive retinal degeneration in which half of the
rods die before cone death is detected. In addi-
tion, a gradual shortening and disorganization of
outer segments precedes rod PRC death in this
model. A notable feature of the Sakami mouse
model is that its degeneration pattern shows
regional retinal degenerative differences such
that the inferior retina degenerates more rapidly
than the superior retina, which is similar to the
superior-inferior differences observed in human
RP patients mentioned above. Other features of
the Sakami mouse model are that the scotopic
ERG amplitudes decline slowly followed by
gradual decline in the photopic ERG. WT and
mutant rhodopsin protein production are equiva-
lent. Interestingly, it does not appear that rhodop-
sin is mislocalized, which is present in other
Rho-P23H mouse models [12, 13]. In aggregate,
the aforementioned similarities of the humanized
mouse model created in the Palczewski labora-
tory to human adRP patients make this mutant
mouse model a particularly attractive tool for
investigating mechanisms of disease and inter-
ventional strategies.
3 Pathogenic Mechanism
Studies
While the long-term goal of many studies of
mouse models of retinal disease is to develop
successful treatment strategies, the mechanism(s)
underlying loss of PRCs must be understood if
those strategies are to move from the bench to the
clinic. Regarding the RHO-P23H mutation, sev-
eral mechanisms have been investigated as under-
lying the degeneration of PRCs. It is known that
if misfolded proteins are not properly degraded,
they can be retained within the endoplasmic
reticulum (ER) which can lead to ER stress and
activation of the unfolded protein response
344
(UPR). The Palczewski group has reported
incomplete glycosylation of rhodopsin in the
Sakami model, which led to retention of protein
within the ER. Further investigation, however,
indicated that reduced glycosylation was detected
only in small quantities, suggesting protein is
rapidly targeted for degradation differing from
previous data suggesting misfolded protein is
retained within the ER and induces ER stress
[16]. The Sakami mouse model was later crossed
with an ER stress-activated indicator, and robust
signal was observed within rod PRCs [2].
Subsequent research performed in various Rho-­
P23H mouse models suggests ER stress and UPR
activation may play a role in activation of cell
death pathways, but this may not be the whole
story. Comitato and co-workers found that cal-
pain activation (characteristic of the apoptotic
pathway of cell death) may be contributing more
to induction of cell death than ER stress-induced
UPR, more so in the Olsson model than the
Sakami model, suggesting activation of ER stress
alone may not be sufficient to induce cell death
[3]. Due to the key role ER stress and proper pro-
tein folding play in the progression of retinal
degeneration, several labs have investigated
inducing misfolded protein clearance (or protein
folding assistance mechanisms) to attenuate reti-
nal degeneration. The Liu laboratory treated
Sakami mice with methotrexate to pharmacologi-
cally clear misfolded rhodopsin and observed
improved protein degradation. Chemical chaper-
ones such as vitamin A, 4-phenylbutyrate, and
curcumin have also been utilized to improve rho-
dopsin folding and transport. Importantly, func-
tional improvement was detected by ERG in
some of these therapeutic strategies [6].
Autophagy and altered proteasome activity have
been proposed as endogenous mechanisms that
clear misfolded proteins and reduce PRC death.
The Sakami model is known to have increased
autophagy [18]. This led several labs to investi-
gate whether decreasing autophagy improves
proteosomal activity and restores their balance
within the cell, thereby improving retinal struc-
ture and function [7, 14]. This research suggests
misfolding and degradation of proteins may play
a major role in retinal disease progression and
S. R. Barwick and S. B. Smith
could pose a promising therapeutic target. Other
labs are investigating therapeutic intervention by
genetically modulating the immune system [1] in
addition to direct modification of the Rho-P23H
mutation [8]. These studies show promising
improvements in retinal structure and function
and are another encouraging avenue of research
for treatment of IRDs.
Here we have discussed various models of the
Rho-P23H mutation and existing research utiliz-
ing them. The current ongoing research is prom-
ising for the future of patients with the RHO-P23H
mutation as well as other retinal degenerations,
but much work is still needed to translate current
findings to the clinic.
Acknowledgments We gratefully acknowledge NIH
(RO1EY028103, P30EY031631) and Foundation
Fighting Blindness (TA-NMT-0617-0721-AUG) for their
support.
References
1. Aguilà M, Bellingham J, Athanasiou D, Bevilacqua
D, Duran Y, Maswood R, Parfitt DA, Iwawaki T,
Spyrou G, Smith AJ, Ali RR. AAV-mediated ERdj5
overexpression protects against P23H rhodopsin tox-
icity. Hum. Mol. Genet. 2020;29(8):1310–8.
2. Chiang WC, Kroeger H, Sakami S, Messah C,
Yasumura D, Matthes MT, Coppinger JA, Palczewski
K, LaVail MM, Lin JH. Robust endoplasmic reticulum-­
associated degradation of rhodopsin precedes retinal
degeneration. Mol. Neurobiol. 2015;52(1):679–95.
3. Comitato A, Schiroli D, La Marca C, Marigo
V. Differential contribution of calcium-activated
proteases and ER-stress in three mouse models
of retinitis pigmentosa expressing P23H mutant
RHO. Retin. Degener. Dis. Cham: Springer; 2019.
p. 311–6.
4. Dias MF, Joo K, Kemp JA, Fialho SL, da Silva Cunha
Jr A, Woo SJ, Kwon YJ. Molecular genetics and
emerging therapies for retinitis pigmentosa: basic
research and clinical perspectives. Prog. Retin. Eye
Res. 2018;63:107–31.
5. Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley
GS, Yandell DW, Sandberg MA, Berson EL. A point
mutation of the rhodopsin gene in one form of retinitis
pigmentosa. Nature. 1990;343(6256):364–6.
6. Liu X, Feng B, Vats A, Tang H, Seibel W, Swaroop
M, Tawa G, Zheng W, Byrne L, Schurdak M, Chen
Y. Pharmacological clearance of misfolded rhodopsin
for the treatment of RHO-associated retinitis pigmen-
tosa. FASEB J. 2020;34(8):10146–67.
Comparison of Mouse Models of Autosomal Dominant Retinitis Pigmentosa Due to the P23H Mutation…
7. Lobanova ES, Finkelstein S, Li J, Travis AM, Hao
Y, Klingeborn M, Skiba NP, Deshaies RJ, Arshavsky
VY. Increased proteasomal activity supports
­photoreceptor survival in inherited retinal degenera-
tion. Nat. Commun. 2018;9(1):1–1.
8. Mao H, James T Jr, Schwein A, Shabashvili AE,
Hauswirth WW, Gorbatyuk MS, Lewin AS. AAV
delivery of wild-type rhodopsin preserves retinal func-
tion in a mouse model of autosomal dominant retinitis
pigmentosa. Hum. Gene Ther. 2011;22(5):567–75.
9. Mendes HF, Van Der Spuy J, Chapple JP, Cheetham
ME. Mechanisms of cell death in rhodopsin retinitis
pigmentosa: implications for therapy. Trends Mol.
Med. 2005;11(4):177–85.
10. Hamel C. Retinitis pigmentosa. Orphanet J. Rare Dis.
2006;1(1):1–2.
11. Naash MI, Hollyfield JG, Al-Ubaidi MR, Baehr
W. Simulation of human autosomal dominant reti-
nitis pigmentosa in transgenic mice expressing a
mutated murine opsin gene. Proc. Natl. Acad. Sci.
1993;90(12):5499–503.
12. Olsson JE, Gordon JW, Pawlyk BS, Roof D, Hayes
A, Molday RS, Mukai S, Cowley GS, Berson EL,
Dryja TP. Transgenic mice with a rhodopsin mutation
(Pro23His): a mouse model of autosomal dominant
retinitis pigmentosa. Neuron. 1992;9(5):815–30.
13. Price BA, Sandoval IM, Chan F, Simons DL, Wu
SM, Wensel TG, Wilson JH. Mislocalization and
345
degradation of human P23H-rhodopsin-GFP in a
knockin mouse model of retinitis pigmentosa. Invest.
Ophthalmol. Vis. Sci. 2011;52(13):9728–36.
14. Qiu Y, Yao J, Jia L, Thompson DA, Zacks
DN. Shifting the balance of autophagy and pro-
teasome activation reduces proteotoxic cell death: a
novel therapeutic approach for restoring photorecep-
tor homeostasis. Cell Death Dis. 2019;10(8):1–4.
15. RetNet [Internet]. Houston (TX):The University of
Texas Health Science Center; c1996–2021. Available
online at https://sph.uth.edu/retnet/
16. Sakami S, Maeda T, Bereta G, Okano K, Golczak
M, Sumaroka A, Roman AJ, Cideciyan AV, Jacobson
SG, Palczewski K. Probing mechanisms of photo-
receptor degeneration in a new mouse model of the
common form of autosomal dominant retinitis pig-
mentosa due to P23H opsin mutations. J. Biol. Chem.
2011;286(12):10551–67.
17. Van Soest S, Westerveld A, De Jong PT, Bleeker-­
Wagemakers EM, Bergen AA. Retinitis pigmen-
tosa: defined from a molecular point of view. Surv.
Ophthalmol. 1999;43(4):321–34.
18. Yao J, Qiu Y, Frontera E, Jia L, Khan NW, Klionsky DJ,
Ferguson TA, Thompson DA, Zacks DN. Inhibiting
autophagy reduces retinal degeneration caused by
protein misfolding. Autophagy. 2018;14(7):1226–38.
19. Zhang Q. Retinitis pigmentosa: progress and perspec-
tive. Asia-Pac J Ophthalmol. 2016;5(4):265–71.
 Compensatory Cone-Mediated
Mechanisms in Inherited Retinal
Degeneration Mouse Models:
A Functional and Gene Expression
Analysis

Alicia A. Brunet, David M. Hunt, Carla Mellough,

Alan R. Harvey, and Livia S. Carvalho

Abstract as an increase in cone-specific genes in the

The retina undergoes compensatory changes
in response to progressive photoreceptor loss/
dysfunction; however, studies of inherited
retinal diseases (IRDs) often lack a temporal
connection between gene expression and
visual function. Here, we used three mouse
models of IRD – Cnga3−/−, Pde6ccpfl1, and
Rd1 – to investigate over time the effect of
photoreceptor degeneration, particularly
cones, on visual function and gene expression.
Changes to gene expression include increases
in cell survival and cell death genes in
Pde6ccpfl1 before significant cell loss, as well
A. A. Brunet (*) · D. M. Hunt · C. Mellough ·
L. S. Carvalho
Centre for Ophthalmology and Visual Sciences, The
University of Western Australia, Crawley, WA,
Australia
Lions Eye Institute Ltd., Nedlands, WA, Australia
e-mail: alicia.brunet@research.uwa.edu.au; david.
hunt@uwa.edu.au; carlamellough@lei.org.au;
liviacarvalho@lei.org.au
A. R. Harvey
School of Human Sciences, The University of
Western Australia,
Crawley, WA, Australia
Perron Institute for Neurological and Translational
Science,
Nedlands, WA, Australia
e-mail: alan.harvey@uwa.edu.au
Rd1 at the peak of rod death. We show that
Cnga3−/− and Pde6ccpfl1 mice maintained phot-
opic visual acuity via optomotor responses,
despite no recordable cone electroretinogram
(ERG), while functional measures and photo-
receptors loss were correlated in Rd1 mice.
There were also significant changes to oscilla-
tory potentials (OPs) in Cnga3−/− and
Pde6ccpfl1, implying an effect on inner retinal
cells as a result of cone degeneration. These
results indicate a potentially malleable retinal
environment following cone degeneration;
however, further investigation is needed to
elucidate how these changes compensate for
the loss of cone function.
Keywords
Vision · Inherited retinal disease ·
Achromatopsia · Retinitis pigmentosa · cpfl1 ·
rd1 · cnga3 · Mechanisms · Cell death
1 Introduction
Cone degeneration varies between inherited reti-
nal disease (IRD) mutations in severity and time
course. Previous studies in IRDs have mainly
focused on morphological and physiological

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 347
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_50
348
changes in the retina at peak photoreceptor
degeneration; however, there is a lack of research
on temporal changes in IRD mice during degen-
eration. Furthermore, several studies have shown
a high level of retinal plasticity, leading to poten-
tial compensatory mechanisms, in response to
photoreceptor degeneration. Synaptic plasticity
is prevalent in the Cnga3−/− model of achroma-
topsia (ACHM) and in the Rho−/− model of retini-
tis pigmentosa (RP), where remaining
photoreceptors form ectopic synapses between
cones and rod-bipolar cells, and rods and cone-­
bipolar cells, respectively [1]. Synaptic remodel-
ing is also observed in the Rd1 and Rd10 RP
models, including loss of dendrites, cell body
migration of horizontal cells, and ectopic synapse
formation with rod bipolar cells [2, 3]. However,
how these mechanisms preserve or contribute to
vision in IRD models remains unclear. To evalu-
ate how the course of cone degeneration affects
the visual response, this study combines gene
expression and physiological and behavioral
approaches in two cone-dystrophy (ACHM) and
one rod-cone dystrophy (RP) mouse model.
2 Materials and Methods
2.1 Animals
Mouse (C57BL/6 J background) experiments
were approved by the Harry Perkins Institute
Animal Ethics Committee, bred and housed at
the Perkins Bioresources Facility, and conducted
in accordance with the ARVO Statement for the
Use of Animals in Ophthalmic and Vision
Research. All IRD lines used in this study
(Cnga3−/−, Pde6ccpfl1,and Rd1) express green flu-
orescent protein (GFP) in cone photoreceptors, as
previously described [4], and are referred to as
(IRD line).GFP. The Chrnb4.GFP model [5] was
used as the wild type, also expressing GFP cones
(referred to as WT).
2.2 Electroretinography (ERG)
ERGs were performed on mice under general
anesthesia (40 mg/kg ketamine, 5 mg/kg xyla-
A. A. Brunet et al.
zine) using the Celeris ERG (Diagnosys, USA)
as previously described [4]. Mice were dark-­
adapted overnight prior to ERG recordings.
Scotopic responses and oscillatory potentials
(OP1 and OP2) were recorded, followed by light
adaptation for 10 min at 30 cd.s.m.−2 before phot-
opic recordings. Responses to a series of increas-
ing light flashes were recorded, but only data at
25 cd.s.m.−2 are presented. Data were analyzed
using the Diagnosys Espion software and
Microsoft Excel.
2.3 Optomotor Response
Optomotor responses were assessed using the
automated OptoDrum (Striatech) to measure the
visual reflex to rotating stimuli. The OptoDrum is
a closed box containing four screens that simulate
a rotating cylinder of alternating white and black
stripes. Mice were placed on a raised platform at
the center of the box, with a camera directly
above. Movement was tracked using computer-
controlled software. Mice were dark-­ adapted
overnight before scotopic recordings, followed by
light adaptation for 2 h and photopic recordings.
Contrast sensitivity and visual acuity (cycles/
degree) were recorded under scotopic (2 mLux)
and photopic (70 Lux) conditions, respectively.
2.4 Flow Cytometry
Whole retinae were dissociated as previously
described [4], and flow cytometry was performed
with a BD FACSMelody Cell Sorter to quantify
GFP+ cell number.
2.5 qRT-PCR Analysis
Total RNA was extracted from whole retinae using
TriReagent (Sigma-Aldrich), and reverse transcrip-
tion was performed using the QuantiTect Reverse
Transcription Kit (Qiagen) as per manufacturer’s
instructions. qRT-PCR was done on a Bio-Rad CFX
Connect Real-Time System using Taqman Fast
Advanced mastermix (ThermoFisher). Relative
expression was expressed as fold change (2-ΔΔct).
Compensatory Cone-Mediated Mechanisms in Inherited Retinal Degeneration Mouse Models…
2.6 Statistical Analysis
Data was analyzed using GraphPad PRISM by
Student’s t-test or two-way ANOVA (post hoc
Tukey’s test). Results were expressed as
mean ± standard error of the mean (SEM).
3 Results
3.1 Compensatory Gene
Expression Changes
in Response to Cell Death
To examine how photoreceptor degeneration
contributes to changes in gene expression, we
first assessed cone numbers over time. Cone
numbers showed no significant difference
between Cnga3.GFP and WT, but were signifi-
cantly decreased in Pde6c.GFP and Rd1.GFP
(Fig. 1). Significantly fewer cones were observed
at P60 for Pde6c.GFP and P24 for Rd1.GFP.
Expression of photoreceptor, cell-survival,
and cell-death genes during the course of degen-
eration were analyzed using qRT-PCR. Cone-­
specific genes (cone arrestin, Arr3; cyclic
nucleotide-gated channel subunit alpha 3, Cnga3;
G protein subunit alpha transducing 3; Gnat2;
Fig. 1 Changes to gene expression in response to photo-
receptor cell death. Cone counts using flow cytometry
showed a significant reduction in average cone numbers in
Pde6c.GFP and Rd1.GFP (P < 0.05) but not in Cnga3.
GFP (n ≥ 4). Pde6c.GFP had a significant increase in both
cell survival and cell death genes compared to WT at P32
349
phosphodiesterase 6C, Pde6c) were decreased
overtime in Cnga3.GFP and Pde6c.GFP com-
pared to WT (Fig. 1). However, in Rd1.GFP there
was increased expression of cone genes, particu-
larly Pde6c at P24 (Fig. 1). Rod-specific genes
(phosphodiesterase 6B, Pde6b; rhodopsin, Rho)
in Cnga3.GFP and Pde6c.GFP were comparable
to WT, except an increase in Pde6b at P16 in
Pde6c.GFP, and were significantly decreased in
Rd1.GFP. In Pde6c.GFP, cell survival (B-cell
lymphoma, Bcl2; Bcl2 like 1, Bcl2l1; rod-derived
cone viability factor; RdCVF) and cell death
genes (apoptotic peptidase activating factor 1,
Apaf1, Bcl2-associated x protein, Bax, caspase-8,
Casp8) were increased at P32 compared to WT,
but decreased by P60 (Fig. 1).
3.2 ERG and Behavioral Visual
Responses Persist
in the Absence of Cone
Function
Assessment of photoreceptor function via ERG
showed no photopic responses in Cnga3.GFP
and Pde6c.GFP (Fig. 2a, b). At P16, Rd1.GFP
had a decreased photopic ERG b-wave (Fig. 2b),
although photopic a-wave levels were compara-
(P < 0.05), which was lost at P60. Cone- and rod-specific
gene expressions are shown. Relative expression was nor-
malized to Gapdh and shown as a fold change compared
to age-matched WT samples using the ΔΔCt method
(n = 3). *P < 0.05, **P < 0.005, ***P < 0.0005,
****P < 0.0001
350
Fig. 2 Photopic spatial frequency is retained in the
absence of cone ERG in cone dystrophy models. (a, b)
Quantification of photopic ERG a-wave (a) and b-wave
(b) responses in Cnga3.GFP, Pde6c.GFP, and Rd1.GFP
models compared to WT. Photopic responses were
unmeasurable in Cnga3.GFP and Pde6c.GFP, and Rd1.
GFP past P16. (i) Cnga3.GFP and Pde6c.GFP photopic
optomotor had no significant difference compared to WT
(P > 0.05). Rd1.GFP had reduced P16 (P < 0.05) and P24
(P < 0.0001) photopic response before being unmeasur-
able at P32. Scotopic a-wave (c) and b-wave (d) responses
were significantly reduced in Rd1.GFP line (P < 0.0001).
There was no significant difference between Cnga3.GFP
and Pde6c.GFP models compared to WT in the scotopic
ble to WT (Fig. 2a), but both were lost by P24.
Cnga3.GFP and Pde6c.GFP had a sustained
optomotor response under photopic conditions
across time, lower than WT past P16, but not sta-
tistically significant (Fig. 2i). Photopic optomo-
tor response was significantly lower in the Rd1.
GFP at P16, and decreased further until being
lost by P32.
In scotopic ERGs, P16 Rd1.GFP possessed a
reduced response which was lost by P24 (Fig. 2c,
d). Scotopic responses in Cnga3.GFP and Pde6c.
GFP showed no differences in a-wave (Fig. 2c),
but a decreased b-wave compared to WT, signifi-
cant at P24 in the Pde6c.GFP and P60 in the
Cnga3.GFP (Fig. 2d). Optomotor scotopic con-
trast sensitivity showed no difference between
Cnga3.GFP and Pde6c.GFP compared to WT,
A. A. Brunet et al.
a-wave response (P > 0.05). Scotopic b-wave responses
were lower in Cnga3.GFP and Pde6c.GFP models when
compared to WT after P16, but was only significant at
P24 in Pde6c.GFP (P < 0.001) and P60 in Cnga3.GFP
(P < 0.05). (j) Scotopic contrast sensitivity was unchanged
in Cnga3.GFP and Pde6c.GFP compared to age-matched
WT mice (P > 0.05) and were unmeasurable in Rd1.
GFP. OPs were analyzed for amplitude (OP1, e, OP2, f)
and latency (OP1, g, OP2, h). There was a significant
decrease in OP1 and OP2 response in Cnga3.GFP and
Pde6c.GFP compared to WT at various timepoints
(P < 0.05). There was no difference in latency except at
P16 in OP2 of Pde6c.GFP (P < 0.0005). n ≥ 4 per age per
line, *P < 0.05, ***P < 0.0005, ****P < 0.0001
but no optomotor scotopic response was detect-
able in Rd1.GFP at all ages (Fig. 2j). OP1 and
OP2 were isolated from the scotopic response of
Cnga3.GFP and Pde6c.GFP, and analyzed for
amplitude (Fig. 2e, f) and latency (Fig. 2g, h). No
OPs were measurable in Rd1.GFP. OP1 (Fig. 2e)
and OP2 (Fig. 2f) amplitudes were significantly
decreased in both Cnga3.GFP and Pde6c.GFP at
various ages after P16. OP latency was mostly
consistent over time (Fig. 2g, h).
4 Discussion
Our Rd1.GFP data replicates previous findings,
with a peak in cone death around P24 [7].
However, Pde6c.GFP has previously been
Compensatory Cone-Mediated Mechanisms in Inherited Retinal Degeneration Mouse Models…
reported to also have a peak in cone death at P24
[8, 9], much earlier than described here (P60).
Previous studies used terminal deoxynucleotidyl
transferase dUTP nick end labeling (TUNEL) to
estimate dying cone numbers, while our study
estimated the amount of viable cones, which may
explain this disparity. Furthermore, distinct dif-
ferences in cell survival and cell death genes
were found between P32 and P60 in Pde6c.GFP,
correlating with a marked decrease in cone num-
bers at P60. Differential expression of cell sur-
vival and cell death genes was not as distinct in
Cnga3.GFP, supporting the lack of cone loss that
we report in this mouse line at the investigated
timepoints.
In our cone dystrophy models, there was a
decrease in cone-specific gene expression.
Interestingly, there was a general increase in
cone-specific genes in Rd1.GFP, particularly of
Pde6c, where expression was almost sevenfold
higher at P24 compared to WT. Rd1.GFP has a
defective Pde6b gene, and compensatory mecha-
nisms may be the cause of the increase in the
expression of the paralogous Pde6c cone gene in
an attempt to facilitate phosphodiesterase func-
tion in rods during peak cone degeneration. A
previous study has shown that supplementation
of Pde6c in the Rd1 mouse partially recovered
vision [6]. The opposite is also seen in Pde6c.
GFP, as Pde6b was more than threefold higher
than WT at P16, although this preceded the drop
in Pde6c.GFP cone numbers.
Cnga3.GFP and Pde6c.GFP are cone-specific
IRDs with supposedly no detrimental effect on
the remaining retinal cells. For the first time,
using optomotor visual responses, we show that
photopic-mediated vision is retained in these
mice in the absence of a photopic ERG. Such
responses could potentially be mediated via mor-
phological changes previously reported to
second-­order neurons [1, 2] that may act to main-
tain visual function to some extent. This is further
justified by data from the Rd1.GFP model, with
significantly less photopic acuity at P16 com-
pared to WT.GFP, then a further decrease at P24
before being undetectable at P32 and P60, mir-
roring the temporal progression of cone death in
Rd1 mice [7].
351
The surprisingly WT-level photopic acuity
response seen in Cnga3.GFP and Pde6c.GFP
may suggest a takeover of the cone visual path-
way, most likely by rods, with an equivalent
type of compensation not seen in Rd1.GFP
mice. Furthermore, significant changes to the
scotopic OPs of the Cnga3.GFP and Pde6c.GFP
indicate changes to inner retinal structures. The
origin of OPs is still not clear; however, it is
thought that they originate from the inner retinal
layer, occurring in the ascending limb of the
scotopic b-wave [10]. Particularly, OP1 and
OP2 arise from bipolar and amacrine cells [11].
The overall decrease in amplitude of OP1 and
OP2 in Cnga3.GFP and Pde6c.GFP compared
to WT may therefore be a result of decreased
amacrine and bipolar cell function, perhaps con-
nected to a “takeover” of the cone system by
surviving rods.
To conclude, we found significant changes in
gene expression at ages of significant cone loss.
Retention of photopic optomotor responses
despite the lack of cone ERG in Cnga3.GFP and
Pde6c.GFP suggests changes to the retinal archi-
tecture to compensate for cone loss. How exactly
these changes occur requires further study.
Additionally, the effect on inner retinal function
shown through changes to scotopic b-wave ERGs
and decreased OP amplitudes suggests cone-­
dystrophies can have a negative impact on
remaining viable retinal cells.
Acknowledgments This research was supported by a
grant from the Lindsay and Heather Payne Medical
Research Charitable Foundation (IPAP2020/0504, LSC).
References
1. Haverkamp S, et al. Synaptic plasticity in CNGA3−/−
mice: cone bipolar cells react on the missing
cone input and form ectopic synapses with rods.
J. Neurosci. 2006;26(19):5248–55.
2. Phillips MJ, Otteson DC, Sherry DM. Progression of
neuronal and synaptic remodeling in the rd10 mouse
model of retinitis pigmentosa. J. Comp. Neurol.
2010;518(11):2071–89.
3. Haq W, et al. Synaptic remodeling generates syn-
chronous oscillations in the degenerated outer mouse
retina. Front Neural Circuit. 2014;8:108.
352
4. Brunet AA, et al. Validating fluorescent chrnb4.
EGFP mouse models for the study of cone photo-
receptor degeneration. Transl. Vis. Sci. Technol.
2020;9(9):28–9.
5. Siegert S, et al. Genetic address book for retinal cell
types. Nat. Neurosci. 2009;12(9):1197–204.
6. Majumder A, et al. Exchange of cone for rod phos-
phodiesterase 6 catalytic subunits in rod photore-
ceptors mimics in part features of light adaptation.
J. Neurosci. 2015;35(24):9225–35.
7. Narayan DS, et al. Spatio-temporal characteriza-
tion of S-and M/L-cone degeneration in the Rd1
mouse model of retinitis pigmentosa. BMC Neurosci.
2019;20(1):1–17.
A. A. Brunet et al.
8. Arango-Gonzalez B, et al. Identification of a common
non-apoptotic cell death mechanism in hereditary
retinal degeneration. PloS One. 2014;9(11):e112142.
9. Trifunović D, et al. cGMP-dependent cone pho-
toreceptor degeneration in the cpfl1 mouse retina.
J. Comp. Neurol. 2010;518(17):3604–17.
10. Speros P, Price J. Oscillatory potentials. History,
techniques and potential use in the evaluation of dis-
turbances of retinal circulation. Surv. Ophthalmol.
1981;25(4):237–52.
11. Wachtmeister L, Dowling JE. The oscillatory poten-
tials of the mudpuppy retina. Invest. Ophthalmol. Vis.
Sci. 1978;17(12):1176–88.
 Inhibition of Ryanodine Receptor
1 Reduces Endoplasmic Reticulum
(ER) Stress and Promotes ER
Protein Degradation in Cyclic
Nucleotide-Gated Channel
Deficiency

Fan Yang, Hongwei Ma, Rekha Garg, Alfred Lewin,

and Xi-Qin Ding

Abstract Ryr1, manifested as increased expression

The cone photoreceptor cyclic nucleotide-­
gated (CNG) channel plays a pivotal role in
cone phototransduction. Mutations in genes
encoding the channel subunits CNGA3 and
CNGB3 account for about 80% of all cases of
achromatopsia and are associated with pro-
gressive cone dystrophies. CNG channel defi-
ciency leads to cellular/endoplasmic reticulum
(ER) calcium dysregulation and ER stress-­
associated cone apoptosis. This work investi-
gated the role of the ER calcium channel
ryanodine receptor 1 (Ryr1) in ER stress and
cone degeneration in CNG channel deficiency.
The AAV-mediated CRISPR/SaCas9 genome
editing was used to knock down Ryr1 specifi-
cally in cones. CNG channel-deficient mice
displayed improved cone survival after sub-
retinal injection of AAV2-SaCas9/gRNA-­
F. Yang · H. Ma · X.-Q. Ding (*)
Departments of Cell Biology, University of
Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
e-mail: Hongwei-ma@ouhsc.edu; xi-qin-ding@
ouhsc.edu
R. Garg · A. Lewin
Department of Molecular Genetics and Microbiology,
University of Florida, Gainesville, FL, USA
e-mail: Garg@UFL.EDU; lewin@UFL.EDU
levels of cone proteins M-opsin, S-opsin, and
cone arrestin. Knockdown of Ryr1 also led to
reduced ER stress and increased expression
levels of the ER-associated degradation pro-
teins. This work demonstrates a role of Ryr1 in
ER stress and cone degeneration in CNG
channel deficiency, and supports strategies tar-
geting ER calcium regulation for cone
preservation.
Keywords
Cyclic nucleotide-gated channel · Cone ·
Retina · Ryanodine receptor · Endoplasmic
reticulum calcium homeostasis · Endoplasmic
reticulum-associated degradation ·
Endoplasmic reticulum stress
1 Introduction
The cone photoreceptor cyclic nucleotide-gated
(CNG) channel is essential for phototransduc-
tion. Upon binding of cyclic guanosine mono-
phosphate (cGMP) under dark conditions, CNG
channels open and permit the influx of the cal-
cium and sodium ions necessary to maintain the
dark current and cellular calcium homeostasis.

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 353
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_51
354
Mutations in the CNGA3 and CNGB3 genes that
encode the channel subunits account for about
80% of all cases of achromatopsia and are associ-
ated with progressive cone dystrophies [2, 5].
These diseases are characterized by severely
impaired daylight vision and lack of color
­discrimination. Cone photoreceptors degenerate
over time in patients and in mouse models of
CNG channel deficiency. With the disease mouse
models, we established that cone death involves
endoplasmic reticulum (ER) stress-associated
apoptosis and cytosolic/ER calcium dysregula-
tion [3, 6]. ER calcium homeostasis is regulated
by two ER calcium channels, the inositol
1,4,5-trisphosphate receptor (IP3R) and ryano-
dine receptors (RyR) for calcium efflux out of the
ER into the cytosol, and the sarco−/endoplasmic
reticulum Ca2+-ATPase for calcium influx into
the ER. There are three isoforms of RyR, Ryr1,
Ryr2, and Ryr3, and photoreceptors express all
these three isoforms [1]. We previously showed
that CNG channel deficiency leads to reduced
cytoplasmic calcium level and elevated expres-
sion/activity of the ER calcium channels, includ-
ing Ryr1 and Ryr2, and that suppression of ER
calcium channels by chemical inhibitors or
genetic deletion of IP3R1 or Ryr2 preserves cones
[1, 4, 7]. This work investigated the effects of
knockdown of Ryr1, and the findings support the
view that Ryr1 contributes to ER stress and cone
degeneration in CNG channel deficiency.
2 Materials and Methods
2.1 Experimental Animals
The Nrl−/− mouse was provided by Dr. Anand
Swaroop (National Eye Institute), the Cnga3−/−
mouse was provided by Dr. Martin Biel
(University of Munich), and Cnga3−/−/Nrl−/−
mouse was generated by cross-breeding. The
double knockout mouse was used as a channel-­
deficient model on a cone-dominant background
to facilitate biochemical evaluations in cones. All 2.3 Subretinal Injection
experiments and animal maintenance were
approved by the local Institutional Animal Care Subretinal injections were performed under a
and Use Committee (Oklahoma City, OK) and Carl Zeiss OPMI VISU 140 surgical operating
F. Yang et al.
conformed to the guidelines on the care and use
of animals adopted by the Society for
Neuroscience and the Association for Research
in Vision and Ophthalmology (Rockville, MD).
2.2 Construction of AAV2/5-­
SaCas9/gRNA-Ryr1 Vector
The knockdown of Ryr1 in cones was achieved
using an AAV-mediated CRISPR/SaCas9 genome
editing technology. The plasmid that expresses an
epitope-tagged version of the Cas9 gene from
Staphylococcus aureus and a cassette for the
expression of guide RNAs containing the U6 pro-
moter was provided by Dr. Feng Zhang
(Massachusetts Institute of Technology), and
modified for directing the expression specially in
cones. The modified plasmid permits packaging in
an AAV capsid and contains a hybrid promoter of
the enhancer from the interphotoreceptor retinoid
binding protein and human transducin alpha-sub-
unit proximal promoter for expression of SaCas9
specifically in cones. The guide RNAs (gRNAs)
for each of the first five exons of the coding region
of Ryr1 were identified using the algorithm for
gRNA design from the Broad Institute (https://
portals.broadinstitute.org/gpp/public/analysis-­
tools/sgrna-­design). We tested five guides in cell
culture (mouse Neuro 2A cells), based on qRT-
PCR detection for knockdown of exons 1–5 of
Ryr1. A sgRNA that led to significant reduction of
Ryr1 mRNA relative to a non-targeting control
gRNA in the cells was cloned in an AAV2 vector,
and expressed using the U6 RNA pol III promoter.
The gRNA sequence is
CCATCATGGGTGATGGAGGAG. The vector
DNAs were packaged in AAV5 capsids for high
efficiency of photoreceptor transduction in mice
and were produced using the two-plasmid co-­
transfection method, followed by subsequent puri-
fication and titration, as described previously [8].
Inhibition of Ryanodine Receptor 1 Reduces Endoplasmic Reticulum (ER) Stress and Promotes ER Protein… 355

Table 1 Primary antibody information

Catalog Dilutions used in immunoblotting (IB) or
Antibody Provider number immunofluorescence labeling (IF)
Ryr1 Cell signaling 8153 1:500 (IB)
M-opsin EMD Millipore AB5405 1:500 (IB)
S-opsin Dr. Muna Naash (University 1:500 (IB)
of Houston)
Cone arrestin EMD Millipore AB15282 1:500 (IB), 1:200 (IF)
Phospho-­ Cell signaling 3398 1:500 (IB)
eIF2α
Phospho-­ Abcam Ab-48,187 1:500 (IB)
IRE1α
Syvn1 Proteintech 13,473–1-AP 1:500 (IB)
Derlin-1 Abcam ab176732 1:500 (IB)
β-actin Abcam ab-6276 1:2000 (IB)

microscope. Briefly, after anesthesia on ice for
2–3 min and complete dilation with 1% cyclo-
pentolate hydrochloride (Akorn), a drop of 2.5%
methylcellulose was added to the corneal surface
to visualize the fundus. A 28-gauge beveled
hypodermic needle (BD Biosciences) was used
to puncture a hole immediately below the limbus.
One microliter of AAV2/5-SaCas9/gRNA-Ryr1
vector (4.4 × 109 vg) was injected subretinally
into one eye of each mouse using a NanoFil
microsyringe injector system with a 33-gauge
blunt needle (Hamilton Co.). The contralateral
eye was injected with 1 μl of vehicle (balanced
salt solution, Alcon).
Li-Cor Odyssey Fc Imager and Image Studio Fc
software (Li-Cor Biosciences) were used for
detection and densitometric analysis.
Mouse eye collection, retinal cross-sectional
preparation, and immunofluorescence labeling
were performed as described previously [4].
Table 1 shows the dilution information of cone
arrestin antibody used in the immunofluores-
cence labeling. The labeling was imaged using an
Olympus FV1000 confocal laser-scanning micro-
scope and FluoView imaging software
(Olympus).
3 Results

2.4 Western Blotting 3.1 Treatment with AAV2/5-­

and Immunofluorescence SaCas9/gRNA-Ryr1 Reduced
Labeling Expression Level of Ryr1
in Cnga3−/−/Nrl−/− Retinas
Retinal protein preparation, SDS-PAGE, and and Increased Expression
Western blotting were performed as described Levels of Cone-Specific
previously [1]. Following gel separation, trans- Proteins
ferring, and blocking, blots were incubated with
primary antibody overnight at 4 °C (see Table 1 Previous studies have shown that the expression
for antibody dilution information) and with level of Ryr1 mRNA was increased in CNG
HRP-­ conjugated secondary antibodies channel-deficient retina [1]. In this work, we
(1:20,000) for 1 h at room temperature. first examined the expression level of Ryr1 pro-
SuperSignal West Dura Extended Duration che- tein in the diseased retina and the effects of Ryr1
miluminescent substrate (Thermo Fisher knockdown. Postnatal day 5 (P5),
Scientific) was used to detect binding of the pri- Cnga3 /Nrl mice received AAV2/5-SaCas9/
−/− −/−

mary antibodies to their cognate antigens. A gRNA-Ryr1 via subretinal injection, and retinas
356
Fig. 1 Knockdown of Ryr1 increased expression levels
of cone proteins in Cnga3−/−/Nrl−/−retinas. The expression
levels of Ryr1, M-opsin, S-opsin, and cone arrestin (CAR)
in Cnga3−/−/Nrl−/− mice treated with AAV2/5-SaCas9/
gRNA-Ryr1 or vehicle were analyzed by western blot
analysis and immunofluorescence labeling. (a, b) Shown
are representative western blot images of Ryr1 (a) and
were collected at P40 for analysis of protein
expression by western blotting. The evaluation
showed that the expression level of Ryr1 in
Cnga3−/−/Nrl−/− retinas was increased, com-
pared with that in the Nrl−/− controls, and treat-
ment with the viral vectors nearly completely
abolished this elevation (Fig. 1a).
We next examined the effects of AAV2/5-­
SaCas9/gRNA-Ryr1 on the expression of the
cone-specific proteins. The evaluation showed
that the expression levels of M-opsin, S-opsin,
F. Yang et al.
cone-specific protein detections and corresponding quan-
titative analysis (b). (c) Shown are representative confocal
images of CAR labeling on retinal cross sections. ONL
outer nuclear layer, INL inner nuclear layer. Data are pre-
sented as mean ± SEM of three independent assays using
retinas from 6 to 8 mice (*p < 0.05)
and cone arrestin (CAR) were significantly
increased in the retinas of Cnga3−/−/Nrl−/− mice
that have been treated with AAV2/5-SaCas9/
gRNA-Ryr1, compared with mice treated with
vehicle (Fig. 1b). The expression level of CAR
was increased by about 50% in Cnga3−/−/Nrl−/−
mice treated with AAV2/5-SaCas9/gRNA-Ryr1,
compared with that in the age-matched vehicle-­
treated controls (Fig. 1b). Increased expression
level of CAR was also shown by immunofluores-
cence labeling (Fig. 1c).
Inhibition of Ryanodine Receptor 1 Reduces Endoplasmic Reticulum (ER) Stress and Promotes ER Protein…
3.2 Treatment with AAV2/5-­
SaCas9/gRNA-Ryr1 Reduced
ER Stress Responses
in Cnga3−/−/Nrl−/− Retinas
and Increased Expression
Levels of ERAD Proteins
We then examined the effects of Ryr1 knock-
down on the ER stress responses. The evaluation
showed that knockdown of Ryr1 significantly
reduced ER stress in CNG channel-deficient reti-
nas. The elevated levels of phospho-IRE1α and
phospho-eIF2α were reversed in retinas of
Cnga3−/−/Nrl−/− mice treated with
­AAV2/5-­SaCas9/gRNA-Ryr1, compared with
vehicle-­treated controls (Fig. 2a).
ER retrotranslocation and ER-associated pro-
tein degradation (ERAD) involve multiple
machinery proteins, including Syvn1 (E3
ubiquitin-­protein ligase synoviolin 1) and
Derlin-1 (degradation in ER protein 1), and these
proteins have been shown to be upregulated by
deletion of Ryr2 [7]. In this work, we examine the
effects of Ryr1 knockdown. The expression lev-
els of Syvn1 and Derlin-1 were not different
between Cnga3−/−/Nrl−/− and Nrl−/− retinas.
Fig. 2 Knockdown of Ryr1 reduced ER stress in
Cnga3−/−/Nrl−/− retinas and increased expression levels of
ERAD proteins. The expression levels of ER stress marker
proteins phospho-IRE1α and phospho-eIF2α (a) and the
expression levels of ERAD proteins Syvn1 and Derlin-1
(b) in Cnga3−/−/Nrl−/− mice treated with AAV2/5-SaCas9/
357
However, treatment with AAV2/5-SaCas9/
gRNA-Ryr1 significantly increased expression
level of these proteins (Fig. 2b).
4 Discussion
Cones in CNG channel-deficient mice display
characteristics of ER stress-associated apoptosis.
Retinas of these mice show elevation of all three
arms of the ER stress pathways, i.e., elevated lev-
els of phospho-eIF2α and phospho-IRE1α and
increased cleavage of ATF6 [1, 3, 6], as well as
increased nuclear localization of CCAAT/−
enhancer-binding protein homologous protein [3,
6]. CNG channel-deficient retinas also show
impaired cytosolic and ER calcium homeostasis
[1, 3, 4, 6]. This work shows that knockdown of
Ryr1 reduces ER stress, promotes ERAD, and
improves cone survival in CNG channel
deficiency.
The cone preservation after knockdown of
Ryr1 is partial. This observation is similar to that
in mice with deletion of IP3R1 or Ryr2 [1, 4, 7],
suggesting an incomplete correction of ER cal-
cium deficiency, likely resulting from compensa-
gRNA-Ryr1 or vehicle were analyzed by western blot
analysis. Shown are representative western blot images of
these detections and corresponding quantitative analysis.
Data are presented as mean ± SEM of three independent
assays using retinas from 6 to 8 mice (*p < 0.05; **p <
0.01; n.s., not significant)
358
tory mechanisms. These could include
compensatory regulation from other isoforms of
the ER calcium channels, from other ER
calcium/protein folding regulators/chaperones,
and from other calcium channels in the inner seg-
ment membranes. Partial protection of cones
might also reflect incomplete transduction of
photoreceptors following subretinal injection
with the viral vectors.
Similar to deletion of Ryr2, knockdown of
Ryr1 is sufficient to reduce ER stress/cone death
and improve ERAD. These findings suggest that
although the potential compensatory mechanisms
among the different channel isoforms cannot be
excluded when one isoform is deleted/knocked
down, these two channel isoforms are indispens-
able and both isoforms contribute to ER calcium
dysregulation in CNG channel deficiency.
In summary, this work demonstrates that Ryr1
contributes to ER stress/cone degeneration in CNG
channel deficiency. Together with previous findings
showing that deletion of IP3R1 or Ryr2 suppresses
ER stress and preserves cones, our findings estab-
lish a role of ER calcium dysregulation in the ER
stress/cone degeneration in CNG channel defi-
ciency and support strategies targeting ER calcium
regulation to slow down cone degeneration.
Acknowledgments We thank Drs. Martin Biel and
Anand Swaroop for providing Cnga3-/- and Nrl-/- mouse
lines, and Dr. Feng Zhang for the SaCas9 plasmid. We
thank the Imaging Core Facility and the Histology Core
Facility of the Department of Cell Biology at OUHSC for
technical assistance. This work was supported by grants
from the National Eye Institute (R01EY027754 and
P30EY021725), the Oklahoma Center for the
Advancement of Science and Technology, the Presbyterian
Health Foundation, and support to Dr. Lewin from the
Shaler Richardson Professorship endowment and an unre-
stricted grant to the University of Florida from Research
to Prevent Blindness.
F. Yang et al.
References
1. Butler MR, Ma H, Yang F, Belcher J, Le YZ,
Mikoshiba K, Biel M, Michalakis S, Iuso A, Krizaj
D, Ding XQ. Endoplasmic reticulum (ER) Ca(2+)-
channel activity contributes to ER stress and cone
death in cyclic nucleotide-gated channel deficiency.
J. Biol. Chem. 2017;292:11189–205.
2. Kohl S, Marx T, Giddings I, Jagle H, Jacobson SG,
Apfelstedt-Sylla E, Zrenner E, Sharpe LT, Wissinger
B. Total colourblindness is caused by mutations in
the gene encoding the alpha-subunit of the cone pho-
toreceptor cGMP-gated cation channel. Nat. Genet.
1998;19:257–9.
3. Ma H, Butler MR, Thapa A, Belcher J, Yang F,
Baehr W, Biel M, Michalakis S, Ding XQ. cGMP/
protein kinase G signaling suppresses inositol
1,4,5-­trisphosphate receptor phosphorylation and pro-
motes endoplasmic reticulum stress in photoreceptors
of cyclic nucleotide-Gated Channel-deficient mice.
J. Biol. Chem. 2015;290:20880–92.
4. Ma H, Yang F, Butler MR, Rapp J, Le YZ, Ding
XQ. Ryanodine receptor 2 contributes to impaired
protein localization in cyclic nucleotide-gated
channel deficiency. eNeuro. 2019;6(3):1–12.
ENEURO.0119-19.2019
5. Nishiguchi KM, Sandberg MA, Gorji N, Berson EL,
Dryja TP. Cone cGMP-gated channel mutations and
clinical findings in patients with achromatopsia, mac-
ular degeneration, and other hereditary cone diseases.
Hum. Mutat. 2005;25:248–58.
6. Thapa A, Morris L, Xu J, Ma H, Michalakis S,
Biel M, Ding XQ. Endoplasmic reticulum stress-­
associated cone photoreceptor degeneration in cyclic
nucleotide-gated channel deficiency. J. Biol. Chem.
2012;287:18018–29.
7. Yang F, Ma H, Butler MR, Ding XQ. Preservation of
endoplasmic reticulum (ER) Ca(2+) stores by deletion
of inositol-1,4,5-trisphosphate receptor type 1 pro-
motes ER retrotranslocation, proteostasis, and protein
outer segment localization in cyclic nucleotide-gated
channel-deficient cone photoreceptors. FASEB J.
2021;35:e21579.
8. Young BM, Jones K, Massengill MT, Walsh E, Li
H, Lewin AS, Ildefonso CJ. Expression of a CARD
slows the retinal degeneration of a geographic atro-
phy mouse model. Mol Ther Methods Clin Dev.
2019;14:113–25.
 Mouse Choroid Proteome
Revisited: Focus on Aging
Donita Garland, James Harnly,
and Radha Ayyagari
Abstract
Age is a major risk factor for age-related mac-
ular degeneration (AMD), and age has a role
in the disease phenotypes of heritable macular
dystrophies. The proteomes of C57Bl6/J
mouse choroids at 2 ages were analyzed to
identify biochemical processes affected by
aging. Proteins of interest were identified as
those contributing most to the variance in
principal component analysis and those show-
ing the largest significant differences between
ages. These proteins implicated altered ECM
composition, immune system function, and
lipid metabolism.
Keywords
Choroid · Mouse · Aging · Proteome · Bruch’s
membrane · Extracellular matrix ·
Complement · Lipid · Immune system
D. Garland (*)
Harnly LLC, Bethesda, MD, USA
J. Harnly
Human Nutrition Center, US Department of
Agriculture, Beltsville, MD, USA
e-mail: james.harnly@usda.gov
R. Ayyagari
Departments of Ophthalmology and Pathology,
Shiley Eye Institute, University of California, San
Diego, CA, USA
e-mail: rayyagari@health.ucsd.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_52
1 Introduction
All of the major risk factors for age-related mac-
ular dystrophy (AMD) will, to varying degrees,
impact biological aging, i.e., the combination of
molecular changes leading to decreased biologi-
cal function [6, 15, 19, 25]. The interplay between
these molecular changes is complex and unique
for individuals. In addition to the impact of
genetic variants on aging, it is important to under-
stand how biological aging influences the impact
of genetic variants or mutations on macular
disease.
The age-related changes in the functions of
the retinal pigment epithelia (RPE) and Bruch’s
membrane (BrM) are key to the development of
macular dystrophies whether age-related or due
to mutation. Mice have been widely used to
model the pathology of AMD and heritable forms
of macular dystrophies [7, 20, 21, 27, 28, 33]. We
chose to assess the effects of chronological age
on the mouse choroid. The choroid consists of
vessels, the choriocapillaris, and BrM which
forms the inner edge of the choroid. The choroid
contains a number of cell types, among them
immune cells, melanocytes, and endothelia cells.
Each component of the choroid undergoes
changes with age that are thought to contribute to
the development of macular dystrophies. These
include the thinning of the choroid, thickening of
BrM, decrease of the choriocapillaris, and the
activation of immune cells [1, 14, 17, 26]. In
359
360
addition, the choroid is a source of certain com-
plement components and regulatory proteins of
the classical and alternative pathways [3].
Our initial proteome analysis of the mouse cho-
roid with age showed altered biological functions
included immune function, signaling, ECM com-
position, and intracellular transport processes [21].
Recent technical advances and improved software
and databases prompted us to revisit quantitative
proteome analysis of the mouse choroid. This
analysis yielded identification of 3700 proteins,
over 4.5 times the number of proteins in the origi-
nal study. This allowed identification of lower
abundance proteins and provided a more in-depth
picture of the age-­related changes.
The aim of this study was to identify the molec-
ular processes most affected by age in the choroid.
This provides a baseline for studying the pathobiol-
ogy in mouse models of heritable macular dystro-
phies and for resolving mutant-­induced pathology
from age-related changes. We outline here our
approach and an overview of the results.
2 Methods
The C57Bl6 mice were generated at UC San
Diego. The use of the mice was approved by the
UCSD Animal Use and Care Committees. The
cornea, lens, and neural retina were removed and
the eyes were held at −80° until used. Room tem-
perature PBS/EDTA was added to the eyecups to
slowly thaw and loosen the RPE [21]. Radial cuts
were made to flatten the tissue. Any remaining
RPE was washed from the surface of Bruch’s
membrane with repeated streams of PBS/
EDTA. The edge of Bruch’s membrane was held
with tweezers and Bruch’s membrane/choroid was
peeled out. To address mouse biological variation,
samples were composites of choroids, one
eye/mouse/sample. Four biological replicates
were done for each age. The mice were 4.4 mo ±
0.25 mo (16 mice, 8F/8M) and 19.2 mo ± 0.6 mo
(13 mice, 5F/8M). These ages correspond to 20–30
and 56–69 human years of age, respectively [18].
The proteins in samples were solubilized and
run 2 cm into SDS gels. In-gel trypsin digestion
of proteins and LC-MS/MS was performed at the
D. Garland et al.
Proteomics and Metabolomics Facility, Wistar
Institute, Philadelphia, PA. MaxQuant 1.6.0.16
was used for database searching, peptide and pro-
tein identification, and label-free quantification
(LFQ) [12, 13].
Principal component analysis was done using
SOLO, Eigen Vector.
3 Results
Across all samples 39,000 peptides were identi-
fied. These were assigned to 3700 protein groups.
The first step was to determine if there were any
patterns in the data. This was done using princi-
pal component analysis (PCA), a multivariate
analysis method that reduces the dimensionality
of large datasets to increase interpretability. As
seen in Fig. 1, the data formed two clusters with
respect to age, separated along the x-axis, which
accounted for 68% of the variance in the data.
The separation along the y-axis accounted for
only 10% of the variance. This separation was
due to biological variation among samples. At
4.4 months the variation among samples is likely
due to gender. For two samples three of the four
choroids were from female, and for two samples
three of the four choroids were from male mice.
The variation was slightly greater in 19.2-mo-old
samples and was likely due to the slightly larger
spread in mouse age. The remaining 22% of the
variance was due to technical variation.
Two approaches were primary in identifying
proteins of potential significance in aging of the
mouse choroid. (1) The PCA “loadings” identify
the contribution of each protein according to their
relative contribution to the separation of the clus-
ters in PCA. In this case, the loadings associated
with PC1/age were of interest. (2) The student t
test was used to identify all proteins that were
significantly altered between the two ages. About
one third (1265) of the proteins were significantly
altered (p < 0.05). Slightly more than half
ofvthese were decreased; the rest were increased.
Seventy-eight proteins were increased threefold
or more, and 124 were decreased threefold or
greater. Biological significance was further eval-
uated by comparison of the top ranked loadings
Mouse Choroid Proteome Revisited: Focus on Aging
0.1
Scores on PC2 (10.44%) 0.05
–0.05
–0.1
–0.15
–0.25 –0.2
Fig. 1 Scores plot for PCA analysis. Separation on X-axis (PC1) correlates with age. Separation on Y-axis correlates
with biological variation within samples
with those proteins identified by student t test as
being significantly altered. The biological func-
tions of those proteins identified as being altered
with age were assessed by using multiple data-
bases for protein class, gene ontology, pathway
analysis, and molecular interactions.
The presence of endothelial cells, mast cells,
macrophages, and melanocytes was verified by
the identification and quantification of specific
markers. For each cell type, the altered levels of
specific markers suggested critical biological
functions were impacted by age.
Components of three classes of proteins were
highly represented in the dataset: extracellular
matrix (ECM), immune system, and lipid metab-
olism. Three hundred proteins were identified as
ECM proteins by comparison with the Matrisome
database; 250 proteins were identified as immune
system proteins by comparison with the
InnateDB; and 319 proteins were associated with
lipids (LipidMaps) [5, 11, 29]. Nearly 50% of the
proteins of the innate immune system were
altered with age (p < 0.05) of which 55% were
increased. About 25% of the ECM proteins were
significantly altered with age ranging from a five-
fold increase to a fivefold decrease. Only 32% of
361
–0.15 –0.1 –0.05 0 0.05 0.1 0.15 0.2 0.25
Scores on PC1 (67.60%)
lipid-associated proteins were significantly
altered with age. In this case, however, two thirds
of those were increased.
Of particular interest was the effect of age on
the composition of Bruch’s membrane (BrM).
Forty-five known components of BrM were iden-
tified and most were altered with age. Mutant
forms of the BrM proteins, CTRP5, EFEMP1,
and TIMP3, lead to heritable forms of macular
dystrophies [2, 4, 9, 31]. Altered levels of another
BrM component, HTRA1, confer risk for AMD
[24, 34]. As seen in Table 1, CTRP5 and HTRA1
were both increased with age. EFEMP1 was
decreased and TIMP3 was not altered.
Thirteen complement components and nine
complement system regulators were identified
in the choroid. The changes observed with
increased age for 6 of these are listed in Table 1.
C4b and Serping1 which increased 2.7 and 1.9
fold, respectively (p = 0.0001 and 0.002), are
components of the classical complement path-
way. Cfh and Cfhr2, regulators of the alterna-
tive complement pathway, were also increased
but to a lesser extent. Factors B, P, D, and I of
the alternative complement pathway were not
detected.
362
Table 1 Ratios of listed protein levels (LFQ intensities)
between 19.2 mo and 4.4 mo mice
19.2mo/4.4mo p value
CFH 1.4 0.001
CFHR2 1.8 0.0003
SERPING1 1.9 0.002
C1S 0.9 0.727
C3 0.9 0.474
C4B 2.7 0.0001
CTRP5 1.4 0.03
HTRA1 2.7 0.001
EFEMP1 0.5 0.0002
TIMP3 1.0 0.656
4 Discussion
Significant changes with age were observed in the
ECM, immune system, and lipid-associated pro-
teins. Components of each confer risk of develop-
ing macular dystrophies and each is involved in
their pathobiology, and they are functionally
interdependent. Engin et al. [16] stated “Altered
expression of ECM affects all biological process
including inflammation” [30, 32]. In addition to
its role in immune homeostasis, ECM is a reser-
voir for signaling molecules and thus plays a criti-
cal role in signaling. Since the composition of
ECM dictates its structure and function, changes
of up to fivefold in the levels of some ECM com-
ponents will have a significant impact on the
structure and function of the ECM [22, 23]. It is
interesting that CTRP5 and HTRA1 were both
increased with age. We recently demonstrated
these were both increased in mice expressing
mutant CTRP5 and are binding partners [8].
There is a large literature regarding the role of
complement in macular dystrophies, and comple-
ment is critical for early stage pathology in
EFEMP1 mutant mice [21]. Choroidal immune
cells are a source of a number of complement
components and regulators, whereas the RPE and
liver are primary sources of others. The signifi-
cance of the age-related increases in the regula-
tors (CFH, CFHR2, SERPING1) and C4B is not
clear (Table 1). Does it reflect increased comple-
ment activity or increased numbers of immune
cells expressing complement? In earlier studies
on human AMD choroid, increased transcription
of complement components was not observed [3].
D. Garland et al.
The absence of complement factors B, D, P,
and I of the alternative complement pathway at
both ages was unexpected. Gene expression of
each was observed in human choroid, and CFP is
reported to be expressed by proinflammatory cells,
cells which were present in the mouse choroid [3,
10]. The main sources of ocular CFB are, however,
RPE and plasma [35]. Other approaches are being
used to verify the presence or absence of these
alternative complement pathway components.
The limitations to this approach are primarily
technical. Very low abundance proteins may be
below the detection limit, and some proteins are
not amenable to detection by mass spectrome-
try. The amino acid sequences may yield few
tryptic peptides, or the tryptic peptides are too
short, are too long, or have low ionization effi-
ciency. Many ECM proteins are long-lived and
become heavily posttranslationally modified
with age. Elastin is such an example; it becomes
cross-linked yielding few detectable peptides.
Only one elastin peptide was detected in all of
the samples analyzed. Proteins which were not
detected but predicted to be in potentially inter-
esting pathways have to be validated by other
techniques. A major advantage of the proteome
approach is, however, the generation of testable
hypotheses.
References
1. Ambati J, Atkinson JP, Gelfand BD. Immunology of
age-related macular degeneration. Nat. Rev. Immunol.
2013;13:438–51.
2. Anand-Apte B, Chao JR, Singh R, Stöhr H. Sorsby
fundus dystrophy: insights from the past and looking
to the future. J. Neurosci. Res. 2019;97:88–97.
3. Anderson DH, Radeke MJ, Gallo NB, Chapin EA,
Johnson PT, Curletti CR, et al. The pivotal role of the
complement system in aging and age-related macular
degeneration: hypothesis re-visited. Prog. Retin. Eye
Res. 2010;29:95–112.
4. Ayyagari R, Mandal MNA, Karoukis AJ, Chen L,
McLaren NC, Lichter M, Sieving PA. Late-onset mac-
ular degeneration and long anterior lens zonules result
from a CTRP5 gene mutation. Invest. Ophthalmol.
Vis. Sci. 2005;46:3363–71.
5. Breuer K, Foroushani AK, Laird MR, Chen C,
Sribnaia A, Lo R. InnateDB: systems biology of innate
immunity and beyond – recent updates and continuing
curation. Nucleic Acids Res. 2013;41:D1228–33.
Mouse Choroid Proteome Revisited: Focus on Aging
6. Chakravarthy U, Wong TY, Fletcher A, Piault E,
Evans C, Zlateva G. Clinical risk factors for age-­
related macular degeneration: a systematic review and
meta-analysis. BMC Ophthalmol. 2010;10:31. https://
doi.org/10.1186/1471-­2415-­10-­31.
7. Chavali VR, Khan NW, Cukras CA, Bartsch
DU, Jablonski MM, Ayyagari R. A CTRP5 gene
S163R mutation knock-in mouse model for late-
onset retinal degeneration. Hum. Mol. Genet.
2011;20:2000–14.
8. Chekuri A, Zientara-Rytter K, Soto-Hermida A,
Borooah S, Voronchikhina M, Biswas P, et al. Late-­
onset retinal degeneration pathology due to mutations
in CTRP5 is mediated through HTRA1. Aging Cell.
2019;18:e13011.
9. Christensen D, Brown F, Cree A, Ratnayaka AJ, Lotery
A. Sorsby fundus dystrophy – a review of pathology
and disease mechanisms. Exp. Eye Res. 2017;165:35.
https://doi.org/10.1016/j.exer.2017.08.014.
10. Cortes C, Ohtola JA, Saggu G, Ferreira VP. Local
release of properdin in the cellular microenviron-
ment: role in pattern recognition and amplifica-
tion of the alternative pathway of complement
front. Immunology. 2013;3 https://doi.org/10.3389/
fimmu.2012.00412.
11. Cotter D, Maer A, Guda C, Saunders B, Subramaniam
S. LMPD: LIPID MAPS proteome database.
Nucleic Acids Res. 2006;34:D507–10. https://doi.
org/10.1093/nar/gkj122.
12. Cox J, Mann M. MaxQuant enables high peptide
identification rates, individualized p.p.b.-range mass
accuracies and proteome-wide protein quantification.
Nat. Biotechnol. 2008;26:1367–72.
13. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann
M. Accurate proteome-wide label-free quantification
by delayed normalization and maximal peptide ratio
extraction. Termed MaxLFQ Mol Cell Proteomics.
2014;13:2513–26.
14. Curcio CA, Johnson M. Structure, function, and
pathology of Bruch’s membrane. Anat Physiol.
2013;20:465–81.
15. Ebrahimi KB, Handa JT. Lipids, lipoproteins,
and age-related macular degeneration. J Lipids.
2011;2011:802059.
16. Engin AB, Nikitovic D, Neagu M, Henrich-Noack
P, Docea AO, Shtilman MI, Golokhvast K, Tsatsakis
AM. Mechanistic understanding of nanoparticles’
interactions with extracellular matrix: the cell and
immune system. Part. Fibre Toxicol. 2017;14:22.
17. Farazdaghi MK, Ebrahimi KB. Role of the choroid
in age-related macular degeneration: a current review.
J. Ophthalmic Vis. Res. 2019;14:78–87.
18. Flurkey K, Currer JM, Harrison DE. The mouse in
aging research. In: Fox JG, et al., editors. The mouse
in biomedical research. 2nd ed. Burlington: American
College Laboratory Animal Medicine (Elsevier);
2007. p. 637–72.
19. Fritsche LG, Fariss RN, Stambolian D, Abecasis
GR, Curcio CA, Swaroop A. Age-related macu-
lar degeneration: genetics and biology coming
together. Ann Rev Genomics and Human Genetics.
2014;15:151–71.
363
20. Fu L, Garland D, Yang Z, Shukla D, Rajendran A,
Pearson E, et al. The R345W mutation in EFEMP1
is pathogenic and causes AMD-like deposits in mice.
Hum. Mol. Genet. 2007;16:2411–22.
21. Garland DL, Fernandez-Godino R, Kaur I, Speicher
KD, Harnly JM, Lambris JD, et al. Mouse genet-
ics and proteomic analyses demonstrate a critical
role for complement in a model of DHRD/ML, an
inherited macular degeneration. Hum. Mol. Genet.
2014;23:52–68.
22. Hynes RO. Extracellular matrix: not just pretty fibrils.
Science. 2009;326:1216–9.
23. Karamanos NK, Theocharis AD, Piperigkou Z,
Manou D, Passi A, Skandalis SS, et al. A guide to the
composition and functions of the extracellular matrix.
FEBS J. 2021;288:6850. https://doi.org/10.1111/
febs.15776.
24. Liu Y, Jin H, Wei D, Li W. HTRA1 rs11200638
variant and AMD risk from a comprehensive anal-
ysis about 15,316 subjects. BMC Med. Genet.
2020;21:107.
25. López-Otín C, Blasco MA, Partridge L, Serrano
M, Kroemer G. The hallmarks of aging. Cell.
2013;153(6):1194–217.
26. McLeod DS, Grebe R, Bhutto I, Merges C, Baba T,
Lutty GA. Relationship between RPE and choriocap-
illaris in age-related macular degeneration. Invest.
Ophthalmol. Vis. Sci. 2009;50:4982–91.
27. Pandi SPS, Arjuna Ratnayaka JA, Lotery AJ,
Teeling JL. Progress in developing rodent mod-
els of age-related macular degeneration (AMD).
2020;203:108404. https://doi.org/10.1016/j.
exer.2020.108404.
28. Pennesi ME, Neuringer M, Courtney RJ. Animal
models of age related macular degeneration. Mol.
Aspects Med. 2012;33:487–509.
29. Shao X, Taha IN, Clauser KR, Gao U, Naba
A. MatrisomeDB: the ECM-protein knowledge data-
base. Nucleic Acids Res. 2020;48:D1136–44.
30. Sorokin L. The impact of the extracellular
matrix on inflammation. Nat. Rev. Immunol.
2010;10:712–23.
31. Stone EM, Lotery AJ, Munier FL, Héon E, Piguet
B, Guymer RH, et al. A single EFEMP1 muta-
tion associated with both Malattia Leventinese and
Doyne honeycomb retinal dystrophy. Nat. Genet.
1999;22:199–202.
32. Theocharis AD, Manou D, Karamanos NK. The
extracellular matrix as a multitasking player in dis-
ease. FEBS J. 2019;286:2830–69.
33. Weber BHF, Lin B, White K, Kohler K, Soboleva
G, Herterich S, et al. A mouse model for Sorsby
fundus dystrophy. Invest. Ophthalmol. Vis. Sci.
2002;43:2732–40.
34. Weber BHF, Lin B, White K, Kohler K, Soboleva
G, Herterich S, et al. A mouse model for Sorsby
fundus dystrophy. Invest. Ophthalmol. Vis. Sci.
2002;43:2732–40.
35. 35. Chen M, Muckersie E, Robertson M, Forrester
JV, Xu H. Up-regulation of complement factor B in
retinal pigment epithelial cells is accompanied by
complement activation in the aged retina. Exp. Eye
Res. 2008;543–550.
 Morphological and Functional
Comparison of Mice Models
for Retinitis Pigmentosa
Prakadeeswari Gopalakrishnan, Avigail Beryozkin,
Eyal Banin, and Dror Sharon
Abstract
Retinitis pigmentosa (RP) is the predominant
form of inherited retinal degenerations (IRDs)
caused by abnormalities and loss of photore-
ceptor cells ensuing diminishment of vision.
RP is a heterogenous genetic disorder associ-
ated with mutations in over 80 genes, showing
various inheritance patterns. Laboratory
mouse models are important for our under-
standing of disease mechanisms, modifier
effects, and development of therapeutic
modalities. In this review, we have summa-
rized a comprehensive comparison of our pre-
viously reported Fam161a knockout (KO)
mouse model with other well-studied RP
mouse models, Fam161aGT/GT, Pde6brd1,
Nr2e3rd7, Rpgrrd9, and Pde6brd10 using struc-
tural and functional analysis of the retina.
Fam161atm1b/tm1b mouse models are important
for developing novel therapies and mainly
AAV-based gene therapy and translational
read-through-inducing drugs.
P. Gopalakrishnan · A. Beryozkin · E. Banin ·
D. Sharon (*)
Department of Ophthalmology, Hadassah Medical
Center, Faculty of Medicine, The Hebrew University
of Jerusalem, Jerusalem, Israel
e-mail: prakadee.gopalakrish@mail.huji.ac.il; avigail.
beryozkin@mail.huji.ac.il; banine@mail.huji.ac.il;
dror.sharon1@mail.huji.ac.il
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_53
Keywords
Retinitis pigmentosa · Fam161a · Mouse
model · Knockout · Retina
Abbreviations
IRDs Inherited retinal degenerations
PR Photoreceptor
RP Retinitis pigmentosa
1 Introduction
Retinitis pigmentosa (RP; MIM 268000) is the
most prevalent inherited retinal degeneration
(IRD) with a prevalence of 1:2000–1:5000
individuals and is one of the major causes of
progressive loss of vision in young individuals
[1, 2]. RP is a heterogeneous disease and can be
inherited in various patterns (autosomal
dominant, autosomal recessive, X-linked, and
mitochondrial) [3]. RP is ensued due to the
abnormalities and loss of photoreceptor cells
which are associated with mutations in over 80
genes (https://sph.uth.edu/retnet/, retrieved on
27th November 2021). The primary clinical
features of RP are apoptosis of rod photoreceptor
cells and subsequent cone photoreceptor cell
degeneration, resulting in partial or even complete
365
366
vision impairment. Not only restricted to the eye,
RP can also transpire along with syndromes
including Usher syndrome and Bardet-Biedl
syndrome [4].
A decade ago, two back-to-back publications
[5, 6] first reported that null mutations in the
FAM161A (OMIM 613596) gene cause RP, fol-
lowed by other reports from various populations.
Mutations in FAM161A are now known to be the
major cause of RP in the Israeli population due to
two founder mutations [7] and additional though
less common mutations have been identified in
RP patients from Europe, the USA, India, and
China [8–12]. Moreover, we have recently
reported on a comprehensive clinical analysis of
over 100 patients with biallelic FAM161A muta-
tions [7], a dataset that can serve as a basis for
future gene therapy treatment. It was therefore
important to understand the underlying patho-
genic mechanism of FAM161A mutations associ-
ated with RP. Experimental animal models were
extremely useful so far in understanding disease
mechanism of various RP types, including knock-
out (KO) and knock-in (KI) models in various
species [13], and this would be obliging for
designing therapeutic regimens. This prompted
us to generate and characterize a new Fam161a
knockout (KO) mouse model, Fam161atm1b/tm1b
which is lacking the major exon 3 [14]. In this
mini review, we intend to assess and summarize
the common and variable characteristics of vari-
ous mouse models of RP, including the
Fam161atm1b/tm1b [14], Fam161aGT/GT [15],
Pde6brd1 [16–19], Nr2e3rd7 [20, 21], Rpgrrd9 [22,
23], and Pde6brd10 [24–26]. To this end, we per-
formed a comparative analysis of these models
based on the following parameters:
(i) Progression of retinal degeneration with
subsequent retinal structural differences that
appear in the outer nuclear layer (ONL)
along with photoreceptor cell loss as deter-
mined by optical coherence tomography
(OCT) scans and histological analysis
(ii) Retinal function as measured by
electroretinography (ERG) and visual acuity
(VA)
P. Gopalakrishnan et al.
(iii) Protein expression by evaluating either
absence of the appropriate full-length func-
tional protein or presence of truncated non-
functional protein by Western blot or
immunohistochemistry (IHC) analysis.
2 Morphological Alterations
of Retinal Structure
Since photoreceptor degeneration is one of the
hallmarks of RP, one can measure ONL thickness
in histological analysis and OCT scans as a mea-
sure of disease progression. The different models
that are analyzed here show variable progression
rates and onset. The Fam161aGT/GT model showed
disorganized outer segment of photoreceptors
already at 1 month, and a 50% reduction in reti-
nal thickness at 2 months of age (Table 1). At the
age of 6 months, 90% of the ONL entirely disap-
peared although the inner retina remained to be
mostly unaffected [15]. A KO model of the same
gene, Fam161atm1b/tm1b, showed a similar rate of
degeneration with gradual thinning of ONL from
23% loss at 1 month to 94% loss at 8 months.
OCT did not reveal any detectable ONL at the
age of 6 months [14]. On the other hand, Pde6brd1
mice showed a more severe form of retinal degen-
eration with 73% substantial reduction of outer
retinal thickness at P13 [27]. Interestingly, the
inner nuclear layer (INL) seems to be well-­
preserved until P34 [27, 28]. Another long-term
characterization study [29] on this model at P14
revealed thinned retina as well as loss of inner
segment and outer segment (IS/OS) junction and
external limiting membrane (ELM). The rd10
(Pde6brd10) model was reported to have a progres-
sive ONL degeneration starting in the central
retina at P16, spreading to the peripheral retina
later at P20, while no ONL was left at P60 [25].
Compared to rd1, the rd10 model exhibited a pro-
gressive but relatively slow decline of total retinal
thickness and only at P103 it reached similar reti-
nal thickness as rd1 [29]. The retina of the rd7
model, Nr2e3rd7, illustrated ONL waves, whorls,
and rosettes at 1 month of age; then, flattened
waves were observed in 5 months, which disap-
peared at 16-month-old retinas. The ONL thick-
Morphological and Functional Comparison of Mice Models for Retinitis Pigmentosa 367

Table 1 Summary of the comparative analyses of well-studied RP mouse models

Rate of Time
Gene Mutation Strain degeneration point
Pde6brd1 Exon 7; p.Tyr347X: B.C3-Pde6brd1; ABJ/Le; BDP/J; 73% retinal P13
Nonsense point mutation & BUB/BnJ; C3H sublines: CBA/J, thickness
an intronic insertion of a FVB/NJ, PL/J, SB, SJL/J, and reduction
leukemia virus (Xmv-28) SWR/J
Pde6brd10 Exon 13; p.Arg560Cys: B6.CXB1-Pde6brd10/J Diminished P16
Missense mutation ONL P60
No ONL
Nr2e3rd7 Deletion of last 36 B6.Cg-Nr2e3rd7/J 4–5 rows of 16 months
nucleotides of exon 4, intron nuclei
4, & single nucleotide
changes in exon 5
Rpgrrd9 32 bp duplication in exon C57BL/6 J-RpgrRd9/Boc 23% ONL 12 months
ORF15 reduction 18 months
34% ONL
reduction
Fam161aGT/GT Gene trap within exon 3 after 129X1/SvJ x 129S1/Sv F1-Kitl+ 50% ONL 2 months
amino acid 362 reduction 6 months
90% ONL
reduction
Fam161atm1b/tm1b Deletion of exon 3 C57BL/6J-Atm1Brd 63% ONL 3 months
reduction 6 months
79% ONL
reduction

ness is relatively preserved with only 19% loss at
the age of 1 year and 46% at 18 months [20].
Rpgrrd9, a mutant model of X-linked RP, has
revealed a fairly diminished ONL at 12 months of
age (23% ONL loss) progressing to 34% at the
age of 18 months (Table 1) [22, 30]. The degree
of progression of retinal degeneration based on
the reduction of total retinal thickness and ONL
rows at specific time points among the above
compared groups follows this pattern (see Fig. 1):
Pde6b rd 1 > Pde6b rd 10 > Fam161a GT / GT >
Fam161a tm1b / tm1b > Rpgr rd 9 > Nr 2e3rd 7.
3 Comparison of Retinal
Functional Response
Functional analysis of retinal function as
measured by ERG is largely compatible with
ONL thickness in retinal degenerative diseases.
The Fam161aGT/GT model has been reported with
abnormal scotopic response even at the age of
1 month that became undetectable at 4 months.
The light-adapted ERGs had a lesser amount of
amplitude decrease compared to dark-adapted
ERGs [15]. Similarly, the other Fam161a model,
Fam161atm1b/tm1b, showed both photopic and sco-
topic ERG response declines from 1 month until
6 months of age, where no ERG signals were
detected [14]. On the other hand, scotopic ERG
response was not obtainable in Pde6brd1 mice at
any of the age time points, as they completely
lack of functional PDE6B and dark-rearing can-
not delay the aggressive Pde6brd1 retinal degen-
eration [31]. The rd10 model, Pde6brd10, has
reduced light-adapted and dark-adapted
responses to 50% and 30% of wild-type response,
respectively, at P18, deteriorating to 30% and
10% at P30 and unrecordable by P50 [25]. ERG
response in the rd7 model, Nr2e3rd7, was reported
to be normal until the age of 5 months which sub-
sequently showed progressive reduction of both
cone and rod signals. In the presence of rosettes
that extensively disrupt retinal integrity at
1 month of age, a- and b-amplitudes at maximum
intensities were slightly reduced compared to
5 months of age when the waves have disap-
peared. ERG amplitudes were reduced by 50% at
16 months of age [20]. In 1-year-old Rpgrrd9
368
Fig. 1 Comparative illustration of the ONL thickness
reduction associated with rate of degeneration in RP
mouse models. The ONL thickness reduction in percent-
age at specific time points showing the rate of progressive
retinal degeneration based on the histological measure-
ments of retinal sections from the appropriate studies for
mice, functions analysis revealed a decreased
retinal light response [22, 30]. The degree of pro-
gression of retinal degeneration based on the reti-
nal physiology at specific time point of age,
among the above-compared group, follows up
this pattern Pde6brd1 > Pde6brd10 > Fam161aGT/
GT
> Fam161atm1b/tm1b > Rpgrrd9 > Nr2e3rd7, which
is in parallel to the morphological finding.
4 Comparison of Protein
Expression
It is highly important to understand the
mechanism of retinal degeneration in animal
models. One important aspect in this regard is
whether functional protein is being produced in
each model and to which extent. Fam161a
protein expression by immunoblotting was
absent in 1-month-old Fam161aGT/GT mice
retina; however, longitudinal retinal section
P. Gopalakrishnan et al.
the following RP models: Pde6brd1 0.5 M (73%), 1 M
(100%) [27]; Pde6brd10, 2 M (90%), 6 M (100%) [26];
Fam161aGT/GT, 1 M (17%), 2 M (50%), 3 M (50%), 4 M
(79%), 5 M (84%), 6 M (90%) [15]; and Fam161atm1b/tm1b,
1 M (23%), 3 M (63%), 6 M (79%), 8 M (94%) [14]
analysis by immunohistochemistry (IHC)
showed decreased levels of expression in all
retinal layers. This finding suggests that
Fam161aGT/GT mice have a weak “leaky”
expression of a truncated Fam161a protein that
might have some residual function [15]. In the
rd10 model, low level of β-PDE protein
expression was detected by immunoblotting in
P9–P11 retinal extracts. IHC labeling for Pde6b
antibody in cryosections of P22 detected
immunoreactivity in the inner and outer seg-
ments of photoreceptors. A similar analysis of
the rd1 model did not reveal any expression by
Western blotting or immunostaining [25]. In
Nr2e3rd7 mice retina, IHC staining of the cone
cells evidences their enhanced number which
might be responsible for retinal dysplasia [21].
Western blot analysis of Rpgrrd9, Rpgr-KO, and
wild-type retinal protein extracts by using anti-
bodies with shared Rpgr epitopes for the two
major transcripts showed expression of the Rpgr
Morphological and Functional Comparison of Mice Models for Retinitis Pigmentosa
Ex1–19 isoform only. No specific reactivity was
reported in Rpgr-KO mice with both antibodies
which clearly indicates the absence of both Rpgr
isoforms [22].
5 Conclusion
The different RP mouse models presented here
show high variability in retinal structure and
function. While rd1 and rd10 show an early-onset
relatively severe phenotype, rd9 and rd7 models
show a relatively slow process. The two Fam161a
models show a relatively similar disease progres-
sion which is moderate in severity. This makes
the Fam161atm1b/tm1b KO mouse model promising
for long-term therapeutic modalities such as
AAV-based gene therapy and translational read-­ 8. Hu Y-S, Song H, Li Y, Xiao Z-Y, Li T. Whole-
through-­inducing drugs (TRIDs) for which KI
models will need to be developed.
Based on the comparative analysis with three
criteria, retinal morphology, retinal physiology,
and expression of protein which we performed
among the selected RP mouse models in this
review, the progression of retinal degeneration
seems to be in the following range:
Pde6b rd 1  Pde6b rd 10  Fam161a tm1b / tm1b
GT / GT rd 9 rd 7
 Fam161a  Rpgr  Nr 2e3 .
Acknowledgments This study was funded by the Israel
Science Foundation (grant number 1147/18).
Conflict of Interest Statement The authors declare no
financial or proprietary and conflict of interest.
References
1. Cremers FPM, Boon CJF, Bujakowska K, Zeitz
C. Special Issue Introduction: Inherited Retinal
Disease: Novel Candidate Genes, Genotype-­
Phenotype Correlations, and Inheritance Models.
Genes (Basel). 2018;9(4):215.
2. Hanany M, Rivolta C, Sharon D. Worldwide carrier 13. Rivas MA, Vecino E. Animal models and different
frequency and genetic prevalence of autosomal
recessive inherited retinal diseases. Proc. Natl. Acad.
Sci. 2020;117(5):2710–6.
3. Hartong DT, Berson EL, Dryja TP. Retinitis
pigmentosa. Lancet. 2006;368(9549):1795–809.
369
4. Ferrari S, Di Iorio E, Barbaro V, Ponzin D,
Sorrentino FS, Parmeggiani F. Retinitis pigmentosa:
genes and disease mechanisms. Curr. Genomics.
2011;12(4):238–49.
5. Bandah-Rozenfeld D, Mizrahi-Meissonnier L,
Farhy C, Obolensky A, Chowers I, Pe’er J, Merin
S, Ben-Yosef T, Ashery-Padan R, Banin E, Sharon
D. Homozygosity mapping reveals null mutations in
FAM161A as a cause of autosomal-recessive retinitis
pigmentosa. Am. J. Hum. Genet. 2010;87(3):382–91.
6. Langmann T, Di Gioia SA, Rau I, Stohr H,
Maksimovic NS, Corbo JC, Renner AB, Zrenner E,
Kumaramanickavel G, Karlstetter M, Arsenijevic Y,
Weber BH, Gal A, Rivolta C. Nonsense mutations in
FAM161A cause RP28-associated recessive retinitis
pigmentosa. Am. J. Hum. Genet. 2010;87(3):376–81.
7. Beryozkin A, Khateb S, Idrobo-Robalino C, Khan
M, Cremers F, Obolensky A, Hanany M, Mezer E,
Chowers I, Newman H, Ben-Yosef T, Sharon D, Banin
E. Unique combination of clinical features in a large
cohort of 100 patients with retinitis pigmentosa caused
by FAM161A mutations. Sci. Rep. 2020;10(1):15156.
exome sequencing identifies novel mutations
in genes responsible for retinitis pigmentosa
in 2 nonconsanguineous Chinese families. Int.
J. Ophthalmol. 2019;12(6):915–23.
9. Zobor D, Balousha G, Baumann B, Wissinger
B. Homozygosity mapping reveals new nonsense
mutation in the FAM161A gene causing autosomal
recessive retinitis pigmentosa in a Palestinian family.
Mol. Vis. 2014;20:178–82.
10. Van Schil K, Klevering BJ, Leroy BP, Pott JWR,
Bandah-Rozenfeld D, Zonneveld-Vrieling MN,
Sharon D, den Hollander AI, Cremers FPM, De Baere
E, Collin RWJ, van den Born LI. A nonsense mutation
in FAM161A is a recurrent founder allele in Dutch
and Belgian individuals with autosomal recessive
retinitis pigmentosa. Invest. Ophthalmol. Vis. Sci.
2015;56(12):7418–26.
11. Duncan JL, Biswas P, Kozak I, Navani M, Syed
R, Soudry S, Menghini M, Caruso RC, Jeffrey
BG, Heckenlively JR, Reddy GB, Lee P, Roorda
A, Ayyagari R. Ocular phenotype of a family
with FAM161A-associated retinal degeneration.
Ophthalmic Genet. 2014:1–9.
12. Zhou Y, Saikia BB, Jiang Z, Zhu X, Liu Y, Huang
L, Kim R, Yang Y, Qu C, Hao F, Gong B, Tai Z,
Niu L, Yang Z, Sundaresan P, Zhu X. Whole-exome
sequencing reveals a novel frameshift mutation in the
FAM161A gene causing autosomal recessive retinitis
pigmentosa in the Indian population. J. Hum. Genet.
2015;60(10):625–30.
therapies for treatment of retinitis pigmentosa. Histol.
Histopathol. 2009;24(10):1295–322.
14. Beryozkin A, Matsevich C, Obolensky A, Kostic C,
Arsenijevic Y, Wolfrum U, Banin E, Sharon D. A new
370
mouse model for retinal degeneration due to Fam161a
deficiency. Sci. Rep. 2021;11(1):2030.
15. Karlstetter M, Sorusch N, Caramoy A, Dannhausen
K, Aslanidis A, Fauser S, Boesl MR, Nagel-Wolfrum
K, Tamm ER, Jagle H, Stoehr H, Wolfrum U,
Langmann T. Disruption of the retinitis pigmentosa
28 gene Fam161a in mice affects photoreceptor ciliary
structure and leads to progressive retinal degeneration.
Hum. Mol. Genet. 2014;23(19):5197–210.
16. Keeler C. Retinal degeneration in the mouse is rodless
retina. J. Hered. 57(2):47–50.
17. Pittler SJ, Keeler CE, Sidman RL, Baehr W. PCR
analysis of DNA from 70-year-old sections of rodless
retina demonstrates identity with the mouse rd defect.
Proc. Natl. Acad. Sci. U. S. A. 1993;90(20):9616–9.
18. Pittler SJ, Baehr W. Identification of a nonsense
mutation in the rod photoreceptor cGMP
phosphodiesterase beta-subunit gene of the rd mouse.
Proc. Natl. Acad. Sci. U. S. A. 1991;88(19):8322–6.
19. Wu W-H, Tsai Y-T, Justus S, Lee T-T, Zhang L, Lin C-S,
Bassuk AG, Mahajan VB, Tsang SH. CRISPR repair
reveals causative mutation in a preclinical model of
retinitis Pigmentosa. Mol. Ther. 2016;24(8):1388–94.
20. Akhmedov NB, Piriev NI, Chang B, Rapoport AL,
Hawes NL, Nishina PM, Nusinowitz S, Heckenlively
JR, Roderick TH, Kozak CA, Danciger M, Davisson
MT, Farber DB. A deletion in a photoreceptor-­specific
nuclear receptor mRNA causes retinal degeneration
in the rd7 mouse. Proc. Natl. Acad. Sci. U. S. A.
2000;97(10):5551–6.
21. Haider NB, Naggert JK, Nishina PM. Excess cone
cell proliferation due to lack of a functional NR2E3
causes retinal dysplasia and degeneration in rd7/rd7
mice. Hum. Mol. Genet. 2001;10(16):1619–26.
22. Thompson DA, Khan NW, Othman MI, Chang B, Jia
L, Grahek G, Wu Z, Hiriyanna S, Nellissery J, Li T,
Khanna H, Colosi P, Swaroop A, Heckenlively JR. Rd9
is a naturally occurring mouse model of a common
form of retinitis pigmentosa caused by mutations in
RPGR-ORF15. PloS One. 2012;7(5):e35865.
23. Falasconi A, Biagioni M, Novelli E, Piano I, Gargini
C, Strettoi E. Retinal phenotype in the rd9 mutant
P. Gopalakrishnan et al.
mouse, a model of X-linked RP. Front. Neurosci.
2019;13:991.
24. Chang B, Hawes NL, Hurd RE, Davisson MT,
Nusinowitz S, Heckenlively JR. Retinal degeneration
mutants in the mouse. Vision Res. 2002;42(4):517–25.
25. Chang B, Hawes NL, Pardue MT, German AM,
Hurd RE, Davisson MT, Nusinowitz S, Rengarajan
K, Boyd AP, Sidney SS, Phillips MJ, Stewart RE,
Chaudhury R, Nickerson JM, Heckenlively JR,
Boatright JH. Two mouse retinal degenerations
caused by missense mutations in the beta-subunit
of rod cGMP phosphodiesterase gene. Vision Res.
2007;47(5):624–33.
26. Rösch S, Johnen S, Müller F, Pfarrer C, Walter
P. Correlations between ERG, OCT, and anatomical
findings in the rd10 mouse. J. Ophthalmol.
2014;2014:874751.
27. Kim KH, Puoris’haag M, Maguluri GN, Umino Y,
Cusato K, Barlow RB, de Boer JF. Monitoring mouse
retinal degeneration with high-resolution spectral-­
domain optical coherence tomography. J. Vis.
2008;8(1):17–111.
28. Nakazawa M, Hara A, Ishiguro S-I. Optical coherence
tomography of animal models of retinitis Pigmentosa:
from animal studies to clinical applications. Biomed.
Res. Int. 2019;2019:8276140.
29. Pennesi ME, Michaels KV, Magee SS, Maricle A,
Davin SP, Garg AK, Gale MJ, Tu DC, Wen Y, Erker
LR, Francis PJ. Long-term characterization of retinal
degeneration in rd1 and rd10 mice using spectral
domain optical coherence tomography. Invest.
Ophthalmol. Vis. Sci. 2012;53(8):4644–56.
30. Collin GB, Gogna N, Chang B, Damkham N, Pinkney
J, Hyde LF, Stone L, Naggert JK, Nishina PM, Krebs
MP. Mouse Models of Inherited Retinal Degeneration
with Photoreceptor Cell Loss. Cell. 2020;9(4):4.
31. Han J, Dinculescu A, Dai X, Du W, Smith WC, Pang
J. Review: the history and role of naturally occurring
mouse models with Pde6b mutations. Mol. Vis.
2013;19:2579–89.
 Current Advancements in Mouse
Models of Retinal Disease

T. J. Hollingsworth, Xiangdi Wang,

Raven N. Simpson, William A. White,
Robert W. Williams, and Monica M. Jablonski

Abstract multifactorial, and/or polygenic diseases is a

The field of retinal degenerative (RDs) disease
study has been in a state of exponential growth
from discovering the underlying genetic com-
ponents of such diseases as age-related macu-
lar degeneration (AMD) and retinitis
pigmentosa (RP) to the first gene therapy
developed and approved for human Leber
congenital amaurosis. However, a source for
high-fidelity animal models of these complex,
T. J. Hollingsworth (*) · X. Wang · R. N. Simpson ·
W. A. White · M. M. Jablonski
Department of Ophthalmology, University of
Tennessee Health Sciences Center,
Memphis, TN, USA
Department of Medicine, University of Tennessee
Health Sciences Center, Memphis, TN, USA
Hamilton Eye Institute, University of Tennessee
Health Sciences Center, Memphis, TN, USA
e-mail: thollin1@uthsc.edu; xwang17@uthsc.edu;
rdavi122@uthsc.edu; wilawhit@uthsc.edu;
mjablonski@uthsc.edu
R. W. Williams
Department of Medicine, University of Tennessee
Health Sciences Center, Memphis, TN, USA
Hamilton Eye Institute, University of Tennessee
Health Sciences Center, Memphis, TN, USA
Department of Genetics, Genomics, and Informatics,
University of Tennessee Health Sciences Center,
Memphis, TN, USA
e-mail: rwilliams@uthsc.edu
need that has yet to be fulfilled. While models
for AMD and RP do exist, they often require
aging the animals for a year or more, feeding
special diets, or introduction of external mod-
ulators such as exposure to cigarette smoke.
Currently, work is being done to uncover
high-fidelity naturally occurring models of
these retinal diseases with the hope and intent
of providing the vision community the tools it
needs to better understand, treat, and, one day,
cure the patients suffering from these devas-
tating afflictions.
Keywords
Age-related macular degeneration · Retinitis
pigmentosa · Retinal dystrophies · Mouse
models · Retinal degenerations · Preclinical
models
1 Introduction
Retinal neurodegenerative diseases come in mul-
tiple shapes and forms. These can range from dis-
eases like age-related macular degeneration
(AMD) and glaucoma which both lead to irre-
versible blindness but almost exclusively or typi-
cally affect patients in middle to old age to
retinitis pigmentosa (RP) and Leber congenital
amaurosis (LCA) which affect patients from birth

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 371
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_54
372
and often cause complete blindness by adult-
hood. These diseases all have different etiologies
with a strong commonality … each has a genetic
component playing a role in its pathogenesis. In
order to study these diseases, high-fidelity animal
models mimicking the human condition are
essential. The purpose of this review is to discuss
the current state of mouse models in the study of
the retinal diseases AMD and RP concluding
with the advancements being made currently in
enhancing the repertoire of relevant, spontaneous
mouse models of the diseases.
2 Inherited Retinal
Dystrophies (IRDs):
A “Monogenic” Retinal
Degeneration
Many IRDs are classified as RP. RP is typically
initiated by mutations in genes affecting the
health or function of photoreceptors (PRs) or
retinal pigment epithelium (RPE) and has a prev-
alence on roughly 1 in 4000–5000 births [1]. RP
inheritance is diverse, with mutations in over 80
genes known to cause some form of the disease
[2], and these mutations are heritable by all forms
of inheritance (autosomal dominant and autoso-
mal recessive being the most common forms) [3,
4]. Many genes are culpable in RP, with RHO
being the first gene identified [5]. ~10% of all RP
cases are associated with RHO mutations, the
majority of which are dominant [6]. Other genes
involved in phototransduction also cause RP
when mutated including GNAT1, PDE6A,
CNGA1, and others [3].
Many severe RP cases often tamper with the
rod cell morphogenesis, specifically the outer
segment/connecting cilium [3]. These can include
mutations in genes such as CEP290 and RPGR
that are essential for the ciliary formation and
genes involved in ciliary cargo transport like
KIF3A and BBS genes [3]. More severe RPs are
instigated by mutations in genes affecting the
visual cycle such as IRBP, LRAT, or RPE65, as
well as genes responsible for the outer segment
growth and renewal like MERTK [4]. Some RPs
thought to be monogenic have been shown to
T. J. Hollingsworth et al.
have polygenic origins with a specific example of
RDS/ROM1 compound mutations or triallelic
cases of BBS2 and BBS6 [7].
3 Current Mouse Models of RP
Mouse models of RP have been fairly simple to
make. Often, genetically ablating the protein of
interest has provided models of significant value
to the field. Countless examples of these knock-
out (KO) mice exist including those for Rho,
Gnat1, Pde6b, and others [8–12] as well as for
RPE-specific genes such as Rpe65, Lrat, and
Mertk [4, 7, 13–16]. While these models do
exhibit RP-like phenotypes observed in humans,
they are only “true” models of humans bearing
nonsense null mutations and a resultant recessive
RP. To better mimic human RP, researchers have
moved beyond simple genetic ablation into the
generation of mouse models in which the normal
gene is completely replaced with a mutated RP
gene (i.e., X349E, Q344X, and P23H Rho knock-
in mice) or mutating the normal mouse gene
­
using Crispr/Cas9 [1, 6, 17–19].
4 AMD: A Perfect Storm
of Genetic Complexity
and Environmental Stressors
AMD is the leading cause of irreparable blindness
in elderly populations and globally affects between
150 and 200 million individuals with that number
increasing dramatically with time to nearly 300
million by 2040 [20, 21]. The primary risk factor
for AMD is age itself; however, multiple other risk
factors, both modifiable and non-­ modifiable,
include race, sex, diet/weight, smoking, and genet-
ics [21–23]. As diet, smoking, and weight are
modifiable risk factors, work on the genetics
underlying the AMD pathophysiology has gar-
nered much attention. Genes with known risk-
associated alleles for AMD include those
associated with inflammation, oxidative stress,
lipid metabolism, neovascularization, as well as
other physiological pathways, especially those
associated with retinal homeostasis [21–27].
Current Advancements in Mouse Models of Retinal Disease
5 Current Mouse Models
of AMD
Mouse models of AMD have come a long way
but without much advancement. Many of the first
models developed followed the course of aging in
conjunction with monogenic manipulation, per-
turbation using environmental stressors, or both
[23, 25, 28–32]. Due to the strong correlations
between the complement system, oxidative
stress, and obesity/Western diet, many of the cur-
rently available models are those having effectors
in these areas. Among the complement models
are the complement factor H Y402H transgenic
mouse which, when aged to 24 months and fed a
high fat, develops a thickening of Bruch’s mem-
brane, small drusen-like deposits observable by
histology, and upregulation of apolipoproteins
B48 and A1 [25], as well as transgenic comple-
ment factor 3 overexpressing mice and the cluster
of differentiation 46 knockout mice [30, 33].
Some oxidative stress models include superoxide
dismutase (SOD) 1 KO and SOD2 knockdown
mice along with mice exposed to cigarette smoke
toxins. These exhibit AMD phenotypes such as
Bruch’s membrane thickening, RPE stress, and
loss of PR function [28, 29, 34]. Models pertain-
ing to obesity/Western diet include mice lacking
functional apolipoprotein E as well as cluster of
differentiation 36 and receptors for low-density
lipoproteins which all exhibit Bruch’s membrane
thickening and drusen-like deposits [31, 32, 35].
6 Systems Genetics
and the BXD Family of Mice:
The Future of Retinal Disease
Modeling?
While most RD models originate through
genetic manipulation like KOs and KIs, another
family of inbred mice has emerged as a unique
and better model system. The BXD mouse fam-
ily, initiated in 1971 by breeding a C57B/6 J to
a DBA/2 J, has proven its worth as a source of
models of numerous human diseases including
cancer and neurodegeneration [36]. The
DBA/2 J mouse is a model for pigmentary dis-
373
persion glaucoma [37]; thus, one of the first
ocular diseases modeled with the BXD family
was glaucoma [38–40]. Very recently, work has
begun to use systems genetics; much like has
been performed in glaucoma studies with the
BXD mice, to elucidate higher fidelity models
of human AMD. Over 25 of the known genes
that have been correlated to AMD pathogenesis/
progression were analyzed in the over 150 BXD
strains. Of these, 11 genes were observed that fit
the selection criteria chosen for the study: (1)
the gene must have an association to human
AMD; (2) the gene must possess cis-expression
quantitative trait loci (eQTLs) with a logarithm
of the odds (LOD) score above 10 (10 = genome-
wide significance); (3) the gene must show dif-
ferential expression between the founder B6 and
D2 strains; and (4) the genes must bear single
nucleotide polymorphisms (SNPs) in regulatory
or coding regions predicted to have an impact
on the gene product’s structure, function, and/or
expression. Thus far, two strains of mice have
been observed to show significant phenotypical
correlations to human AMD. BXD34 and
BXD38 thus far appear to be possible models of
dry to wet transversion AMD and dry AMD,
respectively. Surprisingly, a strain with rapid
degeneration, BXD32, exhibits an RP-like phe-
notype. All three strains present with typical
anatomical and functional deficits associated
with AMD or RP by optical coherence tomogra-
phy (OCT), funduscopy, fluorescein angiogra-
phy (FA), electroretinography, and optokinetic
nystagmography (Fig. 1).
7 Conclusions
Modeling AMD and RP in mice is necessary for
studying and developing treatments. While no
single model generated to date is 100% ideal at
recapitulating the human disease, many do pro-
vide solid foundations for RP and AMD studies.
The development of the BXD mouse family has
provided the ability to use varying SNP profiles
allowing for higher fidelity models of the human
condition with the ultimate goal of treating and
curing these blinding diseases.
Fig. 1 The BXD mouse family can model AMD and RP.
Most mouse models of require in-depth molecular bio-
logical cloning expertise (RP/AMD) and/or special condi-
tions to display a phenotype (i.e., aging to >12 months of
age, feeding HFD, etc. for AMD). By mining the BXD
family of mice, we have found a strain of mouse exhibit-
ing a possible polygenic RP phenotype spontaneously
occurring (BXD32) and two possible models of AMD,
both dry (BXD38) and dry/wet (BXD34) forms. (a) OCT
analysis shows BXD32 exhibits marked retinal thinning
by 6 months of age while BXD38 and 34 both exhibit
fairly normal retinal structure but display small (BXD34)
and remarkably large (BXD38) drusen-like deposits (
). (b) By funduscopy and FA, hallmark characteristics of
RP including pigment appearing through the neural retina
(*) and attenuated retinal vessels (
). BXD34 displays
hyper-reflective foci ( ) and vascular leakage (#) by
9 months of age, while BXD38 exhibits no vascular
anomalies by 9 months of age while appearing to show
possible lipid deposits ( ). (c) By ERG, both BXD34
and 38 vary little from B6, while BXD32 shows essen-
tially a complete loss of retinal function. (d) OKN exams
revealed little difference between the contrast sensitivities
of BXD34 and 38 compared to B6; however, BXD34
showed a loss of visual acuity with age. BXD32 lacked
both CS and VA compared to all strains in agreement with
the ERG results
Current Advancements in Mouse Models of Retinal Disease 375

References of 11-cis-vitamin A in the retinal visual cycle. Nat.

Genet. 1998;20(4):344–51.
15. Duncan JL, Yang H, Vollrath D, Yasumura D, Matthes
1. Hollingsworth TJ, Hubbard MG, Levi HJ, White W,
MT, Trautmann N, et al. Inherited retinal dystro-
Wang X, Simpson R, et al. Proinflammatory pathways
phy in Mer knockout mice. Adv. Exp. Med. Biol.
are activated in the human Q344X rhodopsin knock-in
2003;533:165–72.
mouse model of retinitis pigmentosa. Biomolecules.
16. Batten ML, Imanishi Y, Maeda T, Tu DC, Moise
2021;11(8)
AR, Bronson D, et al. Lecithin-retinol acyltransfer-
2. Yi Z, Ouyang J, Sun W, Li S, Xiao X, Zhang
ase is essential for accumulation of all-trans-retinyl
Q. Comparative exome sequencing reveals novel can-
esters in the eye and in the liver. J. Biol. Chem.
didate genes for retinitis pigmentosa. EBioMedicine.
2004;279(11):10422–32.
2020;56:102792.
17. Bales KL, Ianov L, Kennedy AJ, Sweatt JD, Gross
3. Hollingsworth TJ, Gross AK. Defective trafficking
AK. Autosomal dominant retinitis pigmentosa rho-
of rhodopsin and its role in retinal degenerations. Int.
dopsin mutant Q344X drives specific alterations in
Rev. Cell Mol. Biol. 2012;293:1–44.
chromatin complex gene transcription. Mol. Vis.
4. Ferrari S, Di Iorio E, Barbaro V, Ponzin D,
2018;24:153–64.
Sorrentino FS, Parmeggiani F. Retinitis pigmentosa:
18. Hollingsworth TJ, Gross AK. Innate and autoimmu-
genes and disease mechanisms. Curr. Genomics.
nity in the pathogenesis of inherited retinal dystrophy.
2011;12(4):238–49.
Cell. 2020;9(3):3.
5. Dryja TP, McGee TL, Hahn LB, Cowley GS, Olsson
19. Orlans HO, Barnard AR, Patricio MI, McClements
JE, Reichel E, et al. Mutations within the rhodopsin
ME, MacLaren RE. Effect of AAV-mediated rho-
gene in patients with autosomal dominant retinitis
dopsin gene augmentation on retinal degeneration
pigmentosa. N. Engl. J. Med. 1990;323(19):1302–7.
caused by the dominant P23H rhodopsin mutation
6. Hollingsworth TJ, Gross AK. The severe autosomal
in a knock-in murine model. Hum. Gene Ther.
dominant retinitis pigmentosa rhodopsin mutant
2020;31(13–14):730–42.
Ter349Glu mislocalizes and induces rapid rod cell
20. Li H, Chintalapudi SR, Jablonski MM. Current drug
death. J. Biol. Chem. 2013;288(40):29047–55.
and molecular therapies for the treatment of atrophic
7. Rivolta C, Sharon D, DeAngelis MM, Dryja
age-related macular degeneration: phase I to phase III
TP. Retinitis pigmentosa and allied diseases: numer-
clinical development. Expert Opin. Investig. Drugs.
ous diseases, genes, and inheritance patterns. Hum.
2017;26(10):1103–14.
Mol. Genet. 2002;11(10):1219–27.
21. Fleckenstein M, Keenan TDL, Guymer RH,
8. Calvert PD, Krasnoperova NV, Lyubarsky AL, Isayama
Chakravarthy U, Schmitz-Valckenberg S, Klaver CC,
T, Nicolo M, Kosaras B, et al. Phototransduction
et al. Age-related macular degeneration. Nat. Rev.
in transgenic mice after targeted deletion of the rod
Dis. Primers. 2021;7(1):31.
transducin alpha -subunit. Proc. Natl. Acad. Sci. U. S.
22. Rho J, Percelay P, Pilkinton S, Hollingsworth TJ,
A. 2000;97(25):13913–8.
Kornblau I, Jablonski MM. An overview of age-­
9. Choi S, Hao W, Chen CK, Simon MI. Gene expres-
related macular degeneration: clinical, pre-clinical
sion profiles of light-induced apoptosis in arrestin/
animal models and bidirectional translation. animal
rhodopsin kinase-deficient mouse retinas. Proc. Natl.
models in medicine and biology. InTechOpen. 2021;1
Acad. Sci. U. S. A. 2001;98(23):13096–101.
23. Al-Zamil WM, Yassin SA. Recent developments in
10. Humphries MM, Rancourt D, Farrar GJ, Kenna P,
age-related macular degeneration: a review. Clin.
Hazel M, Bush RA, et al. Retinopathy induced in
Interv. Aging. 2017;12:1313–30.
mice by targeted disruption of the rhodopsin gene.
24. Gorin MB, da Silva MJ. Predictive genetics for AMD:
Nat. Genet. 1997;15(2):216–9.
hype and hopes for genetics-based strategies for treat-
11. Liang Y, Fotiadis D, Maeda T, Maeda A,
ment and prevention. Exp. Eye Res. 2020;191:107894.
Modzelewska A, Filipek S, et al. Rhodopsin
25. Landowski M, Kelly U, Klingeborn M, Groelle M,
signaling and organization in heterozygote
Ding JD, Grigsby D, et al. Human complement fac-
rhodopsin knockout mice. J. Biol. Chem.
tor H Y402H polymorphism causes an age-related
2004;279(46):48189–96.
macular degeneration phenotype and lipoprotein
12. Huttl S, Michalakis S, Seeliger M, Luo DG, Acar N,
dysregulation in mice. Proc. Natl. Acad. Sci. U. S. A.
Geiger H, et al. Impaired channel targeting and retinal
2019;116(9):3703–11.
degeneration in mice lacking the cyclic nucleotide-­
26. Lederman M, Weiss A, Chowers I. Association
gated channel subunit CNGB1. J. Neurosci.
of neovascular age-related macular degeneration
2005;25(1):130–8.
with specific gene expression patterns in periph-
13. Saari JC, Nawrot M, Kennedy BN, Garwin GG,
eral white blood cells. Invest. Ophthalmol. Vis. Sci.
Hurley JB, Huang J, et al. Visual cycle impairment
2010;51(1):53–8.
in cellular retinaldehyde binding protein (CRALBP)
27. Mansoor N, Wahid F, Azam M, Shah K, den
knockout mice results in delayed dark adaptation.
Hollander AI, Qamar R, et al. Molecular mechanisms
Neuron. 2001;29(3):739–48.
of ­complement system proteins and matrix metallo-
14. Redmond TM, Yu S, Lee E, Bok D, Hamasaki D,
proteinases in the pathogenesis of age-related macular
Chen N, et al. Rpe65 is necessary for production
degeneration. Curr. Mol. Med. 2019;19(10):705–18.
376
28. Espinosa-Heidmann DG, Suner IJ, Catanuto
P, Hernandez EP, Marin-Castano ME, Cousins
SW. Cigarette smoke-related oxidants and the devel-
opment of sub-RPE deposits in an experimental ani-
mal model of dry AMD. Invest. Ophthalmol. Vis. Sci.
2006;47(2):729–37.
29. Justilien V, Pang JJ, Renganathan K, Zhan X,
Crabb JW, Kim SR, et al. SOD2 knockdown mouse
model of early AMD. Invest. Ophthalmol. Vis. Sci.
2007;48(10):4407–20.
30. Lyzogubov VV, Bora PS, Wu X, Horn LE, de Roque
R, Rudolf XV, et al. The complement regulatory pro-
tein CD46 deficient mouse spontaneously develops
dry-type age-related macular degeneration-like phe-
notype. Am. J. Pathol. 2016;186(8):2088–104.
31. Picard E, Houssier M, Bujold K, Sapieha P, Lubell W,
Dorfman A, et al. CD36 plays an important role in the
clearance of oxLDL and associated age-­dependent sub-
retinal deposits. Aging (Albany NY). 2010;2(12):981–9.
32. Rudolf M, Ivandic B, Winkler J, Schmidt-Erfurth
U. Accumulation of lipid particles in Bruch’s mem-
brane of LDL receptor knockout mice as a model of
age-related macular degeneration. Ophthalmologe.
2004;101(7):715–9.
33. Cashman SM, Desai A, Ramo K, Kumar-Singh
R. Expression of complement component 3 (C3) from
an adenovirus leads to pathology in the murine retina.
Invest. Ophthalmol. Vis. Sci. 2011;52(6):3436–45.
34. Imamura Y, Noda S, Hashizume K, Shinoda K,
Yamaguchi M, Uchiyama S, et al. Drusen, choroidal
T. J. Hollingsworth et al.
neovascularization, and retinal pigment epithelium
dysfunction in SOD1-deficient mice: a model of age-­
related macular degeneration. Proc. Natl. Acad. Sci.
U. S. A. 2006;103(30):11282–7.
35. Dithmar S, Curcio CA, Le NA, Brown S, Grossniklaus
HE. Ultrastructural changes in Bruch’s membrane of
apolipoprotein E-deficient mice. Invest. Ophthalmol.
Vis. Sci. 2000;41(8):2035–42.
36. Ashbrook DG, Arends D, Prins P, Mulligan MK, Roy
S, Williams EG, et al. A platform for experimental
precision medicine: the extended BXD mouse family.
Cell Syst. 2021;12(3):235–47. e9
37. Anderson MG, Smith RS, Hawes NL, Zabaleta
A, Chang B, Wiggs JL, et al. Mutations in genes
encoding melanosomal proteins cause pigmen-
tary glaucoma in DBA/2J mice. Nat. Genet.
2002;30(1):81–5.
38. King R, Li Y, Wang J, Struebing FL, Geisert
EE. Genomic locus modulating IOP in the BXD RI
Mouse Strains. G3 (Bethesda). 2018;8(5):1571–8.
39. King R, Struebing FL, Li Y, Wang J, Koch AA, Cooke
Bailey JN, et al. Genomic locus modulating cor-
neal thickness in the mouse identifies POU6F2 as a
potential risk of developing glaucoma. PLoS Genet.
2018;14(1):e1007145.
40. Swaminathan S, Lu H, Williams RW, Lu L, Jablonski
MM. Genetic modulation of the iris transillumina-
tion defect: a systems genetics analysis using the
expanded family of BXD glaucoma strains. Pigment
Cell Melanoma Res. 2013;26(4):487–98.
 Single-Cell Transcriptomic
Profiling of Müller Glia in the rd10
Retina

Duygu Sigurdsson and Christian Grimm

Abstract might arise from a novel immune function of

Müller glia are the principal macroglia of the
retina and support retinal neurons both in
health and disease. In retinitis pigmentosa
(RP), a highly heterogeneous inherited retinal
disorder, the most common form of pathology
involves primary rod degeneration, followed
by secondary cone death. To investigate
Müller glia responses to rod degeneration, we
performed droplet-based single-cell RNA
sequencing in the rd10 mouse model of RP
during primary rod degeneration. We con-
firmed known MG behavior on gliosis, meta-
bolic, and immune functions. Pde6brd10 Müller
glia also exhibited an increased expression of
histocompatibility complex members, which
D. Sigurdsson (*)
Lab for Retinal Cell Biology, Department of
Ophthalmology, University Hospital Zurich,
University of Zurich, Zurich, Switzerland
Center for Integrative Human Physiology, University
of Zurich, Zurich, Switzerland
e-mail: duygu.sigurdsson@iob.ch
C. Grimm
Lab for Retinal Cell Biology, Department of
Ophthalmology, University Hospital Zurich,
University of Zurich, Zurich, Switzerland
Center for Integrative Human Physiology, University
of Zurich, Zurich, Switzerland
Neuroscience Center Zurich, University of Zurich,
Zurich, Switzerland
Müller glia in RP. We also describe a possible
decrease in glial lipid biogenesis, which might
affect degenerating photoreceptors.
Keywords
Single-cell RNA sequencing ·
Transcriptomics · Müller glia · Retinal
degeneration · Retinitis pigmentosa · rd10
mouse model
1 Introduction
Retinitis pigmentosa (RP) is a highly heteroge-
neous inherited retinal degenerative disorder that
is a leading cause of blindness in children and
working-age adults. RP is characterized by pri-
mary rod degeneration, commonly due to a rod-­
specific causative mutation, followed by the
secondary death of cones [7]. The genetic hetero-
geneity of RP complicates the correction of caus-
ative mutations for treatment, e.g., by gene
therapy. In contrast, the common disease patho-
physiology provides an avenue for mutation-­
independent approaches that support
neuroprotection [15].
Müller glia (MG) are the principal macroglia
of the retina and provide various kinds of support
to surrounding photoreceptors, especially cones,
including recycling the cone visual pigment [2,

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 377
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_55
378
25]. MG also release neurotrophic factors for
photoreceptors upon injury [12, 23]. In addition,
MG enter gliosis upon damage [5], partake in
retinal remodeling [18], and contribute to the
microglial response [22]. However, the heteroge-
neity of the retina has so far hindered high-­
throughput studies of changes that occur
specifically in MG during rod degeneration,
which may provide clues as to how MG affect
photoreceptor survival in RP.
2 Materials and Methods
Animal Experimentation Animal maintenance
and experiments were performed according to
the standards of the ARVO Statement for the Use
of Animals in Ophthalmic and Vision Research
and the regulations of the Veterinary Office of
Canton Zürich, Switzerland, under the license
ZH141/2016. rd10 (Pde6brd10/rd10) and C57/BL6
mice were purchased from Jackson Laboratories
(Bar Harbor, USA) and maintained in the
Laboratory Animal Services Center facilities of
the University of Zürich under a 14 h:10 h light to
dark cycle with food and water ad libitum.
Euthanasia was performed with CO2 exposure
and cervical dislocation.
Retina Dissociation and scRNAseq Retinas
were isolated from mice at postnatal day (P) 21
and dissociated with the Worthington Papain
Dissociation System (Worthington, Lakewood,
NJ, USA). Cell viability was assessed with
2 μM calcein-AM (Sigma-Aldrich, St. Louis,
MO, USA) and 3 μM propidium iodide (Sigma-­
Aldrich). Five million cells were fixed with
methanol according to the 10X Genomics pro-
tocol (10X Genomics, Pleasanton, CA, USA)
for scRNAseq. 10,000 cells from each sample
were loaded onto an individual lane of a 10X
Genomics Chromium Single-Cell microfluid-
ics chip using the V3 chemistry (10X
Genomics). Libraries were sequenced on an
Illumina NovaSeq 6000 platform (Illumina,
San Diego, CA, USA) at the Functional
Genomics Center of the University of Zürich/
ETH Zürich.
D. Sigurdsson and C. Grimm
Bioinformatic Analysis Sequencing data were
mapped to the GRCm38.p5 genome assembly
and were converted to a cell-gene matrix with the
Cell Ranger pipeline. Downstream analysis was
performed with Seurat v.3.1 [3]. Only cells with
200–6000 unique genes and 1000–20,000 tran-
scripts were retained. Data was log-normalized
with a scale factor of 10,000 and scaled. 5,000
most highly variable genes with 0.1–8 average
expression and >1 dispersion were selected for
analysis. The first 50 principal components were
used for the k-nearest neighbor graph, and clus-
tering was performed with modularity optimiza-
tion on a shared nearest neighbor graph with
resolution = 0.8. Cell cluster identity was
assigned using known marker gene expression. A
previously published algorithm was used for dou-
blet filtering [9]. A cluster expressing markers for
both MG (e.g., Rlbp1, Glul) and rods (e.g., Sag,
Rho) was considered to be rod-contaminated MG
and excluded from the analysis. Differential gene
expression was analyzed with Seurat, using the
Wilcoxon rank-sum test and Bonferroni correc-
tion. Due to the small size of the dataset, genes
with an adjusted p-value of 0.1 or lower were
considered significant. The dataset containing all
cell types is available in the Gene Expression
Omnibus repository (GSE183206).
3 Results
To study single MG transcriptomes during primary
rod degeneration, we performed single-cell RNA
sequencing (scRNAseq) on the retinas of two rd10
animals and two wild-type controls, one male and
one female each, at P21. After quality control, 269
MG identified by marker gene expression (e.g.,
Glul) were retained for analysis (Fig. 1a).
More MG were isolated from rd10 (206 cells)
than from wild-type retinas (63 cells), with a
comparable ratio of cells originating from males
vs. females (22.8% female for rd10, 23.8% for
wild types). Therefore, we pooled cells from
male and female samples together for further
analyses. rd10 MG expressed more transcripts
and more unique genes than wild-type MG, with
a higher percentage of mitochondrial and ribo-
somal transcripts (Fig. 1b). The increase in these
Fig. 1 Transcriptomic properties of Müller glia in rd10
and wild-type retinas analyzed in this study. (a) Expression
of the MG marker gene Glul at the single-cell level. (b)
Violin plots for the main quality control metrics for cells
Fig. 1 (continued) from each genotype, including the
number of transcripts, unique genes expressed, and per-
centage of mitochondrial (percent.mt) and ribosomal
(percent.ribo) genes in each cell. (c) Volcano plot for dif-
ferentially expressed genes in rd10 MG compared to
wild-type MG. Colored dots refer to genes with an
adjusted p-value <0.1. Labeled genes are expressed with
log2 fold change >0.85. Genes upregulated in rd10 cells
have a positive log2 fold change. UMAP: uniform mani-
fold approximation and projection. wt wild type
380
transcripts may stem from the activation of an
MG response in the rd10 retina that involves
increased levels of mRNA translation and
increased energy metabolism. A possible techni-
cal artifact of high mtDNA and ribosomal con-
tent due to low cell quality in rd10 MG is
countered by their higher transcript count, as low
cell quality is associated with lower transcript
counts [11].
To identify the genes that were differentially
regulated in rd10 MG due to primary rod degen-
eration, we carried out differential gene expres-
sion analysis between rd10 and wild-type glia in
our dataset (Fig. 1c). Unsurprisingly, gliosis-­
associated Gfap was the most highly upregulated
gene in rd10 glia [5]. The upregulation of extra-
cellular matrix protein Cd44, seen during second-
ary cone degeneration in other models of RP
[21], may also contribute to retinal remodeling.
While the increases in leukemia inhibitory factor,
glycoprotein 130, and ciliary neurotrophic factor
receptor were not statistically significant, the lev-
els of cytokine signaling mediator Stat3 and
tumor necrosis factor receptor superfamily mem-
ber Tnfrsf1a were significantly higher in rd10
MG. Similar to the rd1 model of RP, mediators of
the complement system were increased in rd10
MG (C4b, Serping1) [21]. In addition, we found
that several major histocompatibility complex
(MHC) components and regulators (H2-D1, H2-­
K1, B2m, A2m) were also higher in rd10 MG,
potentially indicating an antigen-presenting role
of these cells in the rd10 retina. As in other RP
models [21], rd10 MG upregulated various genes
involved in metal homeostasis and anti-­oxidation,
including Mt1, Mt2, Trf (Fig. 1c), Selenow, and
Msrb2 (not shown). Another support role MG
may play in degeneration is via increased retinol-­
binding protein 1 (Rbp1), which is crucial for the
visual cycle [10] that is also increased in other
forms of retinal injury [17].
The most strongly decreased gene in rd10 MG
was AC149090.1. This gene is an ortholog of
phosphatidylserine decarboxylase (PSD), which
is essential for the biogenesis of phosphatidyl-
ethanolamine (PE) [24]. Various genes involved
in RNA processing (Arglu1, Son, Snrnp70,
Prpf4b, Ddx5, Cirbp) were downregulated in
D. Sigurdsson and C. Grimm
rd10 MG. In addition, the levels of two gene
expression regulators, Auts2 and Pax6, were sig-
nificantly lower in the rd10 MG captured in our
dataset (Fig. 1c). Auts2 activates neuronal gene
expression in the developing brain, where it does
not co-localize with glia [4]. Pax6 is a transcrip-
tion factor expressed in MG, horizontal cells,
amacrine cells, and retinal ganglion cells [20].
4 Discussion
Using scRNAseq on the P21 rd10 retina to study
MG, we were able to confirm certain patterns of
MG response to rod degeneration found in other
models, including gliosis, immune modulation
by release of complement factors, and changes to
iron metabolism [21]. Furthermore, we generated
some novel insight that might be relevant in
understanding glial responses to rod injury in RP.
Multiple MHC-associated transcripts were
increased in rd10 MG (Fig. 1c). In RP models,
studies on antigen-presenting capabilities of glia
focused on microglia [16]. However, there has
been recent evidence both in vitro after lipopoly-
saccharide stimulation [14] and in vivo in an
autoimmune uveoretinitis model [8] that MG
express components of the MHC and may act as
antigen-presenting cells. According to our find-
ings, in the rd10 retina, where the cause of degen-
eration is not directly associated with immunity,
MG might also be performing a similar function.
Not much is known about AC149090.1, the
most downregulated transcript in rd10 MG. If
AC149090.1 encodes a PSD-like protein, its
decrease in the rd10 MG might lead to decreased
production of PE, a major lipid moiety in the
retina. Since MG can process and provide PE to
photoreceptors [19] and photoreceptor lipid com-
position changes in other models of RP [6],
Müller glial changes in PE biogenesis might also
affect photoreceptors. As PE is a docosahexae-
noic acid (DHA) carrier, it is tempting to specu-
late that these changes might contribute to
lowered DHA levels observed in RP [1].
PAX6-positive MG are present in rd10 retinas,
with whole-retinal Pax6 expression comparable
to wild types at P21. With further degeneration,
Single-Cell Transcriptomic Profiling of Müller Glia in the rd10 Retina 381

Pax6 levels increased and some PAX6+ MG 9. Hoang T, Wang J, Boyd P, et al. Gene regulatory
networks controlling vertebrate retinal regenera-
nuclei migrated toward the outer nuclear layer tion. Science. 2020; https://doi.org/10.1126/science.
[13]. Since Pax6 is expressed by various inner abb8598.
retinal cells, a partial or transient decrease might 10. Huang J, Possin DE, Saari JC. Localizations of visual
not be detectable in whole-retinal samples but cycle components in retinal pigment epithelium. Mol
Vis. 2009;15:223–34.
still affect the MG transcriptome. Alternatively, 11. Ilicic T, Kim JK, Kolodziejczyk AA, et al.
migrating PAX6+ MG might differentiate from Classification of low quality cells from single-cell
non-migrating MG enough to “escape” the main RNA-seq data. Genome Biol. 2016;17:29.
MG cluster, while Pax6 levels decrease in the 12. Joly S, Lange C, Thiersch M, et al. Leukemia inhibi-
tory factor extends the lifespan of injured photorecep-
non-migrating MG. Together with Auts2, which tors in vivo. J Neurosci. 2008;28:13765–74.
was not previously described in the retina, these 13. Joly S, Pernet V, Samardzija M, Grimm C. Pax6-­
results are of interest for validation, as they can positive Müller glia cells express cell cycle markers
contribute to our understanding of stem cell-like but do not proliferate after photoreceptor injury in the
mouse retina. Glia. 2011;59:1033–46.
properties of mouse MG. 14. Lorenz L, Hirmer S, Schmalen A, et al. Cell surface
profiling of retinal Müller glial cells reveals associa-
Acknowledgments The authors would like to thank the tion to immune pathways after LPS stimulation. Cell.
Functional Genomics Center Zürich for their excellent 2021;10 https://doi.org/10.3390/cells10030711.
guidance and assistance with scRNAseq. This study was 15. Newton F, Megaw R. Mechanisms of photoreceptor
supported by the Swiss National Science Foundation death in retinitis pigmentosa. Genes. 2020;11 https://
(grant nr. 31003A_173008). doi.org/10.3390/genes11101120.
16. Noailles A, Maneu V, Campello L, et al. Persistent
inflammatory state after photoreceptor loss in an
animal model of retinal degeneration. Sci Rep.
References 2016;6:33356.
17. Otake H, Yamamoto T, Deguchi S, et al. Retinal pro-
1. Berson EL, Rosner B, Sandberg MA, et al. Further teomic evaluation of rats following streptozotocin-­
evaluation of docosahexaenoic acid in patients injection using shotgun proteomics. Mol Med Rep.
with retinitis pigmentosa receiving vitamin A 2020;21:379–86.
treatment: subgroup analyses. Arch Ophthalmol. 18. Phillips MJ, Otteson DC, Sherry DM. Progression
2004;122:1306–14. of neuronal and synaptic remodeling in the rd10
2. Bringmann A, Pannicke T, Grosche J, et al. Müller mouse model of retinitis pigmentosa. J Comp Neurol.
cells in the healthy and diseased retina. Prog Retin 2010;518:2071–89.
Eye Res. 2006;25:397–424. 19. Politi L, Rotstein N, Carri N. Effects of docosahexae-
3. Butler A, Hoffman P, Smibert P, et al. Integrating noic acid on retinal development: cellular and molec-
single-cell transcriptomic data across different con- ular aspects. Lipids. 2001;36:927–35.
ditions, technologies, and species. Nat Biotechnol. 20. Roesch K, Jadhav AP, Trimarchi JM, et al. The tran-
2018;36:411–20. scriptome of retinal Müller glial cells. J Comp Neurol.
4. Gao Z, Lee P, Stafford JM, et al. An AUTS2-­ 2008;509:225–38.
Polycomb complex activates gene expression in the 21. Roesch K, Stadler MB, Cepko CL. Gene expression
CNS. Nature. 2014;516:349–54. changes within Müller glial cells in retinitis pigmen-
5. Gargini C, Terzibasi E, Mazzoni F, Strettoi E. Retinal tosa. Mol Vis. 2012;18:1197–214.
organization in the retinal degeneration 10 (rd10) 22. Todd L, Palazzo I, Suarez L, et al. Reactive microg-
mutant mouse: a morphological and ERG study. J lia and IL1β/IL-1R1-signaling mediate neuropro-
Comp Neurol. 2007;500:222–38. tection in excitotoxin-damaged mouse retina. J
6. Hamano F, Kuribayashi H, Iwagawa T, et al. Mapping Neuroinflammation. 2019;16:118.
membrane lipids in the developing and adult mouse 23. Ueki Y, Le Y-Z, Chollangi S, et al. Preconditioning-­
retina under physiological and pathological con- induced protection of photoreceptors requires acti-
ditions using mass spectrometry. J Biol Chem. vation of the signal-transducing receptor gp130 in
2021;296:100303. photoreceptors. Proc Natl Acad Sci U S A.
7. Hartong DT, Berson EL, Dryja TP. Retinitis pigmen- 2009;106:21389–94.
tosa. Lancet. 2006;368:1795–809. 24. Vance JE, Tasseva G. Formation and function of
8. Heng JS, Hackett SF, Stein-O’Brien GL, et al. phosphatidylserine and ­ phosphatidylethanolamine
Comprehensive analysis of a mouse model in mammalian cells. Biochim Biophys Acta.
of spontaneous uveoretinitis using single-cell 2013;1831:543–54.
RNA sequencing. Proc Natl Acad Sci U S A. 25. Wang J-S, Kefalov VJ. The cone-specific visual cycle.
2019;116:26734–44. Prog Retin Eye Res. 2011;30:115–28.
 Methods for In Vivo
Characterization of Proteostasis
in the Mouse Retina

Yixiao Wang and Ekaterina S. Lobanova

Abstract 1 Introduction

An increasing number of studies connect The cellular proteome is regulated at multiple

inherited and age-related retinal degenerations
with changes in the regulation of proteostasis.
Here, we describe technical aspects of exist-
ing assays allowing to assess the status of the
ubiquitin-proteasome system (UPS), changes
in autophagy, and protein translation in mouse
retina in vivo. These methods are helpful for
the development and testing approaches to
modulate proteostasis and delay vision loss.
levels including protein translation, folding, and
degradation. A number of studies suggest that
alterations in the cellular ability to maintain a
healthy proteome contribute to vision loss [1–7].
Here, we review and show representative exam-
ples for methods allowing assessment of protein
translation and degradation in vivo that were suc-
cessfully used in mouse retina in several recent
studies [1–7].

Keywords
2 Approaches to Assess
Ubiquitin-proteasome system · Autophagy · Proteostasis in Mouse Retina
Protein translation · Proteostasis · Retinal In Vivo
degeneration
2.1 Assessments of UPS
with Genetic Reporters

The efficiency of protein degradation by

ubiquitin-­proteasome system (UPS) can be eval-
uated in vivo using genetic UPS reporters [8–11].
Y. Wang In our previous studies, we took advantage of
Department of Ophthalmology, University of Florida, transgenic mice expressing the ubiquitin-­
Gainesville, FL, USA proteasome reporter UbG76V-GFP (Fig. 1a) [5–7].
E. S. Lobanova (*) This reporter is barely detectable in healthy pho-
Department of Ophthalmology, University of Florida, toreceptor cells of wild-type mice: it is quickly
Gainesville, FL, USA ubiquitinated and targeted to proteasomes for
Department of Pharmacology and Therapeutics, degradation. However, it is accumulated, and its
University of Florida, Gainesville, FL, USA clearance is impaired in photoreceptors of several
e-mail: elobanova@ufl.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 383
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_56
384
Fig. 1 Using UbG76V-GFP reporter for UPS assessments
in photoreceptors. (a) Scheme for degradation of dam-
aged proteins and UbG76V-GFP reporter by UPS. Part of
the scheme is created with BioRender.com. (b) UbG76V-­
GFP reporter fluorescence (green) in 20 μm frozen retinal
cross sections of WT and heterozygote RhoP23H/WT knock-
­in mice. Rod outer segments were stained with wheat
germ agglutinin (WGA) conjugated to Alexa Fluor 555
(red). The scale bar is 25 μm. (c) Western blot detection of
the UbG76V-GFP sensor in whole retina lysates (30 μg per
lane) from mice of indicated genotypes with the anti-GFP
antibodies (A11122, Invitrogen; 1:10,000) using ECL
mouse models of retinal degeneration [6, 7, 12,
13]. Impaired clearance of UbG76V-GFP was
observed in rods of transgenic mice expressing
human P23H rhodopsin mutant, heterozygote
P23H rhodopsin knock-in mice, two strains of
rod transducin gamma knockout mice, and rods
of peripherin and rhodopsin knockout mice [5–
7]. Other groups reported changes in the levels of
this reporter in retinas of BBS5 and Lrat knock-
out mice [12, 13].
The level of reporter UbG76V-GFP is set by the
balance between its synthesis and degradation.
The rate-limiting steps for processing ubiquiti-
nated proteins in the diverse mouse models men-
tioned above are currently unknown. It is
unknown which specific changes in degenerating
rods could delay clearing of UbG76V-GFP reporter
and whether they are the same in these mice.
However, these observations point to some kind
of UPS insufficiency as a potential stress factor
present in the degenerating photoreceptors and
encourage the development of tools to stimulate
Y. Wang and E. S. Lobanova
detection. The ECL Prime Blocking Reagent (RPN418,
GE Healthcare Life Sciences) was used to block mem-
branes. The extracts obtained from littermates negative for
UbG76V-GFP transgene were used to control for antibody
specificity. A nonspecific band detected with anti-GFP
antibody is marked as “ns band.” Extracts from retinas of
reporter expressing rod transducin gamma knockout (Gγ1
KO [5]) mouse were run on the same gel as an additional
control. (d) The quantification plot for density bands of
the reporter is shown as a percentage of the average signal
in WT/UbG76V-GFP mice. Rabbit antibodies against Hsc70
protein (ADI-SPA-819) were from Enzo Life Sciences
the degradation of ubiquitinated proteins to delay
vision loss.
The UbG76V-GFP reporter can be detected with
confocal microscopy in frozen retinal sections or
agarose cross sections prepared using standard
protocols [6, 7, 14]. In a typical experiment
shown in Fig. 1b, the samples from evaluated
(heterozygote P23H knock-in mouse [15]) and
wild-type mice expressing UbG76V-GFP reporter
were processed together. The sections prepared
from wild-type mice were used to optimize imag-
ing settings (e.g., gain, laser power) allowing
reliable detection of fluorescent signal. The same
settings (laser intensity, gain, z-stack values)
were then used to collect images from heterozy-
gote P23H knock-in mouse. Retinal sections pre-
pared from mice that did not express reporter
could be used to control for autofluorescence.
The imaging studies were supplemented with
Western blotting analysis to confirm and quantify
reporter changes. Retinal extracts from mice that
do not express reporter were used to control for
Methods for In Vivo Characterization of Proteostasis in the Mouse Retina 385

antibody specificity. For example, the set of pri- in the levels of LC3-II in comparison with unin-
mary/secondary antibodies used in the experi- jected mice (Fig. 2b, c), confirming that it exerts
ment shown in Fig. 1c detected two nonspecific sufficient inhibitory effects as expected. The
bands (marked as “ns”). The blots of retinal injection and Western blotting procedures should
lysates prepared from mice expressing reporter be optimized in the case of inefficient inhibition
displayed two additional bands. One of the bands, or high variability between samples.
migrating under 37 kDa, corresponded to UbG76V-­ Western blot quantification (Fig. 2c) showed
GFP reporter. The second band, representing the that the CQ-induced LC3-II increase (reflecting
non-proteolyzed nonfluorescent xGFP fragment, the autophagy flux and abbreviated ΔLC3-II) in
migrated around 25 kDa [9]. The quantification control and experimental groups are indistin-
of density plots for UbG76V-GFPreporter (Fig. 1d) guishable from one another and the basal level of
complements the fluorescence imaging findings autophagy (continuous formation of phago-
for heterozygote P23H knock-in mice (Fig. 1b) somes) is not affected. Other commonly used
and together shows impaired clearance of the autophagy markers and assays could be used to
reporter. gain additional insights and are discussed else-
where [16].
The autophagy flux measurements could be
2.2 Autophagy Flux performed using immunodetection of LC3 in
Measurements retinal cross sections or detection of the fluores-
cently tagged LC3 protein in LC3-GFP trans-
The basal activity of the autophagy-lysosomal genic mice [3, 17]. Similarly, the fluorescent
pathway is responsible for the continuous degra- approach to measure autophagy flux relies on
dation of cytoplasmic material. One of the key analyzing the change in the number of phago-
steps of phagosome maturation is coordinated by somes caused by treatment with autophagy inhib-
conjugation of LC3 protein (microtubule-­ itors. It requires accurate controls for consistency
associated protein 1A/1B-light chain 3) to phos- of image collection, data analysis, and sample
phatidylethanolamine. The lipidated form of LC3 processing.
protein is abbreviated as LC3-II and non-­lipidated
as LC3-I (Fig. 2a). The changes in the basal abil-
ity of cells to form phagosomes (autophagic flux) 2.3 Assessments of Protein
could be assessed by analyzing the accumulation Translation
of LC3-II in the presence of an autophagy inhibi-
tor [16]. In the retina, this approach was pio- The adaptational changes in protein translation
neered and validated by Dr. David Zacks [3, 4]. can be efficiently assessed using SUnSET (sur-
In one of the ongoing projects shown in face sensing of translation) method [18]. This
Fig. 2b, we noticed slightly elevated levels of method is based on the ability of puromycin to
LC3-I/LC3-II markers in the sets of experimental incorporate into growing polypeptide chains
(Exp) animals compared to controls (Cntr). (Fig. 3a). Incorporated puromycin is detected by
Therefore, to seek differences in the autophagy-­ Western blotting with anti-puromycin antibodies.
lysosomal system between the groups, we per- Changes in the intensity of puromycin staining
formed autophagy flux measurements. To this are shown to be indicative of the efficiency of
end, animals from both groups were given an protein translation, and overall, this method is
intraperitoneal injection of autophagy inhibitor, shown to be as sensitive in translation studies as a
chloroquine (CQ). An accumulation of LC3-II conventional radioactive method. The use of this
was studied several hours postinjection and com- method in the retina was pioneered by Dr. Marina
pared by Western blotting with uninjected mice. Gorbatyuk [1, 2].
Efficient injection of autophagy inhibitor In a typical experiment, mice are intraperito-
should result in a statistically significant increase neally injected with puromycin solution, their
386
Fig. 2 Autophagy flux assessments. (a) Scheme of
phagosome formation and fusion with lysosomes demon-
strating autophagy flux assessments. (b, c) Western blots
and quantification of comparative changes in LC3 mark-
ers in retinal lysates (30 μg per lane) caused by chloro-
quine (CQ) injections 4 h prior to the retina collection.
Fig. 3 Protein translation assessments. (a) Scheme dem-
onstrating a puromycin-based approach for protein trans-
lation assessments. Part of the scheme is created with
BioRender.com. (b, c) Puromycin staining of Western blot
membranes and quantification of density profiles of reti-
nal lysates (40 μg of protein per lane) prepared from mice
injected 30 min prior to the analysis with 50–100 μl of
puromycin (0.04 μmol/g body weight) dissolved in
PBS. Retinal lysates from uninjected mice were used to
control for nonspecific properties of the anti-puromycin
antibody. (d) Western blot membranes for the same sam-
ples as in panel (b) were stained with secondary antibod-
ies only and imaged using the same settings. Samples
retinas are collected 30 min after injections, and
following solubilization, the lysates are immedi-
ately analyzed by Western blotting. Samples pre-
pared from uninjected mice are run on the same
gel to identify puromycin-labeled polypeptides.
In a typical experiment, we detected four
prominent nonspecific bands in the 35–75 kDa
region (Fig. 3b). The same bands were recog-
Y. Wang and E. S. Lobanova
Data are normalized on the average density of LC3-II in
untreated control group. Rabbit antibodies against LC3
protein (1:10,000) were from Cell Signaling Technology
(4108) and anti-beta actin antibodies (MA5-15739-D800)
were from Invitrogen
were blocked in TBST (20 mM Tris-HCl, pH 8.0, 0.1%
Tween-20) solution containing 5% of ECL Prime
Blocking Reagent (RPN418, GE Healthcare Life
Sciences). Puromycin-modified proteins were detected
using primary mouse anti-puromycin (MABE343, EMD
Millipore,1:10,000) and secondary HRP-conjugated anti-­
mouse IgG2a (115-035-206, Jackson Immuno Research
Laboratories) chosen based on the previous studies [2,
18]. Enhanced chemiluminescent reactions were devel-
oped using ProSignal Pico ECL reagent (20–300, Genesee
Scientific). ECL signal for puromycin blots required pro-
longed ~10-min exposure. Protein bands were visualized
with the ChemiDoc Imager system (Bio-Rad Laboratories)
nized in experiments performed with secondary
antibodies only (Fig. 3c). The retinas of
puromycin-­treated mice show additional staining
which was not present in uninjected mice and
most likely correspond to puromycin-modified
peptide chains (Fig. 3b).
The proteins that correspond to four middle-­
range nonspecific bands are unknown; it is
Methods for In Vivo Characterization of Proteostasis in the Mouse Retina
unclear why they become darker in the
puromycin-­injected mice (Fig. 3b). Therefore, to
present data we plotted density profiles of lanes
and avoided quantification of the total lane den-
sity (Fig. 3c).
Reagents and conditions giving the best results
in our hands are listed in the figure legend, but we
cannot exclude the possibility that other block-
ing/developing reagents might perform better
and increase signal or decrease nonspecific back-
ground. It is worth noting that the ECL signal
from the puromycin-labeled proteins is weak and
requires prolonged exposure (10–15 min).
To conclude, we hope that detailed technical
aspects of execution and data analysis of in vivo
proteostasis assays will aid the readers with the
incorporation of these methods into their own
studies. Due to the limited space, we were not
able to cite all relevant literature.
Acknowledgments This work was supported by the
National Institutes of Health grants EY030043 (E.S.L.)
and S10D028476, the University of Florida startup funds
(E.S.L.), and an unrestricted grant from Research to
Prevent Blindness Foundation to the Department of
Ophthalmology of the University of Florida.
References
1. Saltykova IV, Elahi A, Pitale PM, Gorbatyuk OS, Athar
M, Gorbatyuk MS. Tribbles homolog 3-­ mediated
targeting the AKT/mTOR axis in mice with retinal
degeneration. Cell Death Dis. 2021;12(7):664.
2. Starr CR, Pitale PM, Gorbatyuk M. Translational
attenuation and retinal degeneration in mice with
an active integrated stress response. Cell Death Dis.
2018;9(5):484.
3. Qiu Y, Yao J, Jia L, Thompson DA, Zacks
DN. Shifting the balance of autophagy and pro-
teasome activation reduces proteotoxic cell
death: a novel therapeutic approach for restor-
ing photoreceptor homeostasis. Cell Death Dis.
2019;10(8):547.
4. Yao J, Qiu Y, Frontera E, Jia L, Khan NW, Klionsky
DJ, et al. Inhibiting autophagy reduces retinal degen-
eration caused by protein misfolding. Autophagy.
2018;14(7):1226–38.
5. Dexter PM, Lobanova ES, Finkelstein S, Arshavsky
VY. Probing proteostatic stress in degenerating pho-
387
toreceptors using two complementary in vivo report-
ers of proteasomal activity. eNeuro. 2020;7(1):ENE
URO.0428-19.2019.
6. Lobanova ES, Finkelstein S, Li J, Travis AM, Hao Y,
Klingeborn M, et al. Increased proteasomal activity
supports photoreceptor survival in inherited retinal
degeneration. Nat Commun. 2018;9(1):1738.
7. Lobanova ES, Finkelstein S, Skiba NP, Arshavsky
VY. Proteasome overload is a common stress factor in
multiple forms of inherited retinal degeneration. Proc
Natl Acad Sci U S A. 2013;110(24):9986–91.
8. Salomons FA, Verhoef LG, Dantuma NP. Fluorescent
reporters for the ubiquitin-proteasome system. Essays
Biochem. 2005;41:113–28.
9. Dantuma NP, Lindsten K, Glas R, Jellne M, Masucci
MG. Short-lived green fluorescent proteins for quan-
tifying ubiquitin/proteasome-dependent proteolysis in
living cells. Nat Biotechnol. 2000;18(5):538–43.
10. Dantuma NP, Bott LC. The ubiquitin-proteasome
system in neurodegenerative diseases: precipitating
factor, yet part of the solution. Front Mol Neurosci.
2014;7:70.
11. Lindsten K, Menendez-Benito V, Masucci MG,
Dantuma NP. A transgenic mouse model of the
ubiquitin/proteasome system. Nat Biotechnol.
2003;21(8):897–902.
12. Liu YP, Tsai IC, Morleo M, Oh EC, Leitch CC, Massa
F, et al. Ciliopathy proteins regulate paracrine signal-
ing by modulating proteasomal degradation of media-
tors. J Clin Invest. 2014;124(5):2059–70.
13. Xu H, Enemchukwu N, Zhong X, Zhang O, Fu
Y. Deletion of M-opsin prevents M cone degeneration
in a mouse model of Leber congenital amaurosis. Am
J Pathol. 2020;190(5):1059–67.
14. Lobanova ES, Finkelstein S, Song H, Tsang SH,
Chen CK, Sokolov M, et al. Transducin transloca-
tion in rods is triggered by saturation of the GTPase-­
activating complex. J Neurosci. 2007;27(5):1151–60.
15. Sakami S, Maeda T, Bereta G, Okano K, Golczak M,
Sumaroka A, et al. Probing mechanisms of photo-
receptor degeneration in a new mouse model of the
common form of autosomal dominant retinitis pig-
mentosa due to P23H opsin mutations. J Biol Chem.
2011;286(12):10551–67.
16. Klionsky DJ, Abdelmohsen K, Abe A, Abedin
MJ, Abeliovich H, Acevedo Arozena A, et al.
Guidelines for the use and interpretation of assays
for monitoring autophagy (3rd edition). Autophagy.
2016;12(1):1–222.
17. Mizushima N. Methods for monitoring autophagy
using GFP-LC3 transgenic mice. Methods Enzymol.
2009;452:13–23.
18. Goodman CA, Hornberger TA. Measuring pro-
tein synthesis with SUnSET: a valid alternative
to traditional techniques? Exerc Sport Sci Rev.
2013;41(2):107–15.
 Absence of PRCD Leads
to Dysregulation in Lipid
Homeostasis Resulting
in Disorganization
of Photoreceptor Outer Segment
Structure
Sree I. Motipally and Saravanan Kolandaivelu
Abstract
The outer segments of photoreceptors are spe-
cialized sensory cilia crucial for light detec-
tion. Any disruption that alters outer segment
morphology can impair photoreceptor func-
tion and therefore vision. Progressive rod-­
cone degeneration (PRCD) is an integral
membrane protein exclusively present in the
photoreceptor OS with an unknown function.
Multiple mutations in PRCD are linked with
retinitis pigmentosa. The most common
PRCD mutation observed in both human and
multiple dog breeds, PRCD-C2Y, lacks the
lipid modification “palmitoylation,” which is
crucial for protein stability and trafficking to
the OS. Previous studies including ours show
impaired disc morphogenesis and rhodopsin
distributions in the absence of PRCD, but the
precise role of PRCD in maintaining OS struc-
ture and function remains unclear. In this
chapter, we discuss the potential role of PRCD
S. I. Motipally
Departments of Neuroscience and Biochemistry,
Robert C. Byrd Health Sciences Centre, WVU Eye
Institute, Morgantown, WV, USA
S. Kolandaivelu (*)
Departments of Ophthalmology, Visual Sciences and
Biochemistry, Robert C. Byrd Health Sciences
Centre, WVU Eye Institute, Morgantown, WV, USA
e-mail: kolandaivelus@hsc.wvu.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_57
in the maintenance of photoreceptor OS struc-
tural and functional integrity.
Keywords
PRCD · Photoreceptor · Palmitoylation · Disc
membrane · ApoA1 · Lipid homeostasis ·
Phospholipids · Rhodopsin densities ·
Retinitis pigmentosa
1 Introduction
Retinal photoreceptor (PR) neurons possess a
unique outer segment (OS), which is a modified
cilium containing over 1000 flattened and closely
apposed double membranous structures called
discs. These discs contain many phototransduc-
tion proteins including opsins crucial for convert-
ing light into electrical signals. On a daily basis,
one-tenth of these discs are phagocytosed at the
apex by retinal pigment epithelium and perfectly
replaced by addition of new discs at the OS base
[23]. Disturbances to either processes can lead to
impaired visual function and PR degeneration [8,
10]. The maintenance of OS including disc for-
mation and maturation are carried out by con-
certed actions of multiple proteins and lipids. A
proteomic study demonstrated that there are 11
proteins that are found to be strongly associated
389
390
with the disc membrane, including progressive
rod-cone degeneration (PRCD) linked with
retinitis pigmentosa (RP) [17]. PRCD is a
­ absence or defect in OS resident proteins can dis-
54-amino acid long protein that is highly concen-
trated at the PR OS base and plays a critical role
in OS disc morphogenesis [3, 16, 18]. Six muta-
tions in PRCD, including C2Y, R17C, R18X,
R22X, P25T, and V30M, are associated with RP
in humans. Our sequence-based prediction analy-
sis suggested the presence of several structural
domains that include transmembrane helices (aa
3–15), polybasic region (aa 16–18), and 2 poten-
tial phosphorylation sites (aa 37 and 45 in
humans; 38 and 46 in mice). We have previously
shown that PRCD undergoes palmitoylation on
the sole cysteine residue (Cys2) and demon-
strated that this lipid modification is crucial for
protein stability and OS trafficking [15]. The
non-palmitoylated PRCD-C2Y mutant protein is
highly unstable and mistargeted to the PR inner
segment [15]. Previous studies in canine PRCD-­
C2Y models show ~35–45% reduction in disc
renewal rates; however, studies in PRCD-KO
mice suggest attenuated rates of both disc renewal
and phagocytosis [1, 3]. Animal models with
complete absence of PRCD in the OS and models
expressing PRCD-C2Y mutant both show disor-
ganized OS and vesicular profiles [1, 16, 18].
Furthermore, previous studies also show that
PRCD interacts with rhodopsin and this interac-
tion is crucial for its stability as evidenced by its
complete absence in rhodopsin knockout murine
models [19]. However, the precise function of
PRCD’s interaction with rhodopsin and its role in
the maintenance of PR OS structural and func-
tional integrity remain obscure. In this chapter,
we demonstrate that absence of PRCD affects OS
disc membrane lipid homeostasis, which likely
underlies the structural defects observed in OS.
2 PRCD Is Essential
for Photoreceptor Outer
Segment Maintenance
Structural integrity of PR OS is of prime impor-
tance for efficient phototransduction that under-
lies normal vision. Most inherited retinal
degenerations arise from molecular defects that
S. I. Motipally and S. Kolandaivelu
affect the structural and functional properties of
the OS. Previous studies show that complete
rupt OS integrity and ultimately lead to retinal
degeneration [11]. Early studies on canine
PRCD-C2Y models showed abnormal OS
renewal rates, lamellar disorientation, vesicular
profiles, and reduced electroretinogram (ERG)
responses [1, 2]. A recent study reported normal
visual responses in the absence of PRCD, sug-
gesting no changes in rhodopsin packaging den-
sities [18]. In contrast, we showed that
PRCD-deficient retina show ~30% attenuation in
visual responses under bright light conditions.
More importantly, our atomic force microscopy
studies demonstrate altered rhodopsin packaging
densities and distribution in the OS disc mem-
branes of PRCD-KO retina. Interestingly, previ-
ous studies on rhodopsin overexpression and
heterozygous rhodopsin mutants show normal
rhodopsin packaging densities [13, 22].
Additionally, although the rhodopsin mRNA lev-
els did not differ between wild-type and PRCD
knockout animals at P30 and P120, we observed
a 20% decrease in total rhodopsin protein levels
at P120 [16]. Expression levels of rhodopsin are
previously shown to have a direct effect on OS
length, disk diameters, and incisure depth [13,
14]. Taken together, these data suggest a potential
role for PRCD in regulating opsin densities
within the discs which thereby contributes to nor-
mal OS structure and function. Disorganization
of OS disc membranes and progressive loss of
retinal function in PRCD-deficient retinas dem-
onstrate that PRCD is essential for maintaining
normal OS structure and function. However, the
exact role of PRCD in OS structural maintenance
and why PRs degenerate in the absence of PRCD
remains unknown.
3 Phenotypic Variations
in Different PRCD Mutant
Animal Models
Complete PRCD knockouts from three indepen-
dent studies show disorganization of PR disc
membranes and slow progressive degeneration
[3, 16, 18]. However, some morphological and
Absence of PRCD Leads to Dysregulation in Lipid Homeostasis Resulting in Disorganization… 391

functional variations were observed across these previously shown to be critical for intraretinal
models, such as presence or absence of extracel- reverse transport of lipids and cholesterol homeo-
lular vesicles (EVs) in the interphotoreceptor stasis [20]. Additionally, we also observed accu-
matrix (IPM), attenuated or normal visual mulation of neutral lipids in the inner segments
responses with age, and different rates of PR of PRCD-C2Y retina at P200 which also sug-
degeneration suggesting a potential genetic het- gests dysregulated lipid metabolism (data not
erogeneity. In contrast to PRCD-KO mice, PRCD-­ shown). Based on this information, we hypothe-
C2Y knock-in mutant models do not exhibit sized that PRCD is crucial for maintaining PR
attenuated visual responses until after 6 months disc membrane lipid homeostasis and likely an
of age (data not shown). In addition, while the altered membrane lipid composition underlies
ultrastructure of PRCD-C2Y mutant retina shows the structural defects observed in PRCD mutant
presence of vesicles under PR OS base, however, animal models. To test this hypothesis, we inves-
in contrast to the observations made in PRCD KO tigated complete lipid profile in our PRCD-KO
mice models, the presence of EVs in the IPM was and PRCD-C2Y mice along with age-matched
sparse. Nevertheless, our unpublished data wild-type retina by proteomic analysis using
from murine PRCD-C2Y retina displayed lamel- mass spectrometry (LC-MS/MS). Various studies
lar disorientation and vesicular profiles, in con- suggest that dysregulation of lipid and choles-
sistence with canine C2Y models [1]. Although terol homeostasis is one of the mechanisms driv-
several studies in canine PRCD-C2Y and murine ing PR dysfunction in retinal degenerative
PRCD-KO models demonstrate the critical role diseases including RP [12, 21]. Lipidomic analy-
of PRCD in maintaining PR health, the precise sis of PRCD-C2Y retinas at P30 revealed
role of PRCD in supporting PR structure and decreased levels of phosphatidylethanolamine
function remains elusive. (PE), phosphatidylserine, phosphatidyl glycerol,
and phosphatidic acid (PA) when compared to
WT controls (Fig. 2a). Interestingly, only PE and
4 Retina Lacking PRCD Exhibit PA levels were reduced in PRCD-KO retinas.
Altered Membrane Lipid Although no significant changes in the levels of
Composition various phospholipids were observed at P120,
both PRCD-C2Y and PRCD-KO retinas show
Membrane phospholipid and cholesterol levels higher levels of docosahexaenoic acid (DHA)
are tightly regulated in the neural retina. The OS (Fig. 2b) (Motipally and Kolandaivelu in prep).
disc membranes are composed of phospholipids DHA is the most abundant polyunsaturated fatty
(90–95%), sphingolipids (1%), and cholesterol acid present in the OS that is crucial for visual
(4–6%) in certain proportions that provide the function and PR survival [4]. Elevated DHA in
structural and functional integrity needed for effi- PRCD-KO and C2Y mice at P120 is intriguing
cient phototransduction [9]. The accumulation of and warrants further investigation as previous
EVs and the presence of vesicular profiles in the studies in canine PRCD-C2Y models report
IPM of PRCD-KO and canine PRCD-C2Y reti- lower levels of plasma DHA when compared to
nas, respectively, suggest impaired membrane wild-type controls [5]. Furthermore, studies on
lipid homeostasis that can lead to disrupted OS rds/peripherin and P23H rhodopsin mutant mice
disc membrane integrity [1, 18] (Motipally and also show low DHA levels in rod OS [6, 7].
Kolandaivelu in prep). Interestingly, our co-­ Overall, our observations along with previous
immunoprecipitation followed by mass spec- findings suggest that PRCD deficiency alters the
trometry (Fig. 1a, Table 1) and cell culture studies OS disc lipid homeostasis, which likely underlies
using transiently expressed PRCD and apolipo- the observed defects in rhodopsin packaging den-
protein A1 (ApoA1) plasmids (Fig. 1b) shows sities and impaired OS morphology in PRCD-­
that PRCD binds with ApoA1. ApoA1 has been deficient retinas.
392 S. I. Motipally and S. Kolandaivelu

PRCD-IP IgG-IP

nd

nd
u

ou
bo

te

te
Un l
ta

b
kDa X X X

Elu
u

Un
To

El
15
PRCD

25 ApoA1
100 PDE6

50 β tubulin

WT-PRCD + WT-PRCD +
WT-PRCD Apo-A1 NMNAT1
T U E T U E T U E
29 kD
FLAG-IB
26kD

HA-IB 15 kD

Fig. 1 PRCD interacts with Apolipoprotein A1. (a)
Co-immunoprecipitation of PRCD and ApoA1 from P30
wild-type retinal lysate is performed using affinity-­
purified PRCD antibody coupled with protein A/G beads.
Immunoblots were probed with antibodies as indicated
(lanes #1, 2, 4). Similarly, control IP is done using rabbit
IgG as indicated (lanes #6, 8). As controls, we used PDE6
and β-tubulin (n = 3). (b) PRCD-ApoA1 interaction was
further analyzed in HEK-293 T cells. Transiently
expressed PRCD (HA tagged) and ApoA1 (FLAG tagged)
were co-immunoprecipitated using HA beads and ana-
lyzed by immunoblotting using antibodies as indicated.
We used lysates from HEK-293T cells co-transfected with
PRCD-WT alone and flag-tagged NMNAT1 (~29kD)
with PRCD-WT plasmid (n = 3) as controls. (T total, UB
unbound, E elute)

Table 1 PRCD interacts with ApoA1 as identified by PRCD Co-IP followed by LC-MS/MS from retinal extracts
Protein ID Coverage Peptide PSM MW
Apolipoprotein-A1 25% 6 11 ~26 kD

5 Conclusions and Future lipid composition may contribute to the rhodop-

Directions sin packaging defects as well as EV accumula-
tion observed, ultimately resulting in disorganized
Several studies on PRCD-C2Y- and PRCD-­ PR OS structure and function. While significant
deficient models demonstrate impaired disc mor- progress has been made in our understanding
phogenesis and visual responses [1, 3, 16, 18]. about the importance of PRCD, there are many
We previously showed that PRCD plays a critical questions that remain to be addressed. Our future
role in regulating rhodopsin packaging densities focus includes the following: (1) investigating
within OS discs which is crucial for achieving why PRCD is exclusively present in the PR disc
normal OS structure and function [16]. The pres- membranes, (2) studying the importance of sev-
ent study shows that absence of PRCD in the PR eral predicted structural domains and their roles,
OS alters membrane lipid composition in both particularly mutations affecting palmitoyl lipid
PRCD-KO and PRCD-C2Y mice models. We modification and mutations in polybasic region
believe the observed alterations in membrane that are linked with RP, and (3) investigating how
Absence of PRCD Leads to Dysregulation in Lipid Homeostasis Resulting in Disorganization…
Fig. 2 Absence of PRCD in the photoreceptor OS alters
membrane lipid composition. Retina samples from WT,
PRCD-KO, and PRCD-C2Y from postnatal ages 30 and
120 were used to analyze complete lipid profile by LC-­
MS/MS. (a) Relative levels of different phospholipids
(PS, PG, PE, and PA) are indicated in picomoles per ret-
do some PRs eventually achieve normal OS
structure in the absence of PRCD.
References
1. Aguirre G, Alligood J, O’Brien P, et al. Pathogenesis
of progressive rod-cone degeneration in miniature
poodles. Invest Ophthalmol Vis Sci. 1982;23:610–30.
393
ina. (b) No changes were observed in DHA levels at P30
(Bi), but significant increase in DHA levels is seen in
PRCD mutant retinas at P120 (Bii). Groups were com-
pared using a two-way ANOVA and a post hoc t-test. Data
are presented as mean ± SD (n = 4; *p < 0.05, **p < 0.02;
***p < 0.001)
2. Aguirre G, O’Brien P. Morphological and biochemi-
cal studies of canine progressive rod-cone degenera-
tion. 3H-Fucose autoradiography. Invest Ophthalmol
Vis Sci. 1986;27:635–55.
3. Allon G, Mann I, Remez L, et al. PRCD is concen-
trated at the base of photoreceptor outer segments and
is involved in outer segment disc formation. Hum Mol
Genet. 2019;28:4078–88.
4. Alvarez RA, Aguirre GD, Acland GM, et al.
Docosapentaenoic acid is converted to docosahexae-
noic acid in the retinas of normal and prcd-affected
394
miniature poodle dogs. Invest Ophthalmol Vis Sci.
1994;35:402–8.
5. Anderson E, Aude M. Plasma lipid abnormalities
in the miniature poodle with progressive rod-cone
degeneration. Exp Eye Res. 1991;52:349–55.
6. Anderson RE, Maude MB, Bok D. Low docosahexae-
noic acid levels in rod outer segment membranes of
mice with rds/peripherin and P216L peripherin muta-
tions. Invest Ophthalmol Vis Sci. 2001;42:1715–20.
7. Anderson RE, Maude MB, McClellan M, et al. Low
docosahexaenoic acid levels in rod outer segments of
rats with P23H and S334ter rhodopsin mutations. Mol
Vis. 2002;8:351–8.
8. Buyukmihci N, Aguirre G, Marshall J. Retinal degen-
erations in the dog II. Development of the retina in
rod-cone dysplasia. Exp Eye Res. 1980;30:575–91.
9. Giusto NM, Pasquaré SJ, Salvador GA, et al. Lipid
second messengers and related enzymes in vertebrate
rod outer segments. J Lipid Res. 2010;51:685–700.
10. Goldman AI, O’Brien PJ. Phagocytosis in the reti-
nal pigment epithelium of the RCS rat. Science.
1978;201:1023–5.
11. Haeri M, Knox BE. Rhodopsin mutant P23H destabi-
lizes rod photoreceptor disk membranes. PLoS One.
2012;7(1):e30101.
12. Hamano F, Kuribayashi H, Iwagawa T, et al. Mapping
membrane lipids in the developing and adult mouse
retina under physiological and pathological con-
ditions using mass spectrometry. J Biol Chem.
2021;296:100303.
13. Liang Y, Fotiadis D, Maeda T, et al. Rhodopsin sig-
naling and organization in heterozygote rhodopsin
knockout mice. J Biol Chem. 2004;279:48189–96.
14. Makino CL, Wen XH, Michaud NA, et al. Rhodopsin
expression level affects rod outer segment mor-
phology and photoresponse kinetics. PLoS One.
2012;7:e37832.
S. I. Motipally and S. Kolandaivelu
15. Murphy J, Kolandaivelu S. Palmitoylation of pro-
gressive rod-cone degeneration (PRCD) regulates
protein stability and localization. J Biol Chem.
2016;291:23036–46.
16. Sechrest ER, Murphy J, Senapati S, et al. Loss of
PRCD alters number and packaging density of rho-
dopsin in rod photoreceptor disc membranes. Sci Rep.
2020;10:1–12.
17. Skiba NP, Spencer WJ, Salinas RY, et al. Proteomic
identification of unique photoreceptor disc com-
ponents reveals the presence of PRCD, a protein
linked to retinal degeneration. J Proteome Res.
2013;12:3010–8.
18. Spencer WJ, et al. PRCD is essential for high-fidelity
photoreceptor disc formation. Proc Natl Acad Sci.
2019;96(116):13087–96.
19. Spencer WJ, Pearring JN, Salinas RY, et al.
Progressive rod-cone degeneration (PRCD) protein
requires N-terminal S-acylation and rhodopsin bind-
ing for photoreceptor outer segment localization and
maintaining intracellular stability. HHS Public Access
Biochem. 2016;55:5028–37.
20. Tserentsoodol N, Gordiyenko NV, Pascual I, et al.
Intraretinal lipid transport is dependent on high den-
sity lipoprotein-like particles and class B scavenger
receptors. Mol Vis. 2006;12:1319–52.
21. Van der Veen JN, Kennelly JP, Wan S, et al. The
critical role of phosphatidylcholine and phos-
phatidylethanolamine metabolism in health
and disease. Biochim Biophys Acta Biomembr.
2017;1859:1558–72.
22. Wen XH, Shen L, Brush RS, et al. Overexpression of
rhodopsin alters the structure and photoresponse of
rod photoreceptors. Biophys J. 2009;96:939–50.
23. Young RW. The renewal of photoreceptor cell outer
segments. J Cell Biol. 1967;33:61–72.
 Expansion Microscopy of Mouse
Photoreceptor Cilia

Abigail R. Moyel, Michael A. Robichaux,

and Theodore Wensel

Abstract ing of ciliary markers, including tubulin,

CEP290, centrin, and CEP164. The results are
The small size of ciliary structures that under- consistent with those from other super-­
lies photoreceptor function and inherited cil- resolution fluorescence techniques and reveal
iopathies requires imaging techniques adapted new insights into their arrangements with
to visualizing them at the highest possible respect to the subcompartments of photore-
resolution. In addition to powerful super-­ ceptor cilia. This technique is complimentary
resolution imaging modalities, emerging to other imaging modalities used in retinal
approaches to sample preparation, including imaging, and can be carried out in virtually
expansion microscopy (ExM), can provide a any laboratory, without the need for expensive
robust route to imaging specific molecules at specialized equipment.
the nanoscale level in the retina. We describe a
protocol for applying ExM to whole retinas in Keywords
order to achieve nanoscale fluorescence imag-
Expansion microscopy · Connecting cilium ·
CEP290 · Photoreceptor · Super-resolution
A. R. Moyel
Verna and Marrs McLean Department of
Biochemistry and Molecular Biology, Baylor College
of Medicine, Houston, TX, USA
Department of Genetics and Ophthalmology, Institute Abbreviations
of Molecular and Clinical Ophthalmology Basel,
Basel, Switzerland BBS Bardet-Biedl syndrome
M. A. Robichaux BSA bovine serum albumin
Verna and Marrs McLean Department of CC connecting cilium
Biochemistry and Molecular Biology, Baylor College
of Medicine, Houston, TX, USA DAPI 4′,6-diamidino-2-phenylindole
ExM expansion microscopy
Department of Ophthalmology & Visual Sciences and
Department of Biochemistry & Molecular Medicine, IFT intraflagellar transport
West Virginia University, Morgantown, WV, USA NGS normal goat serum
T. Wensel (*) OCT optimal cutting temperature
Verna and Marrs McLean Department of PBS phosphate-buffered saline
Biochemistry and Molecular Biology, Baylor College PFA paraformaldehyde
of Medicine, Houston, TX, USA RT room temperature
e-mail: twensel@bcm.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 395
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_58
396 A. R. Moyel et al.

SDS sodium dodecyl sulfate adapted and optimized by many different labs
SIM structured illumination microscopy over the years, and used for the imaging of a
STORM stochastic optical reconstruction number of ciliary and centriolar structures in cel-
microscopy lular cultures [6–13], and very recently for the
TEMED tetramethylethylenediamine cilia in retinal tissue [14]. This technique is
adaptable to whichever tissue is of interest, and
the extent of expansion can be scaled [15]. The
1 Introduction materials and instruments used for this technique
are relatively accessible as compared to other
In recent years the structure of the mouse rod super-resolution methods.
photoreceptor cilium has been defined at an ever-­ Here we describe an expansion method opti-
increasing level of detail using electron micro- mized for visualizing photoreceptor cilia in
scopic and super-resolution fluorescence mouse retina. It can be used with many micros-
techniques. The tightly packed submicron struc- copy modalities. As an example, we have used
tures of rod photoreceptor sensory cilia require this modified ExM protocol to improve local-
optimized staining procedures and super-­ ization of CEP290 along the microtubules of
resolution for accurate localization analyses. 2D the connecting cilium (CC) axoneme, and have
stochastic optical reconstruction microscopy confirmed and improved localization detail for
(STORM) has been used to localize centrin to the ciliary proteins CEP164 and centrin (Figs. 1
lumen of the CC, surrounded by microtubules and 2).
and mobile components of the CC, like intrafla-
gellar transport (IFT) and BBSome proteins [1].
Comparative studies using super-resolution fluo- 2 Materials and Methods
rescence localization have demonstrated differ-
ences in subcellular localization of ciliary 2.1 Solutions Needed
proteins in retinal ciliopathy mutants, like
Spata7−/− and BBS protein subunit knockout Ames’ Medium [16] (Sigma A1420)
mouse mutants (Bbs2−/−, Bbs4−/−, and Bbs7−/−) Ames’ Block Buffer: 15% (v/v) normal goat serum
[1, 2]. A combination of both structured illumina- (NGS) (Fitzgerald 88R-NG001) + 5% (w/v)
tion microscopy (SIM) and STORM was recently Bovine serum albumin (BSA) (Sigma
used to localize CEP290 along the length of the A9647) + 0.5% (w/v) BSA-c (Aurion
CC, in comparison with other ciliary proteins like 25557) + 5% (w/v) Fish skin gelatin (Sigma
NPHP8 [3]. G7765) + 1x protease inhibitor cocktail
Expansion microscopy (ExM) [4, 5] is a tech- (GenDepot P3100) + 0.2% (w/v) saponin
nique that allows for fluorescence-based imag- (Calbiochem 558255); remaining volume is
ing, on standard microscopes, at nanoscale 1x Ames’ Medium
resolution. It can be combined with SIM, Ames’ Wash Buffer: 2% (v/v) NGS in 1x Ames’
STORM, and other nanoscopic techniques to Ames’ Secondary Buffer: 2% (v/v) NGS in 1x
potentially improve the spatial resolution achiev- Ames’ + 1x protease inhibitor cocktail + 0.2%
able beyond the capabilities of each technique (w/v) saponin
alone. ExM is based on the principle of embed- Phosphate buffered saline (PBS), 1x: 144 mg/L
ding cells and tissues in highly hygroscopic gels KH2PO4, 9000 mg/L NaCl, 421.62 mg/L
polymerized from mixtures of acrylamide and Na2HPO4, pH = 7.4
acrylate, which absorb water, allowing the gel to PBS Block Buffer: 15% NGS + 5% BSA + 0.5%
expand [5]. Proteins are cross-linked to the gel, BSA-c + 5% Fish skin gelatin + 0.2% sapo-
and thus structures containing proteins expand nin + 0.01% (w/v) Na-Azide in 1xPBS
with the gel (Fig. 1). The technique has been PBS Wash Buffer: 2% NGS in 1xPBS
Expansion Microscopy of Mouse Photoreceptor Cilia
Fig. 1 Sample preparation during expansion protocol.
(a–d) Display examples of the retina in different steps of
the protocol, in order: (a) retina immediately after gela-
tion; (b) retina post-disruption, trimmed and slightly
expanded; (c) retina after overnight incubation with pri-
mary antibodies (opacity subsides once they warm to RT);
and (d) orientation of the retinas for embedding in
OCT. Arrows point to retinas within the gels, and colored
lines display length and width measurements to show that
slight expansion of the retinas during disruption and sub-
sequent steps is, by eye, isotropic. Gelled retinas ~0.08
2.2 Gelation Solution
2 M acrylamide (Fisher, BP1402-1), 300 ppm
(ug/ml) N,N′-methylene-bis (acrylamide)
(Sigma, 146072), 1.1 M Na-Acrylate (Santa
Cruz Biotech. sc-236893), 1.5 ppt (mg/ml)
ammonium persulfate and tetramethylethyl-
enediamine (TEMED) each, in 1xPBS
Disruption Buffer: 50 mM Tris-Cl pH 7.5, 5%
sodium dodecyl sulfate (SDS), 200 mM NaCl
397
inches wide, ~0.17 inches long; immediately preceding
freezing, retinas ~0.13–0.17 inches wide, and ~0.23–0.27
inches long (~0.08 inch changes in each direction). (e)
SIM z-projection images displaying cilia, compared in
512 × 512 pixel images, between an expanded section, a
non-expanded control section, and a non-gelled control
section stained for the antibodies indicated. Scale bar
5 μm. (f, g) Dot plots with averages and standard devia-
tions of the lengths and widths of staining in connecting
cilia pre- and post-expansion
2.3 Method
Unless otherwise noted, all incubation steps at
RT and 4 °C were performed with the samples
rocking and covered. Note that there are three
sequential cycles of incubation with primary
antibodies, followed by secondary antibodies,
before and after fixation, and before and after
expansion, a procedure we have found to enhance
sensitivity of immunostaining.
398
Fig. 2 Localization of ciliary markers in connecting cil-
ium following expansion in whole retina. (a, b) SIM
z-projection images of single, straightened cilia stained
for either (a) acetylated alpha-tubulin, glutamylated-­
Day 1
We dissected the retinas into ice-cold Ames’
media in 35 mm petri dishes, on ice, and then
transferred them via a wide-bore pipette tip into
hydrophobic microcentrifuge tubes (GeneMate,
A. R. Moyel et al.
tubulin, and CEP290 or (b) tubulin, centrin, and CEP164
with their corresponding controls. SIM z-projections with
3D deconvolution are shown to the right of each panel. On
the axes, numbers less than 10 represent μm
C-3302-1) filled with 1 mL of Ames Block,
blocked for 2 h. The tubes were positioned so as
to allow the retinas to float around in the tube
with gentle agitation. We added primary antibod-
ies (5–10 μg each) directly to the block buffer and
left the retinas to rock overnight.
Expansion Microscopy of Mouse Photoreceptor Cilia
Day 2
We washed the retinas, gently, with Ames
Wash Buffer six times, 10 min each, on ice. After
the last wash, we added Secondary Buffer and
2°ary antibodies and left the retinas to incubate
for 2 h. We then washed the retinas with Ames
Wash six times, 5 min each, on ice. After rinsing
with 1xPBS to remove serum from the wash, we
fixed the retinas with 4% (w/v) PFA in 1xPBS,
for 20 min, and then quenched with 100 mM gly-
cine HCl in PBS, for 30 min at RT. After one
rinse in 1xPBS, we then blocked the retinas for
2 h in PBS Block Buffer at RT. Finally, we added
fresh primary antibodies directly to the tubes and
stained for 2 full days.
Day 5
We washed the retinas in PBS Wash six times,
10 min each, on ice. We added a fresh 1 mL of PBS
Wash Buffer to each tube, with the corresponding
2°ary antibodies, and incubated overnight.
Day 6
We washed the retinas in PBS Wash six times,
5 min each, on ice. We then postfixed the retinas
with 3% PFA in PBS for 1 h at RT, followed by
quenching with 100 mM glycine HCl in PBS for
30 min at RT. After rinsing in PBS, we carefully
cut a small piece of each retina to serve as a non-­
gelled control. We quickly transferred these
pieces to tubes filled with 30% sucrose (made in
1xPBS), added 1:1 30% sucrose-optimal cutting
temperature (OCT, Tissue-Tek), and flash froze
them in N2(l). We transferred the rest of the retina
to a 0.5 dram glass vial containing 1 mL of
0.1 mg/ml acryloyl-X SE (6-((acryloyl)amino)
hexanoic acid, succinimidyl ester, Thermo
A20770; for cross-linking proteins to hydrogel),
diluted in PBS, and left them to incubate on a
roller or rocker for 24 h at RT:
–– If there is no access to a roller, a rocker can be
used as before.
–– Regular eyecup cryosections can also be used
for the non-gelled control.
–– Incubating for less time in Acryloyl-X SE has
been used in other protocols expanding cul-
399
tured cells, but we found a full day of incuba-
tion to be best for overall incorporation of
acryloyl-X into the entire retinal tissue.
Day 7
Just before use, we prepared gelation solution
(1.5 mL per retina) and added 1 mL per retina to
a cryomold (Ted Pella, 27147-2), on ice. After
rinsing retinas three times in PBS, we placed
them in the center of the cryomold to incubate,
shaking gently on ice, at 4 °C. We then added the
remaining gelation solution to the cryomold
before placing a glass coverslip on top (avoiding
bubbles) and incubating for 2 h in a humidified
37 °C incubator to induce gelation. After cool-
ing, we gently popped the gels out of the cryo-
molds using a pipette tip and trimmed excess gel
from the retinas (Fig. 1a). We placed each gel
into a 15 mL conical tube with 10 mL of disrup-
tion buffer (covered with foil), and incubated in
an 80 °C chamber for 3 h. We washed the gels in
water once and PBS several times to remove
SDS (Fig. 1b), then transferred them to wells of
a new 24-well plate containing PBS + 0.1%
Tween 20 (PBST). We washed the retinas in
PBST two times, 30 min each, at RT, then added
fresh primary antibodies, and incubated
overnight:
–– Although previous expansion methods call for
3 h of gelation time, we found 2 h to be
sufficient.
–– We found less isotropic expansion and
decreased antibody labeling when we used
digestion rather than denaturation.
Day 8
We washed the retinas in PBST three times,
20 min each, at RT. We added fresh 1 mL of
PBST and 2°ary antibodies to the retinas, and
stained them for three and a half hours at
RT. DAPI was added at a 1:500 dilution for at
least 1 h. After washing the retinas in PBST six
times, 15 min each, at RT, we washed the retinas
in 30% (w/v) sucrose (prepared in 1xPBS) three
times, 15 min each. We then transferred the reti-
400
nas to 15 ml conical tubes filled with 10 mL of
30% sucrose. Once the retinas sank to the bottom
of the tube, we transferred them to a petri dish
filled with OCT and swirled them to remove
excess sucrose from the gel block, and trimmed
the gels if possible. We then immediately trans-
ferred the retinas to a cryomold filled with fresh
OCT and froze them by placing the cryomolds on
a flat surface in a −80 °C freezer:
–– If the retinas are left in 30% sucrose overnight,
the structure of the gel changes slightly.
Fluorescence stays intact, but better to not
leave it overnight.
–– During mounting, the gel was pushed to the
bottom of the mold for longitudinal sectioning
and the mold marked to indicate the gel
position.
2.4 Sectioning
Within 3 days after freezing, we cut sections. We
placed the cryomolds in a microtome cryocham-
ber set to −27–35 °C and left them to warm for
~30 min. In advance we filled multiple 50 mL
beakers with Milli-Q water, prepared coverslips
and slides by placing a ~50 ul drop of water on
each, and left a thin paintbrush out at RT. We then
collected sections onto a Superfrost Plus slide
(Fisher, 12-550-15) to check for fluorescence,
mounted in ProLong Glass mounting medium
(Thermo Fisher P36980), and used those as non-­
expanded controls. Once the area of interest was
reached, we cut 10 μm (or less) sections. We used
the RT brush to transfer the section to the glass
beaker by dipping the brush in water, lightly
touching it to the section, and transferring the
section directly into the beaker filled with water.
We left the sections to expand for 10 min, cov-
ered. We used a loop tool (EMS, 70922-03, or a
bigger loop can be made using a wooden stick
and silver wire) to transfer the expanded sections
from the beaker onto the drop of water on a #1.5
glass coverslip. After wicking away excess water
with a Kimwipe (Kimberly-Clark), we mounted
the coverslip on the drop of water on a glass slide.
We again used a Kimwipe to wick away excess
A. R. Moyel et al.
water. We used a fluorescent microscope to
choose the best sections for imaging. After care-
fully sealing the coverslip edges with scotch tape,
we marked the positions of the sections with a
sharpie. To reduce drying we kept them at 4 °C,
protected from light, until and imaged within the
day, except for controls which we imaged later
that week:
–– The rest of the block can be stored in −80 °C,
but fluorescence signal may decrease over
time.
–– We tested leaving the sections in water longer
than 10 min, but the expansion factor did not
increase.
–– Placing the section directly in the water is the
best way to get isotropic expansion of the sec-
tion. Drying it on a coverslip first and then
expanding that in water did not produce reli-
able, consistent expansion.
2.5 Animals
Wild-type mice used for this study were C57BL/6
aged 2–4 months. All procedures were approved
by the Baylor College of Medicine Institutional
Animal Care and Use Committee and adhered to
the Association of Research in Vision and
Ophthalmology (ARVO) guidelines for the
humane treatment and ethical use of animals for
vision research.
2.6 Antibodies
The following commercial antibodies were used:
CEP290 (C-terminus), Bethyl Laboratory, A301-­
659A; acetylated α-tubulin, Santa Cruz,
sc-23950; Centrin, pan-centrin antibody from
EMD Millipore, 04-1624, raised against
Chlamydomonas centrin and reported to recog-
nize all mouse centrin isoforms 1-4 (41, 84);
CEP164, Proteintech, 22227-1-AP; CEP164,
Santa Cruz, sc-515403; MKS3 (cultured cells)
Proteintech, 13975-1-AP; Atto488-Tuba1,
Antibodies-­online.com, ABIN1169085.
Antibodies were used at a concentration of 10 μg/
Expansion Microscopy of Mouse Photoreceptor Cilia
mL, with the exception of Atto488-Tuba1 which
was used at a concentration of 7.5 μg/
mL. Secondary antibodies used were F(ab’)2-­
goat anti-rabbit IgG Alexa 488, F(ab’)2-goat
anti-mouse IgG Alexa 555, and F(ab’)2-goat
anti-mouse IgG Alexa 647 (Thermo Fisher, 8 μg
each).
3 Results
We combined our whole retina immunostaining
technique developed for STORM [1], with two
expansion protocols: whole tissue ExM protocol
developed for expanding Drosophila synaptone-
mal complex during meiosis [17, 18] and further
optimized with insights from an ExM method
termed TREx (tenfold robust expansion micros-
copy) that was optimized for both cells and whole
tissue [15]. We found that by eye the whole retina
expanded isotropically in the gels (Fig. 1).
Although cryosections were fragile, the integrity
of the retinal tissues was maintained sufficiently
to identify correctly localized fluorescently
labeled cilia (in reference to DAPI and non-­
ciliary tubulin staining) for SIM. Though samples
were relatively lightly fixed (3% or 4% PFA for a
total of 80 min), fixation could affect the sensitiv-
ity of some antibodies, which should be taken
into account while optimizing this protocol for
other antibodies/cells.
With SIM, we collected z-stacks that revealed
rod photoreceptor cilia immuno-labeled for post-
translationally modified tubulin (acetylated and
glutamylated), CEP290, CEP164, centrin, and
tubulin that were significantly larger and more
expanded than control, unexpanded cilia, as well
as control non-gelled retina, imaged with the
same settings (Fig. 2a). Reconstructions were
performed in Softworx 7 software, and 3D decon-
volution of SIM reconstructed z-stacks was per-
formed using Nikon NIS-Elements software. We
performed the majority of the analysis thereafter
in FIJI/ImageJ. We calculated the expansion fac-
tor at the single cilium level by taking ROIs of
individual cilia, digitally straightening them, and
then taking the row-average intensities, which
plots the average intensity across the width of the
401
ROI for each row of pixels along the length of the
ROI. Once converted to nm for accurate scaling,
these profiles were used to identify the edges of
antibody labeling (33% of the maximum inten-
sity value). All measurements were made in a
1.5-μm-wide ROI. We achieved a ~ four-fold
expansion factor for length and width (Fig. 1f, g).
GraphPad Prism 7 was used to create the graphs.
The staining patterns for CEP290, centrin, and
CEP164 are all comparable to previously pub-
lished, non-expanded connecting cilia staining
[3, 19, 20], but more detailed analysis is in
progress.
4 Discussion
We demonstrate in this report that ExM is a use-
ful super-resolution fluorescence tool for localiz-
ing proteins in the rod photoreceptor cilium. In
the future, the technique could be applied to
localize other critical components of the cilium.
Although ExM is useful for cilia cytoskeleton
labeling with reasonably isotropic expansion,
there are some potential drawbacks. Some 2°ary
antibodies do not work well; as seen in Fig. 2,
CEP164 staining in the expanded cilia is less
well-maintained than in non-expanded retina, or
when compared to the staining under non-gelling
protocols [3], possibly due to problems with the
Alexa 647-labeled secondary [21]. It remains to
be determined which structures expand isotropi-
cally. Membranes and protein structures must be
disrupted in order to allow for complete gel
embedding and subsequent expansion. The gel
composition and protein disruption techniques
used by different labs vary widely, depending on
the structure and/or proteins of interest. Bioactive
lipid membranes, such as the inner segment and
CC plasma membrane, post-Golgi secretory ves-
icles, and OS membrane discs, may be adversely
affected by the high temperatures used in the pro-
tocol. It seems likely there is some anisotropy in
the expansion, with some structures expanding
more in one direction than in another, but further
analysis and possibly further protocol modifica-
tions will be required. Improvement in further
spatial resolution will require either increasing
402
the expansion factor or by imaging with a more
powerful super-resolution microscope like STED
or STORM. Such changes will also require addi-
tional adaptations to the protocol. Nonetheless,
even in its current state, ExM represents a power-
ful tool for localizing proteins within photorecep-
tor cilia.
Acknowledgments This work was supported by NIH
grant R01-EY26545 (TGW), F32-EY027171 (MAR),
T32-EY007102 (ARM), and F32-EY031574 (ARM) and
a grant from the Knights Templar Eye Foundation (MAR).
3D deconvolution analysis was performed in the West
Virginia University Microscope Imaging Facility, which
has been supported by the WVU Cancer Institute and NIH
grants P20RR016440, P30GM103488, and
U54GM104942.
Conflict of Interest The authors have declared that no
conflicts of interest exist.
References
1. Robichaux MA, Potter VL, Zhang Z, He F, Liu J,
Schmid MF, et al. Defining the layers of a sensory cil-
ium with STORM and cryoelectron nanoscopy. Proc
Natl Acad Sci U S A. 2019;116(47):23562–72.
2. Dharmat R, Eblimit A, Robichaux MA, Zhang Z,
Nguyen TT, Jung SY, et al. SPATA7 maintains a novel
photoreceptor-specific zone in the distal connecting
cilium. J Cell Biol. 2018;217(8):2851–65.
3. Potter VL, Moye AR, Robichaux MA, Wensel
TG. Super-resolution microscopy reveals
photoreceptor-­specific subciliary location and func-
tion of ciliopathy-associated protein CEP290. JCI
Insight. 2021;6(20):e145256.
4. Gallagher BR, Zhao Y. Expansion microscopy: a
powerful nanoscale imaging tool for neuroscientists.
Neurobiol Dis. 2021;154:105362.
5. Chen F, Tillberg PW, Boyden ES. Optical imaging.
Expansion microscopy. Science. 2015;347(6221):543–8.
6. Gambarotto D, Zwettler FU, Le Guennec M, Schmidt-­
Cernohorska M, Fortun D, Borgers S, et al. Imaging
cellular ultrastructures using expansion microscopy
(U-ExM). Nat Methods. 2019;16(1):71–4.
7. Le Guennec M, Klena N, Gambarotto D, Laporte
MH, Tassin AM, van den Hoek H, et al. A helical
inner scaffold provides a structural basis for centriole
cohesion. Sci Adv. 2020;6(7):eaaz4137.
8. Katoh Y, Chiba S, Nakayama K. Practical method for
superresolution imaging of primary cilia and centri-
oles by expansion microscopy using an amplibody
A. R. Moyel et al.
for fluorescence signal amplification. Mol Biol Cell.
2020;31(20):2195–206.
9. Kong D, Loncarek J. Analyzing centrioles and
cilia by expansion microscopy. Methods Mol Biol.
2021;2329:249–63.
10. Sahabandu N, Kong D, Magidson V, Nanjundappa
R, Sullenberger C, Mahjoub MR, et al. Expansion
microscopy for the analysis of centrioles and cilia. J
Microsc. 2019;276(3):145–59.
11. Gambarotto D, Hamel V, Guichard P. Ultrastructure
expansion microscopy (U-ExM). Methods Cell Biol.
2021;161:57–81.
12. Hamel V, Guichard P. Improving the resolution of flu-
orescence nanoscopy using post-expansion labeling
microscopy. Methods Cell Biol. 2021;161:297–315.
13. Zwettler FU, Reinhard S, Gambarotto D, Bell TDM,
Hamel V, Guichard P, et al. Molecular resolution
imaging by post-labeling expansion single-molecule
localization microscopy (Ex-SMLM). Nat Commun.
2020;11(1):3388.
14. Mercey O, Kostic C, Bertiaux E, Giroud A, Sadian Y,
Chang N, et al. The connecting cilium inner scaffold
provides a structural foundation to maintain photore-
ceptor integrity. Plos Bio. 2022;20(6): e3001649.
15. Damstra HGJ, Mohar B, Eddison M, Akhmanova
A, Kapitein LC, Tillberg PW. Visualizing cel-
lular and tissue ultrastructure using Ten-fold
Robust Expansion Microscopy (TREx). bioRxiv.
2021:2021.02.03.428837.
16. Ames A 3rd, Nesbett FB. In vitro retina as an
experimental model of the central nervous system. J
Neurochem. 1981;37(4):867–77.
17. Cahoon CK, Yu Z, Wang Y, Guo F, Unruh JR,
Slaughter BD, et al. Superresolution expansion
microscopy reveals the three-dimensional organiza-
tion of the Drosophila synaptonemal complex. Proc
Natl Acad Sci U S A. 2017;114(33):E6857–E66.
18. Wang Y, Yu Z, Cahoon CK, Parmely T, Thomas
N, Unruh JR, et al. Combined expansion micros-
copy with structured illumination microscopy
for analyzing protein complexes. Nat Protoc.
2018;13(8):1869–95.
19. Yang TT, Chong WM, Wang WJ, Mazo G, Tanos
B, Chen Z, et al. Super-resolution architecture of
mammalian centriole distal appendages reveals dis-
tinct blade and matrix functional components. Nat
Commun. 2018;9(1):2023.
20. Shi X, Garcia G 3rd, Van De Weghe JC, McGorty
R, Pazour GJ, Doherty D, et al. Erratum: super-­
resolution microscopy reveals that disruption of
ciliary transition-­zone architecture causes Joubert
syndrome. Nat Cell Biol. 2017;19(11):1379.
21. Tillberg PW, Chen F, Piatkevich KD, Zhao Y, Yu
CC, English BP, et al. Protein-retention expansion
microscopy of cells and tissues labeled using standard
fluorescent proteins and antibodies. Nat Biotechnol.
2016;34(9):987–92.
 Rod Photoreceptor-Specific
Ablation of Metformin Target,
AMPK, in a Preclinical Model
of Autosomal Recessive Retinitis
Pigmentosa

Nicholas D. Nolan, Laura A. Jenny,

Stephen H. Tsang, and Xuan Cui

Abstract tein kinase (AMPK)-associated metabolic

Retinal gene therapies have shown tremendous
progress in the past decade, but the sheer
number of disease-causing mutations makes
their applicability challenging. In this study
we test our hypothesis that retinitis
pigmentosa-­ associated retinal degeneration
can be prevented through AMP-activated pro-
pathway reprogramming using a gene-­
independent model of degeneration and
rescue. We show that recue of photoreceptor
structure and function is not achieved through
our model of metabolic reprogramming.
These results suggest that RP may not be
treatable through AMPK pathway modulation-­
based therapies.

Ophthalmology, Columbia University,

N. D. Nolan
New York, NY, USA
Department of Biomedical Engineering, Columbia
e-mail: xc2342@cumc.columbia.edu
University, New York, NY, USA
S. H. Tsang
Edward S. Harkness Eye Institute, Department of
Department of Biomedical Engineering, Columbia
Ophthalmology, Columbia University Irving Medical
University, New York, NY, USA
Center/New York-Presbyterian Hospital,
New York, NY, USA Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Jonas Children’s Vision Care, and Bernard & Shirlee
Center/New York-Presbyterian Hospital,
Brown Glaucoma Laboratory, Department of
New York, NY, USA
Ophthalmology, Columbia University,
New York, NY, USA Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Columbia Stem Cell Initiative, Columbia University,
Ophthalmology, Columbia University,
New York, NY, USA
New York, NY, USA
L. A. Jenny · X. Cui (*)
Columbia Stem Cell Initiative, Columbia University,
Edward S. Harkness Eye Institute, Department of
New York, NY, USA
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital, Department of Pathology & Cell Biology, Columbia
New York, NY, USA University, New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee Institute of Human Nutrition, Columbia University,
Brown Glaucoma Laboratory, Department of New York, NY, USA

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 403
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_59
404
Keywords
Retinitis pigmentosa · Retinal degenerations ·
Gene therapy · Metabolomics · Late-stage
treatment
1 Introduction
Retinitis pigmentosa (RP) is the third most
common inheritable cause of vision loss behind
age-­related macular degeneration and glaucoma,
and reports have estimated its prevalence from
between 1 in 750 and 1 in 9000 in various geo-
graphic locations [1–4]. In addition to RP, there
are many related inherited retinal dystrophies,
caused by a variety of underlying mutations that
have similar clinical presentations and perturbed
metabolic pathways [5]. Retinitis pigmentosa
typically begins as a rod photoreceptor degenera-
tion, with patients experiencing mild to more
severe night blindness as a result. If left untreated,
this leads to tunnel vision in mid-stage RP and
eventually progresses to cone loss in the macula,
or loss of photopic vision altogether [6].
In recent years, gene therapy has emerged as a
promising therapeutic strategy applied to oph-
thalmology. By directly editing the causative
underlying mutation, medical researchers aim to
correct the root of pathology. Over three decades
ago, researchers identified the first mutation asso-
ciated with autosomal dominant RP, and as of
now more than 80 genes have been identified to
be associated with non-syndromic RP [7, 8]. The
large number of identified causative mutations in
RP combined with the amount of time and money
it costs to design a therapy for each mutation in
each gene independently makes gene therapies
specific to each mutation challenging. In addi-
tion, most patients are not usually diagnosed until
far after the onset of disease and degeneration.
Given this, a therapeutic aimed at treating RP
must remain efficacious even in mid- to late-­
stage disease. Strategies targeting specific steps
in metabolic pathways which cause disease have
been explored. Reprogramming of the mamma-
lian target of rapamycin (mTOR)- and sirtuin 6
(SIRT6)-related pathways has shown great prom-
N. D. Nolan et al.
ise in recent years, and is capable of treating
patients on the magnitude necessary to signifi-
cantly reduce disease burden [9–11]. In addition,
there is a growing body of evidence that supports
the notion of metabolic ties between the retinal
pigment epithelium and photoreceptors, the
breakdown of which occurs in many retinal dys-
trophies [12]. Targeting this breakdown of cou-
pling is a gene-independent strategy and remains
to be explored herein.
In this study, we used a mutant
phosphodiesterase 6b (PDE6B) mouse model
with rod-­ specific excision of AMP-activated
protein kinase (AMPK). Cellular energy
homeostasis is a dynamic complex process.
During cell states of low energy, AMPK plays a
crucial role phosphorylating specific enzymes
which leads to an increased production of ATP
through downstream targets of fatty acid oxidation
and protein synthesis, and is typically activated
following elevated mitochondrial stress [13, 14].
Other bodies of work have shown a delicate
interplay between the AMPK and mTOR
pathways that regulate cell survival and metabolic
pathways such as mitochondrial homeostasis,
protein synthesis, and autophagy [15]. Previous
researchers have attempted to modulate this
pathway, using the drug metformin to activate
AMPK as a treatment for type 2 diabetes [16].
Contrarily, we hypothesize that AMPK ablation
could shift some of these metabolic pathways and
subsequently improve photoreceptor health and
function. Using this gene-independent model of
retinal degeneration rescue, we investigated
whether photoreceptor degeneration could be
halted independently of underlying, disease-
causing mutations. Our results reveal that in this
specific mouse model of RP, AMPK ablation does
not significantly mediate gene-independent
therapeutic restoration of photoreceptor health
and function.
Rod Photoreceptor-Specific Ablation of Metformin Target, AMPK, in a Preclinical Model of Autosomal…
2 Materials and Methods
2.1 Animals
Our experimental procedures were approved by
the Institutional Animal Care and Use Committee
(IACUC) at Columbia University in New York.
All rodents were used in accordance to the
Statement for the Use of Animals in Ophthalmic
and Vision Research of the Association for
Research in Vision and Ophthalmology and the
Policy for the Use of Animals in Neuroscience
Research of the Society for Neuroscience.
Pde6bH620Q mice were derived via oviduct trans-
fer as described previously [17, 18]. AMPKfl/fl
mice were ordered from the Jackson Laboratory
#014142. These mice have loxP sites flanking
exon 2 of the protein kinase, AMP-activated,
alpha 2 catalytic subunit (Prkaa2) gene. This
exon is deleted following tamoxifen-induced
Cre-recombination, crippling the function of
AMPK in a cell type-specific manner. Pde6gCreERT2
were generated as previously described [19–21].
All animals were maintained in the Columbia
University Eye Institute Annex Animal Care
Services Facility in a standard 12-h light-dark
cycle.
2.2 Tamoxifen Injection
Tamoxifen powder (Sigma-Aldrich T5648) was
diluted in 100% ethanol to a concentration of
100 mg/ml at 42 °C. This mixture was further
diluted with sunflower oil to a final concentration of
10 mg/ml and injected at 100 μg/g body weight on
three consecutive days, starting on postnatal day 9.
2.3 Immunohistochemistry
and Morphometry
Mice were euthanized according to IACUC
guidelines. Mouse eyes were enucleated, fixed in
paraformaldehyde, and sectioned across the sag-
ittal plane as described [21]. Sectioned eyes were
stained with H&E to visualize the photoreceptor
nuclear layer. Quantification and subsequent
405
analysis of the photoreceptor outer nuclear layer
(ONL) thickness was performed on sections con-
taining the thickest cross section of the optic
nerve, corresponding to the most central plane of
the eye (Fig. 1a). Distance from the optic nerve
for all points can be seen in Fig. 1b.
2.4 Electroretinography (ERG)
ERG testing was performed at 6 weeks of age, at
the representative mid-stage of disease progres-
sion in this particular mouse model according to
procedures described [22].
3 Results
3.1 Lack of Functional
and Structural Rescue
in Pde6bH620Q; Pde6gCreERT2;
and AMPKfl/fl Mice
In order to investigate whether or not AMPK-­
mediated metabolic reprogramming would treat
RP independently of the underlying disease-­
causing mutation, we delivered treatment to our
specific RP mouse model Pde6bH620Q/H620Q;
Pde6gCreERT2/+; and AMPKfl/fl mice. After intraper-
itoneal injection of tamoxifen, Pde6gCreERT2/+
becomes activated and halts the AMPK gene
expression and downstream protein production
through a frame shift-mediated premature stop
codon introduction. Our group administered
tamoxifen treatment to P9-P11 Pde6bH620Q/H620Q;
Pde6gCreERT2/+; and AMPKfl/fl mice. At 6 weeks of
age, retinal health has severely declined in this
mouse model (Fig. 1). ONL thickness magni-
tudes are seen in Fig. 1b. Photoreceptor ONL
thickness is reduced dramatically from WT mice
[20]. To assess potential structural rescue from
our treatment, sectioned mouse eyes were subject
to morphometry and ONL thickness character-
ization as described in the methods section of the
chapter (Fig. 1a). Based on our data, AMPK abla-
tion treatment did not significantly reduce ONL
degeneration rates (Fig. 1b). In both treated and
untreated Pde6bH620Q/H620Q; Pde6gCreERT2/+; and
406
Fig. 1 Histological sections and visualization of the outer
nuclear layer (ONL) in Pde6bH620Q/H620Q; Pde6gCreERT2/+;
AMPKfl/fl eyes. (a) Representative sections stained with
H&E for ease of ONL visualization. (b) Quantified ONL
AMPKfl/fl retinas, ONL thickness was markedly
decreased from WT.
In addition to the structural characterization,
treated and untreated mice were subject to func-
tional assays aimed at assessing rod and cone
function. The standard in ophthalmology for
assessing overall photoreceptor function of ERG
was implemented to test 6-week-old mice in this
study. We utilized dark-adapted conditions to
stimulate a purely scotopic response, dark-­
adapted bright light conditions to stimulate a
mixed rod and cone response, and light-adapted
conditions to stimulate a purely photopic
response. Both treated and untreated mice
­exhibited marked degenerations in both A- and
B-wave responses and show little rescue com-
pared to the degenerative control (DC) mice
(Fig. 2a). When quantified, magnitudes of A- and
B-wave responses showed no statistically signifi-
cant difference (Fig. 2b). Treatment at P9 failed
to rescue photoreceptor-associated electrophysi-
ological functionality.
N. D. Nolan et al.
thickness averages mapped against the distance from
optic nerve (all measurements in micrometers). nAMPKfl/
fl
= 4, nAMPK−/− = 6
4 Discussion
In this study we used a Pde6bH620Q/H620Q;
Pde6gCreERT2/+; AMPKfl/fl mouse model which
allowed the deletion of AMPK uniformly from
rods in the retina, circumventing common prob-
lems associated with subretinal injections, and
simplifying analysis. Administration of tamoxifen
at P9 allows us to attempt to prevent AMPK path-
way perturbation from an underlying mutation
before the late-stage degeneration occurs. This
therapy was given early on in degeneration pro-
gression in line with many other animal gene
therapy studies. The data generated within this
study indicates the lack of significant rescue. This
could be due to a compensatory adjustment from
AMPK-related pathways which are also dysregu-
lated in many underlying RP mutations. Several
recent gene therapy clinical trials have demon-
strated the ability to improve retinal function and
structural health but lack the ability to prevent fur-
ther photoreceptor degeneration [9–11, 23–25]. A
therapy aimed at correcting downstream pathway
modulation and degeneration should be investi-
gated in future studies. Our study indicates that
other dysregulated metabolic pathways and their
modulation should be studied in the context of
Rod Photoreceptor-Specific Ablation of Metformin Target, AMPK, in a Preclinical Model of Autosomal… 407

B Scotopic Rod b-wave Scotopic Max b-wave Photopic Cone a-wave Photopic Cone b-wave
50 300 200

40
150
200
Amplitude(mV)

Amplitude(mV)

Amplitude(mV)

Amplitude(mV)
30

100
–10
20
100
50
10

0 0 –20 0
DC Ampkfl/fl Ampk-/- DC Ampkfl/fl Ampk-/- DC Ampkfl/fl Ampk-/- DC Ampkfl/fl Ampk-/-

Fig. 2 Electroretinogram (ERG) photoreceptor functional plotted for comparison. Results indicate no statistically
assay. (a) Average trace recordings of rod (left), rod and significant difference between groups. nDC = 6, nAMPKfl/
cone mixed (middle), and cone (right) photoreceptors in fl
= 2, nAMPK−/− = 5. Error bar is standard error of the mean
Pde6bH620Q/H620Q; Pde6gCreERT2/+; AMPKfl/fl; and Pde6bH620Q/
H620Q
(DC) mice. (b) Quantified A- and B-wave magnitudes

New York Regional Research Center Grant [TA-NMT-

established RP models to assess and develop 0116-0692-COLU], Lynette & Richard Jaffe, the Jaffe
potential therapeutics able to overcome current Family Foundation, Nancy and Kobi Karp, the Crowley
hurdles in the field. Family Funds, the Rosenbaum Family Foundation, Alcon
Research Institute, the Gebroe Family Foundation, the
Research to Prevent Blindness (RPB) Physician-Scientist
Acknowledgments We thank Sarah R. Levi and Jonas Award, unrestricted funds from RPB, New York,
Children’s Vision Care (JCVC) for sharing ideas, and for NY, USA.
critically reading the manuscript; JCVC is supported by
the National Institute of Health 5P30CA013696, Conflict of Interest Statement Stephen H. Tsang has
U01EY030580, U01EY034590, U54OD020351, received support from Emendo. He is also the founder of
R24EY028758, R24EY027285, 5P30EY019007, Rejuvitas and is on the scientific and clinical advisory
R01EY018213, R01EY024698, R01EY026682, board for Nanoscope Therapeutics and Medical
R01EY033770, R21AG050437, the Schneeweiss Stem Excellence Capital.
Cell Fund, New York State [SDHDOH01-
C32590GG-3450000], the Foundation Fighting Blindness
408
References
1. Haim M. Epidemiology of retinitis pigmentosa
in Denmark. Acta Ophthalmol Scand Suppl.
2002;233:1–34.
2. Pagon RA. Retinitis pigmentosa. Surv Ophthalmol.
1988;33(3):137–77.
3. Na KH, Kim HJ, Kim KH, Han S, Kim P, Hann HJ,
et al. Prevalence, age at diagnosis, mortality, and
cause of death in retinitis pigmentosa in Korea – A
nationwide population-based study. Am J Ophthalmol.
2017;176:157–65.
4. Nangia V, Jonas JB, Khare A, Sinha A. Prevalence of
retinitis pigmentosa in India: the Central India eye and
medical study. Acta Ophthalmol. 2012;90(8):e649–50.
5. Verbakel SK, van Huet RAC, Boon CJF, den
Hollander AI, Collin RWJ, Klaver CCW, et al. Non-­
syndromic retinitis pigmentosa. Prog Retin Eye Res.
2018;66:157–86.
6. Sahel J, Bonnel S, Mrejen S, Paques M. Retinitis
pigmentosa and other dystrophies. Dev Ophthalmol.
2010;47:160–7.
7. Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley
GS, Yandell DW, et al. A point mutation of the
rhodopsin gene in one form of retinitis pigmentosa.
Nature. 1990;343(6256):364–6.
8. Daiger SP, Sullivan LS, Bowne SJ, Rossiter
BJF. RetNet: retinal information network. Na+ Ca2.
Houston: The University of Texas Health Science
Center; 2013. p. 5.
9. Venkatesh A, Ma S, Le YZ, Hall MN, Rüegg MA,
Punzo C. Activated mTORC1 promotes long-term
cone survival in retinitis pigmentosa mice. J Clin
Invest. 2015;125(4):1446–58.
10. Zhang L, Du J, Justus S, Hsu C-W, Bonet-Ponce
L, Wu W-H, et al. Reprogramming metabolism by
targeting sirtuin 6 attenuates retinal degeneration. J
Clin Invest. 2016;126(12):4659–73.
11. Zhang L, Justus S, Xu Y, Pluchenik T, Hsu C-W, Yang
J, et al. Reprogramming towards anabolism impedes
degeneration in a preclinical model of retinitis
pigmentosa. Hum Mol Genet. 2016;25(19):4244–55.
12. Brown EE, DeWeerd AJ, Ildefonso CJ, Lewin AS,
Ash JD. Mitochondrial oxidative stress in the retinal
pigment epithelium (RPE) led to metabolic dysfunction
in both the RPE and retinal photoreceptors. Redox
Biol. 2019;24:101201.
13. Herzig S, Shaw RJ. AMPK: guardian of metabolism
and mitochondrial homeostasis. Nat Rev Mol Cell
Biol. 2018;19(2):121–35.
N. D. Nolan et al.
14. Xu L, Ash JD. The role of AMPK pathway
in neuroprotection. Adv Exp Med Biol.
2016;854:425–30.
15. Garza-Lombó C, Schroder A, Reyes-Reyes EM,
Franco R. mTOR/AMPK signaling in the brain: cell
metabolism, proteostasis and survival. Curr Opin
Toxicol. 2018;8:102–10.
16. Hawley SA, Gadalla AE, Olsen GS, Hardie DG. The
antidiabetic drug metformin activates the AMP-­
activated protein kinase cascade via an adenine
nucleotide-independent mechanism. Diabetes.
2002;51(8):2420–5.
17. Hart AW, McKie L, Morgan JE, Gautier P, West K,
Jackson IJ, et al. Genotype–phenotype correlation of
mouse Pde6b mutations. Invest Ophthalmol Vis Sci.
2005;46(9):3443–50.
18. Davis RJ, Tosi J, Janisch KM, Kasanuki JM,
Wang N-K, Kong J, et al. Functional rescue of
degenerating photoreceptors in mice homozygous
for a hypomorphic cGMP phosphodiesterase 6 b
allele (Pde6b H620Q). Invest Ophthalmol Vis Sci.
2008;49(11):5067–76.
19. Davis RJ, Hsu C-W, Tsai Y-T, Wert KJ, Sancho-Pelluz
J, Lin C-S, et al. Therapeutic margins in a novel
preclinical model of retinitis pigmentosa. J Neurosci.
2013;33(33):13475–83.
20. Koch SF, Tsang SH. Success of gene therapy in late-­
stage treatment. Adv Exp Med Biol. 2018;1074:101–7.
21. Koch SF, Duong JK, Hsu C-W, Tsai Y-T, Lin C-S,
Wahl-Schott CA, et al. Genetic rescue models refute
nonautonomous rod cell death in retinitis pigmentosa.
Proc Natl Acad Sci. 2017;114(20):5259–64.
22. Koch SF, Tsai Y-T, Duong JK, Wu W-H, Hsu C-W,
Wu W-P, et al. Halting progressive neurodegeneration
in advanced retinitis pigmentosa. J Clin Invest.
2015;125(9):3704–13.
23. Cideciyan AV, Jacobson SG, Beltran WA, Sumaroka
A, Swider M, Iwabe S, et al. Human retinal
gene therapy for Leber congenital amaurosis
shows advancing retinal degeneration despite
enduring visual improvement. Proc Natl Acad Sci.
2013;110(6):E517–E25.
24. Cideciyan AV, Hauswirth WW, Aleman TS, Kaushal
S, Schwartz SB, Boye SL, et al. Human RPE65 gene
therapy for Leber congenital amaurosis: persistence
of early visual improvements and safety at 1 year.
Hum Gene Ther. 2009;20(9):999–1004.
25. Bainbridge JWB, Smith AJ, Barker SS, Robbie S,
Henderson R, Balaggan K, et al. Effect of gene therapy
on visual function in Leber’s congenital amaurosis. N
Engl J Med. 2008;358(21):2231–9.
 TLR2 Is Highly Overexpressed
in Retinal Myeloid Cells in the rd10
Mouse Model of Retinitis
Pigmentosa

Alonso Sánchez-Cruz, Enrique J. de la Rosa,

and Catalina Hernández-Sánchez

Abstract expression, which was restricted to myeloid

Retinitis pigmentosa (RP) is a genetically het-
erogeneous disease and the predominant cause
of hereditary blindness. Irrespective of the
causative mutation, traits common to all forms
of RP include photoreceptor dysfunction and
death, activation of the retinal glial compo-
nent, and retinal inflammation. Activation of
Toll-like receptors (TLRs) in response to tis-
sue damage is associated with inflammatory
processes that contribute to neurodegenera-
tion. We show that retinal expression of the
genes Tlr1 to Tlr9 is increased in the rd10
mouse model of RP, with Tlr2 showing the
greatest increase (36-fold). Flow cytometry
analysis of the retinal myeloid population
revealed significant increases in numbers of
microglia and infiltrating monocytes and mac-
rophages in rd10 retinas. Furthermore, TLR2
A. Sánchez-Cruz · E. J. de la Rosa
Department of Molecular Biomedicine, Centro de
Investigaciones Biológicas Margarita Salas (CSIC),
Madrid, Spain
C. Hernández-Sánchez (*)
Department of Molecular Biomedicine, Centro de
Investigaciones Biológicas Margarita Salas (CSIC),
Madrid, Spain
Centro de Investigación Biomédica en Red de
Diabetes y Enfermedades Metabólicas Asociadas
(CIBERDEM), ISCIII, Madrid, Spain
e-mail: chernandez@cib.csic.es
cells, was increased in rd10 retinal microglia.
These observations, together with our previ-
ous finding of delayed RP progression follow-
ing Tlr2 deletion, point to TLR2 as a potential
therapeutic target for RP.
Keywords
Retinitis pigmentosa · TLR · TLR2 ·
Microglia · Inflammation · Innate immunity ·
Myeloid cells · Retina · Neurodegeneration
1 Introduction
Retinitis pigmentosa (RP) is a group of retinal
genetic dystrophies responsible for the most
prevalent form of hereditary blindness, and
affects around 2 million patients worldwide. RP
is caused by more than 3000 different mutations
in over 60 genes. Despite its genetic heterogene-
ity, traits common to all forms of RP include pri-
mary dysfunction and death of photoreceptors,
which triggers a rapid response from retinal
microglial and macroglial cells. The persistent
presence of the insult caused by the mutation
leads to non-resolving gliosis and sterile inflam-
mation that further contributes to disease pro-
gression [1]. It has been proposed that targeting
of common alterations, such as the altered glial
response, may constitute a feasible strategy to

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 409
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_60
410 A. Sánchez-Cruz et al.

treat the wide variety of RP types, regardless of 2.2 RNA Isolation

the causative mutation [2].
Toll-like receptors (TLRs) are initiators of
the innate immune response that recognize
both pathogen-associated molecular patterns
and damage-associated molecular patterns
(PAMPs and DAMPs, respectively). DAMPs
are cellular molecules that are released or
increased in response to tissue damage. The
activation of TLRs by DAMPs has prompted
investigation of the role of the former in dis-
eases with an inflammatory component, includ-
ing neurodegenerative conditions. A growing
body of evidence implicates TLRs in brain
neurodegenerative disease [3]. However, little
is known about the role of TLRs in retinal dys-
trophies, particularly RP. We recently demon-
strated that genetic deletion of Tlr2 preserves
photoreceptors and alleviates vision loss in two
mouse models of RP [4], pointing to TLR2 as a
candidate therapeutic target for RP. Here, we
contextualize the increased expression of Tlr2
in the innate immune response to RP and char-
acterize the retinal cellular component involved
in this increase.
2 Materials and Methods
2.1 Animals
The rd10 mouse model of RP carries a homozy-
gous phosphodiesterase 6b mutation (Pde6brd10/
rd10
) on a C57BL/6 J background. rd10 and wild-­
type (WT) mice were obtained from the Jackson
Laboratory. All animals were housed and handled
at the CIB Margarita Salas [4] in accordance with
the ARVO statements and the guidelines of the
European Union and the local ethics committees
of the CSIC and Madrid (PROEX 152/16, 287/19
and 266.1/21).
and Quantitative PCR
RNA isolation and qPCR were carried out as pre-
viously reported [5]. TaqMan assays
(ThermoFisher) are included in Table 1.
2.3 Flow Cytometry
Myeloid cell numbers and TLR2 levels in WT and
rd10 retinas were assessed as previously described
[4]. Staining was carried out with the following
antibodies: CD45-eFluor450 (30-F11, BioLegend);
CD11b-PerCPCy5.5 (M170, BioLegend); F4/80-
APC (BM8, eBioscience), and TLR2-FITC (6C2,
eBioscience). Samples without the TLR2-FITC
antibody were used as a negative control.
2.4 Statistical Analysis
Statistical analyses were performed with
GraphPad Prism 8.0. For normally distributed
data, an unpaired t-test was applied. Analyses of
more than two data sets were performed using a
one-way ANOVA with a Tukey’s post-test.
Comparisons of two variables were performed
using a two-way ANOVA, followed by Sidak’s
multiple comparison test. Statistical significance
was established at p < 0.05.
3 Results
3.1 Expression of Tlr Genes in WT
and rd10 Retinas
First, in both WT and rd10 mouse retinas, we
examined the expression of Tlr genes that are
conserved between humans and mice (Tlr1 to

Table 1 TaqMan assays for qPCR

Gene TaqMan assay Gene TaqMan assay Gene TaqMan assay
Il1b Mm00434228_m1 Tlr3 Mm01207404_m1 Tlr7 Mm00446590_m1
Tbp Mm00446971_m1 Tlr4 Mm00445273_m1 Tlr8 Mm04209873_m1
Tlr1 Mm00446095_m1 Tlr5 Mm00546288_s1 Tlr9 Mm00446193_m1
Tlr2 Mm00442346_m1 Tlr6 Mm02529782_s1 Tnf Mm00443258_m1
TLR2 Is Highly Overexpressed in Retinal Myeloid Cells in the rd10 Mouse Model of Retinitis…
Tlr9). The analysis covered the period from post-
natal day (P)14, before the onset of degeneration,
to P21, which corresponds to early-stage RP [5].
By P21 all Tlr genes analyzed showed increased
expression in rd10 retinas (Fig. 1a), although the
magnitude of this increase differed between
genes: expression levels of Tlr1, Tlr2, and Tlr9
were markedly increased (30-, 36-, and 16-fold,
respectively), while those of Tlr3, Tlr4, Tlr6, and
Tlr7 were increased by 5-, 9-, 6.5-, and 8.5-fold,
respectively, and Tlr5 levels were only modestly
increased (twofold). Tlr8 expression was below
the limit of detection in WT animals but was
detected in rd10 retinas at P21 (not shown).
Interestingly, the elevated expression of the dif-
ferent Tlr genes coincided with a dramatic
increase in expression levels of the proinflamma-
tory cytokine genes Tnf and Il1β (over 90- and
60-fold, respectively) at P21 (Fig. 1b).
3.2 TLR2 Levels in Retinal Cells
from WT and rd10 Retinas
Flow cytometry analysis was used to characterize
the distribution of the TLR2 retinal cell popula-
tion. WT and rd10 retinas at P25 were subjected
to flow cytometry following the gating strategy
described by O’Koren [4, 6]. The myeloid popu-
lation was identified based on CD11b expression.
Within the population of CD11b+ myeloid cells,
macrophages were defined as those with high
levels of F4/80 expression. Cells with intermedi-
ate/low F4/80 expression were classified as
microglia (CD45 low) or monocytes (CD45
high). In the nonmyeloid (CD11b-) cell popula-
tion in both WT and rd10 retinas, levels of TLR2
(median of fluorescence values) were similar to
those of the negative controls (Fig. 2a). However,
significantly higher TLR2 levels were observed
in the myeloid cell population (CD11b+)
(Fig. 2c), indicating selective enrichment of
TLR2 in the myeloid population.
Cell numbers in the three myeloid cell sub-
populations were increased in rd10 versus WT
retinas (Fig. 2b), in agreement with the microg-
lial activation and monocyte and macrophage
infiltration associated with RP [4]. TLR2 expres-
sion differed between the three myeloid popula-
411
tions in rd10 retinas: similar levels were observed
in microglia and monocyte populations, while
those quantified in macrophages were three times
higher (Fig. 2d). In rd10 retinas, TLR2 expres-
sion in activated microglia was four times higher
than that observed in WT microglia (Fig. 2e).
4 Discussion
Here, we show that expression of all members of
the TLR family is increased in the rd10 mouse
retina in early stages of RP. Moreover, we
observed a parallel increase in the expression of
the proinflammatory cytokine genes Tnf and Il-­
1β. The greatest increase was observed for Tlr2
(36-fold increase with respect to WT), suggesting
that TLR2 may play a prominent role in the
innate immune response associated with RP. In
fact, we previously demonstrated that deletion of
Tlr2 has a disease-modifying effect in two RP
models: elimination of Tlr2 in both rd10 and
P23H/+ mice, which carry different mutations
and have distinct hereditary patterns, attenuates
the progression of RP [4]. These findings suggest
that the beneficial effects of Tlr2 deletion reflect
a mutation-independent phenotype, supporting a
role of the innate immune response in the course
of RP.
Flow cytometry analysis revealed that TLR2
expression was restricted to the myeloid retinal
population, in accordance with previous findings
[7], and confirmed the increase in Tlr2 expres-
sion in rd10 retinas revealed by qPCR. The net
increase in Tlr2 expression was primarily due to
an increased number of microglial cells, in which
TLR2 expression was dramatically increased, as
well as monocyte and macrophage infiltration
from the periphery. We previously showed that
Tlr2 deletion in rd10 mice results in a decrease in
microglial cell number [4], suggesting that mod-
ulation of microgliosis could attenuate RP pro-
gression. Although microglial cells are necessary
for homeostasis, overreactive microglia engulf
living photoreceptors, thus contributing to RP
progression [8]. Together, our findings support
the view that TLR2 may constitute a therapeutic
target for RP treatment, irrespective of the caus-
ative mutation.
412
Fig. 1 Expression of Tlr genes in WT and rd10 retinas.
Expression of Tlr1 to Tlr9 (a) and of the proinflammatory
cytokine genes Tnf and Il1β (b) was analyzed by qPCR in
WT and rd10 retinas at the indicated postnatal ages. Dots
represent individual animals, while bars represent the
A. Sánchez-Cruz et al.
mean per group (+SEM). n = 3–4 animals per group.
Transcript levels were normalized to Tbp RNA and
expressed relative to WT counterparts (= 1) for each time
point analyzed. ****p < 0.0001; ***p < 0.001 (two-way
ANOVA followed by Sidak’s multiple comparison test)
TLR2 Is Highly Overexpressed in Retinal Myeloid Cells in the rd10 Mouse Model of Retinitis…
Fig. 2 Analysis of TLR2 levels in WT and rd10 retinas.
P25 retinas were subjected to flow cytometry analysis by
surface staining with antibodies against CD11b, F4/80,
and CD45, and subpopulations were defined as described
in the Results section. (a) Representative histograms
depicting TLR2 levels (median fluorescence intensity) in
nonmyeloid retinal populations (CD11b-). (b) Graphs
show the number of cells in each myeloid cell subpopula-
Acknowledgments We thank Cayetana Murillo and the
staff of the CIB Margarita Salas animal facility for techni-
cal support. This work was supported by a grant from the
Spanish MICINN (PID2019-109506RB-100 to E.J.d.l.R.
and C.H.-S.).
References
1. Silverman SM, Wong WT. Microglia in the retina:
roles in development, maturity, and disease. Annu Rev
Vis Sci. 2018;4:45–77.
2. Murakami Y, Ishikawa K, Nakao S, Sonoda
K-H. Innate immune response in retinal homeosta-
sis and inflammatory disorders. Prog Retin Eye Res.
2020;74:100778.
3. Heneka MT, Kummer MP, Latz E. Innate immune
activation in neurodegenerative disease. Nat Rev
Immunol. 2014;14(7):463–77.
4. Sánchez-Cruz A, Méndez AC, Lizasoain I, de la Villa
P, de la Rosa EJ, Hernández-Sánchez C. Tlr2 gene
413
tion. (c) Representative histograms showing TLR2 levels
of the myeloid cell populations (CD11b+). (d, e) Analysis
of TLR2 levels in the indicated myeloid cell subpopula-
tion. Dots represent individual animals, while bars repre-
sent the mean (+SEM) of each group. n = 4 mice.
****p < 0.0001; **p < 0.01. (Unpaired t-test in B and E;
one-way ANOVA with Tukey’s post-test in D). MFI
median fluorescence intensity
deletion delays retinal degeneration in two genetically
distinct mouse models of retinitis pigmentosa. Int J
Mol Sci. 2021;22(15):7815.
5. Sanchez-Cruz A, Villarejo-Zori B, Marchena M,
Zaldivar-Diez J, Palomo V, Gil C, et al. Modulation of
GSK-3 provides cellular and functional neuroprotec-
tion in the rd10 mouse model of retinitis pigmentosa.
Mol Neurodegener. 2018;13(1):19.
6. O’Koren EG, Mathew R, Saban DR. Fate map-
ping reveals that microglia and recruited
monocyte-derived macrophages are definitively
­
distinguishable by phenotype in the retina. Sci Rep.
2016;6(1):20636.
7. Hooper MJ, Wang J, Browning R, Ash JD. Damage-­
associated molecular pattern recognition is
required for induction of retinal neuroprotective
pathways in a sex-dependent manner. Sci Rep.
2018;8(1):9115.
8. Zhao L, Zabel MK, Wang X, Ma W, Shah P, Fariss
RN, et al. Microglial phagocytosis of living photore-
ceptors contributes to inherited retinal degeneration.
EMBO Mol Med. 2015;7(9):1179–97.
 Environmental Light Has
an Essential Effect on the Disease
Expression in a Dominant RPE65
Mutation

Wenjing Wu, Yusuke Takahashi, Xiang Ma,

Gennadiy Moiseyev, and Jian-Xing Ma

Abstract reduced electroretinography (ERG) ampli-

The retina pigmented epithelium 65 kDa pro-
tein (RPE65) is an essential enzyme in the
visual cycle that regenerates the 11-cis-retinal
chromophore obligatory for vision. Mutations
in RPE65 are associated with blinding dis-
eases. D477G (C.1430G > A) is the only
known RPE65 variant to cause autosomal
dominant retinitis pigmentosa (adRP).
Previously, we reported that the heterozygous
D477G knock-in (WT/KI) mice exposed to
dim light intensity demonstrated delayed
chromophore regeneration rates and slowed
recovery of photoreceptor sensitivity follow-
ing photobleaching. However, visual function
and retinal architecture were indistinguishable
from the wild-type (WT) mice. In this study,
when maintained under the physiological day-­
light intensity (2 K lux), the WT/KI heterozy-
gous mice displayed retina degeneration and
W. Wu · X. Ma · G. Moiseyev (*)
Department of Physiology, University of Oklahoma
Health Sciences Center, Oklahoma City, OK, USA
e-mail: Gennadiy-Moiseyev@ouhsc.edu
Y. Takahashi · J.-X. Ma (*)
Department of Physiology, University of Oklahoma
Health Sciences Center, Oklahoma City, OK, USA
Harold Hamm Diabetes Center, University of
Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
e-mail: Jian-xing-ma@ouhsc.edu
tude, recapitulating that observed in human
patients. Our findings indicated the impor-
tance of the light environment in the mecha-
nism of RPE65 D477G pathogenicity.
Keywords
RPE65 · Luminance · Retinitis pigmentosa ·
D477G · Blindness · Inherited retinopathy ·
Visual cycle
1 Introduction
Inherited retinopathies (IR) are a major cause of
childhood blindness affecting 1 in 2000 people
worldwide [4]. Mutations in over 300 genes
expressed in both the photoreceptor (PR) and the
retinal pigment epithelium (RPE) cause irrepara-
ble blindness in humans. In the United States,
mutations in the RPE65 retinol isomerase account
for no less than 13% of all IR [1]. These mutations
cause Leber congenital amaurosis (LCA), early-
onset severe retinal dystrophy (EOSRD), and reti-
nitis pigmentosa (RP) [18]. Collectively, these
disorders cause progressive vision loss, eventually
leading to blindness [3]. As the causes of these
ocular diseases are genetically based, the contribu-
tion of environmental factors in the progression of
the dystrophies remains to be elucidated. Currently,
over 100 pathogenic mutations spanning all 14

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 415
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_61
416
exons of the RPE65 gene have been identified in
the human population to cause retinal degenera-
tion. Almost all of these mutations are recessively
inherited and affect its isomerase function. In
2011, Bowne’s group uncovered the first patho-
genic dominant-acting mutation of RPE65 [2]. A
single-nucleotide substitution at exon 13 of the
RPE65 gene, a c.1430A > G, caused a missense
mutation, an aspartic acid residue at position 477
to glycine (D477G). Subsequently, the D477G
mutation was identified in other patients with
adRP of unknown etiology [8].
Unlike typical RP patients, RPE65-D477G
carriers exhibit various retinal degeneration phe-
notypes, including the simultaneous loss of
peripheral and central vision, which may involve
choroidal atrophy and often include macula and/
or RPE perturbations [6]. The onset of visual
impairment among the D477G carriers occurs at
various ages, and the degree of retinal degenera-
tion is often independent of the extent of the
decline in visual function [7]. Three groups have,
in total, generated five D477G knock-in (KI)
mouse models to study the pathophysiology of
the mutant in vivo [9]. As with the heterogeneous
clinical features of the D477G adRP patients, the
reported impacts of the mutation were diverse.
As yet, none of the WT/KI mouse models have
recapitulated the visual and morphological
defects found in the human patients or provided a
satisfactory explanation for the observed D477G
dominant pattern of human inheritance. Thus, the
molecular mechanisms for retinal dysfunction
and degeneration caused by the D477G mutation
remain inconclusive.
Here we report retinal dysfunction and mor-
phological changes in WT/KI that resembled the
phenotypes observed in patients. We discovered
that ambient light influenced the occurrence of
retinal dysfunction in the WT/KI mice. We
addressed the dominant-negative nature of the
mutation by comparing WT/KI to RPE65 KO
W. Wu et al.
heterozygotes (WT/KO). It is well documented
that one copy of the functional RPE65 gene is
sufficient to maintain normal retinal health and
vision in both human and rodent models [5]. We
demonstrated that when exposed under the same
day-light luminance intensity of 2000 lux, com-
pared to the WT/KO heterozygotes, the WT/KI
heterozygote mice displayed reduced total retina
thickness and reduced scotopic ERG amplitude
beginning at 15 months of age. Molecularly we
demonstrated that D477G causes atypical
protein-­protein interactions with WT-RPE65
leading to early RPE65 protein degradation (data
not shown). In this study, we ascertained that the
retinal dysfunction in the RPE65 WT/KI mouse
model is due to D477G being dominant negative.
We also identified a link between environmental
light and vision impairment caused by genetic
mutations.
2 Materials and Methods
2.1 Animals
All animal experiments were approved by the
Institutional Animal Care and Use Committee of
the University of Oklahoma Health Sciences
Center (Oklahoma City, OK) and performed fol-
lowing the guidelines of the Association for
Research in Vision and Ophthalmology Statement
for the Use of Animals in Ophthalmic and Vision
Research. The RPE65 D477G KI mouse model
was generated by our group previously [15].
RPE65 knockout (KO) mice were a kind gift
from Dr. Michael Redmond (National Eye
Institute, Bethesda, MD) [14]. WT/KI mice were
obtained by crossing homozygous RPE65 KO
with WT C57BL/6 J mice. All mice were in the
C57BL/6 J background and were maintained in
standard housing conditions with 12/12 h, food
and water ad libitum.
Environmental Light Has an Essential Effect on the Disease Expression in a Dominant RPE65 Mutation
2.1.1 Physiological Day-Light
Exposure
For chronic light exposure at physiological lumi-
nance of 2 K lux, the experimental mice were
first kept at regular vivarium dim-light (DimL,
~100 Lux) to around 3 months of age. At age
3 months, the WT/KI and the WT/KO were
grouped randomly to be maintained in 12 h day-­
light (DayL, ~2 K Lux)/12 h dark or in 12 h
DimL/12 h dark conditions.
2.2 ERG
Full-field ERG was recorded in the WT/KI and
WT/KO mice, maintained under either DimL or
DayL, every 3 months, as previously described
[13]. All ERGs were recorded with the Espion E3
system Ganzfeld Color Dome system (Diagnosys
LLC, Lowell, MA).
2.3 Histology
As previously described, enucleated eyes were
fixed in Davidson’s fixative and stored in 70%
ethanol for subsequent serial dehydration and
embedment in paraffin [11]. Eyes were sectioned
(5 μm thickness) on a standard microtome and
then annealed onto glass slides at 60 °C. Following
hematoxylin/eosin staining of tissue sections, the
Olympus Provis Ax-70 light microscope assessed
gross retinal morphology.
2.3.1 Spectral Domain Optical
Coherence Tomography
(SD-OCT)
Mice were anesthetized, and their pupils were
dilated. Artificial tears (Systane Ultra, Alcon,
Fort Worth, TX) were used to maintain corneal
hydration and clarity. The retinal thickness was
measured using a spectral-domain optical coher-
ence tomography (SD-OCT) device (Bioptigen
Inc. Durham, NC) following a previously estab-
lished method [12].
417
3 Results
3.1 DayL-Exposed RPE65 WT/KI
Mice Exhibited Both Retinal
Function and Morphological
Changes
Previously we and others have detected no visual
function differences between the WT/KI and the
wild-type (WT/WT) mice when raised under
dim-light (DimL) intensity (~100 lux) [9]. Here
we evaluated visual function in the WT/KI and
WT/KO mice exposed to day-light (DayL) lumi-
nance of 2 K lux and found that starting at
15 months of age, compared to the WT/KO, the
WT/KI mice exposed to DayL displayed reduced
scotopic ERG a- and b-wave amplitudes (Fig. 1).
Previous studies reported that WT/KI mice reared
under DimL showed normal retina morphology
[10]. Here we found that, compared to the WT/
KO, WT/KI mice maintained under DayL lumi-
nance displayed retina degeneration in the form
of decreased total retina thickness (Fig. 2a–e), a
phenotype seen in human D477G patients [6].
4 Discussion
In this study, we manipulated the environmental
luminance to expose the retinal pathogenic effect
of D477G. By directly comparing phenotypic
changes of the WT/KI to WT/KO mice, we pro-
vided functional and molecular (data not shown)
evidences supporting the dominant-negative
nature of the D477G mutant. WT/KI raised under
DayL showed reduced retinal ERG amplitudes
(Fig. 1) and architectural defects (Fig. 2d). Our
results suggested that the adverse physiological
consequence of D477G mutant co-expressed
with WT-RPE65 far exceeded that of losing a
single allele of WT-RPE65 (Figs. 1b and 2a, b),
which demonstrated that the retinal dysfunction
caused by WT/KI is not haploinsufficiency.
Moreover, we identified ambient light as a causal
factor that could induce the progression of IR.
418
Fig. 1 ERG declined in WT/KI exposed to DayL lumi-
nance. (a) Representative dark-adapted scotopic single-­
flash ERG traces at 4 cd.s/m2 in mice of indicated
genotypes maintained under DayL or DimL at age
Fig. 2 Total retina thickness thinning observed in DayL-­
exposed WT/KI mice. (a–d) Representative images of
H&E-stained paraffin-embedded eye sections from mice
of indicated genotypes. (e) SD-OCT quantification of
Acknowledgments The authors are grateful to the
OUSHC animal husbandry team for their diligence and
devotion to the well-being of all our mice. This study is
supported by the National Institutes of Health (NIH)
grants (EY018659, EY019309, EY012231, EY028949,
EY032930, EY032931).
W. Wu et al.
15 months. (b) Quantitative evaluation of scotopic
response amplitudes of the WT/KI and WT/KO. Data are
presented as mean ± SEM. n = 8 (*P ≤ 0.05 **P ≤ 0.01,
in one-way ANOVA with Tukey’s post hoc comparison)
total retina thickness in 15-month-old mice of indicated
genotypes exposed to DimL or DayL luminance. Data are
presented as mean ± SEM. n = 6 (**P ≤ 0.01, in one-way
ANOVA with Tukey’s post hoc comparison)
References
1. Aoun M, Passerini I, Chiurazzi P, Karali M, De
Rienzo I, Sartor G, et al. Inherited retinal diseases due
to RPE65 variants: from genetic diagnostic manage-
ment to therapy. Int J Mol Sci. 2021;22(13):7207.
Environmental Light Has an Essential Effect on the Disease Expression in a Dominant RPE65 Mutation
2. Bowne SJ, Humphries MM, Sullivan LS, Kenna PF,
Tam LCS, Kiang AS, et al. A dominant mutation in
RPE65 identified by whole-exome sequencing causes
retinitis pigmentosa with choroidal involvement. Eur
J Hum Genet. 2011;19(10):1074–81.
3. Cai X, Conley SM, Naash MI. RPE65: role in the
visual cycle, human retinal disease, and gene therapy.
Ophthalmic Genet. 2009;30(2):57–62.
4. Cremers FPM, Boon CJF, Bujakowska K, Zeitz
C. Special issue introduction: inherited retinal dis-
ease: novel candidate genes, genotype-phenotype
correlations, and inheritance models. Genes (Basel).
2018;9(4):215.
5. Galvin JA, Fishman GA, Stone EM, Koenekoop
RK. Evaluation of genotype-phenotype associations
in leber congenital amaurosis. Retina (Philadelphia,
Pa). 2005;25(7):919–29.
6. Hull S, Mukherjee R, Holder GE, Moore AT,
Webster AR. The clinical features of retinal disease
due to a dominant mutation in RPE65. Mol Vis.
2016;22:626–35.
7. Jauregui R, Park KS, Tsang SH. Two-year progres-
sion analysis of RPE65 autosomal dominant retinitis
pigmentosa. Ophthalmic Genet. 2018;39(4):544–9.
8. Kenna PF, Humphries MM, Kiang A-S, Brabet P,
Guillou L, Ozaki E, et al. Advanced late-onset retini-
tis pigmentosa with dominant-acting D477G RPE65
mutation is responsive to oral synthetic retinoid ther-
apy. BMJ Open Ophthalmol. 2020;5(1):e000462-e.
9. Kiang AS, Kenna PF, Humphries MM, Ozaki E,
Koenekoop RK, Campbell M, et al. Properties and ther-
apeutic implications of an enigmatic D477G RPE65
419
variant associated with autosomal dominant retinitis
pigmentosa. Genes (Basel). 2020;11(12):1420.
10. Li Y, Furhang R, Ray A, Duncan T, Soucy J, Mahdi R,
et al. Aberrant RNA splicing is the major pathogenic
effect in a knock-in mouse model of the dominantly
inherited c.1430A>G human RPE65 mutation. Hum
Mutat. 2019;40(4):426–43.
11. Ma X, Takahashi Y, Wu W, Liang W, Chen J,
Chakraborty D, et al. ADAM17 mediates ectodomain
shedding of the soluble VLDL receptor fragment in the
retinal epithelium. J Biol Chem. 2021;297(4):101185.
12. Qiu F, Ma X, Shin Y-H, Chen J, Chen Q, Zhou K,
et al. Pathogenic role of human C-reactive protein in
diabetic retinopathy. Clin Sci. 2020;134(13):1613–29.
13. Qiu F, Meng T, Chen Q, Zhou K, Shao Y, Matlock G,
et al. Fenofibrate-loaded biodegradable nanoparticles
for the treatment of experimental diabetic retinopathy
and neovascular age-related macular degeneration.
Mol Pharm. 2019;16(5):1958–70.
14. Redmond TM, Yu S, Lee E, Bok D, Hamasaki D,
Chen N, et al. Rpe65 is necessary for production
of 11-cis-vitamin A in the retinal visual cycle. Nat
Genet. 1998;20(4):344–51.
15. Shin Y, Moiseyev G, Chakraborty D, Ma J-X. A
dominant mutation in Rpe65, D477G, delays dark
adaptation and disturbs the visual cycle in the mutant
knock-in mice. Am J Pathol. 2017;187(3):517–27.
16. Thompson DA, Gyürüs P, Fleischer LL, Bingham
EL, McHenry CL, Apfelstedt-Sylla E, et al. Genetics
and phenotypes of RPE65 mutations in inherited
retinal degeneration. Invest Ophthalmol Vis Sci.
2000;41(13):4293–9.
 Microglia Preserve Visual Function
in a Mouse Model of Retinitis
Pigmentosa with Rhodopsin-P23H
Mutant

Chen Yu and Daniel R. Saban

Abstract Keywords

Microglia · Macrophages · Subretinal space ·

Most forms of outer retinal degenerative dis-
Photoreceptor · Retinal degeneration ·
eases involve the ectopic accumulation of
Retinitis pigmentosa · Rhodopsin · P23H
microglia/macrophages in the subretinal
space, including retinitis pigmentosa.
However, their role in the loss of photorecep-
tor function during retinal degeneration
Abbreviations
remains unknown. Here, we examined the
effect of conditional microglial depletion on
CNS central nervous system
photoreceptor numbers and visual function in
DAM disease-associated microglia
mice with the rhodopsin P23H mutation, a
ERG electroretinogram
dominant form of retinitis pigmentosa in
ONL outer nuclear layer
humans. We found that microglial depletion
RPE retinal pigment epithelium
led to an elevated level of rhodopsin and
increased photoreceptor layer thickness.
However, overall electrophysiological func-
tions of the retina were reduced with microg- 1 Introduction
lial depletion. Therefore, these results identify
an essential role of microglia specially in pre- Microglia, the tissue-resident macrophages in the
serving visual function in outer retinal central nervous system (CNS), are the major
degeneration. immune cells and serve as immune sentinels of
the CNS, including the retina [1, 2]. In particular
to outer retinal degenerative diseases in both ani-
C. Yu
Department of Ophthalmology, Duke University mal models and patients, microglia/macrophages
School of Medicine, Durham, NC, USA are found accumulating at the site of degenera-
D. R. Saban (*) tion, referred to as the subretinal space [3, 4].
Department of Ophthalmology, Duke University However, studies of microglia function in disease
School of Medicine, Durham, NC, USA are often confounded by the presence of infiltrat-
Departments of Ophthalmology and Immunology, ing of monocyte-derived cells [5–7]. Given the
Duke University School of Medicine, differences in ontogeny and residency between
Durham, NC, USA microglia and infiltrated monocyte-derived mac-
e-mail: daniel.saban@duke.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 421
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_62
422
rophages [8], appreciations of their functional
differences have been emerging in many degen-
erative settings of the CNS. Recently, we identi-
fied that microglia are the predominant cells at
the subretinal space, which clear photoreceptor
debris and protect the retinal pigment epithelium
(RPE) from damage caused by degeneration [9].
However, it remains unclear about their role in
preservation of photoreceptors and vision in
degeneration. Here, we performed microglia-­
specific depletion to understand their impact on
photoreceptor function in a genetic mouse model
of retinitis pigmentosa with rhodopsin-P23H
mutant (RhoP23H mice) [10], which is a dominant
form of retinitis pigmentosa in humans.
2 Materials and Methods
2.1 Animals
Cx3cr1YFP-Cre-ER (stock No. 021160) and
Rosa26iDTR (stock No. 006148) were originally
purchased from the Jackson Laboratories. RhoP23H
mice were generated as described previously
[10]. These mice were crossed to generate
RhoP23H/+; Cx3cr1YFP-Cre-ER/+; Rosa26iDTR/+ (P23H-­
iDTR) mice for microglia-specific depletion. All
mice herein did not carry rd8 mutation and were
bred and housed at a barrier-free and specific-­
pathogen-­free facility at Duke University School
of Medicine. All procedures were carried out in
accordance with the guidelines of the Association
for Research in Vision and Ophthalmology state-
ment for the “Use of Animals in Ophthalmic and
Vision Research” and approved by the
Institutional Animal Care and Use Committee at
Duke University.
2.2 Microglia-Conditional
Depletion
Tamoxifen (Sigma-Aldrich, 75 mg/kg dissolved
in corn oil) was intraperitoneally injected at post-
natal day 4 (P4) and 7 (P7), respectively. After
tamoxifen treatment, mice were intraperitoneally
injected with two doses of 0.5 μg diphtheria toxin
C. Yu and D. R. Saban
(DT; Sigma-Aldrich) at P21 and P28, and used
for experiment at P60. The same genotype litter-
mates that did not receive DT were used as con-
trols for experiments.
2.3 Electroretinogram (ERG)
ERG was performed as previously described
[11]. Briefly, mice were dark-adapted for at least
4 h, and pupils were dilated with 0.5% (wt/vol)
tropicamide and 1.25% (wt/vol) phenylephrine
and anesthetized with a mixture of ketamine
(100 mg/kg) and xylazine (10 mg/kg). Scotopic
ERG responses were recorded using an Espion
E2 system (Diagnosys LLC, Lowell, MA), at
increasing flash intensities (2.5 × 10−5, 5 × 10−5,
5 × 10−4, 5 × 10−3, 0.05, 0.5, 5, 50, and 500 cd·s/
m2). Recordings consisted of single-flash presen-
tations, repeated 0–15 times to verify the response
reliability and improve the signal-to-noise ratio.
2.4 Tissue Processing
for Histology
and Immunoblotting
For histology of plastic sections, euthanized mice
were perfused with PBS and then fixed via trans-
cardial perfusion with 0.1% cacodylate buffer
(pH = 7.2) containing 2% paraformaldehyde and
2% glutaraldehyde. The eye tissues were post-
fixed in the same fixative for at least 24 h and
then processed in a solution of 2% osmium
tetroxide in 0.1% cacodylate buffer, following by
dehydration with gradient ethanol from 50% to
100% and propylene oxide, and infiltration of
propylene oxide: epoxy 812 compound with the
ratio of 1:1 overnight under the vacuum. Samples
were further processed with pure epoxy 812
compound the next day and embedded in fresh
epoxy 812 compound resins at 65 °C overnight.
Semi-thin cross sections with 0.5 μm thickness
were stained with 1% methylene blue.
For immunoblotting, dissected retinas were
sonicated with 2% SDS in PBS containing prote-
ase inhibitor mixture. Lysates were centrifuged at
14,800 g for 5 min, and then supernatants were
Microglia Preserve Visual Function in a Mouse Model of Retinitis Pigmentosa with Rhodopsin-P23H Mutant 423

collected. Equal volumes of supernatants were 3.2 Effect of Microglial Depletion

loaded to SDS/PAGE. Proteins were transferred on Photoreceptor Cell
to PVDF membrane (Bio-Rad) and probed with Numbers
primary antibodies against rhodopsin (4D2) and
HLA and goat secondary antibodies conjugated To compare rod photoreceptor levels, we first
with Alexa Fluor 680 or 800 (Invitrogen). Protein analyzed the protein level of rhodopsin in retinal
levels were detected using an Odyssey infrared lysates. Immunoblotting revealed a ~25%
imaging system (LI-COR Bioscience). increase in normalized rhodopsin levels in the
microglia depletion setting (Fig. 1b, c). To test
the effect of microglial depletion on photorecep-
2.5 Statistics tor cell numbers, we measured the thickness of
outer nuclear layer (ONL) in central retinal cross
Graphical data presented in this study are pre- sections across the optic nerve. We found that
sented as the means ± SDs. Data normality and microglial depletion resulted in a thicker photo-
homogeneity of variance were assessed to fit the receptor layer compared with non-depleted con-
assumptions of tests, and transformation was per- trol group (Fig. 1d), which is consistent with
formed when necessary. Two-group comparisons elevated rhodopsin level. Therefore, these data
were analyzed using unpaired Student’s two-­ suggest that microglial clearance contributes to
tailed t test. Multiple-factor comparisons were removal of photoreceptors in retinitis pigmen-
analyzed using ANOVA with Tukey’s post hoc tosa. However, microglial depletion also led to
test. A p-value of <0.05 was considered statisti- the accumulation of dead photoreceptors in this
cally significant. Statistical graphs were gener- model as shown previously [9]. In addition, we
ated using GraphPad Prism version 9.1.2 (La found that the length of outer segment appears
Jolla). shortened with microglial depletion compared
with control, suggesting a compromised function
of these photoreceptors in the absence of microg-
3 Results lia (Fig. 1e).

3.1 Conditional Microglial

Depletion in RhoP23H Mice
To investigate the effect of microglia on photo-
receptors in retinal degeneration, we utilized
lineage tracing technique in P23H-iDTR mice
to specifically deplete microglia. Briefly, the
expression of DTR driven by a macrophage pro-
moter of Cx3cr1 was induced by tamoxifen
treatments at P4 and P7. During 2-week wash-
out period, short-­lived monocytes were replaced
by Cx3cr1− bone marrow stem cells and lost
DTR expression, while long-lived microglia
maintained the expression of DTR. Therefore,
by administrating DT, we were able to deplete
microglia but spare monocyte-derived cells. We
achieved approximately 70% depletion effi-
ciency by analyzing the abundance of subretinal
microglia at P60, 1 month since last DT admin-
istration (Fig. 1a).
3.3 Effect of Microglial Depletion
on Visual Function
Next, we examined visual function of these mice
by measuring their scotopic and photopic ERG
responses. Interestingly, despite increased photo-
receptor cell number with microglial depletion,
scotopic a-waves were similar between two
groups, which suggests the presence of nonfunc-
tional photoreceptors or reduced function of indi-
vidual rod photoreceptor with microglial
depletion (Fig. 2a). Moreover, amplitudes of sco-
topic b-waves were reduced with microglial
depletion, indicating deficiency in responses of
postsynaptic neurons to rod photoreceptors
(Fig. 2b). We did not detect any significant
changes in either photopic a-waves or b-waves at
P60 (Fig. 2c, d). Collectively, our findings dem-
onstrate that microglia depletion leads to impaired
424
Fig. 1 Microglial depletion led to the inefficient clear-
ance of photoreceptors in RhoP23H mice. (a) Quantifications
of depletion efficiency of subretinal microglia between
control (ctrl, n = 4) and depleted (dep, n = 8) P23H-iDTR
mice [9]. (b) Representative immunoblots showing
increased rhodopsin level with microglial depletion as
indicated. (c) Quantifications of normalized rhodopsin
(Rho) protein levels between control and microglial
Fig. 2 Microglial depletion impaired dark-adapted vision
in RhoP23H mice. Graphs showing a-waves and b-waves of
scotopic (a and b) and photopic ERG responses (c and d),
visual function derived from rod but not cone
photoreceptors in the rhodopsin-P23H mouse
model of retinitis pigmentosa.
4 Discussion
In this study, we applied conditional microglia
depletion and demonstrated that absence of
microglia accelerates loss of both functional pho-
toreceptors and vision in retinitis pigmentosa.
The increased rhodopsin protein level and photo-
receptor layer by microglial depletion appear to
result from the absence of dead cell clearance. A
recent study showed that microglia utilize C3 and
C. Yu and D. R. Saban
depletion. Rhodopsin levels were normalized to the load-
ing control HLA and shown as relative to control (n = 5
per group). (d) Graph showing ONL thickness with dis-
tance to the optic nerve. Ctrl: n = 10; dep: n = 15 [9]. (e)
Representative images of retinal cross sections showing
the shrinkage of outer segments with microglial depletion
as indicated by arrows [9]. Scale bar = 100 μm. *p < 0.05;
**p < 0.01; ***p < 0.001
respectively. N = 5 mice per group. **p < 0.01. ns not
significant
CR3-dependent clearance to protect photorecep-
tors in rd10 mouse model of retinitis pigmentosa
[12]. Together with our previous findings on their
protection to RPE cells [9], these results indicate
a critical role of clearance by microglia to limit
deleterious materials released from cell death and
to restore retinal homeostasis in degeneration.
We showed that microglial depletion leads to a
deterioration of ERG responses in RhoP23H mice,
especially scotopic b-waves. Reduced b-waves
may result from lack of direct protection or func-
tional support by microglia on postsynaptic neu-
rons or photoreceptors [13]. Moreover, microglial
depletion had negligible consequences on scoto-
pic a-waves in our study, which could be
Microglia Preserve Visual Function in a Mouse Model of Retinitis Pigmentosa with Rhodopsin-P23H Mutant
explained by at least two reasons. First, the extra
photoreceptors are not likely all dead and do not
completely lose their functions. Some of them
may be in the process of losing functions but still
partially contribute to the ERG responses.
Second, microglia repopulate themselves in the
brain and retina after depletion [14, 15].
Repopulating microglia since depletion at P28
may further minimize the difference on scotopic
a-waves observed in this study.
Recent single-cell RNA-sequencing data
reveal that these subretinal microglia undergo
transcriptional reprogramming [9, 16], which are
similar with disease-associated microglia (DAM)
in other CNS degenerative conditions [17]. Our
strategy demonstrated a protective net effect of
microglial depletion and eliminated about ~70%
subretinal microglia. Given their proximity to
degenerating photoreceptors and the RPE, we
speculate that the phenotypes of microglial
depletion are largely due to loss of these cells
specifically in the subretinal microglia. However,
we cannot rule out the direct contribution of
microglia in the inner retina. Further studies are
needed to better understand the precise role of
subretinal microglia in retinal degeneration.
Acknowledgments This work was funded by the
National Institutes of Health grants R01EY030906 and
R01EY021798 from the National Eye Institute, Bright
Focus Foundation MDR grant, Research to Prevent
Blindness (Unrestricted, Duke Eye Center), NIH/NEI
Core grant P30EY005722 (Duke Eye Center). We would
like to thank William J. Spencer and Mikael Klingeborn
for their technical supports.
References
1. Yu C, Roubeix C, Sennlaub F, Saban DR. Microglia
versus monocytes: distinct roles in degen-
erative diseases of the retina. Trends Neurosci.
2020;43(6):433–49.
2. Reyes NJ, O’Koren EG, Saban DR. New insights into
mononuclear phagocyte biology from the visual sys-
tem. Nat Rev Immunol. 2017;17(5):322–32.
3. Thanos S. Sick photoreceptors attract activated
microglia from the ganglion cell layer: a model to
study the inflammatory cascades in rats with inherited
retinal dystrophy. Brain Res. 1992;588(1):21–8.
4. Gupta N, Brown KE, Milam AH. Activated microg-
lia in human retinitis pigmentosa, late-onset retinal
425
degeneration, and age-related macular degeneration.
Exp Eye Res. 2003;76(4):463–71.
5. O’Koren EG, Mathew R, Saban DR. Fate mapping
reveals that microglia and recruited monocyte-derived
macrophages are definitively distinguishable by phe-
notype in the retina. Sci Rep. 2016;6:20636.
6. Sennlaub F, Auvynet C, Calippe B, Lavalette S,
Poupel L, Hu SJ, et al. CCR2(+) monocytes infiltrate
atrophic lesions in age-related macular disease and
mediate photoreceptor degeneration in experimental
subretinal inflammation in Cx3cr1 deficient mice.
EMBO Mol Med. 2013;5(11):1775–93.
7. Lad EM, Cousins SW, Van Arnam JS, Proia
AD. Abundance of infiltrating CD163+ cells in the
retina of postmortem eyes with dry and neovascular
age-related macular degeneration. Graefes Arch Clin
Exp Ophthalmol. 2015;253(11):1941–5.
8. Ginhoux F, Greter M, Leboeuf M, Nandi S, See P,
Gokhan S, et al. Fate mapping analysis reveals that
adult microglia derive from primitive macrophages.
Science. 2010;330(6005):841–5.
9. O’Koren EG, Yu C, Klingeborn M, Wong AYW,
Prigge CL, Mathew R, et al. Microglial function is
distinct in different anatomical locations during
retinal homeostasis and degeneration. Immunity.
2019;50(3):723–37 e7.
10. Sakami S, Maeda T, Bereta G, Okano K, Golczak M,
Sumaroka A, et al. Probing mechanisms of photo-
receptor degeneration in a new mouse model of the
common form of autosomal dominant retinitis pig-
mentosa due to P23H opsin mutations. J Biol Chem.
2011;286(12):10551–67.
11. Herrmann R, Lobanova ES, Hammond T, Kessler C,
Burns ME, Frishman LJ, et al. Phosducin regulates
transmission at the photoreceptor-to-ON-bipolar cell
synapse. J Neurosci. 2010;30(9):3239–53.
12. Silverman SM, Ma W, Wang X, Zhao L, Wong
WT. C3- and CR3-dependent microglial clearance
protects photoreceptors in retinitis pigmentosa. J Exp
Med. 2019;216(8):1925–43.
13. Wang X, Zhao L, Zhang J, Fariss RN, Ma W,
Kretschmer F, et al. Requirement for microglia for the
maintenance of synaptic function and integrity in the
mature retina. J Neurosci. 2016;36(9):2827–42.
14. Huang Y, Xu Z, Xiong S, Sun F, Qin G, Hu G, et al.
Repopulated microglia are solely derived from the
proliferation of residual microglia after acute deple-
tion. Nat Neurosci. 2018;21(4):530–40.
15. Huang Y, Xu Z, Xiong S, Qin G, Sun F, Yang J, et al.
Dual extra-retinal origins of microglia in the model of
retinal microglia repopulation. Cell Discov. 2018;4:9.
16. Yu C, Saban DR. Identification of a unique sub-
retinal microglia type in retinal degeneration
using single cell RNA-Seq. Adv Exp Med Biol.
2019;1185:181–6.
17. Keren-Shaul H, Spinrad A, Weiner A, Matcovitch-­
Natan O, Dvir-Szternfeld R, Ulland TK, et al. A
unique microglia type associated with ­ restricting
development of Alzheimer’s disease. Cell.
2017;169(7):1276–90 e17.
 Part IX
Mechanisms
of Degeneration – Metabolism
 Measuring the Release of Lactate
from Wild-Type and rd1 Mouse
Retina
Yiyi Chen, Laimdota Zizmare,
Christoph Trautwein,
and François Paquet-Durand
Abstract
The retina has the highest energy consumption
of any tissue in the human body. Remarkably,
to satisfy its energy demand, the retina appears
to rely mostly on aerobic glycolysis, which
results in the production and release of large
amounts of lactate. In the present study, we
compared two different methods to assess lac-
tate release from in vitro organotypic retinal
explants cultured under entirely controlled,
serum-free conditions. We used a standard
lactate assay kit and 1H-nuclear magnetic res-
onance (NMR) spectroscopy-based analysis.
We found that during the culturing of retinal
explants derived from wild-type mice, lactate
was released in large amounts and that the two
different methods agreed well with each other.
When comparing wild-type retina with degen-
erating rd1 mouse retina, we found the latter
to release significantly higher amounts of lac-
tate. Hence, degenerating retina may have an
Y. Chen · F. Paquet-Durand (*)
Cell Death Mechanism Group, Institute for
Ophthalmic Research, University of Tübingen,
Tübingen, Germany
e-mail: Francois.paquet-durand@klinikum.uni-
tuebingen.de
L. Zizmare · C. Trautwein
Werner Siemens Imaging Center, Department of
Preclinical Imaging and Radiopharmacy, University
of Tübingen, Tübingen, Germany
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_63
even higher energy demand and metabolic rate
compared to healthy retina. We conclude that
the use of lactate measurement can be a reli-
able and simple readout to evaluate ongoing
retinal metabolism.
Keywords
Aerobic glycolysis · Retinal metabolism ·
Retina degeneration · Warburg effect ·
NMR Spectroscopy
1 Introduction
The metabolism of the retina is characterized by
a very high energy demand [1, 2] most of which
likely stems from photoreceptors and their need
to maintain the so-called dark current [3, 4]. Most
of the ATP generated in the retina likely comes
from the relatively energy-inefficient glycolysis,
even though oxygen for the more energy-efficient
oxidative phosphorylation would be available.
This phenomenon was recognized by Otto
Warburg already 100 years ago and termed “aero-
bic glycolysis” [5–7]. The by-product of glycoly-
sis, lactate, is a highly dynamic metabolite that
may shuttle through the retinal pigment epithe-
lium (RPE), to the bloodstream. In the retina high
lactate levels (13 mM) were detected at the inter-
photoreceptor matrix, while 3.8 mM lactate was
measured near the RPE surface [8].
429
430
Given the significance of lactate for retinal
energy metabolism, we set out to explore the extra-
cellular lactate released from organotypic retinal
explant cultures using two different ­methodologies:
[1] enzymatic lactate conversion and colorimetric
detection and [2] 1H-nuclear magnetic reso-
nance (NMR) spectroscopy-based metabolomics
analysis. With both methods we found a strong and
continuous lactate excretion from the cultured ret-
ina. Moreover, retina derived from the Pde6b
mutant, photoreceptor degeneration rd1 mouse [9],
released significantly larger amounts of lactate into
the surrounding medium when compared with
wild-type (WT). Given the stability of lactate, we
demonstrate its potential usage in in vitro organo-
typic retinal explant cultures as a biomarker for
metabolic activity under both physiological and
pathophysiological conditions.
2 Materials and Methods
2.1 Animals
C3H HeA Pde6brd1/rd1 (rd1) and congenic C3H
HeA Pde6b+/+ wild-type (WT) mice were used
[10]. Animals were housed under standard white
cyclic illumination, had a free access to food and
water, and were used irrespective of gender. The
procedures were reviewed and approved by the
Tübingen University review board (AK02-19 M),
and in compliance with the association for
research in vision and ophthalmology (ARVO)
statement for the use of animals in ophthalmic
and visual research. Postnatal (P) day 9 animals
were sacrificed by decapitation, and both eyes
were used for the explant preparation. A total of
17 animals was used in this study, yielding 34
retinal explant cultures.
2.2 Organotypic Retinal Explant
Cultures
Retinal explants were derived from P9 mice and
were cultured in R16 medium (Gibco, Paisley,
Ireland; Cat. No.: 07491252A) free of serum
Y. Chen et al.
and antibiotics, as previously described [11–
13]. Briefly, after removing the sclera, the retina
was placed on cell culture inserts (Corning,
Kennebunk, ME; Cat. No.: 3412), with the gan-
glion cell layer facing up and cultured in 1 ml
R16 complete medium (CM) in a humidified
incubator with 5% CO2 at 37 °C. The whole cul-
ture medium was collected and replaced by 1 ml
of fresh CM every 2 days. The culture was
ended at P15 and the retinal tissue was fixed
with 4% PFA and embedded in cryomatrix for
subsequent cryosectioning. For immunohisto-
chemistry, cryosections were rinsed with PBS
three times at room temperature. Then, cell
nuclei were stained with DAPI and sections
were mounted with Vectashield. Finally, fluo-
rescence images were generated by a Zeiss
microscope equipped with a Z1 Aptome (Zeiss,
Oberkochen, Germany).
2.3 Lactate Measurements
Lactate in culture media were measured spec-
trophotometrically using the L-lactate assay kit
I from Eton Bioscience Inc. (San Diego, CA,
USA; Cat. No.: 120001100P). In this assay the
enzyme lactate dehydrogenase converts lactate
and NAD+ into pyruvate and NADH. The
detection is based on the subsequent reduction
of the tetrazolium salt iodonitrotetrazolium
(INT) in a NADH-­coupled enzyme reaction to
formazan, which exhibits an absorbance maxi-
mum at 490 nm. Briefly, L-lactate standards
and culture media samples were added into the
corresponding wells of a 96-well plate. 50 μl of
L-lactate assay solution was added to each
well. Subsequently, the 96-well plate was incu-
bated at 37 °C for 30 min. Then, the reaction
was stopped by addition of 50 μl 0.5 M acetic
acid to each well, followed by brief and gentle
agitation. Finally, the absorbance was mea-
sured by a Tecan Spark10M microplate reader
(Tecan, Männedorf, Switzerland). The lactate
concentration was proportional to the absor-
bance value at 490 nm and was calculated
based on the lactate standard curve.
Measuring the Release of Lactate from Wild-Type and rd1 Mouse Retina 431

2.4 Lactate Measurements Based 3 Results

on 1H-NMR
3.1 Steady Secretion of Lactate
400 μL of retina culture media was added to from Mouse Retina
400 μL of ultrapure methanol, thoroughly mixed
and centrifuged at 30,000× g for 30 min to remove To measure lactate release from retinal explants,
remaining solid particles that would disturb the we used the supernatant medium, which was col-
magnetic field homogeneity. The clear supernatant lected every 2 days at P11, P13, and P15 during
was transferred to a new PTFE tube, and the solu- media change. Media samples were split and ana-
tion was evaporated to dryness overnight in a vac- lyzed either with the standard lactate assay kit or
uum concentrator. Dry metabolite pellet was by using 1H-NMR spectroscopy. Notably, the
resuspended in 45 μL 200 mM phosphate serum-free R16 medium did not contain any lac-
(K2HPO4) buffer containing 200 μM NaN3 tate initially. After 2 days in culture, the lactate
(pH = 7.4). Due to the very high salt content, an content was strongly increased, a phenomenon
internal standard could not be used for absolute that was detected with both lactate assays (P11
quantification of metabolites; instead, integral lactate assay kit, 2.90 ± 0.20 mM, p < 0.001; 1H-­
areas were used for relative quantification. The NMR, 62.48 ± 8.32 standard area (sa), p < 0.001).
suspension was centrifuged at 30,000× g for Between P11 and P13, lactate continued to accu-
10 min, and 40 μL of the supernatant was trans- mulate in the culture media with an even higher
ferred to 1.7 mm autosampler-compatible NMR release rate (P13 lactate assay kit: 3.32 ± 0.17 mM;
tubes (Bruker BioSpin, Germany). Spectra were 1
H-NMR 64.15 ± 3.99 sa). By P15, lactate release
acquired on a 600 MHz ultra-shielded NMR spec- continued increasing abundantly (lactate assay
trometer (Avance III HD, Bruker BioSpin, kit 3.72 ± 0.79 mM; 1H-NMR 81.87 ± 7.02 sa,
Germany) with a 1.7 mm room temperature triple p < 0.01) (Fig. 1).
resonance probe at 298 K. A 1H-NMR 15 min
Carr-Purcell-Meiboom-Gill (CPMG) experiment
with residual macromolecule and water suppres- 3.2 Increased Lactate Release
sion was used. Spectra were processed in Bruker from rd1 Mouse Retina
TopSpin 3.6.1 software, and lactate integral area
was calculated by Chenomx NMR Suite 8.5 We then employed the lactate assay to compare
software. lactate release from a healthy wild-type (WT)
and degenerating rd1 mouse retina. In rd1 retina
a rapid degeneration of photoreceptors occurs
2.5 Statistics starting at around P11. By P15 around 80% of the
rd1 photoreceptors had been lost (Fig. 2a). We
Data were analyzed using Microsoft Excel and followed the temporal changes in lactate release
GraphPad Prism 9.1. Values are given as in culture media from rd1 and WT retina over a
mean ± SD. The data were compared using two-­ period of 6 days, from P9 to P15 (Fig. 2b). Retina
way ANOVA and subsequent Tukey’s multiple from rd1 mice displayed an overall increased
comparison tests. Significance levels as indicated release of lactate compared to WT retina
by asterisks were *p < 0.05; **p < 0.01, and (p < 0.001). Noticeably, a considerably higher
***p < 0.001. release rate was observed from rd1 mice during
the first 2 days (P9–P11) of culturing. Later on,
432
Fig. 1 Release of lactate from wild-type retina into the
R16 culture medium. The line graphs depict extracellular
lactate levels in the organotypic retinal explant culture
medium measured by lactate assay kit (a) and 1H-NMR
spectroscopy (b). Retinal explants were cultured from P9
to P15 in complete R16 medium (CM). The CM was col-
Fig. 2 Comparison of lactate release from wild-type and
rd1 mouse retina. (a) Histological cross section of retinal
tissues from rd1 and wild-type (WT) mice. From P11 to
P15, rd1 mice went through a rapid degeneration of pho-
toreceptors such that, at P15, the outer nuclear layer
(ONL) was markedly thinner than at P11 or when com-
from P13 to P15, lactate release rate slowed
down, yet the overall production was still higher
than in WT.
4 Discussion
In this study, we explored the extracellular release
of lactate from organotypic retinal explant cul-
tures. We used a conventional enzymatic lactate
assay and 1H-NMR spectroscopy-based detection
to show that WT retina releases large amounts of
lactate into the surrounding medium. Remarkably,
lactate release from degenerating rd1 retina was
Y. Chen et al.
lected in triplicate for the lactate assay kit and in five rep-
licates for the 1H-NMR spectroscopy analysis of
extracellular lactate. Data points indicate mean values and
standard deviation; statistical analysis was performed
using one-way ANOVA and Tukey’s multiple comparison
test
pared to aged-matched WT. (b) Lactate release from WT
and rd1 retina explant cultures was measured by lactate
assay kit. Data points shown are mean values and standard
deviation for n = 3. Statistical analysis was performed
using two-way ANOVA and Sidak’s multiple comparison
test
even higher than that of WT. Since the retina is
exceptional in its abundant use of aerobic gly-
colysis, measuring lactate release provides a
unique opportunity to deduce retinal metabolic
activity.
Even though the fact that the retina releases
enormous amounts of lactate in the presence of
oxygen was discovered already 100 years ago
[5], the precise reasons for this phenomenon are
still not completely understood. Moreover, it is
not clear which retinal cell type is responsible for
aerobic glycolysis and lactate production. While
photoreceptors harbor large numbers of mito-
chondria in their inner segments – suggesting that
Measuring the Release of Lactate from Wild-Type and rd1 Mouse Retina
they should perform oxidative phosphorylation –
a recent study indicated that photoreceptors were
using mostly glycolysis to satisfy their large
energy demands [14]. In explant cultures the
strong excretion of lactate between P9 and P15
may at least partially be related to high develop-
mental requirements. The fact that rd1 retinal
explants release approximately twice as much
lactate compared to WT retina suggests a higher
glycolytic rate in the mutant. This in turn could
mean that dying rd1 photoreceptors have a
strongly increased energy demand and could help
to explain their rapid degeneration phenotype.
The relative decrease of lactate release observed
in rd1 retina from P13 to P15 may then be due to
the fact that by this time most photoreceptor cells
have already been lost.
Compared to other metabolites, lactate is
abundant, stable, and can be easily detected [15].
It has been reported that lactate is 10–50 times
more plentiful than pyruvate in cells, serving as
bridge between glycolysis and mitochondria
[16]. With its long and extensive studied history,
lactate is an attractive surrogate marker for study-
ing retinal energy metabolism. At a systemic
level, lactate measurement has been long-­
established in clinical practice as a blood marker
of tissue hypoxia. The significant difference
observed in our study between WT and rd1 retina
indicates that also in RD patient blood samples,
lactate measurements may allow detecting and
monitoring retinal disease state.
Our study confirmed the validity and reliabil-
ity of both lactate kit and 1H-NMR spectroscopy-­
based measurements. Moreover, our data
indicated lactate as a stable and reliable readout
when comparing to other metabolites, such as
ATP. Besides the commercial availability, the
assay kit requires no additional time-consuming
steps. The divergence between the two methods
could result from limits in sensitivity and vari-
ability of the enzyme activity-based colorimetric
approach. However, when attempting to quantify
more than one specific metabolite, the NMR
spectroscopy-based approach can give a full view
on the present metabolic readout. Furthermore,
future NMR assays should incorporate external
433
calibration (e.g., by the ERETIC approach [17])
to fully quantify also NMR data.
In conclusion, we showed two reliable meth-
ods for measuring extracellular lactate in an in
vitro organotypic retinal culture system. This cul-
ture system could be extremely useful in further
retinal energy metabolism studies as it allows
manipulating the retina under entirely controlled
conditions. Given the simplicity, stability, and
cost-effectiveness of lactate measurement, extra-
cellular lactate can be a readily quantifiable read-
out for evaluating cellular metabolic changes
even in a particular disease condition.
Acknowledgments We are grateful for excellent techni-
cal support from Norman Rieger. This study was sup-
ported by grants from the Tistou and Charlotte Kerstan
Foundation and the Chinese Scholarship Council. This
work was supported by Prof. Dr. Bernd J. Pichler and
Werner Siemens Foundation for the access to the NMR
spectroscopy equipment.
References
1. Ames A 3rd, Li YY, Heher EC, Kimble CR. Energy
metabolism of rabbit retina as related to function: high
cost of Na+ transport. J Neurosci. 1992;12(3):840–53.
2. Wong-Riley MT. Energy metabolism of the visual
system. Eye Brain. 2010;2:99–116.
3. Dowling JE. The retina: an approachable part of the
brain. Harvard University Press; 1987.
4. Okawa H, Sampath AP, Laughlin SB, Fain GL. ATP
consumption by mammalian rod photoreceptors in
darkness and in light. Curr Biol. 2008;18(24):1917–21.
5. Warburg O. The metabolism of carcinoma cells. J
Cancer Res. 1925;9(1):148–63.
6. Petit L, Ma S, Cipi J, Cheng SY, Zieger M, Hay N,
et al. Aerobic glycolysis is essential for normal rod
function and controls secondary cone death in retinitis
pigmentosa. Cell Rep. 2018;23(9):2629–42.
7. Vander Heiden MG, Cantley LC, Thompson
CB. Understanding the Warburg effect: the meta-
bolic requirements of cell proliferation. Science.
2009;324(5930):1029–33.
8. Adler AJ, Southwick RE. Distribution of Glucose
and Lactate in the Interphotoreceptor Matrix.
Ophthalmic Research. 1992;24(4):243–252. https://
doi.org/10.1159/000267174
9. Arango-Gonzalez B, Trifunović D, Sahaboglu A,
Kranz K, Michalakis S, Farinelli P, et al. Identification
of a common non-apoptotic cell death mecha-
nism in hereditary retinal degeneration. PLoS One.
2014;9(11):e112142.
434 Y. Chen et al.

10. Sanyal S, Bal AK. Comparative light and electron 15. Seymour CW, Carlbom D, Cooke CR, Watkins TR,
microscopic study of retinal histogenesis in normal Bulger EM, Rea TD, et al. Temperature and time sta-
and rd mutant mice. Z Anat Entwicklungsgesch. bility of whole blood lactate: implications for feasi-
1973;142(2):219–38. bility of pre-hospital measurement. BMC Res Notes.
11. Caffe AR, Ahuja P, Holmqvist B, Azadi S, Forsell 2011;4(1):169.
J, Holmqvist I, et al. Mouse retina explants after 16. Brooks GA. The science and translation of lactate
long-term culture in serum free medium. J Chem shuttle theory. Cell Metab. 2018;27(4):757–85.
Neuroanat. 2001;22(4):263–73. 17. Akoka S, Barantin L, Trierweiler M. Concentration
12. Sahaboglu A, Tanimoto N, Bolz S, Garrido MG, measurement by proton NMR using the ERETIC
Ueffing M, Seeliger MW, et al. Knockout of method. Anal Chem. 1999;71(13):2554–7.
PARG110 confers resistance to cGMP-induced tox-
icity in mammalian photoreceptors. Cell Death Dis.
2014;5(5):e1234-e.
13. Belhadj S, Tolone A, Christensen G, Das S, Chen Y,
Paquet-Durand F. Long-term, serum-free cultivation
of organotypic mouse retina explants with intact reti-
nal pigment epithelium. J Vis Exp. 2020;165 https://
doi.org/10.3791/61868.
14. Kanow MA, Giarmarco MM, Jankowski CS, Tsantilas
K, Engel AL, Du J, et al. Biochemical adaptations
of the retina and retinal pigment epithelium support
a metabolic ecosystem in the vertebrate eye. elife.
2017;6:e28899.
 Aerobic Glycolysis
in Photoreceptors Supports
Energy Demand in the Absence
of Mitochondrial Coupling

Daniel T. Hass, Celia M. Bisbach, Martin Sadilek,

Ian R. Sweet, and James B. Hurley

Abstract Keywords

Metabolism is adapted to meet energetic Photoreceptors · Metabolic flux · Aerobic

needs. Based on the amount of ATP required glycolysis · Mitochondria · Uncoupling ·
to maintain plasma membrane potential, pho- Retina
toreceptor energy demands must be high. The
available evidence suggests that photorecep-
tors primarily generate metabolic energy
through aerobic glycolysis, though this evi- Abbreviations
dence is based primarily on protein expression
and not measurement of metabolic flux. ATP Adenosine triphosphate
Aerobic glycolysis can be validated by mea- GC-MS Gas chromatography-mass
suring flux of glucose to lactate. Aerobic gly- spectrometry
colysis is also inefficient and thus an GCR Glucose consumption rate
unexpected adaptation for photoreceptors to HK2 Hexokinase 2
make. We measured metabolic rates to deter- LPR Lactate production rate
mine the energy-generating pathways that NADH Nicotinamide adenine dinucleotide
support photoreceptor metabolism. We found NADPH Nicotinamide adenine dinucleotide
that photoreceptors indeed perform aerobic phosphate
glycolysis and this is associated with mito- OCR Oxygen consumption rate
chondrial uncoupling. PKM2 Pyruvate kinase M2

1 Introduction
D. T. Hass (*) · C. M. Bisbach · J. B. Hurley
Department of Biochemistry, University of
Washington, Seattle, WA, USA When glucose enters cells, glycolysis breaks it
e-mail: dhass@uw.edu down to pyruvate. In mitochondria pyruvate can
M. Sadilek be oxidized to CO2, and in the cytosol it is
Department of Chemistry, University of Washington, reduced to lactate in a process called aerobic
Seattle, WA, USA glycolysis [1]. Oxidation in mitochondria yields
I. R. Sweet approximately 16 times more ATP per glucose
UW Medicine - Diabetes Institute, University of than conversion to lactate. Energy demand is
Washington, Seattle, WA, USA

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 435
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_64
436
high in the retina and it relies on glucose to sur-
vive [2, 3]. Mitochondrial pyruvate oxidation is a
more efficient way to meet energy demands, yet
at physioxia most of energy in the retina instead
comes from aerobic glycolysis [4].
Hexokinase 2 (HK2) and pyruvate kinase M2
(PKM2) are associated with aerobic glycolysis in
cancer, and both are expressed in photoreceptors,
suggesting that rods and cones are the major sites
of aerobic glycolysis [5–7]. However when these
genes are knocked out, aerobic lactate production
decreases at most by 25% [8, 9]. If the associa-
tion between HK2, PKM2, and aerobic glycoly-
sis is not causal, photoreceptor expression of
these enzymes is not sufficient evidence that they
are the source of aerobic glycolysis in the retina.
This study tests whether photoreceptors are
sites of aerobic lactate production. We approach
this goal by comparing glycolytic flux and O2
consumption (OCR) in retinas from C57BL/6J
(B6) mice and C57BL/6J; AIPL1−/− mice
(AIPL1−/−). AIPL1−/− mice are model of Leber’s
congenital amaurosis, in which photoreceptors
degenerate by 1 month of age [10]. By contrast-
ing metabolism in retinas with or without photo-
receptors, we find that photoreceptors are a major
contributor to aerobic glycolysis but not the
exclusive source of lactate. We also find that pho-
toreceptor aerobic glycolysis is associated with
mitochondrial uncoupling. Uncoupling is a sign
of dysfunction in many cells, but in photorecep-
tors it may be a normal mode of metabolism.
2 Materials and Methods
2.1 Animals and Euthanasia
This study was in accordance with National
Research Council’s Guide for the Care and Use
of Laboratory Animals (8th ed). All protocols
were approved by the UW IACUC. We used
2–4 month-old male and female B6 and AIPL1−/−
mice. Mice were housed at 25 °C, with a 12-h
light cycle and ad libitum access to water and
normal rodent chow. Immediately prior to mea-
sures of metabolic flux, we euthanized mice via
D. T. Hass et al.
cervical dislocation and dissected retinas in
Hank’s buffered salt solution.
2.2 Ex Vivo Incubations
Following dissection, retinas were placed in
Krebs-Ringer bicarbonate buffer (KRB; 98.5 mM
NaCl, 4.9 mM KCl, 1.2 mM KH2PO4 1.2 mM
MgSO4-7H2O, 20 mM HEPES, 2.6 mM CaCl-­
2H2O, 25.9 mM NaHCO3) with 5 mM glucose, at
37 °C and 95% air/5% CO2. Extracellular flux
was measured in 5 mM unlabeled glucose, in
which tissues were incubated for 90 min at 37 °C
and 5% CO2 (media sampling times are indicated
in figures). Intracellular fluxes were measured in
tissue incubated in KRB with 5 mM 4-2H glucose
at 37 °C and 95% air/5% CO2.
2.3 Glucose Assay
We measured media glucose with a coupled
enzymatic assay wherein glucose phosphoryla-
tion and oxidation is coupled to NADP+ reduc-
tion [11]. NADPH absorbs light at 340 nm. We
incubated samples and 0–7 mM standards in the
assay buffer: 50 mM Tris, 1 mM MgCl2, 500 μM
NADP+, 500 μM ATP, 0.2 U/mL hexokinase,
0.08 U/mL glucose-6-phosphate dehydrogenase,
pH 8.1. We measured A340 over time until A340
reached steady state using a Bio-Tek Synergy 4
plate-reader. Other measures of glucose were
performed using an Accu-Chek Performa blood
glucometer (Roche).
2.4 Lactate Assay
We measured media lactate with a coupled
enzymatic assay where lactate dehydrogenase
converts lactate and NAD+ to pyruvate and
NADH [11]. Pyruvate is consumed by the assay
buffer, drawing the reaction to completion.
NADH absorbs light at 340 nm. We incubated
equal volumes of samples and 0–7 mM standards
in assay buffer (300 mM glycine, 166 mM
Aerobic Glycolysis in Photoreceptors Supports Energy Demand in the Absence of Mitochondrial Coupling
hydrazine, 2.5 mM NAD+, 8 U/mL lactate
dehydrogenase) and determined A340 with a Bio-
Tek Synergy 4 plate-reader. Steady-state A340 was
used standards to determine media [lactate].
2.5 Photoreceptor Contributions
to Retina Metabolism
LPR: Lactate Production Rate, GCR: Glucose
Consumption Rate
LPRphotoreceptors = LPRC57BL6/J – LPR AIPL1
GCRphotoreceptors = GCRC57BL6/J – GCR AIPL1
Aerobic glycolysis = LPR/GCR
Note: The maximum molar ratio of lactate to
glucose is 2, which is thus maximum possible
value for LPR/GCR. We omitted values >2 and
negative values of LPR/GCR because these
results are likely consequences of technical
imprecision in data collection (pipetting errors or
the influence of measurements taken near the
assay’s limit of detection). The statistical signifi-
cance of the result is maintained regardless of
whether we drop either or both of these exclusion
criteria.
2.6 Metabolite Extraction and Gas
Chromatography-Mass
Spectrometry
4-2H-glucose flux was determined using gas
chromatography-mass spectrometry (GC-MS).
We extracted metabolites with 10 μM methylsuc-
cinate in 80% methanol. We derivatized metabo-
lites from single retinas in 20 mg/mL
methoxyamine in pyridine (10 μL) and with tert-­
butyl dimethylsilyl-N-methyltrifluoroacetamide
(10 μL). Samples were analyzed using an Agilent
7890/5975C GC-MS system operated in selec-
tive ion monitoring mode to detect ions specific
to metabolites of interest eluting at specific reten-
tion times. Extracted ion chromatogram peak
areas were used to quantify the metabolite con-
centration utilizing a calibration curve generated
for analytes of interest. We corrected for natural
isotopologue abundance using IsoCor [12].
437
2.7 Measurement of O2
Consumption Rate (OCR)
We determined OCR in a perifusion flow-­culture
system [13]. Tissues were placed in chambers
between Cytopore beads (Amersham
Biosciences) and porous frits and then perifused
in KRB with 5 mM glucose, 1x Antibiotic-­
Antimycotic, 1 mg/mL fatty acid-free albumin,
21% O2, 5% CO2, and 74% N2. Media was
passed through a bubble trap before exposure to
tissues. Outflow media was in contact with a
glass wall coated with a thin layer of oxygen-
sensitive polymerized Pt(II) Meso-
tetra(pentafluorophenyl)porphine dye (Frontier
Scientific). Following a 405 nm light pulse, the
dye-coated glass emits a phosphorescent signal
detected at 650 nm. The decay lifetime is depen-
dent on oxygen tension. The media flow rate and
the quantitative relationship between dye phos-
phorescent decay and oxygen concentration
were used to determine OCR.
2.8 Statistical Analysis
Data were graphed and analyzed in Prism v9.0
(GraphPad Software). We set the significance
threshold at p < 0.05. Displayed p-values repre-
sent the result of a parametric two-tailed student’s
t-test. To compare fluxes we performed linear
regressions of the data and compared slopes with
an extra-sum-of-squares F-test.
3 Results
We compared glucose consumption (GCR) and
lactate production rates (LPR) in retina explants
freshly from B6 and AIPL1−/− mice in 5 mM glu-
cose and 21% O2. Retinas lacking photoreceptors
consumed glucose 59% and produced lactate 65%
more slowly than retinas with photoreceptors
(Fig. 1a, b). This suggests photoreceptors consume
the most glucose and produce the most lactate.
Rather than an “all or none” contribution of photo-
receptors there was residual lactate production in
438
AIPL1−/− retinas, suggesting that other cells also
contribute to aerobic glycolysis (Fig. 1b).
We quantified aerobic glycolysis in B6 and
AIPL1−/− retinas by normalizing the LPR to
GCR. This normalization accounts for differ-
ences in retina tissue amount. At most a glucose
molecule can make two lactate molecules. The
LPR/GCR, or “Lactate/Glucose,” is lower in
AIPL1−/− than B6 retinas, indicating photorecep-
tors contribute to aerobic glycolysis (Fig. 1c).
Assuming the difference between glucose con-
sumption and lactate production between B6 and
AIPL1−/− retinas represents photoreceptors, the
“photoreceptor” ratio of lactate/glucose is
1.9 ± 0.2, nearing the theoretical maximum molar
ratio of 2.
We next measured intracellular flux of 2H
from 4-2H-glucose. 2H from glucose travels with
glucose breakdown products in glycolysis until
the glyceraldehyde-3-phosphate dehydrogenase
reaction; it is transferred to NAD+ to make
NAD2H. 2H then is transferred either to lactate by
lactate dehydrogenase or to malate by malate
dehydrogenase (Fig. 1d) [14]. The rate of 2H
accumulation on fractional lactate labeling is
63% lower in AIPL1−/− retinas (Fig. 1e). This
change in 2H labeling could result from a decrease
in the proportion of glucose molecules converted
to lactate, in glucose consumption, or both. If
glucose consumption is slowed in AIPL1−/− reti-
nas, 2H accumulation on malate would be slowed
to 63% of control. 2H-accumulation rate on
malate is only 44% lower in AIPL1−/− retinas
(Fig. 1f). Since 2H-lactate production is decreased
more dramatically than 2H-malate production,
the proportion of glucose converted to lactate
must be less in retinas lacking photoreceptors.
Independent measurements of extracellular
and intracellular 2H flux lead to the same conclu-
sions: AIPL1−/− retinas consume less glucose
than normal retinas, and for every glucose mole-
cule that is oxidized, less becomes lactate. This
strongly suggests that photoreceptors are the
main site for aerobic glycolysis in the retina.
Anaerobic glycolysis occurs when
mitochondria do not generate sufficient ATP
from mitochondrial activity [15]. This happens
when ATP synthesis is not coupled to O2
D. T. Hass et al.
consumption (OCR). We determined whether
OCR in photoreceptor mitochondria generates
ATP by measuring mitochondrial “uncoupling”
(residual respiration when ATP synthesis in
inhibited). Oligomycin inhibits ATP synthesis.
Uncoupling (OCRoligomycin/OCRbasal) is the
reciprocal of the respiratory control ratio, a
common metric of mitochondrial function [16].
Oligomycin completely inhibits respiration in
fully coupled mitochondria, and yields a “%
uncoupling” of 0. In AIPL1−/− retinas, oligomycin
inhibits 65% of OCR, but in B6 retinas it inhibits
only 45%, showing that mitochondria in B6
retinas are more uncoupled. We subtracted
AIPL1−/− retina OCR from B6 OCR to estimate
the effect on photoreceptor mitochondria. The
difference curve (blue) suggests that oligomycin
has little effect on photoreceptor mitochondria and
that that electron transport in photoreceptor
mitochondria is mostly uncoupled. Thus, aerobic
glycolysis and lactate production may be espe-
cially active in photoreceptors to compensate for
poor mitochondrial ATP synthesis.
4 Discussion
Predicted energetic requirements for
photoreceptors suggest that retinas lacking rods
should require less metabolic energy than retinas
with rods [3]. Glycolytic differences between
rod-­sufficient (B6) and rod-deficient (AIPL1−/−)
retinas confirm this. Our findings suggest
photoreceptors convert a high proportion of glu-
cose to lactate, a sign of aerobic glycolysis.
We also show that photoreceptor mitochondria
are uncoupled and do not generate substantial
ATP (Fig. 1g, h). These OCR measurements
replicate our earlier findings [17], and since that
report we learned that retinas synthesize and
export succinate [18]. Succinate release sacri-
fices a source of reducing power mitochondria
could use if they were coupled, and is consistent
with mitochondrial uncoupling in photorecep-
tors. Our combined data suggest that since mito-
chondria are uncoupled, aerobic glycolysis may
be the only remaining metabolic pathway to
Aerobic Glycolysis in Photoreceptors Supports Energy Demand in the Absence of Mitochondrial Coupling 439

A B C 0.0059
1500 1500 2.0

Lactate / Glucose
1.5
Glucose (nmol)

Lactate (nmol)
1000 1000

1.0

500 500
C57BL6/J 0.5
AIPL1-/-
0 0 0.0
0 20 40 60 80 100 0 20 40 60 80 100

-/-
J
L6

L1
Time (mintues) Time (mintues)

IP
57

A
C
D E F
15 C57BL6/J 15

% m1 Lactate AIPL1-/-

% m1 Malate
10 10

5 5

0 0
0 20 40 60 80 100 120 0 20 40 60 80 100 120
Time (seconds) Time (seconds)

G H
Oligomycin Antimycin A KCN
3.0 1.0
OCR (nmol O2/min/retina)

(Oligomycin / Basal OCR)

C57BL6/J
2.5 0.8
AIPL1-/- 0.0026
Uncoupling

2.0
"Photoreceptors" 0.6
1.5
0.4
1.0

0.5 0.2

0.0 0.0
0 50 100 150
-/-
/J

L1
L6

Time (min)
IP
B
57

A
C

Fig. 1 Glycolytic and oxidative metabolism in the incubated in 5 mM 4-2H glucose. (g) Retina OCR before
C57BL/6J and C57BL/6J; AIPL1−/− retina. (a) Glucose and after treatment with 30 μM oligomycin, to isolate
depletion and (b) lactate production in retinas iso- uncoupled respiration and 1 μM antimycin A and 3 mM
lated from C57BL/6J and AIPL1−/− mice (n = 5–7). (c) KCN, to fully inhibit mitochondrial respiration (n = 4).
Lactate production rate over glucose consumption rate in The mean difference of these OCR traces is in blue. (h)
a larger data set (n = 11–18). (d) Scheme for 2H labeling Ratio of mitochondrial respiration with oligomycin to
of metabolites, created on BioRender.com. (e) 2H labeling basal mitochondrial respiration with glucose. Error bars:
of lactate and (f) malate in C57BL/6J and AIPL1−/− retinas SEM. Blue dotted lines are estimates of photoreceptor-­
specific metabolism (c, h)

make sufficient ATP to meet photoreceptor be the sole cause of metabolic differences
energetic needs (Fig. 2). between B6 and AIPL1−/− retinas. There are
There is a critical caveat to the interpretation structural differences in AIPL1−/− retina neurons,
of our findings. A lack of photoreceptors may not and glia become more “activated,” or “reactive”
440
Fig. 2 Model of the relationship between mitochondrial
uncoupling and aerobic glycolysis in photoreceptors. To
meet ATP demand, glucose enters photoreceptors and
generates ATP by glycolysis. A portion of pyruvate from
glycolysis enters mitochondria and is oxidized by the
TCA cycle. This generates NADH, but electron transport
[10]. Transcriptomic analysis of reactive Müller
glia shows increased expression of glycolytic
genes [19], and activated microglia are more gly-
colytic in culture [20, 21]. However, if Müller
glial or microglial glycolysis increases in
AIPL1−/− mice, it is insufficient to mask the more
dominant decrease in glucose use and decrease in
lactate/glucose ratio. Increased glycolysis associ-
ated with gliosis may account for residual lactate
production we observe from AIPL1−/− retinas
(Fig. 1b).
References
1. Warburg O. The metabolism of carcinoma cells. J
Cancer Res. 1925;9(1):148–63.
D. T. Hass et al.
from NADH to H2O does not fuel ATP synthesis because
of H+ leak. This prevents ATP synthesis. Mitochondria do
not generate sufficient ATP for rods to meet ATP demand,
so pyruvate from glycolysis becomes lactate and is
exported. This allows rapid glycolysis to generate suffi-
cient ATP. (Created with BioRender.com)
2. Winkler BS. Glycolytic and oxidative metabolism
in relation to retinal function. J Gen Physiol.
1981;77(6):667–92.
3. Okawa H, Sampath AP, Laughlin SB, Fain GL. ATP
consumption by mammalian rod photoreceptors in
darkness and in light. Curr Biol. 2008;18(24):1917–21.
4. Ames A, Li Y-Y, Heher EC, Kimble CR. Energy
metabolism of rabbit retina as related to function: high
cost of Na+ transport. J Neurosci. 1992;12(3):940–53.
5. Lindsay KJ, Du J, Sloat SR, Contreras L, Linton
JD, Turner SJ, et al. Pyruvate kinase and aspartate-­
glutamate carrier distributions reveal key metabolic
links between neurons and glia in retina. Proc Natl
Acad Sci U S A. 2014;111(43):15579.
6. Ferguson EC, Rathmell JC. New roles for pyruvate
kinase M2: working out the Warburg effect. Trends
Biochem Sci. 2008;33(8):359–62.
7. Wolf A, Agnihotri S, Micallef J, Mukherjee J, Sabha
N, Cairns R, et al. Hexokinase 2 is a key mediator
of aerobic glycolysis and promotes tumor growth
in human glioblastoma multiforme. J Exp Med.
2011;208(2):313–26.
Aerobic Glycolysis in Photoreceptors Supports Energy Demand in the Absence of Mitochondrial Coupling
8. Petit L, Ma S, Cipi J, Cheng S-Y, Zieger M, Hay N,
et al. Aerobic glycolysis is essential for normal rod
function and controls secondary cone death in retinitis
pigmentosa. Cell Rep. 2018;23(9):2629.
9. Chinchore Y, Begaj T, Wu D, Drokhlyansky E,
Cepko C. Glycolytic reliance promotes anabolism in
photoreceptors. elife. 2017;6:e25946.
10. Singh RK, Kolandaivelu S, Ramamurthy V. Early
alteration of retinal neurons in Aipl1−/− animals.
Invest Ophthalmol Vis Sci. 2014;55(5):3081–92.
11. Lowry OH, Passonneau JV. A flexible system of
enzymatic analysis. Elsevier; 1972.
12. Millard P, Delépine B, Guionnet M, Heuillet M,
Bellvert F, Létisse F. IsoCor: isotope correction
for high-resolution MS labeling experiments.
Bioinformatics. 2019;35(21):4484–7.
13. Neal A, Rountree A, Philips C, Kavanagh T, Williams
DP, Newham P, et al. Quantification of low-level drug
effects using real-time, in vitro measurement of oxygen
consumption rate. Toxicol Sci. 2015;148(2):594–602.
14. Lewis CA, Parker SJ, Fiske BP, Mccloskey D, Gui DY,
Green CR, et al. Article tracing compartmentalized
NADPH metabolism in the cytosol and mitochondria
of mammalian cells. Mol Cell. 2014;55:253–63.
441
15. Pasteur L. Expériences et vues nouvelles sur la nature
des fermentations. Comptes rendus l’Académie des
Sci. 1861;52:1260–4.
16. Brand M, Nicholls D. Assessing mitochondrial
dysfunction in cells. Biochem J. 2011;435(2):297–312.
17. Du J, Rountree A, Cleghorn WM, Contreras L,
Lindsay KJ, Sadilek M, et al. Phototransduction
influences metabolic flux and nucleotide metabolism
in mouse retina. J Biol Chem. 2016;291(9):4698–710.
18. Bisbach CM, Hass DT, Robbings BM, Rountree AM,
Sadilek M, Sweet IR, et al. Succinate can shuttle
reducing power from the hypoxic retina to the O2-rich
pigment epithelium. Cell Rep. 2020;31(5):107606.
19. Roesch K, Stadler MB, Cepko CL. Gene expression
changes within Müller glial cells in retinitis
pigmentosa. Mol Vis. 2012;18:1197.
20. Scholz R, Sobotka M, Caramoy A, Stempfl T, Moehle
C, Langmann T. Minocycline counter-regulates pro-­
inflammatory microglia responses in the retina and
protects from degeneration. J Neuroinflammation.
2015;12(1):1–14.
21. Wang L, Pavlou S, Du X, Bhuckory M, Xu H, Chen
M. Glucose transporter 1 critically controls microglial
activation through facilitating glycolysis. Mol
Neurodegener. 2019;14(1):1–15.
 Redox Status in Retinitis Pigment
osa

L. Olivares-González, S. Velasco, I. Campillo,

J. M. Millán, and R. Rodrigo

Abstract cytokines released by the activated immune

Retinitis pigmentosa (RP) is the most
common form of inherited retinal dystrophy
characterized by the progressive loss of
vision. It is a rare disease. Despite being a
genetic disease, its progression is influenced
by oxidative damage and chemokines and
L. Olivares-González · S. Velasco · I. Campillo
Pathophysiology and Therapies for Vision Disorders,
Principe Felipe Research Center (CIPF),
Valencia, Spain
Joint Unit on Rare Diseases CIPF-La Fe,
Valencia, Spain
e-mail: lolivares@cipf.es; svelasco@cipf.es;
icampillo@cipf.es
J. M. Millán
Joint Unit on Rare Diseases CIPF-La Fe,
Valencia, Spain
Rare Diseases Networking Biomedical Research
Centre (CIBERER), Madrid, Spain
Molecular, Cellular and Genomic Biomedicine,
Health Research Institute La Fe, Valencia, Spain
e-mail: millan_jos@gva.es
R. Rodrigo (*)
Pathophysiology and Therapies for Vision Disorders,
Principe Felipe Research Center (CIPF),
Valencia, Spain
Joint Unit on Rare Diseases CIPF-La Fe,
Valencia, Spain
Rare Diseases Networking Biomedical Research
Centre (CIBERER), Madrid, Spain
e-mail: rrodrigo@cipf.es
cells (e.g., macrophages or microglia). The
role of oxidative stress is very important in
the retina. Rods are the main consumers of
oxygen (O2), so they are constantly exposed
to oxidative stress and lipid peroxidation.
According to the oxidative hypothesis, after
rod death in the early stages of the disease,
O2 would accumulate in large quantities in
the retina, producing hyperoxia and favoring
the accumulation of reactive oxygen species
and reactive nitrogen species that would
cause oxidative damage to lipids, proteins,
and DNA, exacerbating the process of retinal
degeneration. Evidence shows alterations in
the antioxidant-oxidant state in patients and
in animal models of RP. In recent years,
therapeutic approaches aimed at reducing
oxidative stress have emerged as useful
therapies to slow down the progression of
RP. We focus this review on oxidative stress
and its relationship with the progression of
RP.
Keywords
Retinitis pigmentosa · Hyperoxia · Oxidative
damage · Antioxidant response ·
Inflammation · Cell death

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 443
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_65
444 L. Olivares-González et al.

Abbreviations cium accumulation or endoplasmic reticulum

stress, etc. [6–9].
DHA docosahexaenoic acid
HIF1 hypoxia-inducible factor 1
IL interleukins 2 Oxidative Stress
IRDs inherited retinal dystrophies
NUT nutraceuticals Oxidative stress occurs because of an alteration
O2 oxygen between the formation of reactive oxygen (ROS)
ROS reactive oxygen species and nitrogen species and the ability of the anti-
RP retinitis pigmentosa oxidant systems to eliminate them [10].
TNFα tumor necrosis factor alpha Retinal photoreceptor cells are metabolically
very active cells with a weak antioxidant system,
so they are very sensitive to oxidative damage
1 Introduction and to changes in O2 concentration [11–13]. Rods
make up 95% of the photoreceptor cells. Rod
Inherited retinal dystrophies (IRDs) comprise a death in the early stages of RP could lead to a
heterogeneous group of diseases that lead to pro- decrease in O2 consumption that reaches the ret-
gressive loss of vision [1]. IRDs are mainly ina (oxidative hypothesis). This would cause a
caused by dysfunction or loss of photoreceptor situation of retinal hyperoxia that would produce
cells (cones and rods) affecting 1 in 2000–3000 oxidative damage including ROS generation;
individuals [2]. IRDs can affect rods, cones, and oxidation of macromolecules such as lipids
both, thus classifying themselves as rod-­ (malondialdehyde), proteins (protein carbonyl-
dominated dystrophies, cone-dominated dystro- ation), and nucleic acids (8-oxoguanine, 8-oxo-
phies, and generalized dystrophies involving ­dG); or the deregulation of antioxidant effectors
both rods and cones [3]. They are clinically and (antioxidant enzymes) contributing to the cone
genetically heterogeneous. To date, more than degeneration observed in RP models [2, 14–18]
300 genes are known, and different mutations in (Fig. 1).
the same gene can lead to different phenotypes Inducible hypoxia factor alpha (HIF1α) is a
[4]. IRDs include retinitis pigmentosa (RP), hypoxic signaling protein that regulates many
Leber’s congenital amaurosis, Stargardt’s macu- genes under conditions of low O2 concentration.
lar dystrophy, and choroideremia [5]. It appears to be important in O2-dependent retinal
RP is the most common IRD. It is a rare diseases [19, 20]. We previously observed that
disease characterized by the progressive loss of HIF1α protein and its HIF1α target genes vascu-
rods and cones, with a prevalence of 1 in 4000 lar endothelial growth factor, glucose transporter
individuals [5]. RP patients lose night and 1, and endothelin-1 were decreased in rd10 mice
peripheral vision in the early stages of the dis- across the degeneration suggesting a hyperoxic
ease, due to rod death by genetic mutations. In situation in the retina. Stabilization of HIF1α by
advanced stages of the disease, cone death dimethyloxalylglycine increased gene expression
occurs resulting in loss of central and color of HIF1α target, reduced the photoreceptor cell
vision. Rod death causes the release of different loss and microglia activation, and ameliorated
substances to the extracellular environment as the antioxidant response in rd10 mice [16].
free radicals or inflammatory molecules, which Supporting this hypothesis and an altered
would generate a toxic microenvironment that redox status, oxidative stress markers and reduced
may affect cone survival, exacerbating the pro- antioxidant response have been observed in bio-
cess of degeneration [2, 6]. Several factors seem logical samples of RP patients [15, 21, 22]. In
to participate in the progression of IRDs includ- response to these changes, vascular pruning and
ing inflammation, oxidative stress, guanosine vessel attenuation would occur promoting cone
monophosphate deregulation, intracellular cal- death and a situation of hypoxia in the inner ret-
Redox Status in Retinitis Pigmentosa
Fig. 1 Schematic representation of the oxidative stress processes underlying photoreceptor degeneration in retinitis
pigmentosa
ina [17, 23]. In this sense, changes in the concen-
tration and distribution of O2 across different RP
stages have been also detected in the retina of
animal models [18, 24, 25] and RP patients [26,
27], reflecting a gradual loss of O2 metabolism.
3 Antioxidant Therapies
with Nutraceuticals
Several antioxidant strategies have been carried
out to reduce oxidative damage during IRD pro-
gression. In particular, the oral supplementation
with substances called nutraceuticals seems to
be a very promising treatment. Functional or
nutraceutical foods are natural substances that
exhibit antioxidant or/and anti-inflammatory
properties. They have been already used as puta-
tive therapeutic strategies against different reti-
nal diseases [16, 22, 28, 29]. Compounds such
as vitamin A, vitamin E, docosahexaenoic acid
445
(DHA), lutein, zeaxanthin, progesterone, and
lipoic acid have been selected for this purpose.
In recent years, several studies have documented
the beneficial effects of these compounds by
reducing cell death and improving retinal func-
tion in animal models of IRDs [30, 31].
Supplementation with vitamins A and E has
been assayed in RP [32, 33]. However, it seems
that only the combination of vitamin A plus
DHA present some beneficial effect on RP pro-
gression [34]. Lutein and zeaxanthin are macu-
lar pigments acting to protect cells from
oxidative damage, and death. They also improve
photoreceptor function, probably by reducing
endoplasmic reticulum oxidative stress in ani-
mal models of IRDs [30, 35, 36]. Progesterone
is capable of preventing photoreceptor cell loss
and reactive gliosis maybe by reducing lipid
peroxidation in rd1 and rd10 mice, two RP mod-
els [37, 38]. Other compounds such as lipoic
acid and curcumin can also reduce oxidative
446
stress and promote cell survival in RP models
[23, 39, 40].
Recently, it has been described the oral
supplementation with a formulation of
nutraceuticals containing folic acid, vitamin A,
vitamin B6, copper, zinc, selenium, lutein, and
zeaxanthin (called NUT), improved retinal redox,
photoreceptor survival, and visual function in
rd10 mice [41]. In addition, NUT also showed
anti-­inflammatory effects by decreasing microglia
activation, reactive gliosis, and cytokines (IL-6,
IL-1β, or TNFα) [41].
4 Oxidative Stress
and Inflammation
Oxidative stress and inflammation are closely
related pathophysiological processes. Both cel-
lular processes contribute to the pathogenesis of
RP. During the progression of RP, a chronic and
sustained inflammation has been observed in ani-
mal models of RP and patients. The inflammation
leads to microglia activation, release of pro-­
inflammatory cytokines such as the TNFα, IL6,
IL1β, etc., reactive gliosis, free radical produc-
tion, etc. [28].
Compounds with typically anti-inflammatory
characteristics such as progesterone, lipoic acid
[31, 39], and curcumin [42] also have antioxidant
properties reducing oxidative stress. Therefore,
the combination of antioxidant and inflammatory
compounds would be a comprehensive strategy
for tackling retinal degenerative diseases.
5 Conclusions and Future
Perspectives
IRDs, including RP as genetic diseases, leads to
blindness; however, there are different underly-
ing cellular processes such as oxidative stress,
inflammation, cyclic guanosine monophosphate
deregulation, intracellular calcium accumulation,
and endoplasmic reticulum stress that can exac-
erbate the death of photoreceptor cells [6–9]. On
the other hand, the oxidation of lipids, proteins,
L. Olivares-González et al.
and DNA derived from the oxidative stress gener-
ated after rod death can contribute to activate
microglia, and trigger the inflammatory process,
which, if prolonged over time, may also contrib-
ute to the process of retinal degeneration [43, 44].
Despite the advances in the knowledge of the
mechanisms involved in photoreceptor cell death,
the great diversity of the findings shows the com-
plexity of IRDs. However, evidence suggests that
both oxidative stress and inflammation are
involved in the progression of IRDs. Strategies to
target oxidative stress or inflammation could
slow down, at least in part, the progression of
IRDs regardless of the genetic defect. Therefore,
the design of combined strategies to deal with
both processes could be an interesting approach.
References
1. Hartong DT, Berson EL, Dryja TP. Retinitis
pigmentosa. Lancet (London, Engl).
2006;368(9549):1795–809.
2. Wooff Y, Man SM, Aggio-Bruce R, Natoli R,
Fernando N. IL-1 family members mediate cell death,
inflammation and angiogenesis in retinal degenerative
diseases. Front Immunol. 2019;10:1618.
3. Broadgate S, Yu J, Downes SM, Halford
S. Unravelling the genetics of inherited retinal
dystrophies: past, present and future. Prog Retin Eye
Res. 2017;59:53–96.
4. RetNet. Retinal Information Network. Available
from: https://sph.uth.edu/retnet/home.htm
5. Chang B. Animal models of retinitis Pigmentosa (RP).
In: Chan C-C, editor. Animal models of ophthalmic
diseases. Cham: Springer International Publishing;
2016. p. 101–16.
6. Campochiaro PA, Mir TA. The mechanism of cone
cell death in retinitis Pigmentosa. Prog Retin Eye Res.
2018;62:24–37.
7. Kruk J, Kubasik-Kladna K, Aboul-Enein HY. The role
oxidative stress in the pathogenesis of eye diseases:
current status and a dual role of physical activity. Mini
Rev Med Chem. 2015;16(3):241–57.
8. Viringipurampeer IA, Bashar AE, Gregory-Evans CY,
Moritz OL, Gregory-Evans K. Targeting inflamma-
tion in emerging therapies for genetic retinal disease.
Int J Inflamm. 2013;2013:581751.
9. Yoshida N, Ikeda Y, Notomi S, Ishikawa K, Murakami
Y, Hisatomi T, et al. Clinical evidence of sustained
chronic inflammatory reaction in retinitis pigmentosa.
Ophthalmology. 2013;120(1):100–5.
10. Sies H. Oxidative stress: concept and some practical
aspects. Antioxidants (Basel). 2020;9(9):852.
Redox Status in Retinitis Pigmentosa
11. Arjunan P, Lin X, Tang Z, Du Y, Kumar A, Liu L,
et al. VEGF-B is a potent antioxidant. Proc Natl Acad
Sci U S A. 2018;115(41):10351–6.
12. De La Paz MA, Anderson RE. Lipid peroxidation
in rod outer segments. Role of hydroxyl radical and
lipid hydroperoxides. Invest Ophthalmol Vis Sci.
1992;33(7):2091–6.
13. Glickman RD, Lam KW. Oxidation of ascorbic acid
as an indicator of photooxidative stress in the eye.
Photochem Photobiol. 1992;55(2):191–6.
14. Martínez-Fernández de la Cámara C, Hernández-­
Pinto AM, Olivares-González L, Cuevas-Martín C,
Sánchez-Aragó M, Hervás D, et al. Adalimumab
reduces photoreceptor cell death in A mouse model of
retinal degeneration. Sci Rep. 2015;5:11764.
15. Murakami Y, Ikeda Y, Yoshida N, Notomi S, Hisatomi
T, Oka S, et al. MutT homolog-1 attenuates oxidative
DNA damage and delays photoreceptor cell death
in inherited retinal degeneration. Am J Pathol.
2012;181(4):1378–86.
16. Olivares-González L, Martínez-Fernández de la
Cámara C, Hervás D, Millán JM, Rodrigo R. HIF-1α
stabilization reduces retinal degeneration in a
mouse model of retinitis pigmentosa. FASEB J.
2018;32(5):2438–51.
17. Shen J, Yang X, Dong A, Petters RM, Peng YW, Wong
F, et al. Oxidative damage is a potential cause of cone
cell death in retinitis pigmentosa. J Cell Physiol.
2005;203(3):457–64.
18. Yu DY, Cringle S, Valter K, Walsh N, Lee D, Stone
J. Photoreceptor death, trophic factor expression,
retinal oxygen status, and photoreceptor function
in the P23H rat. Invest Ophthalmol Vis Sci.
2004;45(6):2013–9.
19. Ivan M, Kondo K, Yang H, Kim W, Valiando J, Ohh M,
et al. HIFalpha targeted for VHL-mediated destruction
by proline hydroxylation: implications for O2 sensing.
Science (New York, NY). 2001;292(5516):464–8.
20. Ke Q, Costa M. Hypoxia-inducible factor-1 (HIF-1).
Mol Pharmacol. 2006;70(5):1469–80.
21. Martínez-Fernández de la Cámara C, Salom D,
Sequedo MD, Hervás D, Marín-Lambíes C, Aller E,
et al. Altered antioxidant-oxidant status in the aqueous
humor and peripheral blood of patients with retinitis
pigmentosa. PloS One. 2013;8(9):e74223.
22. Martínez-Fernández de la Cámara C, Sequedo MD,
Gómez-Pinedo U, Jaijo T, Aller E, García-Tárraga
P, et al. Phosphodiesterase inhibition induces retinal
degeneration, oxidative stress and inflammation in
cone-enriched cultures of porcine retina. Exp Eye
Res. 2013;111:122–33.
23. Komeima K, Rogers BS, Lu L, Campochiaro
PA. Antioxidants reduce cone cell death in a model
of retinitis pigmentosa. Proc Natl Acad Sci U S A.
2006;103(30):11300–5.
24. Yu DY, Cringle SJ. Retinal degeneration and local
oxygen metabolism. Exp Eye Res. 2005;80(6):745–51.
25. Yu DY, Cringle SJ, Su EN, Yu PK. Intraretinal
oxygen levels before and after photoreceptor
loss in the RCS rat. Invest Ophthalmol Vis Sci.
2000;41(12):3999–4006.
447
26. Lang M, Harris A. Vascular dysfunction in retinitis
pigmentosa. Acta Ophthalmol. 2019;97(7):660–4.
27. Türksever C, Valmaggia C, Orgül S, Schorderet
DF, Flammer J, Todorova MG. Retinal vessel
oxygen saturation and its correlation with structural
changes in retinitis pigmentosa. Acta Ophthalmol.
2014;92(5):454–60.
28. Olivares-González L, Velasco S, Campillo I, Rodrigo
R. Retinal inflammation, cell death and inherited
retinal dystrophies. Int J Mol Sci. 2021;22(4):2096.
29. Valero-Vello M, Peris-Martínez C, García-Medina
JJ, Sanz-González SM, Ramírez AI, Fernández-
Albarral JA, et al. Searching for the antioxidant,
anti-­inflammatory, and neuroprotective potential of
natural food and nutritional supplements for ocular
health in the mediterranean population. Foods.
2021;10(6):1231.
30. Dias MF, Joo K, Kemp JA, Fialho SL, da Silva Cunha
A Jr, Woo SJ, et al. Molecular genetics and emerging
therapies for retinitis pigmentosa: basic research
and clinical perspectives. Prog Retin Eye Res.
2018;63:107–31.
31. Hernandez-Rabaza V, Lopez-Pedrajas R, Almansa
I. Progesterone, lipoic acid, and sulforaphane as
promising antioxidants for retinal diseases: a review.
Antioxidants (Basel). 2019;8(3):53.
32. Berson EL, Rosner B, Sandberg MA, Hayes KC,
Nicholson BW, Weigel-DiFranco C, et al. A randomized
trial of vitamin A and vitamin E supplementation for
retinitis pigmentosa. Arch Ophthalmol (Chicago, Ill:
1960). 1993;111(6):761–72.
33. Li T, Sandberg MA, Pawlyk BS, Rosner B,
Hayes KC, Dryja TP, et al. Effect of vitamin A
supplementation on rhodopsin mutants threonine-17
→ methionine and proline-347 → serine in transgenic
mice and in cell cultures. Proc Natl Acad Sci U S A.
1998;95(20):11933–8.
34. Berson EL, Rosner B, Sandberg MA, Weigel-­
DiFranco C, Moser A, Brockhurst RJ, et al. Further
evaluation of docosahexaenoic acid in patients with
retinitis pigmentosa receiving vitamin A treatment:
subgroup analyses. Arch Ophthalmol (Chicago, Ill:
1960). 2004;122(9):1306–14.
35. Thomson LR, Toyoda Y, Langner A, Delori FC,
Garnett KM, Craft N, et al. Elevated retinal zeaxanthin
and prevention of light-induced photoreceptor
cell death in quail. Investig Ophthalmol Vis Sci.
2002;43(11):3538–49.
36. Yang F, Yu J, Ke F, Lan M, Li D, Tan K, et al. Curcumin
alleviates diabetic retinopathy in experimental
diabetic rats. Ophthalmic Res. 2018;60(1):43–54.
37. Pajovic S, Saicic ZS, Spasic MB, Petrovic VM,
Martinovic JV. Effect of progesterone and estradiol
benzoate on superoxide dismutase activity in the brain
of male rats. Experientia. 1996;52(3):221–4.
38. Stein DG, Wright DW, Kellermann AL. Does
progesterone have neuroprotective properties? Ann
Emerg Med. 2008;51(2):164–72.
39. Ramírez-Lamelas DT, Benlloch-Navarro S, López-­
Pedrajas R, Gimeno-Hernández R, Olivar T, Silvestre
D, et al. Lipoic acid and progesterone alone or in
448
combination ameliorate retinal degeneration in an
experimental model of hereditary retinal degeneration.
Front Pharmacol. 2018;9:469.
40. Sanz MM, Johnson LE, Ahuja S, Ekstrom PA, Romero
J, van Veen T. Significant photoreceptor rescue by
treatment with a combination of antioxidants in an
animal model for retinal degeneration. Neuroscience.
2007;145(3):1120–9.
41. Olivares-González L, Velasco S, Campillo I, Salom
D, González-García E, Soriano Del Castillo J, et al.
Nutraceutical supplementation ameliorates visual
function, retinal degeneration, and redox status in
rd10 Mice. Antioxidants (Basel). 2021;10(7):1033.
L. Olivares-González et al.
42. Wang Y, Yin Z, Gao L, Sun D, Hu X, Xue L, et al.
Curcumin delays retinal degeneration by regulating
microglia activation in the retina of rd1 mice. Cell
Physiol Biochem. 2017;44(2):479–93.
43. Rojo AI, McBean G, Cindric M, Egea J, Lopez MG,
Rada P, et al. Redox control of microglial function:
molecular mechanisms and functional significance.
Antioxid Redox Signal. 2014;21(12):1766–801.
44. Roy A, Jana A, Yatish K, Freidt MB, Fung YK,
Martinson JA, et al. Reactive oxygen species up-­
regulate CD11b in microglia via nitric oxide:
implications for neurodegenerative diseases. Free
Radic Biol Med. 2008;45(5):686–99.
 Perspectives on Retinal Dolichol
Metabolism, and Visual Deficits
in Dolichol Metabolism-Associated
Inherited Disorders

Sriganesh Ramachandra Rao, Steven J. Pittler,

and Steven J. Fliesler

Abstract ciated with Dol metabolism disorders, and

De novo synthesis of dolichol (Dol) and doli-
chyl phosphate (Dol-P) is essential for protein
glycosylation. Herein, we provide a brief
overview of Dol and Dol-P synthesis and the
maintenance of their cellular content. Retinal
Dol metabolism and the requirement of Dol-­
linked oligosaccharide synthesis in the neural
retina also are discussed. There are recently
discovered and an emerging class of rare con-
genital disorders that affect Dol metabolism,
involving the genes DHDDS, NUS1, SRD5A3,
and DOLK. Further understanding of these
congenital disorders is evolving, based upon
studies utilizing yeast and murine models, as 1 Introduction
well as clinical reports of these rare disorders.
We summarize the known visual deficits asso- The mevalonate pathway generates a broad spec-
S. Ramachandra Rao · S. J. Fliesler (*)
Departments of Ophthalmology and Biochemistry,
and Neuroscience Graduate Program, Jacobs School
of Medicine and Biomedical Sciences, State
University of New York, Buffalo, NY, USA
Research Service, VA Western NY Healthcare
System, Buffalo, NY, USA
e-mail: sramacha@buffalo.edu; fliesler@buffalo.edu;
steven.fliesler@va.gov
S. J. Pittler
Department of Optometry and Vision Science, Vision
Science Research Center, School of Optometry,
University of Alabama at Birmingham,
Birmingham, AL, USA
e-mail: pittler@uab.edu
identify the need for generation and character-
ization of suitable animal models of these dis-
orders to elucidate the underlying molecular
and cellular mechanisms of the associated
retinopathies.
Keywords
Dolichol · Dolichyl phosphate · Retinitis
pigmentosa · Vision defects · Protein glyco-
sylation · DHDDS · NUS1 · SRD5A3 ·
DOLPP1 · DOLK
trum of isoprenoid metabolites essential for life.
This includes cyclic isoprenoids such as choles-
terol and other sterols, and linear isoprenoids
such as dolichol (Dol) and its derivatives, and
ubiquinone. Several of these key isoprenoid
metabolites are directly involved in protein post-
translational modifications (e.g., protein prenyl-
ation). Farnesyl pyrophosphate (FPP) and
isopentenyl pyrophosphate (IPP) are key meval-
onate pathway intermediates required for the
synthesis of squalene, sterols, as well as Dol (see
Fig. 1). This article focuses on Dol metabolism
and its role and requirement in retinal physiol-
ogy, specifically as pertains to protein

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 449
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_66
450
g­lycosylation. We will briefly discuss genetic
disorders pertaining to Dol metabolism and the
associated visual deficits.
The committed step in Dol synthesis is cata-
lyzed by the heterotetrameric cis-prenyl transfer-
ase (CPT) complex, constituted by
dehydrodolichyl diphosphate synthase (DHDDS,
OMIM# 608172) and Nogo-B receptor (NgBR;
NUS1, OMIM# 610463) (Fig. 1). The mamma-
lian CPT complex catalyzes the cis-condensation
of an FPP (C15) molecule with multiple molecules
of IPP (C5), to form polyprenol pyrophosphate
(C90-C100) [1–4]. Polyprenol pyrophosphate then
undergoes reduction to generate dolichyl pyro-
phosphate (Dol-PP), catalyzed by steroid-5α-­
reductase 3 (SRD5A3) [5]. However, the obligate
glycan carrier required for protein glycosylation
is dolichyl phosphate (Dol-P) [6, 7]. Cellular
Dol-P homeostasis is maintained by the action of
dolichol diphosphatase 1 (DOLPP1) on Dol-PP,
which generates Dol-P. DOLPP1 also can cata-
lyze the conversion of Dol-P to Dol, albeit at
Fig. 1 Schematic representation of Dol-P synthesis and
Dol homeostasis. The interplay between Dol homeostasis
and protein glycosylation has been represented. Visual
deficits associated with congenital disorders of Dol
metabolism have been provided. Abbreviations: DHDDS
S. Ramachandra Rao et al.
lower rates [8]. Free Dol is phosphorylated to
form Dol-P by a CTP-dependent, ER-resident
enzyme called dolichol kinase (DOLK) [9]. The
N-linked oligosaccharide synthesis begins on the
cytosolic face of ER, before the Dol-P-linked oli-
gosaccharide (with five mannose residues) is
flipped across the ER membrane to the ER
lumen via the activity of scramblases/flippases
that are yet to be identified and characterized
[10–13] (Fig. 1). An oligosaccharyl
transferase (DPAGT1, dolichyl phosphate
N-acetylglucosaminephosphotransferase 1) cata-
lyzes the transfer of oligosaccharides onto aspar-
agine glycosylation consensus sites of nascent
peptides in the rough ER lumen. This regenerates
Dol-PP on the rough ER luminal face, the sub-
strate for DOLPP1, and regenerates Dol-P. Dol-P
is then flipped to the cytoplasmic side of the ER
for subsequent rounds of oligosaccharide synthe-
sis [14].
Contribution of dietary Dol to tissue Dol con-
tent is negligible [15–17]. Although serum Dol is
dehydrodolichyl diphosphate synthase, NUS1 Nogo-B
receptor (NgBR), SRD5A3 steroid-5α-reductase 3,
DOLPP1 dolichyl diphosphatase 1, DOLK dolichol
kinase, OST oligosaccharyltransferase, CTP cytidine
triphosphate
Perspectives on Retinal Dolichol Metabolism, and Visual Deficits in Dolichol Metabolism-Associated…
associated with high-density lipoproteins (HDL)
[18–23], there is no receptor-mediated endocytic
mechanism for cellular/tissue Dol uptake in vivo.
On the other hand, low-density lipoprotein (LDL)
particles loaded with Dol may undergo receptor-­
mediated endocytosis, but such Dol accumulates
in the lysosomes [24]. However, uptake of LDL-­
borne cholesterol (via LDL receptor-mediated
uptake), or pharmacological inhibition of the
mevalonate pathway at the level of 3-hydroxy-­3-
methylglutaryl coenzyme-A reductase
(HMGCR), using statins, decreases tissue Dol
synthesis [25–28]. Therefore, tissues including
the neural retina depend on de novo synthesis of
Dol for Dol-dependent cellular processes.
2 Dolichol Synthesis
and Dolichol-Linked
Oligosaccharides
in the Neural Retina
The de novo synthesis of Dol and its derivatives
in the retina was first assessed in vitro by incubat-
ing frog retinas with [3H]acetate, the de novo pre-
cursor to acetyl-CoA in the mevalonate pathway
[29] (Fig. 1). The specific activity of radiolabeled
Dol was determined by radio-HPLC. The major-
ity of the [3H]acetate was incorporated into squa-
lene, rather than into sterols. Dol synthesis was
found to be 60-fold slower than that of choles-
terol synthesis [29]. [3H]acetate was incorporated
into squalene, as well as cholesterol, and Dol [29,
30]. This in vitro experiment demonstrated the
capacity of the neural retina to synthesize Dol de
novo. Other in vitro studies, utilizing bovine,
chick, and rodent retinas, demonstrated an essen-
tial role for Dol-P in incorporation of mannose
into retinal glycoproteins [31–37]. Statin treat-
ment also affects protein prenylation in the neural
retina, and leads to retinal degeneration [38, 39].
Further, in vivo [40] and in vitro [41, 42] admin-
istration of tunicamycin, a DPAGT1 oligosac-
charyltransferase (OST) inhibitor, on adult
amphibian retinas, demonstrated the importance
of protein N-glycosylation in maintaining the
structure and function of the neural retina, and
demonstrated glycosylation-dependent traffick-
451
ing and incorporation of rhodopsin into rod outer
segment (ROS) membranes. Similarly, point
mutation of either of the two glycosylation con-
sensus sites of rhodopsin leads to autosomal
dominant retinitis pigmentosa, with rapid retinal
degeneration [43–45]. Below, we briefly discuss
an emerging class of inherited disorders, involv-
ing mutations in genes (DHDDS, NUS1, SRD5A3,
DOLK, and DOLPP1) pertinent to Dol and Dol-P
homeostasis, wherein the underlying mechanism
of retinopathy is presumed to be driven by defec-
tive protein glycosylation.
3 Inherited Disorders Affecting
Dolichol Metabolism
3.1 DHDDS and NUS1-CDG
Dol-P, the obligate glycan carrier, is indispens-
able for protein N-glycosylation, as well as pro-
tein O- and C-mannosylation, O-glucosylation,
and glycosylphosphatidylinositol (GPI) anchor
synthesis [5–7, 46]. The first described cases of
DHDDS-associated retinopathy were classified
as a non-syndromic autosomal recessive form of
retinitis pigmentosa, called RP59 (OMIM#
613861). They involved a founder missense
mutation (K42E) in DHDDS [47, 48]. Other
DHDDS mutations also have been described in
RP59 patients (e.g., T206A, R98W both found
heterozygously with the K42E mutation) [49–
53]. Since de novo synthesized Dol-P is required
by all eukaryotic cells for the assembly of
N-glycan chains and cell viability, RP59 and
NUS1-associated retinopathies have been classi-
fied as “congenital disorders of glycosylation”
(CDGs) [47, 48, 54]. Curiously, the clinical fea-
tures of RP59 are restricted to the eye/retina (i.e.,
RP59 is non-syndromic); the retina-specific func-
tions of DHDDS are yet unknown [47, 48, 53]
(Fig. 1). More recently, mutations in DHDDS
have been implicated in early-onset encephalopa-
thy [50, 55–57]. The proposed mechanism of
CPT-associated retinopathies involves defective
rod and cone opsin N-glycosylation leading to
loss of photoreceptors [47, 48]. This hypothesis
was based upon studies of a dhdds knockdown
452
zebrafish model [48, 58]. We generated the first
validated murine animal models to determine the
link between CPT activity and retinal protein gly-
cosylation and morphology/function, by knock-
ing in the RP59-associated K42E DHDDS
mutation, as well as selectively ablating (knock-
out) Dhdds in rod photoreceptors and RPE cells
[4, 59, 60]. Surprisingly, rod-specific knockout of
Dhdds led to rapid retinal degeneration within
6 weeks of age [4]; however, the observed degen-
eration did not lead to obvious protein
N-glycosylation defects, despite marked reduc-
tion in retinal Dol levels. The global K42E
knock-in mouse model of RP59 exhibits no overt
degenerative phenotype up to at least 12 months
of age [49, 59]; however, a mild, age-dependent
phenotype has been observed at later time points
(unpublished results). Further, RP59 patient
fibroblasts and serum transferrin profiles also do
not exhibit obvious protein N-glycosylation
defects [50, 56]. These findings argue against the
hypothesis implicating the primary involvement
of defective protein N-glycosylation [4] in RP59.
We have not observed retinal degeneration as
occurs when N-glycosylation is specifically dis-
rupted [40–42, 45, 61]. In contrast, RP59 patient-­
derived fibroblasts exhibit accumulation of lipid
droplets and signatures of lysosome storage dis-
orders [56, 57]. The disease mechanism underly-
ing RP59 remains to be elucidated, and to be
studied in relation to other genes involved in Dol
synthesis pathway, to better define how Dol
homeostasis is achieved and maintained in the
neural retina.
NgBR (the NUS1 gene product) is a heterotet-
rametric partner of DHDDS, required for Dol
synthesis. However, NgBR appears to have a
broad interactome based on its various functions
[62–65]. NgBR plays a critical role in lysosome
function and lipid trafficking, by stabilizing the
Niemann-Pick type C-2 complex (NPC2), which
is required for trafficking of free cholesterol from
lysosomes to the ER. Deletion of Nus1 causes a
Niemann-Pick type C disease-like lysosomal
storage disorder [63, 66, 67]. Yeast and mamma-
lian models involving Nus1 mutations or knock-
out clearly exhibit protein glycosylation defects,
and classic signatures of lysosomal storage disor-
S. Ramachandra Rao et al.
ders [54, 62, 63, 66–69]. Foveal lesions have
been reported in patients with mutations in NUS1
[54] (Fig. 1). Defects in other cellular processes
mediated by CPT, or their interacting protein
partners, cannot be ruled out; however, it is diffi-
cult to envision such effects being retina specific.
It may be interesting to investigate the role of
dolichol in photoreceptor membrane, and if such
functions are compromised by the reduction in
chain length, as observed in RP59 [49].
Understanding the roles of DHDDS and NgBR in
Dol-dependent protein glycosylation, specifi-
cally in retinal photoreceptors, may provide criti-
cal insights regarding the developmental role of
the CPT complex in photoreceptor glycosylation
as well as in phagolysosome biology.
3.2 SRD5A3-CDG
The reduction of polyprenol pyrophosphate to
Dol-PP in the ER was demonstrated using rat
liver microsome preparations [70]. The involve-
ment of SRD5A3 (steroid-5α-reductase 3) in the
catalytic reduction of the terminal isoprene unit
(the alpha isoprene residue) of CPT-synthesized
polyprenol pyrophosphate to Dol-PP was
described recently [5] (Fig. 1). Deletion of the
yeast ortholog of SRD5A3, dfg10–100, leads to
accumulation of polyprenol pyrophosphate and
decrease in Dol-PP, with accompanying protein
glycosylation defects [5]. Such glycosylation
defects in dfg10–100 could be rescued by co-­
transfection with human SRD5A3. Murine
global knockout of Srd5a3 leads to embryonic
lethality by E13.5 days, with reduction of Dol
levels, and accumulation of polyprenol pyro-
phosphate. Targeted deletion of Srd5a3 in the
cerebellum in mice, using a conditional allele
model, leads to frank protein glycosylation
defects [71]. Patient-­ associated mutations in
SRD5A3 lead to a CDG [5, 72, 73] (OMIM#
612379). Ocular manifestations of SRD5A3
mutation include retinal dystrophy, optic atro-
phy, nystagmus, and myopia (Fig. 1). Other sys-
temic defects involve ichthyosis (skin defects),
cerebellar ataxia, muscular hypotonia, and cog-
nitive deficits [5, 72–74].
Perspectives on Retinal Dolichol Metabolism, and Visual Deficits in Dolichol Metabolism-Associated… 453

3.3 DOLPP1-CDG from yeast and mouse models of human disor-

ders classified as CDGs, associated with Dol
DOLPP1 belongs to the PAP2 (phosphatidic acid metabolism. We have further accounted for the
phosphatase 2)-like superfamily of proteins [75]. reported biochemical and vision-related pheno-
The classic enzymatic active sites of the PAP2-­ types in patients with mutations associated with
like family of proteins are fully conserved genes involved in Dol metabolism. While muta-
between DOLPP1 and its yeast ortholog, CWH8 tions in most of the Dol metabolism-associated
[76, 77]. Both Dol-PP and Dol-P serve as enzy- genes (NUS1, SRD5A3, DOLK, DOLPP1) clearly
matic substrates (Fig. 1). DOLPP1 activity lead to protein glycosylation defects, DHDDS-­
increases during brain development, and requires associated mutations surprisingly do not.
divalent cations, especially Mn2+ [78, 79]. Mutations in Dol metabolism-associated genes
Mutation of the yeast gene cwh8 leads to protein are emerging as a new class of congenital disor-
hypoglycosylation, which could be rescued by ders with significant ocular manifestations. To
reconstitution of DOLPP1 [80, 81]. To date, there fully elucidate the role of Dol metabolism in the
are no published clinical reports pertaining to neural retina, and to understand the disease
DOLPP1 mutations. mechanisms underlying the above-discussed
congenital disorders, we propose that there is a
need for the generation and characterization of
3.4 DOLK-CDG animal models with retinal cell type-specific
deletion of these genes and further modeling of
DOLK belongs to cytidylyltransferase family of identified mutations. Such rigorous modeling of
CTP-dependent kinase enzymes [75] (Fig. 1). these rare metabolic disorders will facilitate bet-
DOLK is an ER-resident protein; the highest ter understanding of the disease mechanisms,
level of DOLK activity is exhibited in the brain providing a rational basis for development of tar-
during development [9, 82]. DOLK transcript geted therapeutic interventions, as well as pro-
and protein expression have been documented in viding a more thorough understanding of
all cell types of the neural retina [46, 83]. Deletion Dol-linked protein glycosylation in the neural
of sec59, the yeast ortholog of DOLK, also leads retina.
to protein hypoglycosylation and lipid droplet
accumulation [9, 46, 84] (Fig. 1). Patients with
DOLK mutations (OMIM# 610768) are clini- References
cally diagnosed by a CDG type 1 transferrin gly-
cosylation pattern, with elevated disialo- and 1. Edani BH, Grabinska KA, Zhang R, Park EJ, Siciliano
B, Surmacz L, et al. Structural elucidation of the cis-­
asialo-transferrin glycoforms [46, 85, 86]. Also, prenyltransferase NgBR/DHDDS complex reveals
patients harboring DOLK mutations (OMIM# insights in regulation of protein glycosylation. Proc.
610768) exhibit systemic defects, such as cardio- Natl. Acad. Sci. U. S. A. 2020;117(34):20794–802.
myopathy, hepatic and renal complications, mus- 2. Bar-El ML, Vankova P, Yeheskel A, Simhaev L,
Engel H, Man P, et al. Structural basis of hetero-
cular hypotonia with underlying tetrameric assembly and disease mutations in the
dystroglycanopathy, and ichthyosis, along with human cis-prenyltransferase complex. Nat. Commun.
visual system defects, including nystagmus and 2020;11(1):5273.
strabismus (Fig. 1) [46, 86]. 3. Ramachandra Rao S, Fliesler SJ. Cholesterol homeo-
stasis in the vertebrate retina: biology and pathobiol-
ogy. J. Lipid Res. 2021;62:100057.
4. Ramachandra Rao S, Skelton LA, Wu F, Onysk A,
4 Conclusions Spolnik G, Danikiewicz W, et al. Retinal degeneration
caused by rod-specific dhdds ablation occurs without
concomitant inhibition of protein N-glycosylation.
Herein, we have briefly reviewed the role and iScience. 2020;23(6):101198.
requirement of Dol metabolism in the neural ret- 5. Cantagrel V, Lefeber DJ, Ng BG, Guan Z, Silhavy JL,
ina, and have described relevant observations Bielas SL, et al. SRD5A3 is required for converting
454
polyprenol to dolichol and is mutated in a congenital
glycosylation disorder. Cell. 2010;142(2):203–17.
6. Leloir LF. The role of dolichol in protein glycosyl-
ation. Adv. Exp. Med. Biol. 1977;83:9–19.
7. Parodi AJ. Synthesis of glycosyl-dolichol derivatives
in bakers’ yeast and their role in protein glycosyl-
ation. Eur. J. Biochem. 1977;75(1):171–80.
8. Scher MG, Waechter CJ. Brain dolichyl pyrophosphate
phosphatase. Solubilization, characterization, and dif-
ferentiation from dolichyl monophosphate phospha-
tase activity. J. Biol. Chem. 1984;259(23):14580–5.
9. Shridas P, Waechter CJ. Human dolichol kinase, a
polytopic endoplasmic reticulum membrane protein
with a cytoplasmically oriented CTP-binding site.
J. Biol. Chem. 2006;281(42):31696–704.
10. Verchere A, Cowton A, Jenni A, Rauch M, Haner
R, Graumann J, et al. Complexity of the eukaryotic
dolichol-­linked oligosaccharide scramblase suggested
by activity correlation profiling mass spectrometry.
Sci. Rep. 2021;11(1):1411.
11. Sanyal S, Menon AK. Stereoselective transbilayer
translocation of mannosyl phosphoryl dolichol by an
endoplasmic reticulum flippase. Proc. Natl. Acad. Sci.
U. S. A. 2010;107(25):11289–94.
12. Sanyal S, Menon AK. Specific transbilayer transloca-
tion of dolichol-linked oligosaccharides by an endo-
plasmic reticulum flippase. Proc. Natl. Acad. Sci.
U. S. A. 2009;106(3):767–72.
13. Sanyal S, Frank CG, Menon AK. Distinct flippases
translocate glycerophospholipids and oligosaccharide
diphosphate dolichols across the endoplasmic reticu-
lum. Biochemistry. 2008;47(30):7937–46.
14. Rush JS, Gao N, Lehrman MA, Waechter
CJ. Recycling of dolichyl monophosphate to the cyto-
plasmic leaflet of the endoplasmic reticulum after the
cleavage of dolichyl pyrophosphate on the lumenal
monolayer. J. Biol. Chem. 2008;283(7):4087–93.
15. Keller RK, Jehle E, Adair WL Jr. The origin of doli-
chol in the liver of the rat. Determination of the dietary
contribution. J. Biol. Chem. 1982;257(15):8985–9.
16. Rip JW, Carroll KK. Distribution, metabolism and
excretion of [1-14C]dolichol injected intravenously
into rats. Biochem. J. 1985;227(3):705–10.
17. Crick DC, Carroll KK. Absorption and distribution
of [1-14C]dolichol intubated into rats. Biochem. Cell
Biol. 1987;65(4):317–20.
18. Elmberger PG, Engfeldt P, Dallner G. Presence of
dolichol and its derivatives in human blood. J. Lipid
Res. 1988;29(12):1651–62.
19. Elmberger PG, Kalen A, Brunk UT, Dallner
G. Discharge of newly-synthesized dolichol and ubi-
quinone with lipoproteins to rat liver perfusate and to
the bile. Lipids. 1989;24(11):919–30.
20. Van Dessel G, Lagrou A, Hilderson HJ, Dierick
W. The shuttling of dolichol between VLDL and HDL:
involvement of a protein factor from lipoprotein-­
deficient human serum. Biochim. Biophys. Acta.
1993;1166(1):64–72.
21. Marinari UM, Pronzato MA, Dapino D, Gazzo P,
Traverso N, Cottalasso D, et al. Effects of simvas-
S. Ramachandra Rao et al.
tatin on liver and plasma levels of cholesterol, doli-
chol and ubiquinol in hypercholesterolemic rats. Ital.
J. Biochem. 1995;44(1):1–9.
22. Kuriyama M, Yoshidome H, Nakahara K, Nakagawa
H, Fujiyama J, Take H, et al. Blood dolichols in
a patient with abetalipoproteinaemia. Ann. Clin.
Biochem. 1999;36(Pt 2):176–9.
23. Shiota Y, Kiyota K, Kobayashi T, Kano S, Kawamura
M, Matsushima T, et al. Distribution of dolichol in
the serum and relationships between serum dolichol
levels and various laboratory test values. Biol. Pharm.
Bull. 2008;31(3):340–7.
24. Van Dessel G, Van Meirvenne H, Lagrou A, Hilderson
H, Dierick W. Uptake of dolichol by Vero cells.
Biochem. Cell Biol. 1992;70(6):475–80.
25. Borgford TJ, Hurta RA, Tough DF, Burton
DN. Regulation of 3-hydroxy-3-methylglutaryl coen-
zyme A reductase and lipid metabolism in a concana-
valin A-resistant Chinese hamster ovary cell line.
Arch. Biochem. Biophys. 1986;244(2):502–16.
26. Dull BJ, McCarthy RD, Kilara A. The modulating
effect of an inhibitor of cholesterol genesis pres-
ent in bovine milk upon the synthesis of choles-
terol, dolichol and ubiquinone. Atherosclerosis.
1983;49(3):231–9.
27. Filipovic I, Menzel B. Action of low-density lipo-
protein and compactin, a competitive inhibitor of
3-hydroxy-3-methylglutaryl-CoA reductase, on the
synthesis of dolichol-linked oligosaccharides and
low-density-lipoprotein receptor in human skin fibro-
blasts. Biochem. J. 1981;196(2):625–8.
28. Appelkvist EL, Edlund C, Low P, Schedin S, Kalen
A, Dallner G. Effects of inhibitors of hydroxymeth-
ylglutaryl coenzyme A reductase on coenzyme Q
and dolichol biosynthesis. Clin. Investig. 1993;71(8
Suppl):S97–102.
29. Keller RK, Fliesler SJ, Nellis SW. Isoprenoid bio-
synthesis in the retina. Quantitation of the sterol
and dolichol biosynthetic pathways. J. Biol. Chem.
1988;263(5):2250–4.
30. Fliesler SJ, Florman R, Rapp LM, Pittler SJ, Keller
RK. In vivo biosynthesis of cholesterol in the rat ret-
ina. FEBS Lett. 1993;335(2):234–8.
31. Kean EL. GDP-mannose-polyprenyl phosphate
mannosyltransferases of the retina. J. Biol. Chem.
1977;252(16):5622–9.
32. Kean EL. Mannosyl transferases of the retina: man-
nolipid and complex glycan biosynthesis. I. Kinetic
properties; product identification. Exp. Eye Res.
1977;25(4):405–17.
33. Kean EL. Activation by dolichol
phosphate-­ mannose of the biosynthesis of
N-acetylglucosaminylpyrophosphoryl polyprenols by
the retina. J. Biol. Chem. 1982;257(14):7952–4.
34. Kean EL. Influence of metal ions on the biosynthesis
of N-acetylglucosaminyl polyprenols by the retina.
Biochim. Biophys. Acta. 1983;750(2):268–73.
35. Plantner JJ, Kean EL. The dolichol pathway in the
retina: oligosaccharide-lipid biosynthesis. Exp. Eye
Res. 1988;46(5):785–800.
Perspectives on Retinal Dolichol Metabolism, and Visual Deficits in Dolichol Metabolism-Associated…
36. Kean EL. The dolichol pathway in the retina and
its involvement in the glycosylation of rhodopsin.
Biochim. Biophys. Acta. 1999;1473(2–3):272–85.
37. O'Brien PJ. Incorporation of mannose into rho-
dopsin in isolated bovine retina. Exp. Eye Res.
1977;24(5):449–58.
38. Pittler SJ, Fliesler SJ, Fisher PL, Keller PK, Rapp
LM. In vivo requirement of protein prenylation for
maintenance of retinal cytoarchitecture and photore-
ceptor structure. J. Cell Biol. 1995;130(2):431–9.
39. Pittler SJ, Fliesler SJ, Rapp LM. Novel morphological
changes in rat retina induced by intravitreal injection
of lovastatin. Exp. Eye Res. 1992;54(1):149–52.
40. Fliesler SJ, Rapp LM, Hollyfield JG. Photoreceptor-­
specific degeneration caused by tunicamycin. Nature.
1984;311(5986):575–7.
41. Fliesler SJ, Basinger SF. Tunicamycin blocks the
incorporation of opsin into retinal rod outer seg-
ment membranes. Proc. Natl. Acad. Sci. U. S. A.
1985;82(4):1116–20.
42. Fliesler SJ, Rayborn ME, Hollyfield JG. Membrane
morphogenesis in retinal rod outer segments: inhibi-
tion by tunicamycin. J. Cell Biol. 1985;100(2):574–87.
43. Tam BM, Moritz OL. The role of rhodopsin gly-
cosylation in protein folding, trafficking, and
light-sensitive retinal degeneration. J. Neurosci.
2009;29(48):15145–54.
44. Kim KJ, Kim C, Bok J, Kim KS, Lee EJ, Park SP, et al.
Spectrum of rhodopsin mutations in Korean patients
with retinitis pigmentosa. Mol. Vis. 2011;17:844–53.
45. Murray AR, Vuong L, Brobst D, Fliesler SJ, Peachey
NS, Gorbatyuk MS, et al. Glycosylation of rhodop-
sin is necessary for its stability and incorporation into
photoreceptor outer segment discs. Hum. Mol. Genet.
2015;24(10):2709–23.
46. Lefeber DJ, de Brouwer AP, Morava E, Riemersma
M, Schuurs-Hoeijmakers JH, Absmanner B, et al.
Autosomal recessive dilated cardiomyopathy due to
DOLK mutations results from abnormal dystroglycan
O-mannosylation. PLoS Genet. 2011;7(12):e1002427.
47. Zelinger L, Banin E, Obolensky A, Mizrahi-­
Meissonnier L, Beryozkin A, Bandah-Rozenfeld D,
et al. A missense mutation in DHDDS, encoding dehy-
drodolichyl diphosphate synthase, is associated with
autosomal-recessive retinitis pigmentosa in Ashkenazi
Jews. Am. J. Hum. Genet. 2011;88(2):207–15.
48. Züchner S, Dallman J, Wen R, Beecham G, Naj A,
Farooq A, et al. Whole-exome sequencing links a vari-
ant in DHDDS to retinitis pigmentosa. Am. J. Hum.
Genet. 2011;88(2):201–6.
49. Wen R, Lam BL, Guan Z. Aberrant dolichol chain
lengths as biomarkers for retinitis pigmentosa caused
by impaired dolichol biosynthesis. J. Lipid Res.
2013;54(12):3516–22.
50. Sabry S, Vuillaumier-Barrot S, Mintet E, Fasseu M,
Valayannopoulos V, Heron D, et al. A case of fatal
type I congenital disorders of glycosylation (CDG
I) associated with low dehydrodolichol diphosphate
synthase (DHDDS) activity. Orphanet J. Rare Dis.
2016;11(1):84.
455
51. Venturini G, Koskiniemi-Kuendig H, Harper S,
Berson EL, Rivolta C. Two specific mutations are
prevalent causes of recessive retinitis pigmentosa in
North American patients of Jewish ancestry. Genet.
Med. 2015;17(4):285–90.
52. Biswas P, Duncan JL, Maranhao B, Kozak I, Branham
K, Gabriel L, et al. Genetic analysis of 10 pedigrees
with inherited retinal degeneration by exome sequenc-
ing and phenotype-genotype association. Physiol.
Genomics. 2017;49(4):216–29.
53. Kimchi A, Khateb S, Wen R, Guan Z, Obolensky
A, Beryozkin A, et al. Nonsyndromic retini-
tis Pigmentosa in the Ashkenazi Jewish popula-
tion: genetic and clinical aspects. Ophthalmology.
2018;125(5):725–34.
54. Park EJ, Grabinska KA, Guan Z, Stranecky V,
Hartmannova H, Hodanova K, et al. Mutation of
Nogo-B receptor, a subunit of cis-prenyltransferase,
causes a congenital disorder of glycosylation. Cell
Metab. 2014;20(3):448–57.
55. Piccolo G, Amadori E, Vari MS, Marchese F, Riva
A, Ghirotto V, et al. Complex neurological phe-
notype associated with a De Novo DHDDS muta-
tion in a boy with intellectual disability, refractory
epilepsy, and movement disorder. J Pediatr Genet.
2021;10(3):236–8.
56. Galosi S, Edani BH, Martinelli S, Hansikova H,
Eklund EA, Caputi C, et al. De novo DHDDS variants
cause a neurodevelopmental and neurodegenerative
disorder with myoclonus. Brain; 2021.
57. Courage C, Oliver KL, Park EJ, Cameron JM,
Grabinska KA, Muona M, et al. Progressive myoc-
lonus epilepsies-residual unsolved cases have marked
genetic heterogeneity including dolichol-dependent
protein glycosylation pathway genes. Am. J. Hum.
Genet. 2021;108(4):722–38.
58. Wen R, Dallman JE, Li Y, Zuchner SL, Vance JM,
Pericak-Vance MA, et al. Knock-down DHDDS
expression induces photoreceptor degeneration in
zebrafish. Adv. Exp. Med. Biol. 2014;801:543–50.
59. Ramachandra Rao S, Fliesler SJ, Kotla P, Nguyen
MN, Pittler SJ. Lack of overt retinal degeneration in
a K42E Dhdds knock-in mouse model of RP59. Cell.
2020;9(4):4.
60. DeRamus ML, Davis SJ, Rao SR, Nyankerh C, Stacks
D, Kraft TW, et al. Selective ablation of dehydrodoli-
chyl diphosphate synthase in murine retinal pigment
epithelium (RPE) causes RPE atrophy and retinal
degeneration. Cell. 2020;9(3):3.
61. Murray AR, Fliesler SJ, Al-Ubaidi MR. Rhodopsin:
the functional significance of asn-linked glycosyl-
ation and other post-translational modifications.
Ophthalmic Genet. 2009;30(3):109–20.
62. Harrison KD, Park EJ, Gao N, Kuo A, Rush JS,
Waechter CJ, et al. Nogo-B receptor is neces-
sary for cellular dolichol biosynthesis and protein
N-glycosylation. EMBO J. 2011;30(12):2490–500.
63. Harrison KD, Miao RQ, Fernandez-Hernando C,
Suarez Y, Davalos A, Sessa WC. Nogo-B receptor sta-
bilizes Niemann-Pick type C2 protein and ­regulates
456
intracellular cholesterol trafficking. Cell Metab.
2009;10(3):208–18.
64. Zhao B, Hu W, Kumar S, Gonyo P, Rana U, Liu Z,
et al. The Nogo-B receptor promotes Ras plasma
membrane localization and activation. Oncogene.
2017;36(24):3406–16.
65. Yang YD, Li MM, Xu G, Feng L, Zhang EL, Chen J,
et al. Nogo-B receptor directs mitochondria-­associated
membranes to regulate vascular smooth muscle cell
proliferation. Int. J. Mol. Sci. 2019;20(9):9.
66. Yu SH, Wang T, Wiggins K, Louie RJ, Merino EF,
Skinner C, et al. Lysosomal cholesterol accumula-
tion contributes to the movement phenotypes asso-
ciated with NUS1 haploinsufficiency. Genet. Med.
2021;23(7):1305–14.
67. Ory DS. Getting a “hold” on NPC2. Cell Metab.
2009;10(3):161–2.
68. Park EJ, Grabinska KA, Guan Z, Sessa WC. NgBR
is essential for endothelial cell glycosyl-
ation and vascular development. EMBO Rep.
2016;17(2):167–77.
69. Zhang P, Cui D, Liao P, Yuan X, Yang N, Zhen Y,
et al. Case report: clinical features of a Chinese boy
with epileptic seizures and intellectual disabilities
who carries a truncated NUS1 variant. Front. Pediatr.
2021;9:725231.
70. Sagami H, Kurisaki A, Ogura K. Formation of doli-
chol from dehydrodolichol is catalyzed by NADPH-­
dependent reductase localized in microsomes of rat
liver. J. Biol. Chem. 1993;268(14):10109–13.
71. Medina-Cano D, Ucuncu E, Nguyen LS, Nicouleau
M, Lipecka J, Bizot JC, et al. High N-glycan multi-
plicity is critical for neuronal adhesion and sensitizes
the developing cerebellum to N-glycosylation defect.
Elife. 2018;7:7.
72. Taylor RL, Arno G, Poulter JA, Khan KN, Morarji J,
Hull S, et al. Association of steroid 5alpha-­reductase
type 3 congenital disorder of glycosylation with
early-onset retinal dystrophy. JAMA Ophthalmol.
2017;135(4):339–47.
73. Grundahl JE, Guan Z, Rust S, Reunert J, Muller B,
Du Chesne I, et al. Life with too much polyprenol:
polyprenol reductase deficiency. Mol. Genet. Metab.
2012;105(4):642–51.
74. Wheeler PG, Ng BG, Sanford L, Sutton VR,
Bartholomew DW, Pastore MT, et al. SRD5A3-CDG:
expanding the phenotype of a congenital disorder of
glycosylation with emphasis on adult onset features.
Am. J. Med. Genet. A. 2016;170(12):3165–71.
75. Marchler-Bauer A, Derbyshire MK, Gonzales
NR, Lu S, Chitsaz F, Geer LY, et al. CDD: NCBI’s
S. Ramachandra Rao et al.
conserved domain database. Nucleic Acids Res.
2015;43(Database issue):D222–6.
76. Ishikawa K, Mihara Y, Gondoh K, Suzuki E, Asano
Y. X-ray structures of a novel acid phosphatase
from Escherichia blattae and its complex with
the transition-state analog molybdate. EMBO J.
2000;19(11):2412–23.
77. Lu S, Wang J, Chitsaz F, Derbyshire MK, Geer
RC, Gonzales NR, et al. CDD/SPARCLE: the con-
served domain database in 2020. Nucleic Acids Res.
2020;48(D1):D265–D8.
78. Scher MG, Sumbilla CM, Waechter CJ. Dolichyl
phosphate metabolism in brain. Developmental
increase in polyisoprenyl phosphate phosphatase
activity. J. Biol. Chem. 1985;260(25):13742–6.
79. Bhat NR, Frank DW, Wolf MJ, Waechter
CJ. Developmental changes in enzymes involved in
dolichyl phosphate metabolism in cultured embryonic
rat brain cells. J. Neurochem. 1991;56(1):339–44.
80. Rush JS, Cho SK, Jiang S, Hofmann SL, Waechter
CJ. Identification and characterization of a cDNA
encoding a dolichyl pyrophosphate phosphatase
located in the endoplasmic reticulum of mammalian
cells. J. Biol. Chem. 2002;277(47):45226–34.
81. Fernandez F, Rush JS, Toke DA, Han GS, Quinn
JE, Carman GM, et al. The CWH8 gene encodes a
dolichyl pyrophosphate phosphatase with a lumi-
nally oriented active site in the endoplasmic reticu-
lum of Saccharomyces cerevisiae. J. Biol. Chem.
2001;276(44):41455–64.
82. Volpe JJ, Sakakihara Y, Rust RS. Dolichol kinase and
the regulation of dolichyl phosphate levels in develop-
ing brain. Brain Res. 1987;428(2):193–200.
83. Uhlen M, Fagerberg L, Hallstrom BM, Lindskog
C, Oksvold P, Mardinoglu A, et al. Proteomics.
Tissue-based map of the human proteome. Science.
2015;347(6220):1260419.
84. William James A, Ravi C, Srinivasan M, Nachiappan
V. Crosstalk between protein N-glycosylation and
lipid metabolism in Saccharomyces cerevisiae. Sci.
Rep. 2019;9(1):14485.
85. Helander A, Stodberg T, Jaeken J, Matthijs G,
Eriksson M, Eggertsen G. Dolichol kinase deficiency
(DOLK-CDG) with a purely neurological presenta-
tion caused by a novel mutation. Mol. Genet. Metab.
2013;110(3):342–4.
86. Kranz C, Jungeblut C, Denecke J, Erlekotte A,
Sohlbach C, Debus V, et al. A defect in dolichol
phosphate biosynthesis causes a new inherited disor-
der with death in early infancy. Am. J. Hum. Genet.
2007;80(3):433–40.
 Retinal Metabolic Profile on IMPG2
Deficiency Mice with Subretinal
Lesions

Rong Xu, Yekai Wang, Jianhai Du,

and Ezequiel M. Salido

Abstract energy metabolism in mice retinas of IMPG2

The interphotoreceptor matrix (IPM) is the
extracellular matrix between the photorecep-
tors and the retinal pigment epithelium (RPE).
The IPM has two proteoglycans: the IPM pro-
teoglycans 1 and 2 (IMPG1 and IMPG2,
respectively). Patients with mutations on
IMPG2 develop subretinal vitelliform lesions
that affect vision. We previously created an
IMPG2 knockout (KO) mice model that gen-
erates subretinal lesions similar to those found
in humans. These subretinal lesions in IMPG2
KO mice retinas are, in part, composed of mis-
localized IMPG1. In addition, IMPG2 KO
mice show microscopic IMPG1 material accu-
mulation between the RPE and the photore-
ceptor outer segments. In this work we discuss
the possibility that material accumulation on
IMPG2 KO mice retinas affects photoreceptor
metabolism. To further investigate this idea,
we used targeted metabolomics to profile reti-
nal metabolome on IMPG2 KO mice. The
metabolite set enrichment analysis showed
reduced glutamate metabolism, urea cycle,
and galactose metabolism suggesting affected
R. Xu · Y. Wang · J. Du · E. M. Salido (*)
Departments of Biochemistry and molecular
medicine, and Ophthalmology and Visual Sciences,
West Virginia University, Morgantown, WV, USA
e-mail: ezequiel.salido@hsc.wvu.edu
KO mice with subretinal lesion.
Keywords
Interphotoreceptor matrix · Metabolomics ·
Vitelliform macular dystrophy · IMPG2 ·
Retina · Metabolite
1 Introduction
In between the photoreceptors and interfacing
with the retinal pigment epithelium (RPE) lies an
extracellular matrix called interphotoreceptor
matrix (IPM). Activities crucial to vision occur
within IPM, including the trafficking of nutrients
and metabolites [12]. The IPM has two unique
proteoglycans: the IPM proteoglycans 1 and 2
(IMPG1 and IMPG2, respectively), also known
as SPACR and SPACRCAN or IPM150 and
IPM200, respectively [9, 12]. Humans with
mutations in IMPG2 develop, over time, vision
loss characterized by subretinal vitelliform
lesions, predominantly in the macula, named
vitelliform macular dystrophy (VMD) [5, 15,
21]. Previously, our lab created an animal model
lacking IMPG2 that generates subretinal lesions
similar to those found in humans. In the absence
of IMPG2, abnormal accumulation of material
constituted by IMPG1 and chondroitin sulfate
was found between the photoreceptors and RPE.

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 457
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_67
458
Over time, these mutant mice develop subretinal
lesions detectable by optical coherence tomogra-
phy (OCT), glial reactivity, and migration of
microglia focalized in the area of the subretinal
lesion [16].
The primordial nutrition of the photoreceptors
comes from the RPE [6, 11]. All nutrients and
metabolites that flow between photoreceptors
and RPE must pass through the IPM between
these cells. We think that pathological diseases
that alter the functional-structural properties of
the IPM can impair molecules exchange. This
work uses a mice model with disrupted IPM to
evaluate possible metabolic impairment of the
retina. To address this, we used targeted metabo-
lomics using mass spectrometry (MS) coupled
with liquid chromatography (LC) to evaluate 241
metabolites in mutant and control mice retinas.
2 Materials and Methods
2.1 Animals
The IMPG2 KO animal model used in this study
was generated by Crispr-Cas9 technology as
described by Salido and Ramamurthy [16].
Briefly, heterozygote animals were backcrossed
with C57BL/6 J (The Jackson Laboratory). All
animals were generated at the Transgenic Core of
West Virginia University and did not contain rd1
or rd8 alleles. Mice of both sexes at 8 months old
were used in this experiment. The animals were
maintained under 12-h light/dark cycles with
food and water provided ad libitum. All experi-
mental procedures involving animals in this study
were approved by the Institutional Animal Care
and Use Committee of West Virginia University.
2.2 Retina Collection
Retinas were collected as described in Wang
et al. [20]. Briefly, mice were euthanized and
eyes enucleated and placed on wet filter papers
presoaked with cold HBSS on ice. The anterior
half of the eye was removed, and the posterior
half was moved and submerged in a drop of 50 μl
R. Xu et al.
cold HBSS solution for retina isolation. Once
collected in microtubes, two retinal tissues were
snap-frozen in liquid N2. Five animals from the
same litter were used. Two IMPG2 KO mice with
confirmed subretinal lesions in both eyes by opti-
cal coherence tomography (OCT) and three
IMPG2 heterozygous mice were used as control.
Total of N = 4 retinas for IMPG2 KO and N = 6
retinas for the control group.
2.3 Mass Spectrometry Sample
Preparation and Metabolite
Analysis by LC-MS/MS
Samples were processed and analyzed as
described in Grenell et al. [7] and Li et al. [14].
Briefly, retinas were homogenized in pre-chilled
80% methanol to extract metabolites. The extracts
were dried and reconstituted for LC-MS/MS
analysis. Metabolite extracts were analyzed by a
Shimadzu LC Nexera X2 UHPLC coupled with a
QTRAP 5500 LC-MS/MS (AB Sciex). An
ACQUITY UPLC BEH Amide analytic column
(2.1 × 50 mm, 1.7 μm) (Waters Corp., Milford,
MA) was used for chromatographic separation.
The mobile phase was (A) water with 10 mM
ammonium acetate (pH 8.9) and (B) acetonitrile/
water (95/5) with 10 mM ammonium acetate
(pH 8.2) (all solvents were LC-MS Optima grade
from Fisher Scientific). The total run time was
11 min. With a flow rate of 0.5 ml/min. and an
injection volume of 5 μl. The gradient elution was
95–61% B in 6 min, 61–44% B at 8 min, 61–27%
B at 8.2 min, and 27–95% B at 9 min. The column
was equilibrated with 95% B at the end of each
run. The source and collision gas was N2. The ion
source conditions in positive and negative mode
were curtain gas (CUR) = 25 psi, collision gas
(CAD) = high, ion spray voltage (IS) = 3800/-
3800 volts, temperature (TEM) = 500 °C, ion
source gas 1 (GS1) = 50 psi, and ion source gas 2
(GS2) = 40 psi. Each metabolite was tuned with
standards for optimal transitions. 13C-nicotinic
acid (Toronto Research Chemicals) was used as
the internal standard. The extracted MRM peaks
were integrated using MultiQuant 3.0.3 software
(AB Sciex, Concord, ON, CA).
Retinal Metabolic Profile on IMPG2 Deficiency Mice with Subretinal Lesions 459

2.4 Statistical Analysis datasets shows two distinct groups with different
metabolic profiles (Fig. 1).
Differences between means were determined by To identify significantly changed metabolites,
unpaired two-tailed T-tests. The principal compo- we perform a T-test statistical analysis over all
nent analysis and partial least squares-­ the target metabolites analyzed between groups.
discriminant analysis (PLS-DA) (P < 0.05 on raw This study identified 11 different significant
data, unpair) were analyzed using MetaboAnalyst metabolites described in Table 1. All identified
5.0 (http://www.metaboanalyst.ca/). Enrichment metabolites are significantly reduced in the KO
analysis for significantly altered metabolic path- group with respect to the control. In order to visu-
ways was performed with MetaboAnalysts. alize and evaluate metabolites changes from indi-
vidual samples, we performed a fold change
hierarchical cluster analysis for each sample
3 Results using the top 25 most statistically different sam-
ples by T-test (Fig. 2). The heatmap represents
To evaluate the metabolic homeostasis of retinas the fold change for each sample using a color
with altered IPM and subretinal lesions, we per- code.
formed a metabolomics analysis comparing reti- To identify biologically meaningful pathways
nas from heterozygous IMPG2 KO mice as a affected on retinas from mutant mice, we per-
control group and homozygous IMPG2 KO mice. form a metabolite set enrichment analysis
We first evaluate for general differences between (Fig. 3). The top three most significantly enriched
control and KO groups using a PLS-DA analysis. metabolite sets are glutamate metabolism, urea
The score plot analysis on individual samples cycle, and galactose metabolism.

Fig. 1 Distinctive
metabolic profiles
between control and
IMPG2 KO retinas.
Score plot of retina
metabolites separated
into two different groups
by PLS-DA. The
explained variances are
shown in brackets
460 R. Xu et al.

Table 1 Individual statistically significant molecules by T-test

Important molecules identified by T-tests
Metabolite t.stat p.value FDR FC log2(FC)
1 cGMP 4.429 0.0022 0.205 1.35 0.433
2 Malate 3.784 0.0054 0.236 1.20 0.266
3 Nicotinamide 3.386 0.0096 0.236 1.39 0.475
4 Alanine 3.344 0.0102 0.236 1.18 0.244
5 Taurine 3.167 0.0132 0.246 1.31 0.387
6 Myo-inositol 2.752 0.0250 0.304 1.13 0.172
7 Erythritol 2.744 0.0253 0.304 1.30 0.381
8 UDP 2.722 0.0262 0.304 1.30 0.382
9 3-Aminoisobutyrate 2.481 0.0380 0.363 1.22 0.285
10 GMP 2.464 0.0391 0.363 1.36 0.441
11 Aspartic acid 2.308 0.0498 0.421 1.18 0.240
Fold change (FC) obtained as control/KO. t.stat t-statistic, FDR false discovery rate

Fig. 2 Metabolites’ hierarchical cluster analysis for each are fold change of ion intensity of the KO vs. control.
sample shown as a heatmap. The data were clustered for N = 10 from five animals in total
similar patterns using MetaboAnalyst 5.0 software. Data
Retinal Metabolic Profile on IMPG2 Deficiency Mice with Subretinal Lesions 461

Fig. 3 Most enriched affected metabolic pathways on IMPG2 KO retinas. Top metabolite patterns plot listed based on
lower P-value and colored coded. The enrichment ratio is visualized as the size of the circles

4 Discussion RPE generate a negative impact on the photore-

In this work, we identified glutamate metabolism,
urea cycle, and galactose metabolism as the most
affected pathways in the retina of mutant mice.
These findings suggest that retinas with altered
IPM and subretinal lesions create changes in the
retina metabolic homeostasis.
4.1 Altered
IPMInterphotoreceptor matrix
(IPM) and Retina Metabolism
The photoreceptors cells are the most abundant
cell type in the retina as well as one of the cells
with higher demand for nutrients in the body
[14]. Nutrient deficits between these cells and
ceptors’ health [6]. Mice with IMPG2 deletion
develop extracellular matrix material accumula-
tion and subretinal lesions between the photore-
ceptors and the RPE. At 8 months old, the retina
function of these mice is significantly reduced
without major changes in the retina. We hypoth-
esize that the observed decrease in GMP and
cGMP are directly related to a decrease in the
photoreceptor outer segment health. A detailed
analysis of photoreceptors outer segments’ length
needs to be done to confirm this hypothesis.
The neural retina consumes glucose, aspartate,
glutamate, citrate, nicotinamide, and other
nutrients to sustain its active glycolysis, mito-
chondrial oxidative metabolism, and neurotrans-
mitter synthesis [14]. We consider that the
decrease in the glutamate metabolism, urea cycle,
462
and galactose metabolism is directly linked to
photoreceptor nutrient stress product of the
affected IPM. On the other hand, carnitine plays
a vital role in transporting long-chain CoA into
the mitochondria for oxidation [20]. In this sense,
the only three positively enriched metabolites in
the mutant retinas are acetylcarnitine, spermine,
and 2-methylbutyroylcarnitine indicating dys-
regulation of lipid metabolism.
4.2 Experimental Limitations
and Future Directions
The data gathered in this work help to understand
the photoreceptor function reduction in IMPG2
KO mice; nevertheless, it possesses several limi-
tations that need to be addressed in further work.
In this work, heterozygous IMPG2 littermate
mice have been used as a control reference.
Heterozygous mice may present unknown defects
in the IPM structure that also affect the molecules
interchange thought the IPM. In this case, the dif-
ferences found in this work between IMPG2 KO
and control are underestimated. Further
experiments using wild-type mice as control
­ mice. SDDs are thought as independent risk fac-
could yield greater and new significant metabo-
lite differences between groups. On the other
hand, this work used both eyes from the same
animal as separate data points. Further experi-
ments need to pool both retinas in one sample
and increase the sample group size to five for
each group.
The photoreceptors and the RPE work in
combination to interchange nutrients and
metabolic waste. The RPE metabolic homeostasis
can potentially be affected by defects in the IPM.
In future studies, we will evaluate the metabolism
of the RPE along with the retina.
Mice without IMPG2 generate subretinal
lesions after 5 months of age but possess material
accumulation between photoreceptors and RPE
as young as 45 days old. To dissect the influence
of the subretinal lesions and the micro-material
accumulation, metabolomics analysis could be
R. Xu et al.
performed in younger IMPG2 KO mice before
subretinal lesion formation. In addition, 8-month-­
old mutant mice present microglia migration and
Müller cell reactivity [16]. A major limitation in
the data interpretation arises due to the impossi-
bility to separate the metabolic changes origi-
nated from the immune response from those
changes inherent to nutrient stress. Hence, test
metabolomics in younger mice will help to
reduce the influence of the immune response.
4.3 Subretinal Lesions, Nutrient
Stress, and Macular
Degeneration
The extracellular matrices tend to lose their
mechanical and hydration properties over time [3].
During aging, the retina metabolism changes [20].
Unstudied age-related changes in the IPM may
contribute to changes in vision observed with
aging [2]. Patients suffering from age-­related mac-
ular degeneration (AMD) can accumulate material
within the IPM called subretinal drusenoid depos-
its (SDDs) similar to those found in IMPG2 KO
tors for late AMD. Geographic atrophy and cho-
roidal neovascularization are particularly
associated with SDD [1, 8, 17, 18]. Furthermore,
patients with SDDs without signs of AMD have an
increased risk of disease development [10, 19]. In
addition, the photoreceptors from patients with
AMD exhibit an increased expression of glyco-
lytic genes in addition to an altered metabolic
marker profile suggesting nutrient stress during
disease [4, 13]. In this sense, retina metabolism
disbalance and subretinal lesions developed in
IMPG2 KO animals place these mutant mice as a
promising tool to study the role of subretinal
lesions in the AMD context.
Acknowledgments The Knight Templar Eye Foundation
(EMS) and West Virginia Lions and Lions Club
International Foundation supported this work. We thank
Scott Rhodes and Benjamin Mitchell for support in the
maintenance of animal models and genotyping.
Retinal Metabolic Profile on IMPG2 Deficiency Mice with Subretinal Lesions 463

References 12. Ishikawa M, Sawada Y, Yoshitomi T. Structure

and function of the interphotoreceptor matrix
surrounding retinal photoreceptor cells. Exp Eye Res.
1. Alten F, Eter N. Current knowledge on reticular
2015;133:3–18.
pseudodrusen in age-related macular degeneration. Br
13. Jones BW, Pfeiffer RL, Ferrell WD, Watt CB, Tucker
J Ophthalmol. 2015;99:717–22.
J, Marc RE. Retinal remodeling and metabolic
2. Al-Ubaidi MR, Naash MI, Conley SM. A perspective
alterations in human AMD. Front Cell Neurosci.
on the role of the extracellular matrix in progressive
2016;10:103.
retinal degenerative disorders. Invest Ophthalmol Vis
14. Li B, Zhang T, Liu W, Wang Y, Xu R, Zeng S, Zhang
Sci. 2013;54:8119–24.
R, Zhu S, Gillies MC, Zhu L, Du J. Metabolic features
3. Birch HL. Extracellular matrix and ageing. Subcell
of mouse and human retinas: rods versus cones,
Biochem. 2018;90:169–90.
macula versus periphery, retina versus RPE. iScience.
4. Cheng SY, Cipi J, Ma S, Hafler BP, Kanadia RN, Brush
2020;23:101672.
RS, Agbaga MP, Punzo C. Altered photoreceptor
15. Meunier I, Manes G, Bocquet B, Marquette V,
metabolism in mouse causes late stage age-related
Baudoin C, Puech B, Defoort-Dhellemmes S, Audo
macular degeneration-like pathologies. Proc Natl
I, Verdet R, Arndt C, Zanlonghi X, Le Meur G,
Acad Sci U S A. 2020;117:13094–104.
Dhaenens CM, Hamel CP. Frequency and clinical
5. Chowers I, Tiosano L, Audo I, Grunin M, Boon
pattern of vitelliform macular dystrophy caused by
CJ. Adult-onset foveomacular vitelliform dystrophy: a
mutations of interphotoreceptor matrix IMPG1 and
fresh perspective. Prog Retin Eye Res. 2015;47:64–85.
IMPG2 genes. Ophthalmology. 2014;121:2406–14.
6. Du J, Zhu S, Lim RR, Chao JR. Proline metabolism
16. Salido EM, Ramamurthy V. Proteoglycan IMPG2
and transport in retinal health and disease. Amino
shapes the Interphotoreceptor matrix and modulates
Acids. 2021;53:1789.
vision. J Neurosci. 2020;40:4059–72.
7. Grenell A, Wang Y, Yam M, Swarup A, Dilan TL,
17. Sivaprasad S, Bird A, Nitiahpapand R,
Hauer A, Linton JD, Philp NJ, Gregor E, Zhu S,
Nicholson L, Hykin P, Chatziralli I, Moorfields
Shi Q, Murphy J, Guan T, Lohner D, Kolandaivelu
UCLAMDC. Perspectives on reticular pseudodrusen
S, Ramamurthy V, Goldberg AFX, Hurley JB, Du
in age-related macular degeneration. Surv
J. Loss of MPC1 reprograms retinal metabolism to
Ophthalmol. 2016;61:521–37.
impair visual function. Proc Natl Acad Sci U S A.
18. Spaide RF, Ooto S, Curcio CA. Subretinal drusenoid
2019;116:3530–5.
deposits AKA pseudodrusen. Surv Ophthalmol.
8. Hogg RE. Reticular pseudodrusen in age-related
2018;63:782–815.
macular degeneration. Optom Vis Sci. 2014;91:854–9.
19. Spaide RF, Yannuzzi L, Freund KB, Mullins R,
9. Hollyfield JG, Rayborn ME, Midura RJ, Shadrach
Stone E. EYES WITH SUBRETINAL DRUSENOID
KG, Acharya S. Chondroitin sulfate proteoglycan
DEPOSITS AND NO DRUSEN: progression of
core proteins in the interphotoreceptor matrix:
macular findings. Retina. 2019;39:12–26.
a comparative study using biochemical and
20. Wang Y, Grenell A, Zhong F, Yam M, Hauer A,
immunohistochemical analysis. Exp Eye Res.
Gregor E, Zhu S, Lohner D, Zhu J, Du J. Metabolic
1999;69:311–22.
signature of the aging eye in mice. Neurobiol Aging.
10. Huisingh C, McGwin G Jr, Neely D, Zarubina
2018;71:223–33.
A, Clark M, Zhang Y, Curcio CA, Owsley C. The
21. Wilde C, Lakshmanan A, Patel M, Morales MU,
association between subretinal Drusenoid deposits in
Dhar-Munshi S, Amoaku WM. Prevalence of reticular
older adults in Normal macular health and incident
pseudodrusen in newly presenting adult onset
age-­related macular degeneration. Invest Ophthalmol
foveomacular vitelliform dystrophy. Eye (Lond).
Vis Sci. 2016;57:739–45.
2016;30:817–24.
11. Hurley JB, Lindsay KJ, Du J. Glucose, lactate, and
shuttling of metabolites in vertebrate retinas. J
Neurosci Res. 2015;93:1079–92.
 Part X
Neuroprotection
 Glutathione Coating of Liposomes
Enhances the Delivery
of Hydrophilic Cargo to the Inner
Nuclear Layer in Retinal Cultures

Gustav Christensen and François Paquet-Durand

Abstract in the retinal inner vasculature, but further

To successfully deliver intracellular
compounds to retinal cells, a delivery system
based on purified lipids, self-assembled into
synthetic vesicles called liposomes, can be
used. Liposomes have the potential to target
distinct tissues and cells in the body by molec-
ular targeting moieties conjugated to their sur-
face. To enhance liposome delivery to neurons,
glutathione has formerly been used as target-
ing moiety. It is unclear whether and how the
glutathione conjugation improves the
liposome-­induced uptake to cells within the
retina. To explore this, glutathione-liposomes
were prepared and loaded with a fluorescent
tracer, which was added to organotypic retinal
explant cultures derived from mice. The fluo-
rescence in the tissue was analyzed from his-
tological sections using fluorescent
microscopy. Comparisons were done with
liposomes without a targeting device and
cysteine-­conjugated liposomes. A significant
increase (p ≤ 0.05) of fluorescent signal was
observed from the inner nuclear layer of reti-
nas exposed to glutathione-conjugated lipo-
somes. Qualitatively, this might be attributed
to the accumulation of glutathione-liposomes
G. Christensen · F. Paquet-Durand (*)
Institute for Ophthalmic Research, University of
Tübingen, Tübingen, Germany
e-mail: francois.paquet-durand@uni-tuebingen.de
studies are needed for verification.
Keywords
Liposomes · Retinal explant cultures ·
Blood-retinal barrier · Glutathione
1 Introduction
Liposomes are lipid-based submicron vesicles
(20–1000 nm) able to encapsulate drug molecules.
Liposomal encapsulation may prolong drug
release and decrease drug treatment intervals,
and can be used to target specific cell types or
tissues [2, 3, 5, 7]. Typically, coating the
liposomes with highly hydrophilic polymers,
e.g., poly(ethylene glycol) (PEG), is done to
shield the liposome surface, so as to limit immune
responses [9]. Liposomes with glutathione
conjugated to the end of the PEG chains have
previously been used to target neurons in the
brain, and have shown an enhanced permeation
through the blood-brain barrier [6, 8]. Not much
is known about the specific mechanism of uptake,
however. One hypothesis is that glutathione, due
to preferred uptake in brain endothelial cells,
allows the liposomes to be taken up from the
plasma side and transport the encapsulated cargo
to the brain [8]. Whether this would be the same
for the retina is not well understood even though

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 467
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_68
468 G. Christensen and F. Paquet-Durand

glutathione-­conjugated liposomes have also 3 Methods

shown improved delivery of neuroprotective
compounds to the in vivo retina in mouse models 3.1 Liposome Preparation
of retinal degeneration, when compared to and Encapsulation
administration of the free drug [12].
Here, we performed an exploratory study to Liposomes were prepared using a published
test the uptake of glutathione-conjugated lipo- protocol [13], which will be briefly summa-
somes in organotypic retinal explant cultures rized here. The lipids POPC, cholesterol, and
derived from wild-type mice. As controls, we DSPE-­mPEG2000 or DSPE-PEG2000-maleimide,
used liposomes with unconjugated PEG chains dissolved in chloroform, were mixed in a
(mPEG), as well as liposomes with cysteine con- round-bottom flask in the molar ratio of 63.3:
jugations. We analyzed where in the tissue the 31.7: 5 (total mass = 1 mg of dried material).
different types of liposomes accumulated prefer- The chloroform was removed from the mixture
entially, and which cell types showed enhanced on a rotary evaporator (model RC600, KNF
uptake of a fluorescent tracer. Neuberger, Trenton, NJ, USA), operating at a
speed of 100 rpm and a pressure of 300 mbar
for at least 1 h. Afterwards, a thin film of dried
2 Materials lipids remained on the bottom of the curved
flask. 1 mL of calcein (2 mM in PBS) was
1 - P a l m i t o y l - 2 - o l e o y l - s n - g l y c e r o - 3 -­ added to the lipids, and the flask vortexed, until
phosphocholine (POPC), 3β-hydroxy-5-­ all the lipids were visibly dissolved. The mix-
cholesten (cholesterol), 1,2-distearoyl- ture was extruded using a mini-extruder (Avanti
s n - g l y c e r o - 3 -­­p h o s p h o e t h a n o l a m i n e - N - Polar Lipids, Alabaster, AL, USA) through a
[(polyethylene glycol)-2000] (ammonium salt) 100 nm porous polycarbonate membrane
(DSPE-mPEG2000), 1,2-distearoyl-sn-glycero- between 2 filter supports back and forth at least
3-­­phosphoethanolamine-N-[maleimide(polyethy 11 times. For samples containing DSPE-
lene glycol)-2000] (ammonium salt) (DSPE- PEG2000-maleimide, 20 μL of either L-cysteine
PEG2000-maleimide), anhydrous chloroform (≥ or reduced glutathione (1 mg/mL in maleimide-
99%) with 0.5–1% ethanol, paraformaldehyde, thiol reaction buffer) was added and incubated
sucrose, disodium hydrogen phosphate dihy- with the samples for 2 h at room temperature to
drate, sodium dihydrogen phosphate monohy- produce cysteine-coated liposomes (Lp-Cys) or
drate, sodium chloride, hydrogen chloride, glutathione-coated liposomes (Lp-Glu), respec-
sodium hydroxide, Tris(2-­carboxyethyl)phos- tively. Alternatively, 20 μL of PBS was added to
phine hydrochloride (TCEP), L-cysteine, reduced the liposomes with DSPC-­ mPEG2000
glutathione, and calcein were all obtained from (Lp-Control). Excess L-cysteine or glutathione
Sigma-Aldrich (Darmstadt, Germany). and nonencapsulated calcein were removed
Buffers: Phosphate-buffered saline (PBS): from the solutions by dialysis against 150 mM
10 mM disodium hydrogen phosphate dihydrate, NaCl (Slide-A-Lyzer Dialysis Cassettes, 10 K
1.8 mM sodium dihydrogen phosphate monohy- MWCO, cellulose membrane, Thermo Fisher
drate, and 137 mM sodium chloride in miliQ Scientific, Waltham, MA, USA). Afterwards,
water. Maleimide-thiol reaction buffer: 10 mM the liposomes were sterile filtered (Millex-GP,
TCEP in miliQ water. All buffers were adjusted 0.22 μm, polyethersulfon, Merck Millipore,
to pH 7.4 with HCl and NaOH using an elec- Darmstadt, Germany) and stored at 2–8 °C until
tronic pH meter. further use.
Glutathione Coating of Liposomes Enhances the Delivery of Hydrophilic Cargo to the Inner Nuclear Layer… 469

3.2 Liposome Uptake following retinal layers: ganglion cell layer

in Organotypic Retinal (GCL), inner plexiform layer (IPL), inner nuclear
Explant Cultures layer (INL), outer nuclear layer (ONL), and the
outer and inner photoreceptor segments using the
Organotypic retinal explants derived from wild-­ acquisition software (ZEN 2.6, Zeiss). This sig-
type mice at postnatal day (P) 13 were cultured nal was divided by the area of the corresponding
following an established protocol [1, 10]. Briefly, layer and compared across the three types of lipo-
the eyes were enucleated and the isolated retinas somes tested. GraphPad Prism 9 (GraphPad
placed in a Transwell insert (0.4 μm, polycarbon- Software, San Diego, CA, USA) was used to
ate, Corning-Costar, New York, NY, USA) in a present the data and perform statistical tests.
6-well plate with the attaching RPE layer facing
down. Serum-free R16 medium (Thermo Fisher
Scientific, Waltham, MA, USA) was added from 4 Results and Discussion
underneath the retinal cultures and replaced every
second day. At P15, a 20 μL solution of lipo- To assess how different targeting components,
somes (100 μg/mL) with encapsulated calcein conjugated to the surface of dye-loaded lipo-
(see above) was added dropwise on the top of the somes, would affect their distribution in the ret-
culture. This has been done previously to exam- ina, glutathione-coated, cysteine-coated, and
ine the effect of nanoparticles entering the retina PEGylated control liposomes were tested and
from the vitreous side as they would during an compared. Since not much was known about how
intravitreal injection [4, 11]. After 6 h of incuba- glutathione coating of liposomes benefits drug
tion, the retinas were fixed in a 4% paraformalde- delivery to the retina, we focused on how gluta-
hyde/PBS solution for 45 min, followed by thione affected cellular uptake and distribution
cryoprotection in solutions of incremental within the retina. For comparison, we used also
amounts of sucrose (10% sucrose for 10 min, cysteine conjugation because this molecule
20% sucrose for 20 min, and 30% sucrose at shares structural similarities with glutathione
2–8 °C overnight) and submerged in blocks of (Fig. 1a), thus allowing to assess the specificity
embedding medium (Tissue-Tek of glutathione. The retinal explants were cultured
O.C.T. Compound, Sakura Finetek Europe, for a period of 2 days between explantation and
Alphen aan den Rijn, Netherlands), which was treatment, so as to allow proper assessment of
then frozen in liquid nitrogen. The frozen blocks retinal culture quality and viability. Liposomes
were sectioned on a cryostat (NX50, Thermo loaded with the green dye calcein were then
Fisher, Waltham, MA, USA) to produce 14 μm added to retinas derived from mice and incubated
sections on Superfrost Plus object slides for 6 h (Fig. 1b). A relatively short incubation
(R. Langenbrinck, Emmendingen, Germany) time was chosen since longer culturing periods
from the center of the retinal culture (in the range were deemed to less well represent native condi-
of 1700–2900 μm from the edge). The sections tions (e.g., ganglion and endothelial cells in cul-
were washed in PBS, stained with DAPI ture are degenerating over a time course of
(Vectashield with DAPI, Vector laboratories, 4 days). Another reason for the short incubation
Burlingame, CA, USA), and imaged with fluo- time was that, over longer periods of time, cal-
rescence microscope (Axio Imager Z2 with cein might (passively or actively) redistribute
ApoTome function, Zeiss, Oberkochen, between cells, which would make it harder to dis-
Germany). A CCD camera with a 20X objective tinguish specific effects of the targeting compo-
was used. A blue filter was used to measure the nents. After the incubation period, the tissues
DAPI signal (Ex./Em. 353/465 nm), and a green were sectioned and imaged, using the same
filter was used to measure the calcein signal (Ex./ parameters across all samples (Fig. 1c). The aver-
Em. 493/517 nm). The signal intensity from the age calcein signal was measured from different
green channel was measured coming from the retinal layers (Fig. 1c iv). Since the liposomes
470
Fig. 1 Distribution of cysteine- and glutathione-­
conjugated liposomes in organotypic retinal explant
cultures
(a) Structure of liposome built from 1-palmitoyl-2-oleoyl-
sn-glycero-3-phosphocholine (POPC), cholesterol, and
1,2-distearoyl-sn-glycero-3-­­p hosphoethanolamine
(DSPE) with 2 kDa poly(ethylene glycol) (2000PEG)
conjugated to either of three different chemical groups
(R): either R = methoxyl group (OMe) in the formulation
Lp-control, R = cysteine in Lp-cysteine, or R = glutathi-
one in Lp-glutathione. (b) Experimental design.
Organotypic retinal explant cultures derived from mice
were isolated and cultured at postnatal day 13. Liposomes
were added to the cultures from the side closest
to the ganglion cell layer, we saw the most abun-
dant fluorescence signal there, while signals from
the deeper retinal layers were gradually decreas-
ing. An exception was the inner/outer segments
(IOS), where the signal appeared to be stronger
than signal from the inner or outer nuclear
layers.
Remarkably, Lp-glutathione seemed to be
localized in large depots between the INL and
ONL (Fig. 1c iii), and a significant increase in the
G. Christensen and F. Paquet-Durand
loaded with calcein were added on top of the cultures
(from the ganglion cell layer side) at postnatal day 15, and
the cultures were fixed after a 6-h incubation period. (c)
Calcein signal measured from cross sections obtained
from retinal explant cultures, where (i) Lp-control/cal-
cein, (ii) Lp-cysteine/calcein, or (iii) Lp-glutathione/cal-
cein was added. Scale bar = 50 μm. (iv) Averaged calcein
signal quantified across retinal layers and expressed as
mean ± SD for n = 3–5. *p < 0.05. Images shown in C are
representative for explant cultures obtained from n = 3–5
animals. Statistical analysis: One-way ANOVA with
Tukey’s post hoc test
signal coming from the INL could be detected in
cultures to which Lp-glutathione was added
(Fig. 1c iv), indicating that the glutathione conju-
gation might assist liposomes in reaching deeper
into the retinal tissue. The large green areas might
relate to the inner retinal vasculature, suggesting
that Lp-glutathione was accumulating in the
endothelial cells within the retina. In the explant
culture system, the outer vasculature is removed
prior to culturing. Thus, if indeed conjugated
liposomes were targeting endothelial cells, gluta-
Glutathione Coating of Liposomes Enhances the Delivery of Hydrophilic Cargo to the Inner Nuclear Layer…
thione conjugation could potentially help to
deliver cargo across the inner blood-retinal
­barrier. Alternatively, the accumulated fluorescent
signal could relate to horizontal cells, which 6.
reside in the INL, in close proximity to the
OPL. In the future, it will be interesting to label
cells with distinct markers in the retinal tissue
sections (e.g., RBPMS expressed in certain types 7.
of ganglion cells, CD31 expressed in the capillary
endothelium, or calbindin expressed in horizontal
cells) to investigate potential co-localization with
the liposome-delivered dye. 8.
Acknowledgments We are grateful for excellent
technical support from Norman Rieger. This study was
supported by grants from the Tistou and Charlotte Kerstan
Foundation and the Deutsche Forschungsgemeinschaft
9.
(DFG; PA1751/10-1).
References
10.
1. Belhadj S, Tolone A, Christensen G, Das S, Chen Y,
Paquet-Durand F. Long-term, serum-free cultivation
of Organotypic mouse retina explants with intact
11.
retinal pigment epithelium. J Vis Exp. 2020;
2. Blazaki S, Pachis K, Tzatzarakis M, Tsilimbaris M,
Antimisiaris SG. Novel liposome aggregate platform
(LAP) system for sustained retention of drugs in
the posterior ocular segment following intravitreal
12.
injection. Int J Pharm. 2020;576:118987.
3. Bourlaist CL, Chevanne F, Ropert P, Bretagne G, Acar
L, Zia H, Sado PA, Needham T, Leverge R. Release
kinetics of liposome-encapsulated ganciclovir after
intravitreal injection in rabbits. J Microencapsul.
1996;13(4):473–80.
4. Christensen G, Barut L, Urimi D, Schipper N, Paquet-­
Durand F. Investigating ex vivo animal models to
test the performance of intravitreal liposomal drug
13.
delivery systems. Pharmaceutics. 2021;13(7)
5. del Amo EM, Rimpelä A-K, Heikkinen E, Kari
OK, Ramsay E, Lajunen T, Schmitt M, Pelkonen L,
Bhattacharya M, Richardson D, Subrizi A, Turunen
471
T, Reinisalo M, Itkonen J, Toropainen E, Casteleijn
M, Kidron H, Antopolsky M, Vellonen K-S, Ruponen
M, Urtti A. Pharmacokinetic aspects of retinal drug
delivery. Prog Retin Eye Res. 2017;57:134–85.
Hu Y, Gaillard PJ, de Lange ECM, Hammarlund-­
Udenaes M. Targeted brain delivery of methotrexate
by glutathione PEGylated liposomes: how can
the formulation make a difference? Eur J Pharm
Biopharm. 2019;139:197–204.
Khiev D, Mohamed ZA, Vichare R, Paulson R, Bhatia
S, Mohapatra S, Lobo GP, Valapala M, Kerur N,
Passaglia CL, Mohapatra SS, Biswal MR. Emerging
nano-formulations and nanomedicines applications
for ocular drug delivery. Nano. 2021;11(1)
Maussang D, Rip J, van Kregten J, van den Heuvel A,
van der Pol SMA, van der Boom B, Reijerkerk A, Chen
L, de Boer M, Gaillard PJ, de Vries HE. Glutathione
conjugation dose-dependently increases brain-­
specific liposomal drug delivery in vitro and in vivo.
Drug Discov Today Technol. 2016;20:59.
Nosova AS, Koloskova OO, Nikonova AA, Simonova
VA, Smirnov VV, Kudlay D, Khaitov MR. Diversity
of PEGylation methods of liposomes and their
influence on RNA delivery. Med Chem Comm.
2019;10(3):369–77.
Prajapati M, Christensen G, Paquet-Durand F,
Loftsson T. Cytotoxicity of β-cyclodextrins in retinal
explants for intravitreal drug formulations. Molecules.
2021;26(5)
Sen M, Al-Amin M, Kicková E, Sadeghi A, Puranen
J, Urtti A, Caliceti P, Salmaso S, Arango-Gonzalez
B, Ueffing M. Retinal neuroprotection by controlled
release of a VCP inhibitor from self-assembled
nanoparticles. J Control Release. 2021;339:307–20.
Vighi E, Trifunović D, Veiga-Crespo P, Rentsch A,
Hoffmann D, Sahaboglu A, Strasser T, Kulkarni M,
Bertolotti E, van den Heuvel A, Peters T, Reijerkerk
A, Euler T, Ueffing M, Schwede F, Genieser H-G,
Gaillard P, Marigo V, Ekström P, Paquet-Durand
F. Combination of cGMP analogue and drug delivery
system provides functional protection in hereditary
retinal degeneration. Proc Natl Acad Sci U S A.
2018;115(13)
Zhang H. Thin-film hydration followed by extrusion
method for liposome preparation. In: D’Souza GGM,
editor. Liposomes: methods and protocols. New York:
Springer; 2017. p. 17–22.
 Modification of Müller Glial Cell
Fate and Proliferation with the Use
of Small Molecules

Marcus J. Hooper

Abstract 1 Introduction

In recent years, reprogramming Müller glia
by overexpressing Ascl1 and other transcrip-
tion factors has shown promise for the regen-
eration of postmitotic retinal neurons,
primarily bipolar cells, following injury.
Müller glial proliferation and efficiency of
neuronal differentiation can be modified by
the use of small molecules in various sys-
tems. The molecules and pathways studied
thus far share remarkable consistency with
astrocytes. In this mini review, we provide an
overview on the modulation of Müller glial
proliferation and cell fate using small mole-
cules in injury and reprogramming. We also
compare these observations to what has been
observed in astrocytes.
Keywords
Müller glia · Reprogramming · Drug · Small
molecule · Neuron · Glia · Neuronal repro-
gramming · Pharmacological · Proliferation
M. J. Hooper (*)
Department of Biological Structure, University of
Washington, Seattle, WA, USA
e-mail: mjhooper@uw.edu
The death of postmitotic retinal neurons causes
retinal degeneration, a primary cause of
irreversible blindness. Current treatment
strategies for retinal degeneration do not restore
lost neurons or visual function, but delay
degeneration. Regeneration of lost neurons is an
ideal solution to this problem. Regeneration of
retinal neurons in mammals is a largely
unexplored but growing field, due to promising
developments in recent years [1–3]. In zebrafish,
retinal glia, called Müller glia, are responsible for
regeneration of all retinal cell types following
ablation by various types of injury. The response
to retinal damage induces regenerative programs,
which include proneural and developmental
transcription factors.
In the mammalian retina, however, the natural
response to damage does not lead to robust
regeneration, and critical factors such as Ascl1
are not induced. In order to replace lost neurons
effectively in disease, further understanding of
Müller glial cell reprogramming is necessary.
With the eventual goal of replacing lost neurons
via glial cell conversion, this review is written to
summarize findings about pathways that influence
Müller glial cell fate and proliferation, in
reprogramming and injury. As Müller glia share
many characteristics with astrocytes, we also

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 473
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_69
474 M. J. Hooper

compare to studies in astrocyte reprogramming
to highlight pathways that are conserved for glial
cell conversion.
2 Drugs and Pathways Shown
to Affect MG Cell Fate After
Injury
Glial cells undergo several changes in response
to injury, and injury is often necessary to induce
neurogenesis in regenerative systems. Neurotoxic
injury, such as that induced with NMDA, is often
used as a means to induce retinal ganglion cell
death in the retina. Much has been done in exam-
ining the role of pharmacological agents and spe-
cific pathways in the chick retina after retinal
NMDA-induced injury. Interestingly, in this sys-
tem, Fgf signaling is able to partially compensate
for the signals induced in injury. Because a lot of
work has been done in this system, using consis-
tent experimental approaches, we have summa-
rized these findings in Table 1. Pharmacological
treatments that have been shown to alter Müller

Table 1 Pharmacological treatments found to alter Müller glial fate or proliferation following injury
Pathway Compound(s) Target Effect References
BMP DMH1 ALK2 ↓ proliferation ⬖ [4]
FGF SU5402 FGFR VEGFR ↓ proliferation ⬖ [5]
PDGFR
Gelatinases and SB-3CT MMP2/9 ↑ proliferation ⬖◨ [6]
metalloproteinases
Gelatinases and MMP2i II MMP2 ↑ proliferation ⬖◨ [6]
metalloproteinases
GR Dexamethasone Mono−/dimeric ↓ proliferation ⬖◨ [7]
GR (agonist)
GR Compound A Monomeric GR ↓ proliferation ⬖◨ [7]
(agonist)
GR RU486 GR ↑ proliferation ⬖ [7]
Hedgehog SAG Smo (agonist) ↑ proliferation ⬖◨ (8)
Hedgehog GANT61 Gli1 + Gli2 DNA ↓ proliferation ⬖ [8]
binding
Hedgehog GANT58 Gli1 DNA binding ↓ proliferation ⬖ [8]
Hedgehog KAAD-cyclopamine Smo ↓ proliferation ⬖ [8]
MAPK U0126 MEK1/MEK2 ↓ proliferation ⬖ [5]
mTOR Rapamycin mTOR ↓ proliferation ⬖◨ [9]
NF-kB Sulfasalazine IκBα ↑ proliferation ⬖ [10]
NF-kB Prostaglandin J2 Nf-kB P50, ↑ proliferation ⬖ [10]
PPARγ ligand
NF-kB SC75741 Nf-kB DNA ↑ proliferation ⬖ [10]
binding
Notch DAPT y-secretase ↓ proliferation, ↑neuronal [11]
survival ⬖
RAR TTNBP RAR (agonist) ↑ proliferation ⬖ [12]
RAR BMS 483 RAR ↓ proliferation ⬖ [12]
STAT sc144 Gp130 ↓ proliferation ◨, ↑ [13]
neuronal differentiation ⬖
STAT Stattic Stat3 ↓ proliferation ◨ [13]
Tgfb SIS3 Smad3 ↑ proliferation ⬖ [4]
Tgfb SB431542 ALK4,5,7 ↑ proliferation ⬖ [4]
Wnt XAV939 Tankyrase 1/2 ↓ proliferation ⬖, ↑ Ascl1 [14]
expression
Wnt Wnt-c59 Porcupine ↓ proliferation ⬖ [14]
Wnt 1-Azakenpaullone, Gsk3B (Wnt ↑ proliferation ⬖ [14]
CHIR99021, BIO agonist)
The compound, relevant pathway, and specific target are shown. ⬖, with injury; ◨, with Fgf2 treatment
Modification of Müller Glial Cell Fate and Proliferation with the Use of Small Molecules
glial cell fate and proliferation following injury
include those that affect sonic hedgehog (SHH),
mTOR, Wnt, MapK, glucocorticoid receptors
(GR), NF-kB, retinoic acid receptors (RAR),
Notch, Tgfb, and gelatinases. There are a few
inferences that can be made from these studies.
Firstly, Müller glial proliferation and response to
injury can be prevented by targeting many path-
ways. This may mean that these pathways are
highly integrated or dependent on one another.
Second, thus far, modulation of Müller glial phe-
notype using small molecules in vivo depends on
an initial injury or induction of Fgf signaling.
Third, use of single small molecule treatments
does not seem to alter cell diversity of Müller
glia-derived neurons with most candidates tested
thus far. Lastly, many treatments seem to alter
cell proliferation (thymidine analog uptake),
while few treatments increase the efficiency of
reprogramming Müller glia to neuronal fates,
with some notable exceptions. STAT3 inhibition
has also been found to increase neurogenesis fol-
lowing injury in mice [2]. This observation makes
sense, in that STAT3 has been established as a
critical transcription factor in glial cell differen-
tiation and activity. In mice, histone deacetylase
(HDAC) inhibition has also been shown to
increase Müller glial neuronal differentiation
(Otx2+ bipolar cells) when coupled with Ascl1
overexpression [1].
3 Emphasis on Pathways
Common with Astrocytes
Many of the pathways that have effects on Müller
glial reprogramming have also been shown to
have similar effects in astrocytes. These are of
particular interest, as they are repeatable across
labs, and consistently deliver similar effects on
cell fate in different species and systems, in vitro
and in vivo. As mentioned above, Fgf signaling is
important for the proliferative response to injury
in Müller glia, and the same is true in astrocytes.
MEK and MapK are downstream of Fgf activa-
tion, and inhibition with U0126 has also been
shown to inhibit a proliferative phenotype in
astrocytes after injury [15]. Another pathway that
475
consistently influences proliferation is activation
of SHH signaling, the activation of which consis-
tently increases cell division in glia. Activation of
the SHH pathway in combination with Oct4
increases cell proliferation and may improve
electrophysiological responses of reprogrammed
neurons [16]. Consistent with observations in
Müller glia, activation of GR signaling using
dexamethasone inhibits proliferation, while
inhibiting GR signaling using RU-486 increases
proliferation [17]. As in Müller glia, inhibition of
mTOR, using rapamycin in spinal cord astro-
cytes, also reduces proliferation after injury [18].
Gamma secretase (Notch) inhibition in astrocytes
using DAPT significantly increases the efficiency
of reprogramming as it does in Müller glia [19].
To our knowledge, STAT3 inhibition hasn’t yet
been reported to increase neurogenesis in astro-
cyte reprogramming, but consistent with obser-
vations in Müller glia, a recent report shows that
inhibiting STAT3 increases neuronal gene expres-
sion, including Tuj1 in rat neural stem cells [20].
STAT3 has also been shown to be important for
glial scar formation in spinal cord injury [21].
3.1 Effects of Combination
Treatments in Astrocytes
As mentioned above, studies have been done in
astrocyte reprogramming that claim efficient
reprogramming of astrocytes to neurons using
combinations of small molecules. Often, these
include modulators of the pathways mentioned
above, including Wnt, SHH, Notch, Tgfb, and
HDACs. It is common for these studies to use
several combinations of drugs and, after an effect
is observed, remove individual compounds to see
which are necessary for the observed effect. One
particular study showed that a combination of
nine molecules reprogrammed astrocytes to neu-
rons. Removing any of the following reduced
efficiency of reprogramming, in order of effect
size: DAPT, CHIR99021, SB431542,
LDN193189, SAG + purmorphamine, and val-
proic acid [19]. SHH activation with purmor-
phamine is commonly included as a part of drug
cocktails in astrocyte to neuron reprogramming
476
schemes [19]. The results of another study show
that transcription factor-mediated reprogram-
ming of astrocytes can be enhanced by a combi-
nation of small molecules, including
5-aza-2′-deoxycytidine, valproic acid, SB431542,
LDN193189, CT99021, and purmorphamine
[22]. It is important to note, however, that these
candidate molecule screens are generally tar-
geted toward modulating signaling pathways of
known developmental importance, and a large-­
scale unbiased screen for reprogramming factors
might yield additional candidates.
3.2 Non-cell Autonomous Effects
In Vivo
In recent years, studies have shown an interaction
between Müller glia and microglia after inflam-
matory challenge or injury [23]. Studies in chick
and mouse retina have shown that microglial
ablation using small molecules, including
plx5622, influences Müller glia cell fate during
reprogramming in vivo [24]. Further, the effect of
Nf-kB inhibition on Müller glial reprogramming
and proliferation in chick is eliminated in the
absence of microglia, further supporting the rel-
evance of non-cell autonomous pharmacological
intervention on the success of glial to neuron
reprogramming in vivo [10]. Like Müller glia,
astrocyte proliferation and response to injury are
also affected by non-cell autonomous effects,
caused by infiltrating monocytes [25].
4 Discussion
Reprogramming glial cells to adopt neuronal
fates is an attractive method to regenerate postmi-
totic neurons in neurodegenerative disorders.
Müller glial reprogramming holds promise for
retinal regeneration. There have been recent suc-
cesses of transcription factor-mediated repro-
gramming of Müller glial cells. Small molecule
treatments may further improve or complement
reprogramming strategies in the long term. Many
studies find that single small molecule treatments
are capable of influencing glial cell proliferation
M. J. Hooper
positively or negatively. Fortunately, several
pathways relevant in Müller glial reprogramming
are also found to impact the same activity in
astrocytes following injury or in reprogramming.
Few studies, however, have shown an increase in
the efficiency of neuronal differentiation, and
fewer still have identified factors that increase the
diversity or maturation of reprogrammed neu-
rons. Despite these drawbacks, small molecules
allow an efficient means to activate and inhibit
and study relevant pathways, and due to ease of
delivery may be useful in examining effects of
combinations of treatments. Indeed the literature
does suggest that combinations of small mole-
cules can lead to either more efficient or qualita-
tively different outcomes when reprogramming
glia. These combination treatments often involve
complex treatment paradigms and are not repli-
cated across organisms and tissue types, further
increasing complexity. Additionally, these types
of studies are rarely done in a large-scale, sys-
tematic manner, and the readout is often cell
counts using immunohistochemistry, which is
laborious and can be subject to biases. This sug-
gests the need for a more efficient, quantitative,
and reproducible system. Lastly, recent studies
show that the interaction between microglia and
Müller glia is important for influencing Müller
cell response to injury and cell fate. For this rea-
son, future in vivo reprogramming strategies will
likely benefit from considering their role.
References
1. Jorstad NL, Wilken MS, Grimes WN, Wohl SG,
VandenBosch LS, Yoshimatsu T, et al. Stimulation of
functional neuronal regeneration from Müller glia in
adult mice. Nature. 2017 Aug 3;548(7665):103–7.
2. Jorstad NL, Wilken MS, Todd L, Finkbeiner C,
Nakamura P, Radulovich N, et al. STAT signaling
modifies Ascl1 chromatin binding and limits neural
regeneration from Müller glia in adult mouse retina.
Cell Rep. 2020;30(7):2195–208.e5.
3. Todd L, Hooper MJ, Haugan AK, Finkbeiner C,
Jorstad N, Radulovich N, et al. Efficient stimulation
of retinal regeneration from Müller glia in adult mice
using combinations of proneural bHLH transcription
factors. Cell Rep. 2021 Oct 19;37(3):109857.
4. Todd L, Palazzo I, Squires N, Mendonca N, Fischer
AJ. BMP- and TGFβ-signaling regulate the formation
Modification of Müller Glial Cell Fate and Proliferation with the Use of Small Molecules
of Müller glia-derived progenitor cells in the avian
retina. Glia. 2017;65(10):1640–55.
5. Fischer AJ, Scott MA, Tuten W. Mitogen-activated
protein kinase-signaling stimulates Müller glia to
­proliferate in acutely damaged chicken retina. Glia.
2009 Jan 15;57(2):166–81.
6. Campbell WA 4th, Deshmukh A, Blum S, Todd L,
Mendonca N, Weist J, et al. Matrix-metalloproteinase
expression and gelatinase activity in the avian retina
and their influence on Müller glia proliferation. Exp
Neurol. 2019 Oct;320:112984.
7. Gallina D, Zelinka C, Fischer AJ. Glucocorticoid
receptors in the retina, Müller glia and the formation
of Müller glia-derived progenitors. Development.
2014 Sep;141(17):3340–51.
8. Todd L, Fischer AJ. Hedgehog signaling stimulates
the formation of proliferating Müller glia-derived
progenitor cells in the chick retina. Development.
2015 Aug 1;142(15):2610–22.
9. Zelinka CP, Volkov L, Goodman ZA, Todd L, Palazzo
I, Bishop WA, et al. mTor signaling is required for
the formation of proliferating Müller glia-derived
progenitor cells in the chick retina. Development.
2016 Jun 1;143(11):1859–73.
10. Palazzo I, Deistler K, Hoang TV, Blackshaw S,
Fischer AJ. NF-κB signaling regulates the formation
of proliferating Müller glia-derived progenitor cells
in the avian retina. Development [Internet]. 2020
147(10). Available from: https://doi.org/10.1242/
dev.183418
11. Ghai K, Zelinka C, Fischer AJ. Notch signaling
influences neuroprotective and proliferative
properties of mature Müller glia. J Neurosci. 2010
Feb 24;30(8):3101–12.
12. Todd L, Suarez L, Quinn C, Fischer AJ. Retinoic acid-­
signaling regulates the proliferative and neurogenic
capacity of Müller glia-derived progenitor cells in the
avian retina. Stem Cells. 2018 Mar;36(3):392–405.
13. Todd L, Squires N, Suarez L, Fischer AJ. Jak/Stat
signaling regulates the proliferation and neurogenic
potential of Müller glia-derived progenitor cells in the
avian retina. Sci Rep. 2016 Oct 19;6:35703.
14. Gallina D, Palazzo I, Steffenson L, Todd L, Fischer
AJ. Wnt/β-catenin-signaling and the formation of
Müller glia-derived progenitors in the chick retina
[Internet]. Vol. 76, Developmental Neurobiology.
2016. pp. 983–1002. Available from: https://doi.
org/10.1002/dneu.22370
477
15. Neary JT, Kang Y, Shi Y-F. Cell cycle regulation
of astrocytes by extracellular nucleotides and
fibroblast growth factor-2. Purinergic Signal. 2005
Dec;1(4):329–36.
16. Yang H, Liu C, Fan H, Chen B, Huang D, Zhang
L, et al. Sonic hedgehog effectively improves Oct4-­
mediated reprogramming of astrocytes into neural
stem cells. Mol Ther. 2019 Aug 7;27(8):1467–82.
17. Crossin KL, Tai MH, Krushel LA, Mauro VP, Edelman
GM. Glucocorticoid receptor pathways are involved
in the inhibition of astrocyte proliferation. Proc Natl
Acad Sci U S A. 1997 Mar 18;94(6):2687–92.
18. Goldshmit Y, Kanner S, Zacs M, Frisca F, Pinto
AR, Currie PD, et al. Rapamycin increases neuronal
survival, reduces inflammation and astrocyte
proliferation after spinal cord injury. Mol Cell
Neurosci. 2015 Sep;68:82–91.
19. Zhang L, Yin J-C, Yeh H, Ma N-X, Lee G, Chen XA,
et al. Small molecules efficiently reprogram human
Astroglial cells into functional neurons. Cell Stem
Cell. 2015 Dec 3;17(6):735–47.
20. Li T, Zhao X, Duan J, Cui S, Zhu K, Wan Y, et al.
Targeted inhibition of STAT3 in neural stem cells
promotes neuronal differentiation and functional
recovery in rats with spinal cord injury. Exp Ther
Med. 2021 Jul;22(1):711.
21. Herrmann JE, Imura T, Song B, Qi J, Ao Y, Nguyen
TK, et al. STAT3 is a critical regulator of astrogliosis
and scar formation after spinal cord injury. J Neurosci.
2008 Jul 9;28(28):7231–43.
22. di Val Cervo PR, Romanov RA, Spigolon G, Masini
D, Martin-Montanez E, Toledo EM, et al. Induction of
functional dopamine neurons from human astrocytes
in vitro and mouse astrocytes in a Parkinson’s disease
model. Nat Biotechnol. 2017;35(5):444–52.
23. Wang M, Ma W, Zhao L, Fariss RN, Wong
WT. Adaptive Müller cell responses to microglial
activation mediate neuroprotection and coordinate
inflammation in the retina. J Neuroinflammation.
2011 Dec 7;8:173.
24. Todd L, Finkbeiner C, Wong CK, Hooper MJ,
Reh TA. Microglia suppress Ascl1-induced
retinal regeneration in mice. Cell Rep. 2020 Dec
15;33(11):108507.
25. Frik J, Merl-Pham J, Plesnila N, Mattugini N, Kjell J,
Kraska J, et al. Cross-talk between monocyte invasion
and astrocyte proliferation regulates scarring in brain
injury. EMBO Rep [Internet]. 2018 19(5). Available
from: https://doi.org/10.15252/embr.201745294
 A Potential Neuroprotective Role
for Pyruvate Kinase 2 in Retinal
Degeneration

Jiaming Zhou, Michel Rasmussen,

and Per Ekström

Abstract Keywords

Retinitis pigmentosa (RP) is an inherited dis-
order that results in vision impairment that
specific therapeutic strategies are not avail-
able. However, it is widely regarded that the
cGMP system, including cGMP and its inter-
actor cGMP-dependent protein kinase (PKG),
acts as a crucial effector during retinal degen-
eration. We have previously identified a list of
cGMP-PKG-dependent genes in the context
of RP, and in this study, we further validated
one of the targets, namely, pyruvate kinase 2
(PKM2), and investigated the potential role of
PKM2 for the photoreceptors’ well-being dur-
ing RP. With the aid of organotypic retinal
explant cultures, we pharmacologically
manipulated the PKM2 activities in different
RP mouse models via the addition of TEPP-46
(a PKM2 activator) and found that activation
of PKM2 alleviates the progress of photore-
ceptor death in the rd10 mouse model. This
observation provides supportive evidence that
PKM2 may serve as a novel potential molecu-
lar target in RP.
J. Zhou (*) · M. Rasmussen · P. Ekström
Ophthalmology, Department of Clinical Sciences,
Lund University, Lund, Sweden
e-mail: jiaming.zhou@med.lu.se;
michel.rasmussen@med.lu.se;
per.ekstrom@med.lu.se
PKM2 · Retinal degeneration · Cell death ·
TUNEL · Organotypic retinal explant culture
1 Introduction
Retinitis pigmentosa (RP) is one of the most
common forms of inherited retinal degeneration,
which refers to genetic disorders in retinal photo-
receptors, leading to severe vision problems. The
prevalence of this retinal disorder reaches 1 in
3000–4000 [5], and there is currently in principle
no effective treatment available, likely because of
the extensively heterogeneous mutations of
disease-­leading genes [4]. Work in our laboratory
has previously shown that a neurodegenerative
effect of elevated cGMP at least in part works via
increasing the activity of its dependent protein
kinase G (cGMP-dependent protein kinase;
PKG) leading to over-phosphorylation within
photoreceptors [7].
The subtype of pyruvate kinase (PKM2) has
been shown to express within photoreceptors
[10]. Our previous transcriptome research [13],
where we modulated the cGMP-PKG system in
retinal explants from the healthy wild-type (wt)
model, showed a lower expression of PKM2 after
PKG activation in wt retinas. This pointed to the
possibility that PKM2 may be inhibited by the

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 479
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_70
480
high cGMP-PKG within diseased photorecep-
tors. To this end, we know that PKG inhibition
via a liposome-formulated cGMP analogue can
protect degenerating photoreceptors and preserve
their function after systemic administration [12].
We speculated that since PKG appears to decrease
PKM2 in the degenerating photoreceptors, direct
activation of PKM2 during the degeneration may
have neuroprotective effects.
To acquire a deeper understanding of this, we
here utilized a manipulation of the PKM2 activity
in the retina via a pharmacological method. To do
so we added 6-((3-aminophenyl)methyl)-
4-methyl-2-methylsulfinylthieno [3,
4]-pyrrolo[1,3-d]pyridazin-5-one (TEPP-46, a
PKM2 activator) [6] during organotypic retinal
explant culturing with tissue from either rd2 [11]
or rd10 strains [2], two RP models where photo-
receptor cGMP is also high [1]. According to our
hypothesis, we expected to have a lower expres-
sion of PKM2 in these disease models and that
activation of this enzyme may alleviate the prog-
ress of cell death.
Our investigations show that rd10 retinas ben-
efitted with an apparent lower amount of photore-
ceptor death from PKM2 activation, while no
difference could be observed in the rd2 strain
with the same treatment. Given the slow progress
of photoreceptor loss in the rd2 strain, a positive
effect of long-term PKM2 activation in rd2 can-
not be excluded, though.
2 Materials and Methods
2.1 Experiment with Animals
The mouse strains rd2 (C3H) and rd10
(C57BL/6) were used in our study. Animals
were kept under standard white cyclic lighting,
with ad libitum access to food and water, and
used irrespective of sex. All procedures had
been evaluated by the local animal care and eth-
ics committees and performed in accordance
with permit 2124-20. All efforts were made to
keep the number of animals used and their suf-
fering to a minimum.
J. Zhou et al.
2.2 Organotypic Retinal Explant
Culture
This followed our previous protocol as in Vighi
et al. [12]. The culturing paradigm used is termed
P9 + 2 + 8 in vivo and means that the animals
were sacrificed at postnatal day 9 (P9), after
which they were cultured for 2 days without
manipulation followed by 8 days with PKM2
activation (TEPP-46 (HY-18657),
MedChemExpress), with medium changes every
second day during the whole culturing period. In
parallel, untreated counterparts served as con-
trols. The culturing paradigm thus means that the
endpoint resembles P19.
2.3 Cryosectioning
At the culture endpoint P19, the samples were
collected for cryosectioning. All explants were
treated with 4% formaldehyde for 2 h, washed
4 × 15 min in phosphate-buffered saline (PBS),
and cryoprotected in PBS + 10% sucrose over-
night at +4 °C and then with PBS + 25% sucrose
for 2 h. After embedding, 12-μm-thick retinal
cross sections were cut and collected from an
HM560 cryotome (Microm, Walldorf, Germany).
2.4 TUNEL Assay
Fluorescent terminal deoxynucleotidyl transfer-
ase dUTP nick end labeling (TUNEL) assay
(11687495910, Roche Diagnostics, Mannheim,
Germany) was performed as by manufacturer’s
instructions and used on cryosections from the
different conditions to evaluate cell death. The
number of TUNEL-positive cells in the
photoreceptor-­bearing outer nuclear layer (ONL)
was calculated as shown previously [7]. For each
situation, three to four sections from five to six
animals were analyzed to generate an average
value. The same sections were used for the analy-
sis of ONL thickness, which was done via mea-
surements using the ZEN2 software (blue edition)
tool for image analysis.
A Potential Neuroprotective Role for Pyruvate Kinase 2 in Retinal Degeneration
2.5 Microscopy and Image
Processing
A Zeiss Imager Z1 Apotome Microscope (Zeiss,
Oberkochen, Germany), with a Zeiss Axiocam
digital camera, was used for microscopy observa-
tions. Image generation and contrast enhance-
ment were performed identically for all images
via the ZEN2 software (blue edition).
2.6 Statistics
All t-tests in this report were performed via
GraphPad Prism 9, and a p-value lower than 0.05
was regarded as significant.
3 Results
In this study, we manipulated the PKM2 activi-
ties within the photoreceptors in two RP models
by adding TEPP-46 during the organotypic reti-
nal explant cultures. For the rd10 model, we
found that the number of TUNEL-positive cells
decreased compared to the untreated counterpart
(Fig. 1c) and that this was complemented with an
increase of ONL thickness (Fig. 1d–f). By con-
trast, we could not observe any significant differ-
ences in either photoreceptor death or ONL
thickness in the explants with PKM2 activation
from the rd2 model compared to their untreated
counterparts (Fig. 1a–b, e–f). However, we note
that the activator treatment of the rd2 explants
gave thickness values with a mean that was
higher than for corresponding untreated controls
(activator 54 ± 3; control 42 ± 1, unit: μm). The
rd2 outcome thus at least partially pointed toward
a similar effect by the activator treatment as in the
rd10 case, but without attaining statistical
significance.
4 Discussion
The lower counts of degenerating photoreceptors
in rd10 after PKM2 activation were accompanied
by a thicker ONL, which indicated a neuropro-
481
tective potential of PKM2 during RP progression
in this model. For the rd2 strain, there were
changes in the same directions on the ONL thick-
ness by the PKM2 activation, but these were
smaller and did not reach statistical significance.
The rd2 retina has a peak of cell death at around
P18, but cell death is seen also several days after
that [1]. Given that our explant culturing protocol
starts at P9 and ends at P19, we might thus have
missed a fully developed protective effect that
may require longer treatment to be clearly
detected. The higher percentage of dying photo-
receptors in the rd10 retina at around P18 [1]
could then explain why the effect came out
clearer in that model. Alternatively, since the dif-
ferent gene mutations of rd10 and rd2 are likely
to result in differences in for instance exact path-
way activation patterns, PKM2 could be of less
protective importance in rd2, either throughout
the degeneration or in the period studied.
Our results go very well together with those of
Rajala et al. [10], who observed an increased
number of degenerating cells within the ONL in
retinas from their mouse model with genetically
deleted PKM2 expression, indicating its impor-
tance for photoreceptor viability. Interestingly,
they also observed that PKM2 deletion lowered
the expression of glucose transporter-1 (Glut1),
which has the important function to deliver glu-
cose to photoreceptors [9]. The role for PKM2
may thus be to stabilize photoreceptors via the
maintenance of energy supply, a situation that
appears vital as photoreceptors are regarded as
one of the most metabolically active cells within
the body [3]. In fact, the general outcome of our
previous transcriptome analysis [13] was that an
overactive cGMP system could be an important
negative regulator of retinal metabolic events.
Since increased cGMP levels can be linked to
many types of RP [8], it is thus possible that dis-
turbed actions of PKM2, or other enzymes related
to energy metabolism, lie at the heart of the RP
pathology.
Many questions with respect to PKM2 and
photoreceptor degeneration remain to be
answered, like if the retinal substrates for this
enzyme are the same as in other tissues, and if
this changes in disease. Moreover, it will be of
482
Fig. 1 Activation of PKM2 showed a decreased number
of dying photoreceptors in rd10 explants as well as
resulted in a thicker ONL, while the same treatment did
not change these parameters in rd2 explants. TUNEL-­
positive cells are shown in green, and DAPI (blue) was
used as nuclear counterstain. (a–d) rd2 untreated control,
rd2 treated with PKM2 activator, rd10 untreated control,
rd10 treated with PKM2 activator. (e–f) Bar chart sum-
J. Zhou et al.
marizing the TUNEL-positive ONL cell counts and ONL
thickness of the different experimental groups, respec-
tively. Two t-tests, namely, the comparison between rd2
with PKM2 activator vs rd2 untreated and rd10 with
PKM2 activator vs rd10 untreated was performed in e and
f. ONL outer nuclear layer, INL inner nuclear layer,
GCL ganglion cell layer. N = 4–5 biological replicates
A Potential Neuroprotective Role for Pyruvate Kinase 2 in Retinal Degeneration
interest to see if treatment of wt explants with a
pharmacological PKM2 inhibitor will mimic the
outcome of genetic deletion of the enzyme, as in
Rajala et al. [10], i.e., and lead to photoreceptor
death. If so, this would not only strengthen the
connection between PKM2 and retinal degenera-
tion but also by inference again point to PKM2 as
a molecular target for RP therapy.
All in all, the outcomes from our study shed
light on a potential novel molecular target that
may exert a direct effect on RP. Modulation of
PKM2, therefore, appears suitable for further
exploration in other RP models in the future to
gain deeper insights.
Acknowledgments This study was funded by the
European Union’s Horizon 2020 research and innovation
program under the Marie Sklodowska-Curie grant agree-
ment No 765441 (transMed; H2020-­ MSCA-­ 765441),
Stiftelsen för Synskadade i f.d. Malmöhus län,
Kronprinsessan Margaretas Arbetsnämnd för synskadade,
and Ögonfonden.
References
1. Arango-Gonzalez B, Trifunović D, Sahaboglu A,
et al. Identification of a common non-apoptotic cell
death mechanism in hereditary retinal degeneration.
PLoS One. 2014;9:112142.
2. Chang B, Hawes N, Hurd R, et al. Retinal degenera-
tion mutants in the mouse. Vis Res. 2002;42:517–25.
483
3. Country M. Retinal metabolism: a comparative look
at energetics in the retina. Brain Res. 2017;1672:50–7.
4. Daiger S, Sullivan L, Bowne S. Genes and muta-
tions causing retinitis pigmentosa. Clin Genet.
2013;84:132–41.
5. Haim M. The epidemiology of retinitis pigmentosa
in Denmark. Acta Ophthalmol Scand. 2002;80:1–34.
6. Jiang J, Boxer M, Vander Heiden M, et al. Evaluation
of thieno[3,2-b]pyrrole[3,2-d]pyridazinones as
activators of the tumor cell specific M2 isoform
of pyruvate kinase. Bioorganic Med Chem Lett.
2010;20:3387–93.
7. Paquet-Durand F, Hauck S, van Veen T, et al.
PKG activity causes photoreceptor cell death in
two retinitis pigmentosa models. J Neurochem.
2009;108:796–810.
8. Power M, Das S, Schütze K, et al. Cellular mecha-
nisms of hereditary photoreceptor degeneration –
focus on cGMP. Prog Retin Eye Res. 2020;74:100772.
9. Pragallapati S, Manyam R. Glucose transporter
1 in health and disease. J Oral Maxillofac Pathol.
2019;23:443.
10. Rajala A, Wang Y, Brush R. Pyruvate kinase M2 regu-
lates photoreceptor structure, function, and viability.
Cell Death Dis. 2018;9:240.
11. Travis G, Brennan M, Danielson P, et al. Identification
of a photoreceptor-specific mRNA encoded by the
gene responsible for retinal degeneration slow (rds).
Nature. 1989;338:70–3.
12. Vighi E, Trifunović D, Veiga-Crespo P. Combination
of cGMP analogue and drug delivery system provides
functional protection in hereditary retinal degenera-
tion. Proc Natl Acad Sci U S A. 2018;115:2997–3006.
13. Zhou J, Rasmussen M, Ekström P. cGMP-PKG
dependent transcriptome in normal and degenerating
retinas: novel insights into the retinitis pigmentosa
pathology. Exp Eye Res. 2021;212:108752.
 Part XI
Photoreceptors
 Critical Role of VEGF as a Direct
Regulator of Photoreceptor
Function

Jianyan Hu, Meili Zhu, Dai Li, Qiang Wu,

and Yun-Zheng Le

Abstract toreceptor function with electroretinography

Vascular endothelial growth factor (VEGF or
VEGF-A), a major pathogenic factor for dia-
betic and hypoxic blood–retina barrier (BRB)
diseases, has been shown to act as a direct
functional regulator for neurons in the periph-
eral and central nerve systems. To determine if
VEGF plays a direct role in regulating retinal
neuronal function, we established specific
experimental procedures and examined the
effect of recombinant VEGF (rVEGF) on pho-
(ERG) in mice. In our case, rVEGF caused a
significant reduction of scotopic ERG a-wave
and b-wave amplitudes and photopic ERG
b-wave amplitudes in a dose-dependent
manner in dark-adapted wild-type (WT) mice,
shortly after the intravitreal delivery of rVEGF
in dark. However, the effect of rVEGF on
photoreceptor function was nullified in adult
Akita diabetic mice. Our data strongly suggest
that VEGF is a direct regulator of photoreceptor
function and VEGF upregulation contributes

J. Hu
Department of Medicine/Endocrinology, University
of Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
Department of Ophthalmology, Shanghai Jiao Tong
University Affiliated Sixth People’s Hospital,
Shanghai, China
M. Zhu
Department of Medicine/Endocrinology, University
of Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
D. Li
Department of Medicine/Endocrinology, University
of Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
School of Optometry, Hubei University of Science
and Technology, Xianning, China
Q. Wu
Department of Ophthalmology, Shanghai Jiao Tong
University Affiliated Sixth People’s Hospital,
Shanghai, China
Shanghai Key Laboratory of Diabetes Mellitus,
Shanghai, China
e-mail: qiang.wu@shsmu.edu.cn
Y.-Z. Le (*)
Department of Medicine/Endocrinology, University
of Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
Department of Cell Biology, University of Oklahoma
Health Sciences Center, Oklahoma City, OK, USA
Department of Ophthalmology, University of
Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
Harold Hamm Diabetes Center, University of
Oklahoma Health Sciences Center,
Oklahoma City, OK, USA
e-mail: Yun-Le@ouhsc.edu

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 487
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_71
488
significantly to the diabetes-induced reduction
of photoreceptor function. In this chapter, we
will discuss the relevant background, key
experimental procedures and results, and clin-
ical significance of our work.
Keywords
VEGF · Photoreceptor function · ERG ·
Diabetes · Hypoxia
1 Introduction
A major accomplishment in the treatment of
blood–retina barrier (BRB) diseases in recent
decades is the identification of vascular endothe-
lial growth factor (VEGF) as a major pathogenic
factor for BRB breakdown in diabetic retinopa-
thy (DR), retinopathy of prematurity (ROP), and
age-related macular degeneration (AMD) [1–3,
17, 18]. However, VEGF is known to play a role
as a neuronal functional regulator in the brain
and peripheral neurons, through major VEGF
receptors and co-receptors. It has been shown
that VEGF was capable of reducing excessive
excitation of hypoglossal motor neurons by
downregulating stimulus-evoked depolarization,
a critical mechanism to prevent amyotrophic lat-
eral sclerosis [13]. VEGF has also been shown to
reduce synaptic responses significantly in rat
hippocampal neurons through VEGF receptor-2
(VEGFR2) signaling [9, 12]. VEGFR2 also
plays a role in activating P2X2/3 in primary sen-
sory neurons to mediate neuropathic pain trans-
mission [10]. VEGF co-receptor neuropilin 1
(NRP1) is involved in downregulating synaptic
transmission in hippocampal synapses [5]. As
both VEGFR1 and VEGFR2 are present in the
retina, including photoreceptors [7, 8, 15, 16], it
is possible that VEGF receptors and co-receptors
could mediate photoreceptor function in the ret-
ina. To explore the direct role of VEGF in modu-
lating retinal neuronal function, we established
specific experimental procedures and used elec-
troretinography (ERG) approach to measure
photoreceptor function shortly after intravitreal
recombinant VEGF (rVEGF) delivery.
J. Hu et al.
2 Critical Factors
in Experimental Design
Although there were many investigations on the
effect of rVEGF on retinal function with ERG,
the experimental limitations in these studies
made it impossible to obtain information on the
role of VEGF as a direct functional regulator for
retinal neurons. This is due to the fact that VEGF
is a secreted multifunctional protein that could
play many roles once it is introduced into the
retina. Any experiment that does not measure the
immediate effect of VEGF is unlikely to reveal
the direct role of VEGF in modulating photore-
ceptor function. To address this issue, we made
modifications to our experimental procedures
with the following special arrangement: we dark-­
adapted the mice overnight, intravitreally injected
rVEGF under long-wave illumination, and per-
formed ERG 15–20 min post-intravitreal injec-
tion. The waiting period is necessary for rVEGF
to migrate to photoreceptor regions. Using a
method established by us previously [21], we
detected migration of bright 10-kDa fluorescein
isothiocyanate (FITC)–dextran, which had a
comparable MW as that of VEGF, to the photore-
ceptor region 20 min after intravitreal injection
(Fig. 1a). This suggests the feasibility of this time
frame. These experimental settings allow us to
measure the direct effect of VEGF on photore-
ceptor function, which is conceptually identical
to the exposure of rVEGF briefly to brain slices
that in the initial identification of VEGF as a
direct functional regulator of hippocampal neu-
rons [12].
3 Effect of VEGF
on Photoreceptor Function
To determine the direct effect of VEGF on
photoreceptor function, we intravitreally injected
human rVEGF (0.3 μg/eye) to 1.5-month-old
overnight dark-adapted C57BL6 background
mice under long-wavelength illumination.
Twenty minutes after intravitreal rVEGF injec-
tion, scotopic ERG was recorded with flash
intensities from 0.002 to 400 cd·s/m2. Figure 1b
Critical Role of VEGF as a Direct Regulator of Photoreceptor Function
Fig. 1 Measurement of direct effect of intravitreally
injected rVEGF-induced reduction of photoreceptor func-
tion with ERG. (a) Frozen retinal section showing the
migration of 10 kDa FITC-dextran (bright), which has a
comparable MW to rVEGF, in mice 20 min after intravit-
demonstrated representative scotopic ERG trac-
ers of rVEGF downregulated both scotopic ERG
a-wave and b-wave amplitudes significantly.
However, rVEGF did not affect the time for
trough or peak in the ERG. The effect of rVEGF
on scotopic ERG appeared dose-dependent
(Figure 1 in [8]). Likewise, rVEGF also had an
dose-dependent effect on depressing cone photo-
receptor function, as shown in photopic ERG
(Figure 2 in [8]). As our experiments were
designed to measure the direct effect of rVEGF
on photoreceptor function, our data strongly sug-
gest that VEGF is a direct functional regulator of
photoreceptors.
4 Contribution of VEGF
on Reducing Photoreceptor
Function in Diabetes
and Hypoxia
Reduction of photoreceptor function is a
characteristic of DR (Figures 3 and 4 in [8]). We
therefore hypothesized that VEGF upregulation
is a contributing factor for the reduction of
photoreceptor function in DR. To test this
hypothesis, we used Akita spontaneous diabetic
mice, an acceptable model for experimental DR
[4], and examined the direct effect of intravitreally
injected rVEGF on photoreceptor function with
ERG. Compared with that in age-matched WT
controls, the effect of rVEGF on scotopic ERG
a-wave and b-wave amplitudes, as well as on
489
real injection. (b) Representative scotopic ERG tracers
showing VEGF-induced reduction of ERG amplitudes in
overnight dark-adapted WT mice, 20 min after intravitreal
injection of human rVEGF (0.3 μg/eye) in dark. Flash
intensity: 200 cd·s/m2
photopic ERG b-wave amplitudes, was nullified
in 5-month-old Akita spontaneous diabetic mice
(Figures 3 and 4 in [8]). To ascertain if VEGF
was upregulated in 5-month-old Akita spontane-
ous diabetes mice, we localized VEGF with
immunohistochemistry and found that VEGF
levels were elevated in the area of photoreceptor
inner segments, Müller glia, outer nuclear layer
(ONL), outer plexiform layer (OPL), inner
nuclear layer (INL), and ganglion cell layer
(Figure 5 in [8]), where VEGFR2 was also pres-
ent (Figure 6 in [8]) [7]. In short, our results
strongly suggest that VEGF is a contributing fac-
tor for diabetes-induced reduction of photorecep-
tor function. Finally, hypoxia-induced VEGF
upregulation may also play a similar role in
depressing photoreceptor function in AMD and
other hypoxic retinal diseases. We are actively
investigating this possibility using an animal
chamber with regulatable oxygen content.
5 Potential Mechanism
of VEGF-Mediated Direct
Effect on Photoreceptor
Function
Our work on the direct role of VEGF on
photoreceptor function reveals a major knowledge
gap in retinal neurobiology for the first time. At
present, the mechanism of VEGF-induced
reduction of visual function remains largely
unknown. As there was an elevated presence of
490
VEGF in ­photoreceptor inner segments in aging
diabetic mice (Figure 5 in [8]), it is likely that
VEGF may regulate photoreceptor function under
pathological stresses. Based on the observation of
ciliary neurotrophic factor- or diabetes-induced
depression of visual function [6, 11, 14, 19, 20],
VEGF might modulate photoreceptor function by
altering phototransduction or visual cycle
machinery. VEGF elevation in DR and hypoxia
could serve as a compensatory or protective
mechanism for photoreceptors under these
stresses. VEGF has been shown to regulate synap-
tic transmission through VEGF receptor-mediated
signaling in the rat hippocampus [9]. A strong
presence of VEGFR2 in photoreceptor synaptic
terminal area suggests a possibility for VEGFR2-
mediated alteration of photoreceptor synaptic
transmission (Figure 6 in [8]). More work with
photoreceptor-­specific VEGFR2 knockout mice
will allow us to address this issue and to reveal the
potential mechanisms of VEGF-regulated neuro-
nal function.
6 Clinical Relevance
Comparison of the effect of rVEGF on
photoreceptor function between Akita diabetic
mice and WT controls suggests that VEGF is a
major contributing factor for diabetes-induced
reduction of photoreceptor function, which not
only reveals a major knowledge gap in DR field
for the first time but also provides the mechanistic
basis for investigating diabetes-altered visual
function. Our work also produces the critical
knowledge background related to the therapeutic
effect(s) of anti-VEGF drugs in DR, AMD, and
other hypoxic retinal disorders. In addition, our
finding could serve as the scientific basis for the
development of improved patient care procedures
during anti-­VEGF therapies. Since VEGF family
cytokines and their soluble receptors and
co-receptors are potential therapeutic agents/
targets for BRB breakdown in DR, wet AMD,
retinopathy of prematurity, and other hypoxic
vascular diseases, further research into the
mechanism and direct role of VEGF family
cytokines and receptors in the modulation of
retinal neuronal function will be necessary to the
J. Hu et al.
development of new therapeutics for these
leading causes of blindness.
Acknowledgments Our work was supported by NIH
grants R01EY26970, P30EY021725, and P30GM122744;
National Natural Science Foundation of China grants
81070738 and 81300775; grants from Presbyterian Health
Foundation and Oklahoma Center for Advancement of
Science and Technology; and endowments from Mr.
Harold Hamm and Choctaw Nation of Oklahoma.
Conflicts of Interest Authors declare no conflicts of
interest.
References
1. Aiello LP, Avery RL, Arrigg PG, Keyt BA, Jampel HD,
Shah ST, Pasquale LR, Thieme H, Iwamoto MA, Park
JE, et al. Vascular endothelial growth factor in ocular
fluid of patients with diabetic retinopathy and other
retinal disorders. N Engl J Med. 1994;331:1480–7.
2. Alon T, Hemo I, Itin A, Pe’er J, Stone J, Keshet
E. Vascular endothelial growth factor acts as a sur-
vival factor for newly formed retinal vessels and has
implications for retinopathy of prematurity. Nat Med.
1995;1:1024–8.
3. Bai Y, Ma JX, Guo J, Wang J, Zhu M, Chen Y, Le
YZ. Muller cell-derived VEGF is a significant
contributor to retinal neovascularization. J Pathol.
2009;219:446–54.
4. Barber AJ, Antonetti DA, Kern TS, Reiter CE, Soans
RS, Krady JK, Levison SW, Gardner TW, Bronson
SK. The Ins2Akita mouse as a model of early retinal
complications in diabetes. Invest Ophthalmol Vis Sci.
2005;46:2210–8.
5. Bouzioukh F, Daoudal G, Falk J, Debanne D, Rougon
G, Castellani V. Semaphorin3A regulates synaptic
function of differentiated hippocampal neurons. Eur
J Neurosci. 2006;23:2247–54.
6. Chen J, Shao Y, Sasore T, Moiseyev G, Zhou K,
Ma X, Du Y, Ma JX. Interphotoreceptor retinol-
binding protein ameliorates diabetes-induced
retinal dysfunction and neurodegeneration through
rhodopsin. Diabetes. 2021;70:788–99.
7. Fu S, Dong S, Zhu M, Sherry DM, Wang C, You Z,
Haigh JJ, Le YZ. Müller glia are a major cellular
source of survival signals for retinal neurons in
diabetes. Diabetes. 2015;64:3554–63.
8. Hu J, Zhu M, Li D, Wu Q, Le YZ. VEGF as a direct
functional regulator of photoreceptors and contributing
factor to diabetes-induced alteration of photoreceptor
function. Biomolecules. 2021;11:988–97.
9. Kim BW, Choi M, Kim YS, Park H, Lee HR, Yun
CO, Kim EJ, Choi JS, Kim S, Rhim H, Kaang BK,
Son H. Vascular endothelial growth factor (VEGF)
signaling regulates hippocampal neurons by elevation
of intracellular calcium and activation of calcium/
Critical Role of VEGF as a Direct Regulator of Photoreceptor Function
calmodulin protein kinase II and mammalian target of
rapamycin. Cell Signal. 2008;20:714–25.
10. Lin J, Li G, Den X, Xu C, Liu S, Gao Y, Liu H, Zhang
J, Li X, Liang S. VEGF and its receptor-2 involved in
neuropathic pain transmission mediated by P2X(2)(/)
(3) receptor of primary sensory neurons. Brain Res
Bull. 2010;83:284–91.
11. Malechka VV, Moiseyev G, Takahashi Y, Shin Y, Ma
JX. Impaired rhodopsin generation in the rat model of
diabetic retinopathy. Am J Pathol. 2017;187:2222–31.
12. McCloskey DP, Croll SD, Scharfman HE. Depression
of synaptic transmission by vascular endothelial
growth factor in adult rat hippocampus and evidence
for increased efficacy after chronic seizures. J
Neurosci. 2005;25:8889–97.
13. McCloskey DP, Hintz TM, Scharfman
HE. Modulation of vascular endothelial growth
factor (VEGF) expression in motor neurons and
its electrophysiological effects. Brain Res Bull.
2008;76:36–44.
14. McGill TJ, Prusky GT, Douglas RM, Yasumura D,
Matthes MT, Nune G, Donohue-Rolfe K, Yang H,
Niculescu D, Hauswirth WW, Girman SV, Lund RD,
Duncan JL, LaVail MM. Intraocular CNTF reduces
vision in normal rats in a dose-dependent manner.
Invest Ophthalmol Vis Sci. 2007;48:5756–66.
491
15. Saint-Geniez M, Maharaj AS, Walshe TE, Tucker
BA, Sekiyama E, Kurihara T, Darland DC, Young
MJ, D'Amore PA. Endogenous VEGF is required for
visual function: evidence for a survival role on muller
cells and photoreceptors. PLoS One. 2008;3:e3554.
16. Shih SC, Ju M, Liu N, Smith LE. Selective stimulation
of VEGFR-1 prevents oxygen-induced retinal
vascular degeneration in retinopathy of prematurity. J
Clin Invest. 2003;112:50–7.
17. Wang J, Xu X, Elliott MH, Zhu M, Le YZ. Muller
cell-derived VEGF is essential for diabetes-induced
retinal inflammation and vascular leakage. Diabetes.
2010;59:2297–305.
18. Wang JJ, Zhu M, Le YZ. Functions of Muller cell-­
derived vascular endothelial growth factor in diabetic
retinopathy. World J Diabetes. 2015;6:726–33.
19. Wen R, Tao W, Li Y, Sieving PA. CNTF and retina.
Prog Retin Eye Res. 2012;31:136–51.
20. Wen R, Song Y, Kjellstrom S, Tanikawa A, Liu Y, Li Y,
Zhao L, Bush RA, Laties AM, Sieving PA. Regulation
of rod phototransduction machinery by ciliary
neurotrophic factor. J Neurosci. 2006;26:13523–30.
21. Xu HZ, Le YZ. Significance of outer blood-retina
barrier breakdown in diabetes and ischemia. Invest
Ophthalmol Vis Sci. 2011;52:2160–4.
 Lysine Ubiquitylation Drives
Rhodopsin Protein Turnover
Allen P. F. Chen, Leon Chea, Eun-Jin Lee,
and Jonathan H. Lin
Abstract
Rhodopsin is a G-protein-coupled receptor that
is specifically and abundantly expressed in rod
photoreceptors. Over 150 rhodopsin mutations
cause autosomal dominant retinitis pigmentosa
(adRP). The most common mutation in the
United States is the conversion of proline to his-
tidine at position 23 (P23H) in the N-terminal
A. P. F. Chen
Medical Scientist Training Program, Renaissance
School of Medicine at Stony Brook University,
Stony Brook, NY, USA
e-mail: allen.chen@stonybrookmedicine.edu
L. Chea · J. H. Lin (*)
Department of Ophthalmology, Palo Alto, CA, USA
Department of Pathology, Stanford University,
Palo Alto, CA, USA
VA Palo Alto Healthcare System,
Palo Alto, CA, USA
e-mail: l1chea@stanford.edu;
Jonathan.H.Lin@stanford.edu
E.-J. Lee
Department of Ophthalmology, Palo Alto, CA, USA
Department of Pathology, Stanford University,
Palo Alto, CA, USA
VA Palo Alto Healthcare System,
Palo Alto, CA, USA
USC ROSKI Eye Institute and Department of
Ophthalmology, Keck School of Medicine, University
of Southern California, Los Angeles, CA, USA
e-mail: eunjin76@stanford.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_72
domain of rhodopsin. We previously found that
P23H rhodopsin was misfolded, ubiquitinyl-
ated, and rapidly degraded. Here, we investi-
gated the role of lysine residues on P23H
rhodopsin ubiquitinylation and turnover. We
transfected HEK293 cells with a P23H human
rhodopsin construct where all 11 lysine residues
were mutated to arginine (K-null P23H). We
found that the K-null P23H rhodopsin was sig-
nificantly less ubiquitylated than intact P23H
rhodopsin. We found that K-null P23H protein
turnover was significantly slower compared to
P23H rhodopsin through cycloheximide chase
analysis. Finally, we also generated a wild-type
rhodopsin construct where all lysines were con-
verted to arginine and found significantly
reduced ubiquitylation. Our findings identify
ubiquitinylation of lysine residues as an impor-
tant posttranslational modification involved in
P23H rhodopsin protein degradation.
Keywords
Rhodopsin · Ubiquitylation · Lysine ·
ER-associated degradation · P23H
1 Introduction
Rhodopsin is a light-sensitive G-protein-coupled
receptor that is highly expressed in rod photore-
ceptors where it compromises >90% of proteins
493
494 A. P. F. Chen et al.

in the rod outer segment [7]. A proline to histi- 4–15% Mini-PROTEAN TGX gels (Bio-Rad).
dine missense mutation at amino acid 23 of rho- For primary antibodies, anti-rhodopsin 1D4
dopsin (P23H) is the most common retinitis (1:1000, Santa Cruz Biotechnologies) and anti-
pigmentosa rhodopsin mutation in North America ubiquitin PD41 (1:1000, Santa Cruz
[6]. The P23H mutation causes rhodopsin protein Biotechnologies) were used and incubated at
misfolding in the endoplasmic reticulum (ER) 4 °C (24 h). Membranes were washed in TBS
[11] to undergo endoplasmic reticulum-­with 0.1% Tween-20, followed by incubation
associated degradation (ERAD) [4, 5]. with horseradish peroxidase-­coupled secondary
ERAD is a protein quality control pathway that antibody in 5% nonfat milk in washing buffer
targets misfolded ER client proteins for retrotrans- for 1 h. Immunoreactive bands were detected
location from the ER, ubiquitinylation, and protea- with the SuperSignal West chemiluminescent
somal degradation [12]. Ubiquitin is a 73-amino substrate (Pierce). ImageJ software was used to
acid polypeptide that is covalently conjugated most for protein quantification.
commonly at lysine residues of target proteins to Immunoprecipitation was performed as pre-
mark them for degradation [9]. Prior studies found viously described [4]. 1D4 anti-rhodopsin anti-
that P23H rhodopsin is robustly degraded and ubiq- body (Santa Cruz Biotechnologies) was added
uitinylated in vitro and in retina [3–5, 8]. Here, we to equal amounts of total protein-Dynabeads
performed site-­directed mutagenesis of lysine resi- Protein G (Life Technologies) and incubated for
dues on P23H rhodopsin to evaluate their roles in 30 min at 4 °C. Antibody–bead complex was
ubiquitinylation and protein turnover in vitro. crosslinked using dimethyl pimelimidate
(ThermoFisher). Aliquoted protein mixtures
were incubated overnight at 4 °C with rotation.
2 Materials and Methods Beads were then heated in 1X LDS (lithium
dodecyl sulfate) sample buffer with suspended
2.1 Cell Culture and Transfection beads at a total volume of 40 μL at 95 °C for
rhodopsin elution fraction.
HEK293FT cells were maintained in 10-cm cul-
ture plates at 37 °C at 5% CO2 in DMEM
(Mediatech) supplemented with 1% penicillin/ 2.3 Cycloheximide (CHX) Chase
streptomycin (Invitrogen) and 5% fetal bovine Assay
serum (Invitrogen). Wild-type and P23H human
rhodopsin were expressed by transient transfection Cycloheximide (10 μg/uL) was added to
of a pcDNA3.1 plasmid vector driven by HEK293FT cells after 24 h incubation of trans-
Cytomegalovirus (CMV) enhancer–promoter fection. Cells were harvested 3, 6, or 12 h after
(Invitrogen). FuGENE 6 transfection reagent addition of cycloheximide. CHX-treated cells
(Promega) was used [3, 5]. PrimeStar Mutagenesis were cultured on Poly-D Lysine-coated plates
site-directed primers were used to modify amino (EMD Millipore).
acid lysine to arginine through in-frame modifica-
tion of 5′-AAG-3′ to 5′-AGG-3′ in pcDNA3.1
(Takara Bio Inc). HEK239FT cells were trans- 2.4 Statistical Analysis
fected 24 h prior to lysis.
Representative graphical results were shown as
a mean with standard error of the mean (SEM).
2.2 Immunoblotting Analysis Commercial software program (GraphPad
and Immunoprecipitation Prism 9) was used to determine P values
through two-­way ANOVA or Student’s two-
Immunoblotting analysis and quantification tailed t-test. P value <0.05 was considered
were performed as previously published [4]. significant.
Equal amounts of protein were applied onto
Lysine Ubiquitylation Drives Rhodopsin Protein Turnover
3 Results
3.1 P23H Rhodopsin Is Less
Ubiquitylated When Lysine Is
Replaced with Arginine
Human rhodopsin is a 348-amino acid membrane
protein, with 11 lysines distributed across intra-
discal/ER luminal (1 lysine), cytosolic (9 lysines),
and transmembrane (1 lysine) domains (Fig. 1a).
To investigate the role of lysines in P23H rhodop-
sin ubiquitylation and degradation, we performed
site-directed mutagenesis to convert all 11 lysine
residues into arginine (K-to-R) (K-null P23H)
(Fig. 1a, b) [2]. Arginine is positively charged
like lysine but cannot form an isopeptide bond
with ubiquitin. First, to determine if the change in
lysine residues affected rhodopsin protein expres-
sion, we visualized immunoblots of cell lysates
transfected with P23H rhodopsin or K-null P23H
rhodopsin (Fig. 1c). We saw no difference in the
levels of monomeric (35–50 kDa) or total rho-
dopsin protein levels between P23H and K-null
P23H (P > 0.05, Fig. 1c). This finding indicated
that the K-to-R conversions did not interfere with
rhodopsin protein synthesis and folding in vitro.
Next, we examined how mutating all lysine resi-
dues affected P23H rhodopsin ubiquitylation. We
immunopurified comparable amounts of K-null
P23H and P23H rhodopsin protein (Fig. 1d). We
noted visibly less ubiquitylation signal using
anti-ubiquitin antibody P4D1 on the immunopu-
rified K-null P23H protein compared to P23H
rhodopsin (Fig. 1d). These findings indicated that
P23H rhodopsin undergoes ubiquitinylation on
its lysines.
We next examined if reduced ubiquitinylation
of K-null P23H protein affected its half-life (t1/2).
We collected transfected cell lysates 3, 6, and
12 h after cycloheximide (CHX) treatment and
quantified total rhodopsin protein levels at each
time point (Fig. 1e). WT rhodopsin protein levels
remained stable at all time points in our CHX
experiment. P23H rhodopsin protein levels
dropped quickly after CHX treatment with a
t1/2 ~ 3–6 h similar to prior studies [11]. By con-
trast, K-null P23H protein levels remained sig-
nificantly elevated compared to P23H at 6 h after
495
CHX treatment (purple asterisk *P < 0.05,
Fig. 1e). This finding indicates that K-null P23H
has a greater t1/2 than P23H and supports that
lysine ubiquitinylation drives P23H rhodopsin
protein turnover.
3.2 K-null WT Rhodopsin Is Less
Ubiquitylated Than WT
Rhodopsin
We also generated a WT human rhodopsin
expression construct where all 11 lysines were
converted to arginines (K-null WT) (Fig. 1a, b).
Immunoblot analysis showed comparable levels
of rhodopsin immunoreactive bands in both WT
and K-null WT transfected cell lysates (Fig. 2a).
However, when we immunopurified WT or
K-null WT rhodopsin protein from total lysates,
we saw significantly less ubiquitinylation of
K-null WT rhodopsin compared to WT rhodop-
sin (Fig. 2b). This finding indicates that lysines
are also ubiquitinylated on WT rhodopsin protein
and likely drive normal rhodopsin turnover.
4 Discussion
In this study, we show that ubiquitylation and
turnover of P23H rhodopsin is lysine-dependent.
We show that the K-null P23H rhodopsin was
significantly less ubiquitylated and more stable
compared to P23H rhodopsin with intact lysine
residues. Single K-to-R substitutions did not alter
P23H rhodopsin ubiquitinylation levels (data not
shown), and this suggests that multiple lysines on
rhodopsin are likely covalently modified. Future
studies can identify on the combination of lysine
residues of P23H rhodopsin that are covalently
conjugated to ubiquitin to drive its degradation.
In the absence of lysines, K-null P23H rho-
dopsin was still degraded albeit at a slower pace
(Fig. 1e). This may indicate redundant and
compensatory protein degradation systems to
­
remove P23H rhodopsin. Previously, we found
that P23H rhodopsin could be degraded through
proteasome and autophagy pathways [5]. In vivo,
P23H rhodopsin triggered ER stress and acti-
496 A. P. F. Chen et al.

Fig. 1 Role of lysine residues on P23H rhodopsin ubiqui- Lysine residues are in red. The proline 23 converted to
tylation and turnover. (a) Schematic representation of histidine (P23H) is in blue. (b) Table lists pcDNA3.1
human rhodopsin protein with 348-amino acid sequence. expression constructs of wild-type (WT) rhodopsin; WT
Lysine Ubiquitylation Drives Rhodopsin Protein Turnover 497

Fig. 2 Role of lysine

residues on wild-type
rhodopsin
ubiquitylation. (a) Cells
were transfected with
WT or K-null WT
rhodopsin and
immunoblotted for
rhodopsin. (b)
Rhodopsin was
immunoprecipitated
from cells from (a) and
immunoblotted for
rhodopsin (top). The
membrane was stripped
and re-probed for
ubiquitin (bottom)

vated the Unfolded Protein Response, which in
turn regulates many anabolic and catabolic mech-
anisms (translation, autophagy, ERAD, etc.) to
reduce cellular levels of misfolded ER client pro-
teins [1, 4]. Recently, modulation of autophagy
or proteasome activity in P23H rhodopsin mice
reduced retinal degeneration [10, 13]. Strategies
to ubiquitinylate P23H rhodopsin could enhance
its protein clearance by autophagy or proteasome
and potentially benefit retinitis pigmentosa
patients carrying these mutations.
Acknowledgments This study was supported by NIH
awards R01EY027335, CIRM DISC2-10973 award, and
VA Merit I01BX002284.

Fig. 1 (continued) rhodopsin with all lysines converted to arginine (K-null); P23H rhodopsin; and P23H rhodopsin with
all lysines converted to arginine (K-null P23H). (c) Protein lysates were prepared from HEK293 cells transfected with
P23H or K-null P23H (n = 6 independent experimental replicates). Monomeric and total rhodopsin protein were
detected by immunoblotting, quantified, and normalized to loading control, Actin. Data represent mean ± SEM,
Student’s t-test, *P < 0.05. (d) Left panels show lysates of cells transfected with P23H or K-null P23H and immunoblot-
ted for rhodopsin, ubiquitin, or actin (loading control). On right, rhodopsin was immunoprecipitated from cells express-
ing P23H or K-null P23H and immunoblotted for rhodopsin (top right). The membrane was stripped and re-probed for
ubiquitin (bottom right). (e) Cells were transfected with WT, P23H, or K-null P23H. Cycloheximide (CHX) was added
after 24 h. Lysates were collected as indicated after CHX addition and a representative immunoblot for rhodopsin or
actin (loading control) is shown. Rhodopsin protein levels after CHX treatment were quantified from three experimental
repeats, normalized to actin, and are graphed relative to protein levels at start of CHX treatment. Shown are rhodopsin
protein levels in WT vs K-null P23H (red asterisk), WT vs P23H (blue asterisk), and P23H vs K-null P23H (purple
asterisk). Data represent mean ± SEM, two-way ANOVA, *P < 0.05,**P < 0.005
498 A. P. F. Chen et al.

References 7. Hargrave PA. Rhodopsin structure, function,

and topography the Friedenwald lecture. Invest
Ophthalmol Vis Sci. 2001;42(1):3–9.
1. Alavi MV, Chiang WC, Kroeger H, Yasumura D,
8. Illing ME, Rajan RS, Bence NF, Kopito RR. A rho-
Matthes MT, Iwawaki T, LaVail MM, Gould DB, Lin
dopsin mutant linked to autosomal dominant reti-
JH. In vivo visualization of endoplasmic reticulum
nitis pigmentosa is prone to aggregate and interacts
stress in the retina using the ERAI reporter mouse.
with the ubiquitin proteasome system. J Biol Chem.
Invest Ophthalmol Vis Sci. 2015;56(11):6961–70.
2002;277(37):34150–60.
2. Batonnet S, Leibovitch MP, Tintignac L, Leibovitch
9. Komander D, Rape M. The ubiquitin code. Annu Rev
SA. Critical role for lysine 133 in the nuclear
Biochem. 2012;81:203–29.
ubiquitin-­mediated degradation of MyoD. J Biol
10. Lobanova ES, Finkelstein S, Li J, Travis AM, Hao
Chem. 2004;279(7):5413–20.
Y, Klingeborn M, Skiba NP, Deshaies RJ, Arshavsky
3. Chiang WC, Hiramatsu N, Messah C, Kroeger H, Lin
VY. Increased proteasomal activity supports photore-
JH. Selective activation of ATF6 and PERK endo-
ceptor survival in inherited retinal degeneration. Nat
plasmic reticulum stress signaling pathways prevent
Commun. 2018;9(1):1738.
mutant rhodopsin accumulation. Invest Ophthalmol
11. Sung CH, Davenport CM, Hennessey JC, Maumenee
Vis Sci. 2012a;53(11):7159–66.
IH, Jacobson SG, Heckenlively JR, Nowakowski R,
4. Chiang WC, Kroeger H, Sakami S, Messah C,
Fishman G, Gouras P, Nathans J. Rhodopsin muta-
Yasumura D, Matthes MT, Coppinger JA, Palczewski
tions in autosomal dominant retinitis pigmentosa.
K, LaVail MM, Lin JH. Robust endoplasmic reticulum-­
Proc Natl Acad Sci U S A. 1991;88(15):6481–5.
associated degradation of rhodopsin precedes retinal
12. Wu X, Rapoport TA. Mechanistic insights into
degeneration. Mol Neurobiol. 2015;52(1):679–95.
ER-associated protein degradation. Curr Opin Cell
5. Chiang WC, Messah C, Lin JH. IRE1 directs protea-
Biol. 2018;53:22–8.
somal and lysosomal degradation of misfolded rho-
13. Yao J, Qiu Y, Frontera E, Jia L, Khan NW,
dopsin. Mol Biol Cell. 2012b;23(5):758–70.
Klionsky DJ, Ferguson TA, Thompson DA, Zacks
6. Dryja TP, McGee TL, Reichel E, Hahn LB, Cowley
DN. Inhibiting autophagy reduces retinal degen-
GS, Yandell DW, Sandberg MA, Berson EL. A point
eration caused by protein misfolding. Autophagy.
mutation of the rhodopsin gene in one form of retinitis
2018;14(7):1226–38.
pigmentosa. Nature. 1990;343(6256):364–6.
 In Silico Prediction
of MYO1C-­Rhodopsin Interactions
and Its Significance in Protein
Localization and Visual Function

Glenn P. Lobo, Rakesh Radhakrishnan,

Matthias Leung, Andrew Gruesen, Hans-­
Joachim Knölker, Frederik J. van Kuijk,
and Sandra R. Montezuma

Abstract this study, using modeling and docking

Rods and cones are photoreceptor neurons in
the retina that are required for visual sensation
in vertebrates, where proper protein localiza-
tion and compartmentalization are critical for
phototransduction and visual function. In
human retinal diseases, improper protein
transport to the outer segment (OS) or mislo-
calization of proteins to the inner segment (IS)
could lead to impaired visual responses and
photoreceptor cell degeneration, causing a
loss of visual function. We showed involve-
ment of an unconventional motor protein,
MYO1C, in the proper localization of rhodop-
sin to the OS, where loss of MYO1C in a
mammalian model caused mislocalization of
rhodopsin to IS and cell bodies, leading to
progressively severe retinal phenotypes. In
G. P. Lobo (*) · R. Radhakrishnan · M. Leung ·
A. Gruesen · F. J. van Kuijk · S. R. Montezuma
Department of Ophthalmology and Visual
Neurosciences, University of Minnesota,
Minneapolis, MN, USA
e-mail: lobo0023@umn.edu; rakeshr@umn.edu;
leung132@umn.edu; grues020@umn.edu; vankuijk@
umn.edu; smontezu@umn.edu
H.-J. Knölker
Faculty of Chemistry, Technische Universität
Dresden, Dresden, Germany
e-mail: hans-joachim.knoelker@tu-dresden.de
analysis, we aimed to identify the protein–
protein interaction sites between MYO1C and
Rhodopsin to establish a hypothesis that a
physical interaction between these proteins is
necessary for the proper trafficking of
rhodopsin and visual function.
Keywords
Motor protein · Myosin 1C · Photoreceptor ·
Rhodopsin · Retina · Protein localization ·
Outer segments · Visual function
1 Introduction
All proteins destined for the photoreceptor outer
segment (OS) are synthesized in the inner
segment (IS) compartment, so they must be
properly trafficked to reach their final functional
destination. The proper trafficking of proteins to
specific cellular compartments of the
photoreceptor cell are critical for effective
phototransduction and visual function [1].
Specific sorting of proteins within the
photoreceptor cell requires trafficking and plasma
membrane targeting/localization sequences that
serve as “biochemical zip codes.” Wherein, rapid
and efficient transport and proper localization of

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 499
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_73
500
the proteins from the endoplasmic reticulum
(ER) to the proximal OS is essential for the
photoreceptor cell function and survival. Thus,
making the photoreceptors among the most
interesting cells to study intracellular protein
sorting, trafficking, and localization in retinal
health and disease conditions [2]. A fundamental
question in this regard is how the post-­
biosynthesis transport of plasma membrane-­
associated proteins occurs and what mechanisms
target these proteins to the OS for disc assembly
and/or their participation in the phototransduc-
tion cascade. Thus, understanding and identify-
ing the yet unknown mechanisms involved in
regulating and maintaining accurate protein
transport and compartmentalization in photore-
ceptors is important. The G-protein coupled
receptor (GPCR) Type II Opsin, Rhodopsin, con-
stitutes the majority (approximately 80%) of the
OS resident proteins, and is the major player in
vertebrate phototransduction [3–8]. Our recent
work identified MYO1C as an unexpected pro-
tein for proper rhodopsin localization to rod pho-
toreceptor OS [9]. In co-immunoprecipitation
assays using retinal lysates from mice, we identi-
fied opsins as novel cargo for MYO1C. In the
absence of MYO1C, while rhodopsin was still
able to localize to OS, retinas of Myo1c−/− mice
showed progressively severe rhodopsin mislocal-
ization and retention in the photoreceptor IS and
cell bodies [9]. Most importantly, the global
genetic deletion of Myo1c only affected the ret-
ina, while other systemic organs analyzed
remained unaffected. Our study identified for the
first time that an unconventional motor protein,
MYO1C, is an essential component within mam-
malian photoreceptors, where it plays a canonical
role in promoting the proper localization of rod
opsin and in maintaining the normal visual func-
tion of the eye [9]. While the mechanisms facili-
tating the binding of MYO1C with Rhodopsin in
photoreceptor cell function are still under investi-
gation, our computational-based studies suggest
the binding of MYO1C with Rhodopsin likely
occurs within the C-terminal sites of both pro-
teins, where rhodopsin has a conserved VXPX
motif that is necessary for its membrane localiza-
tion. In this study, using a combination of model-
G. P. Lobo et al.
ing and docking analysis and cell culture, we
aimed to investigate the hypothesis that rhodop-
sin is a cargo for MYO1C, which is critical for its
trafficking to the photoreceptor OS, in the sup-
port of visual function.
2 Materials and Methods
2.1 Phylogenetic Sequence
Analysis
The protein sequence of unconventional Myosin
family proteins was obtained from the NCBI
database and an alignment and a phylogenetic
analysis was conducted using MEGA version X
[10]. The available MYO1C structures were
derived from the truncated protein and alphafold
protein structure database (https://alphafold.ebi.
ac.uk/), which is an AI system that predicts a
complete structure of unsolved protein structures.
To understand the possible composition, the pre-
dicted complete MYO1C structure was obtained
in a PDB file format and visualized and color-­
coded in PyMOL Molecular Graphics System,
Version 2.0 Schrödinger, LLC.
2.2 Protein–Protein Interaction
Bioinformatics Tools
The complete structure of human MYO1C and
Rhodopsin was obtained from the human protein
sequences MYO1C (UNIPROT ID O00159) and
RHO (UNIPROT ID P08100) against the avail-
able crystal structure of human MYO1C
N-terminus PDB 4BYF and mouse MYOIC
C-terminus PDB 4R8G and Bovine RHO com-
plete structure 1HZX. Using the MEMDOCK
server (http://bioinfo3d.cs.tau.ac.il/Memdock;
[11]), the interactions between human MYO1C
and RHO were predicted by protein–protein
docking. The active site of this putative interac-
tion was visualized by the PyMOL Molecular
Graphics System, Version 2.0 Schrödinger.
Docking analysis was further confirmed using a
second docking server, HADDOCK 2.4 [12],
which showed similar results. The human
In Silico Prediction of MYO1C-Rhodopsin Interactions and Its Significance in Protein Localization and…
MYO1C gene mutation residues that lead to hear-
ing impairments and the Rhodopsin gene muta-
tions that cause Retinitis Pigmentosa (RP) are
available in the Human Gene Mutation Database
(http://www.hgmd.cf.ac.uk/).
2.3 In Vitro Transfections
and Co-localization Studies
COS1 cells were cultured on coverslips in
DMEM (Cat. No. 10566024, Thermo Fisher
Scientific, Waltham, MA) supplemented with
10% FBS (Cat. No. F2442, Sigma-Aldrich, St.
Louis, MO) and 1X Penicillin-Streptomycin anti-
biotic solution (Cat. No. 30-002-CI, Corning,
Glendale, AZ). The pmCherry Myo1c and
Rhodopsin GFP (Cat. No. RG211328, Origene,
Rockville, MD) plasmids were transfected into
COS1 cells using FuGENE® HD Transfection
Reagent (Cat. No. E2311, Promega, Madison,
WI) as per the manufacturer’s instructions. After
12 h transfection, the media was replaced with
fresh complete DMEM media, and after 48 h of
incubation, cells were fixed in 4% PFA (buffered
in PBS) and mounted with DAPI (Vector
Laboratories, Newark, CA) on microscope slides
and images were captured using a Keyence
microscope (Keyence Corporation of America,
Itasca, IL) in 60X oil immersion objective.
3 Results
3.1 Myosin Family Controlling
Cytosolic Dynamics
Myosins are a superfamily of over 20 classes that
connect and translocate along actin filaments
using the energy obtained from ATP hydrolysis
[13]. They typically consist of three domains: (1)
a conserved head responsible for actin binding,
ATPase activity, and movement generation; (2) a
short neck that typically interacts with myosin
light chains; and (3) a variable tail that commonly
binds the motor “cargo” and determines the
motor’s functional specificity (Fig. 1a, b).
Secondary structure of MYO1C is composed of
501
the alpha helix and the beta sheets (Fig. 1c). It
performs numerous functions, including facilitat-
ing myosin association, anchoring myosins for
movement relative to actin filaments, and defin-
ing binding to diverse payloads [13]. Although
cells may create certain types of movement by
polymerizing actin, many cellular motions rely
on interactions between actin filaments and myo-
sin and ATPase that travels along actin filaments
by connecting ATP hydrolysis to conformational
changes [14]. As a result, this sort of enzyme that
transfers chemical energy into mechanical energy
is known as a mechanochemical enzyme or, more
commonly, a motor protein. Myosin is the motor,
actin filaments are the rails that myosin travels
along, and ATP is the fuel that drives
movement [15].
3.2 MYO1C Interaction
with Rhodopsin
Protein–protein interactions in vesicle trafficking
are critical for sustaining orientation-based vesi-
cle movement in three-dimensional cytoplasmic
content. Transmembrane protein like rhodopsin
has many hindrances for direct physical interac-
tions with cytosolic proteins (Fig. 2a). It is known
that the spanning of transmembrane residues cov-
ered by lipid membrane nullifies the accessibility
by potential interaction partners, restricting the
interactions to the cytosolic overhangs of resi-
dues (Fig. 2a). The MYO1C protein is an unusual
Myosin family member with an evolutionarily
conserved motor domain for ATP hydrolysis and
two IQ domains and one TH1 domain at its
C-terminus, according to the Uniprot database.
IQ domains are around 25 amino acids long,
which helps in interacting with calmodulin in the
absence of Ca2+. Whereas the TH1 domain, also
known as the Class1 tail homology domain, has
an embedded pleckstrin-homology (PH) domain
capable of attaching to lipid membranes [16]
(Figs. 1 and 3a, b). While the mechanisms facili-
tating MYO1C–Rhodopsin binding in photore-
ceptor function are still being investigated, our in
silico studies suggest that MYO1C–Rhodopsin
binding most likely occurs within the C-terminus
502 G. P. Lobo et al.

Fig. 1 Phylogenic tree of Myosin. (a) MEGA-X software lar evolutionary analysis [10]. (b) Domains and residue
version 10.2.6 was used to align the Myosin family pro- position of MYO1C. (c) The structure of MYO1C, with
tein sequences, and a phylogenetic tree was constructed. the alpha-helix in cyan and the beta sheets in magenta
MEGA version X was used for phylogenetic and molecu-

Fig. 2 Homology modeling of MYO1C. (a) The bovine MYO1C. The complete structure of both MYO1C and
rhodopsin structure in lipid bilayer and possible sites of Rhodopsin was obtained from https://alphafold.ebi.ac.
anchoring are shown in distortion view from http://mem- uk/. [19]
protmd.bioch.ox.ac.uk [18]. (b) The predicted structure of
In Silico Prediction of MYO1C-Rhodopsin Interactions and Its Significance in Protein Localization and…
sites of both proteins, where rhodopsin has a con-
served VXPX motif that is required for mem-
brane localization [17]. Our in silico modeling
investigations further indicated that a putative
interaction between MYO1C and Rhodopsin
occurs at their C-terminal (Fig. 3a). At the IQ
domains of MYO1C and serine and threonine
residues near the VXPX area of rhodopsin, they
create hydrogen bonds and salt bridges. The
VXPX region of rhodopsin’s cytosolic overhang
makes it more accessible for protein–protein
interaction and tethering for vesicle trafficking
(Fig. 3c). MYO1C comprises an N-terminus
Fig. 3 Protein docking and predicted active sites for
MYO1C to Rhodopsin interaction. (a) MYO1C and
Rhodopsin structure with predicted interaction sites are
shown in cartoon view. Detailed domains of MYO1C are
indicated. The putative active binding site of MYO1C–
Rhodopsin interaction (shown in the red circle) was
obtained in the PyMOL Molecular Graphics System,
Version 2.0 Schrödinger, LLC. The protein–protein dock-
ing analysis was performed using MEMDOCK. (b, c) The
representative figure showing the domains, sites, and
genetic point mutations in MYO1C and Rhodopsin. Two
mutations in MYO1C (E831K and K823N) found in
503
motor domain for ATP hydrolysis and actin fila-
ment binding, while the C-terminus domains IQ
and TH1 help in protein and lipid binding
(Fig. 1b). Interestingly, our docking analysis of
MYO1C and Rhodopsin revealed putative con-
tact sites in which MYO1C had active amino acid
residues from region 785 to 858. The two docu-
mented MYO1C mutations (K823N and E831K)
previously identified in patients with deafness
and Rhodopsin C-terminal mutations (P34S/L,
V345M, and Q344ter) fall within this predicted
MYO1C–RHO binding domain, explicitly sug-
patients with deafness, and Rhodopsin C-terminal muta-
tions (P34S/L, V345M, and Q344ter) fall within the pre-
dicted MYO1C–RHO binding domain. (d) Protein–protein
interactions in COS1 cell line, where MYO1C tagged
with pmCherry (red) and Rhodopsin tagged with EGFP
(green), were overexpressed. This analysis shows co-­
localization patterns (merge, yellow) between the MYO1C
and Rhodopsin and possible sites of co-localization
(boxed and in the zoom panel) in the plasma membrane of
transfected cells, which are visible in the accompanying
intensity profiles
504
gesting the relevance of this interaction in human
eye and ear pathologies (Fig. 3a–c).
3.3 Co-Localization of MYO1C
with Rhodopsin in COS1 Cells
Our co-transfection experiments in COS1 cells References
demonstrated co-localization patterns of wild-­
1. Imanishi Y. Protein Sorting in Healthy and Diseased
type MYO1C with Rhodopsin at the plasma
membrane with a positive Pearson correlation
(Fig. 3d). However, to completely understand the 2. Bales KL, Gross AK. Aberrant protein trafficking
significance and implications of these protein–
protein interactions between MYO1C and
Rhodopsin in human retinal disorders, these pre- 3. Jastrzebska B, Fotiadis D, Jang GF, Stenkamp RE,
dictive interactions between MYO1C and
Rhodopsin must be further investigated.
4 Discussion
Understanding the mechanisms responsible for
protein localization and trafficking in photore-
ceptor cells is crucial for understanding visual
function and disorders associated with hereditary
retinal cell degeneration. The unexpected discov-
ery of an unconventional motor protein, MYO1C,
as an important component of rhodopsin (RHO)
localization to rod OS reveals a completely
undiscovered function for motor proteins in pro-
tein transport and emphasizes the importance of
the myosin-tail homology domain in cargo/protein
localization, particularly in photoreceptor cells.
Future in vitro and in vivo studies are therefore
warranted to further explore the physiological
role of MYO1C in Rhodopsin trafficking for
visual function. In the future, it will be intriguing
to understand the molecular mechanism that
favor MYO1C interaction with the C-terminus
end of Rhodopsin and how disruption of these
interactions might be causative of protein mis-
trafficking in photoreceptors and retinal
dysfunction.
G. P. Lobo et al.
Acknowledgments This work was supported by the
National Institute of Health—National Eye Institute
(NIH-NEI) grants R21EY025034 and R01EY030889 to
G.P.L. This project was also supported in part by a SCTR-
NIH/NCATS grant (5UL1TR001450) and University of
Minnesota Start-up funds to G.P.L.
Photoreceptors. Annual Review of Vision Science.
2019;5(1):73–98.
in retinal degenerations: The initial phase of
retinal remodeling. Experimental Eye Research.
2016;150:71-80.
Engel A, Palczewski K. Functional and structural
characterization of rhodopsin oligomers. J Biol Chem.
2006;281(17):11917–11922.
4. Jastrzebska B. GPCR: G protein complexes—the
fundamental signaling assembly. Amino Acids.
2013;45(6):1303–1314.
5. Lobo GP, Ebke LA, Au A, Hagstrom SA. TULP1
Missense mutations induces the endoplasmic retic-
ulum unfolded protein response stress complex
(ER-UPR). Adv Exp Med Biol. 2016a;854:223–30.
6. Lobo GP, Au A, Kiser PD, Hagstrom
SA. Involvement of Endoplasmic reticulum stress
in tulp1 induced retinal degeneration. PLOS ONE.
2016b;11(3):e0151806–10.
7. Nemet I, Ropelewski P, Imanishi Y. (2015). Trafficking
of GPCRs: rhodopsin trafficking and mistrafficking.
Prog Mol Biol Transl Sci. 2015;132:39–71.
8. Orban T, Jastrzebska B, Palczewski K. Structural
approaches to understanding retinal proteins
needed for vision. Current Opinion in Cell Biology.
2014;27:32–43.
9. Solanki AK, et al. Loss of Motor Protein MYO1C
Causes Rhodopsin Mislocalization and Results in
Impaired Visual Function. Cells. 2021;10(6):1322.
10. Tamura K, Stecher G, Kumar S. MEGA11:
Molecular Evolutionary Genetics Analysis Version
11 Abstract Molecular Biology and Evolution.
2021;38(7):3022–3027.
11. Hurwitz N, Schneidman-Duhovny D, Wolfson
HJ. Memdock: an α-helical membrane protein docking
algorithm. Bioinformatics. 2016;32(16):2444-2450.
12. van Zundert GCP, et al. The HADDOCK2.2
Web Server: User-Friendly Integrative Modeling
of Biomolecular Complexes. J of Mol. Biol.
2016;428(4):720–725.
In Silico Prediction of MYO1C-Rhodopsin Interactions and Its Significance in Protein Localization and…
13. Sellers JR. Myosins: a diverse superfamily Biochimica
et Biophysica Acta (BBA) - Molecular Cell Research.
2000;1496(1):3–22.
14. Svitkina T. The Actin Cytoskeleton and Actin-Based
Motility. Cold Spring Harbor Perspectives in Biology.
2018;10(1):a018267.
15. Mosby LS, et al. Myosin II Filament Dynamics
in Actin Networks Revealed with Interferometric
Scattering Microscopy. Biophysical Journal.
2020;118(8):1946–1957.
16. Hokanson DE, Laakso JM, Lin T, Sept D, Ostap
EM. Myo1c Binds Phosphoinositides through a
505
Putative Pleckstrin Homology Domain. Molecular
Biology of the Cell. 2006;17(11):4856–4865.
17. Mazelova J, et al. Ciliary targeting motif VxPx directs
assembly of a trafficking module through Arf4. The
EMBO Journal. 2009;28(3):183–192.
18. Newport TD, Sansom MSP, Stansfeld PJ. The
MemProtMD database: a resource for membrane-­
embedded protein structures and their lipid interactions.
Nucleic Acids Research. 2019;47(D1) D390–D397.
19. Richard JJ, et al. Highly accurate protein
structure prediction with AlphaFold. Nature.
2021;596(7873):583–589.
 A Ciliary Branched Actin Network
Drives Photoreceptor Disc
Morphogenesis

William J. Spencer and Vadim Y. Arshavsky

Abstract many studies focusing on the role of actin dur-

The light-detecting organelle of the photorecep-
tor cell is a modified primary cilium, called the
outer segment. The outer segment houses hun-
dreds of light-sensitive membrane, “discs,” that
are continuously renewed by the constant for-
mation of new discs at the outer segment base
and the phagocytosis of old ones from outer seg-
ment tips by the retinal pigment epithelium. In
this chapter, we describe how an actin cytoskel-
eton network, residing precisely at the site of
disc formation, provides the driving force that
pushes out the ciliary plasma membrane to form
each disc evagination that subsequently can
mature into a bona fide disc. We highlight the
functions of actin-binding proteins, particularly
PCARE and Arp2/3, that are known to partici-
pate in disc formation. Finally, we describe a
working model of disc formation built upon the
W. J. Spencer (*)
Department of Ophthalmology, Duke University,
Durham, NC, USA
Duke Eye Center, Durham, NC, USA
Upstate Medical University, Syracuse, NY, USA
e-mail: will.spencer@duke.edu;
spencerw@upstate.edu
V. Y. Arshavsky
Department of Ophthalmology, Duke University,
Durham, NC, USA
e-mail: vadim.arshavsky@duke.edu
ing disc morphogenesis.
Keywords
Actin cytoskeleton · Cilia · Outer segment ·
Photoreceptor · Vision
1 Filamentous Actin Resides
Within the Photoreceptor’s
Cilium at the Site of Disc
Formation
Primary cilia were first shown to contain actin
nearly 40 years ago in quail oviduct cells [16]. A
couple of years later, it was shown by anti-actin
immunogold electron microscopy that a rela-
tively large patch of actin resides within the cil-
ium of frog photoreceptor cells, at the site of disc
formation [7]. More specifically, actin was found
within the first newly forming disc evagination,
whereas it is completely absent from mature
discs inside the outer segment. This result was
corroborated in photoreceptors of numerous ver-
tebrate species including humans [4, 6, 20]. The
actin present at the site of disc formation was
shown to be in a filamentous form by labeling it
with myosin subfragment-1, which specifically
interacts with filamentous actin making it visible
by electron microscopy [1, 5]. Furthermore, dec-
orating actin filaments with myosin subfragment-

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 507
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_74
508
1­ allows differentiation of the growing end from
the non-growing end of an actin filament, which
appear by electron microscopy as barbs or points,
respectively. The barbed, growing ends of the
actin filaments could be observed oriented toward
the ciliary plasma membrane, while the pointed,
non-growing ends were oriented toward the axo-
neme. This means that these actin filaments
began to form at the axoneme and grew toward
the ciliary plasma membrane.
2 Inhibition of Actin
Polymerization Prevents
Initiation of Disc Formation
In a classical study by Williams et al. [22], the
functional significance of the actin filaments
present at the site of disc formation in rods and
cones was shown by treating frog retinas with
cytochalasin D. This toxin tightly binds the
barbed end of actin filaments, thereby blocking
addition of actin monomers and ultimately inhib-
iting actin polymerization. Treating retinas with
cytochalasin D for 6 h caused the massive over-
Fig. 1 Actin polymerization is required for the formation
of new disc evaginations. Left: A cartoon depicting the
site of photoreceptor disc formation. Photoreceptors make
~18 new discs every 6 h – visualized by purple highlight.
Right: A photoreceptor that has been incubated with the
actin polymerization inhibitor cytochalasin D for 6 h.
Inhibiting actin polymerization prevents the formation of
W. J. Spencer and V. Y. Arshavsky
growth of the several disc evaginations at the
base of the outer segment. To interpret this result,
one must consider that each photoreceptor cell
has several newly forming disc evaginations
present at the base of the outer segment at any
given time; for example, ~5 disc evaginations
observed in frog rods [2]. These evaginations are
continuous with the ciliary plasma membrane,
enabling them to accept membrane material
delivered through the connecting cilium so that
they can be expanded to their final size (i.e., the
diameter of the outer segment). Once the expan-
sion of an immature disc is completed, it can
enclose inside the outer segment as a fully
matured disc, thereby allowing space for a new
disc evagination to form and the cycle to con-
tinue. Photoreceptor cells make a new, fully
matured disc every ~20 min, which is about 18 of
them in 6 h (Fig. 1, left). The treatment of retinas
for 6 h with cytochalasin D halts the formation of
new, discrete disc evaginations, without prevent-
ing the trafficking of protein and lipid material to
the cilium. As a result, 6 hours’ worth of protein
and lipid material delivered through the cilium
was directed into the ~5 disc evaginations that
new disc evaginations without impairing the flow of mem-
brane material through the cilium. This causes 6 hours’
worth of disc membrane material (highlighted in purple)
to be directed into the several disc evaginations already
present at the start of treatment, ultimately causing them
to overgrow
A Ciliary Branched Actin Network Drives Photoreceptor Disc Morphogenesis 509

were already present at the time of treatment acute cytochalasin D treatment because the
rather than being allocated into ~18 new discs knockout was permanent, resulting in a never-­
(Fig. 1, right). As a result, the immature disc ending supply of membrane material. This work
evaginations at the base of the outer segment put forth a new model of disc formation whereby
overgrew several fold larger than normal. branched actin polymerization, nucleated by
The effect of cytochalasin D treatment on disc Arp2/3, provides the force that pushes out the
formation was corroborated in several subse- ciliary membrane to initiate disc formation. This
quent studies and shown to be a direct effect [10, mechanism is functionally analogous to the role
12, 14, 19, 21]. Most recently it was shown that of Arp2/3 in driving actin polymerization that
the overgrown disc evaginations present after protrudes the plasma membrane to form the lead-
cytochalasin D treatment can be enclosed [19]. ing edge of migrating cells, called the lamellipo-
This result implies that disc enclosure does not dia [3].
require a normal disc diameter or the action of
the actin cytoskeleton.
4 PCARE Recruits Actin
Polymerization Machinery
3 The Arp2/3 Complex Initiates to the Cilium
Actin Polymerization During
Disc Formation The Arp2/3 complex is ubiquitously expressed
by eukaryotic cells and requires other proteins to
The experiments treating retinas with cytochala- direct its action to the correct cellular location.
sin D showed that actin polymerization is Recently, a breakthrough was made in how
required for disc formation, but the molecular Arp2/3 activity is directed to the site of disc for-
players involved in the process were unknown mation in photoreceptor cells. A photoreceptor-­
until recently. To identify these molecules, specific protein called PCARE (photoreceptor
Spencer et al. [19] isolated proteins present at the cilium actin regulator; originally C2orf71) was
site of disc morphogenesis and identified them by shown to localize to the site of disc formation and
mass spectrometry. They identified a large num- recruit the actin nucleation-promoting factor,
ber of actin binding proteins, including the WASF3 to this site [9]. Nucleation-promoting
branched actin nucleating protein complex, factors are essential cofactors for Arp2/3 and pro-
Arp2/3. Because actin nucleation is the essential, vide a means to regulate branched actin polymer-
rate limiting step in the formation of actin net- ization at the right time and place [17].
works, the authors generated a conditional, rod-­ Highlighting the sufficiency of PCARE to drive
specific knockout of the Arp2/3 complex to actin polymerization in the cilia, PCARE reliably
determine its role in disc formation. The knock- targets to the cilia in cultured cells and, when co-­
out of the Arp2/3 complex from rods correlated expressed with WASF3, it causes the formation
with a loss of the actin filaments at the site of disc of actin filaments within the cilium [9, 15]. The
formation. Analogous to the case of cytochalasin loss of PCARE in rods causes a phenotype simi-
D treatment, the loss of this actin network blocked lar to that of the Arp2/3 knockout [13].
the formation of new disc evaginations without Collectively, these data show that PCARE
stopping the delivery of protein and lipid material recruits the molecular machinery that initiates
to the cilium. This caused the immature disc branched actin polymerization at the site of disc
evaginations already present at the time of knock- formation to create new disc evaginations.
out to overgrow into massive membrane whorls, A couple of questions remain regarding
which completely disrupted outer segment struc- PCARE’s function in photoreceptors. Because
ture, eventually leading to photoreceptor cell PCARE localizes throughout the entire length of
death. The extent of disc overgrowth in the the cilium in cultured cells [9, 15], it remains to
Arp2/3 knockout was much greater than upon be determined how it precisely localizes to the
510
site of disc formation rather than the whole length
of the outer segment. Furthermore, WASF3 is
known to require the activity of the small GTPase,
Rac1 [8], yet mice containing a rod specific
knockout of Rac1 have completely normal disc
morphogenesis [11]. Future studies are required
to determine if WASF3 has a direct role in disc
formation and whether any small GTPase is
involved in the process.
5 A Cycle of Actin
Polymerization
and Depolymerization
Initiates Disc Formation
These findings can be summarized in the current
model about the role of actin during disc mor-
phogenesis (Fig. 2). In step 1, PCARE localizes
Fig. 2 The actin dynamics cycle that initiates disc forma-
tion. A cycle of actin polymerization/disassembly begins
in step 1 when PCARE (photoreceptor cilium actin regu-
lator) recruits an actin nucleation-promoting factor, like
WASF3, to the site of disc morphogenesis. This actin
nucleation-promoting factor associates with the Arp2/3
complex to nucleate branched actin filaments (F-actin). In
step 2, continued actin polymerization pushes the ciliary
membrane outward. The Arp2/3 complex remains as a
W. J. Spencer and V. Y. Arshavsky
directly to the site of disc formation and recruits
WASF3. WASF3 and Arp2/3 work together to
nucleate branched actin filaments that polymer-
ize from the axoneme toward the ciliary plasma
membrane. In step 2, continued branched actin
polymerization provides the force that pushes
out the ciliary membrane to form a broad mem-
brane protrusion called a “lip” in early literature
[7]. In step 3, the branched actin filaments depo-
lymerize, allowing the newly formed immature
disc evagination to flatten. In step 4, the
branched actin filaments have completely depo-
lymerized to allow the immature disc evagina-
tion to become perfectly flat and the cycle to
repeat itself. At any given time, there are several
immature disc evaginations at the base of the
outer segment (see Spencer et al. [18] for a
detailed description and 3D animation of this
process).
structural component of these filaments. In step 3, while
the membrane remains protruded, actin filaments are dis-
assembled and retracted allowing the evaginated mem-
brane to flatten. In step 4, actin has completely retracted,
and the initiation step of disc formation is complete.
Meanwhile, the newly forming disc continues to elongate
through ongoing addition of membrane material.
Reprinted with permission from Spencer et al. [18]
A Ciliary Branched Actin Network Drives Photoreceptor Disc Morphogenesis
Acknowledgments This work was supported by NIH
grants EY012859, EY030451, and EY005722; the
Knights Templar Eye Foundation; and Unrestricted Grant
from Research to Prevent Blindness.
References
1. Arikawa K, Williams DS. Organization of actin fila-
ments and immunocolocalization of alpha-actinin in
the connecting cilium of rat photoreceptors. J Comp
Neurol. 1989;288:640–6.
2. Besharse JC, Hollyfield JG, Rayborn ME. Turnover
of rod photoreceptor outer segments. II. Membrane
addition and loss in relationship to light. J Cell Biol.
1977;75:507–27.
3. Blanchoin L, Boujemaa-Paterski R, Sykes C, et al.
Actin dynamics, architecture, and mechanics in cell
motility. Physiol Rev. 2014;94:235–63.
4. Chaitin MH, Bok D. Immunoferritin localization of
actin in retinal photoreceptors. Invest Ophthalmol Vis
Sci. 1986;27:1764–7.
5. Chaitin MH, Burnside B. Actin filament polarity at
the site of rod outer segment disk morphogenesis.
Invest Ophthalmol Vis Sci. 1989;30:2461–9.
6. Chaitin MH, Carlsen RB, Samara GJ. Immunogold
localization of actin in developing photoreceptor
cilia of normal and rds mutant mice. Exp Eye Res.
1988;47:437–46.
7. Chaitin MH, Schneider BG, Hall MO, et al. Actin in
the photoreceptor connecting cilium: immunocyto-
chemical localization to the site of outer segment disk
formation. J Cell Biol. 1984;99:239–47.
8. Chen Z, Borek D, Padrick SB, et al. Structure and
control of the actin regulatory WAVE complex.
Nature. 2010;468:533–8.
9. Corral-Serrano JC, Lamers IJC, van Reeuwijk J, et al.
PCARE and WASF3 regulate ciliary F-actin assem-
bly that is required for the initiation of photoreceptor
outer segment disk formation. Proc Natl Acad Sci U S
A. 2020;117:9922–31.
10. Hale IL, Fisher SK, Matsumoto B. The actin network
in the ciliary stalk of photoreceptors functions in
the generation of new outer segment discs. J Comp
Neurol. 1996;376:128–42.
11. Haruta M, Bush RA, Kjellstrom S, et al. Depleting
Rac1 in mouse rod photoreceptors protects them
511
from photo-oxidative stress without affecting their
structure or function. Proc Natl Acad Sci U S A.
2009;106:9397–402.
12. Kaplan MW. Disk membrane initiation and inser-
tion are not required for axial disk displacement in
Xenopus laevis rod outer segments. Curr Eye Res.
1998;17:73–8.
13. Kevany BM, Zhang N, Jastrzebska B, et al. Animals
deficient in C2Orf71, an autosomal recessive reti-
nitis pigmentosa-associated locus, develop severe
early-onset retinal degeneration. Hum Mol Genet.
2015;24:2627–40.
14. Nemet I, Tian G, Imanishi Y. Submembrane assem-
bly and renewal of rod photoreceptor cGMP-gated
channel: insight into the actin-dependent pro-
cess of outer segment morphogenesis. J Neurosci.
2014;34:8164–74.
15. Nishimura DY, Baye LM, Perveen R, et al.
Discovery and functional analysis of a retinitis
pigmentosa gene, C2ORF71. Am J Hum Genet.
2010;86:686–95.
16. Sandoz D, Gounon P, Karsenti E, et al.
Immunocytochemical localization of tubulin,
actin, and myosin in axonemes of ciliated cells
from quail oviduct. Proc Natl Acad Sci U S A.
1982;79:3198–202.
17. Soderling SH. Grab your partner with both hands:
cytoskeletal remodeling by Arp2/3 signaling. Sci
Signal. 2009;2:pe5.
18. Spencer WJ, Lewis TR, Pearring JN, et al.
Photoreceptor discs: built like Ectosomes. Trends Cell
Biol. 2020;30:904–15.
19. Spencer WJ, Lewis TR, Phan S, et al. Photoreceptor
disc membranes are formed through an Arp2/3-­
dependent lamellipodium-like mechanism. Proc Natl
Acad Sci U S A. 2019;116:27043–52.
20. Vaughan DK, Fisher SK. The distribution of F-actin
in cells isolated from vertebrate retinas. Exp Eye Res.
1987;44:393–406.
21. Vaughan DK, Fisher SK. Cytochalasin D disrupts
outer segment disc morphogenesis in situ in rabbit
retina. Invest Ophthalmol Vis Sci. 1989;30:339–42.
22. Williams DS, Linberg KA, Vaughan DK, et al.
Disruption of microfilament organization and deregu-
lation of disk membrane morphogenesis by cytochala-
sin D in rod and cone photoreceptors. J Comp Neurol.
1988;272:161–76.
Part XII
RPE
 Revisiting the Daily Timing of POS
Phagocytosis

Antonio E. Paniagua, Harjas S. Sabharwal,

Kausalya Kethu, Andrew W. Chang,
and David S. Williams

Abstract Keywords

Retinal pigment epithelium (RPE) cells daily Phagocytosis · Phagosome · RPE ·

ingest the tips of the photoreceptor outer seg-
ments (POSs), with phagosome number vary-
ing throughout a 24-h cycle. A major focus in
the literature has been on a peak in phagosome
concentration shortly after lights-on.
Moreover, this peak has frequently been
inferred to represent a peak in POS tip inges-
tion. Here, we have reviewed old and new lit-
erature on the daily cycle of phagosome
number in the RPE and conclude that there is
more variation in the timing of phagosome
concentration peaks than is currently acknowl-
edged. We also discuss that phagosome quan-
tity is affected by the rate of phagosome
degradation as well as the rate of ingestion;
given that phagosome half-life may not be
constant throughout the daily cycle, maximal
POS ingestion may not necessarily coincide
with a peak in phagosome concentration.
A. E. Paniagua (*) · H. S. Sabharwal · K. Kethu ·
A. W. Chang · D. S. Williams (*)
Departments of Ophthalmology and Neurobiology,
Stein Eye Institute, David Geffen School of Medicine
at UCLA, Los Angeles, CA, USA
e-mail: paniagua@ucla.edu; hsabharwal@ucla.edu;
krkethu@g.ucla.edu; andrewchang0731@ucla.edu;
dswilliams@ucla.edu
Photoreceptor outer segment · Daily rhythm
1 Introduction
Electron micrographs of photoreceptor outer
segment (POS) phagosomes were first published
in the early 1960s [1]. Subsequent autoradiography
experiments demonstrated that these structures
were indeed phagosomes, originating from the
POS tips, as part of the continual renewal of POS
disk membranes [2, 3]. The entire POS is renewed
in ~10 days in the rat, mouse, and monkey and
40–50 days in frogs [3–5]. Given these renewal
rates, the relative sizes of the POSs and
phagosomes, and the average number of
photoreceptors that interface a single retinal
pigment epithelium (RPE) cell [4, 6], each RPE
cell degrades 50–300 phagosomes daily in a
monkey retina, and 200–400 in a mouse retina.
The ingestion and degradation of the POS tips is
essential for photoreceptor cell viability, as any
impairment in either POS ingestion or degradation
leads to retinal degeneration [7, 8].
Phagocytosis involves two consecutive
processes: ingestion of the POS tip, followed by
degradation of the phagosome. Although
reference to “disk shedding” that precedes
ingestion of shed POS particles is common in the

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 515
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_75
516 A. E. Paniagua et al.

literature, there is no convincing evidence of shed similar size, one after lights-on and another after
packets of disk membranes awaiting ingestion. lights-off [15].
Loss of the POS tip requires normal attachment Studies on two other animals also found two
to the RPE [9] and appears to transpire only as daily peaks in phagosome numbers. First, in the
part of ingestion by the RPE. Phagosome mouse, a main peak after lights-on was accompa-
degradation occurs entirely within the RPE [10]. nied by a small elevation in phagosome number
In 1976, LaVail reported a daily peak in during the night (about double that during the lat-
phagosome number shortly after the onset of ter part of the day) [5]. Then, the duplex retina of
light in rats [11]. A similar peak was described in a tree squirrel was reported to have a similar dou-
frogs [12]. Although subsequent studies with ble peak, although the second peak was not evi-
other species showed different types of daily dent until the middle of the night [16].
rhythms in phagosome number, the prevailing While these studies were consistent with the
dogma is that phagosome number is highest after hypothesis of phagosomes from rod outer seg-
lights-on. Moreover, the daily variation in phago- ments (OSs) after lights-on and cone OSs after
some number has often been interpreted to indi- lights-off, they were followed by studies, from
cate a comparable variation in ingestion, but this the early 1980s, that did not support this
assumes that phagosome degradation is coupled hypothesis.
directly with ingestion so that phagosome half-­ Fisher and colleagues found that in the
life remains constant. We are questioning these domestic cat, a crepuscular feline that has a
assumptions. Here, we have reviewed the litera- duplex retina, phagosome concentration is
ture with respect to the daily rhythm of phago- elevated after lights-on and during the latter part
some number. We discuss limitations in the of the dark phase. Notably, rod and cone
conclusions that can be drawn from the reported phagosomes, which could be distinguished based
results. on their initial location, were present during both
periods [17]. The same group also studied the
tree shrew, which is a diurnal mammal with
2 Daily Cycle of Phagosome mostly cone photoreceptors; their results showed
Number that a single peak in phagosome concentration
occurred in the morning [18]. Thus, the cat and
The 1976 studies on rat and frog [11, 12] tree shrew studies indicated that peaks in
concerned phagosomes mainly from rods. phagosome concentration could not be explained
Shortly after that, a study on the all-cone retina generally by differences in the timing of rod and
of a lizard found that, in contrast, phagosome cone phagosomes.
number peaked after lights-off [13]. Young A study of four Rhesus macaques was also
thus proposed that the disks from each inconsistent with the hypothesis of rod phago-
photoreceptor type are ingested when the cell somes at lights-on, cone phagosomes at lights-­off.
becomes less functional: rods at lights-on, Retinas were fixed at 1 or 5 h after lights-on or
cones at lights-off. lights-off. Phagosome number was found to vary
This idea was supported by his subsequent little among the timepoints in the foveal RPE,
studies on rods and cones in duplex retinas. In the where cone density is highest. However, in extra-
goldfish, which has five times more rods than foveal RPE, where there are 20 times more rods
cones, a large peak of phagosome number than cones, phagosomes were most abundant at
occurred after lights-on and was attributed to rod 5 h after lights-off, with a secondary peak in
disks, while a smaller one occurred after lights-­ phagosome number at 1 h after lights-on [19]. This
off and was attributed to cone disks [14]. In the study suffers from the limited number of individu-
chicken retina, where cones make up the majority als analyzed, but so far, it represents the only his-
of photoreceptors, there were also two peaks of
Revisiting the Daily Timing of POS Phagocytosis
tological analysis of phagosome number at
different times of day in the RPE of any primate.
More recently, specific antibodies that
distinguish rod and cone phagosomes from each
other were used to determine the rod or cone
origin of phagosomes at different times of day. In
the Nile rat, a diurnal rodent with a 2:1 ratio of
rods to cones, a morning peak in phagosomes
from both rods and cones was observed, together
with a small elevation in phagosome number
during the night [20]. A study from Besharse’s
lab, on zebrafish and mouse, then showed two
similar peaks in phagosome number, one shortly
after lights-on and another shortly after lights-off.
Moreover, at all times and in both species, the
phagosomes originated from both rods and cones
[21].
In conclusion, the daily cycle of phagosome
number commonly includes an elevation during
the dark phase, as well as after lights-on, with
both periods containing phagosomes from both
rods and cones.
3 Ingestion and Degradation
Rates
The number of phagosomes at any given time of
day is a consequence of not only the rate of inges-
tion but also the rate of phagosome degradation.
An increase in phagosome number is a result of a
higher ingestion rate than degradation rate, and a
decrease in phagosome number occurs when
degradation rate overcomes the ingestion rate.
However, a change in phagosome number has
often been interpreted as a change in the rate of
ingestion, despite the lack of evidence on whether
the rate of phagosome degradation remains con-
stant or varies. The ability to distinguish early
phagosomes from late phagosomes is helpful in
addressing whether the relationship between
POS ingestion and degradation is constant or dif-
fers among different times of day.
Herman and Steinberg [22] analyzed RPE
phagosomes in the opossum, a nocturnal marsu-
pial with a rod dominant retina. The large height
of its RPE cells makes this animal a useful model
to study phagosome maturation, as phagosomes
517
move up to 100 μm from the apical side, where
they are ingested, to the basal side, where their
degradation is completed. Therefore, the apical
phagosomes represent newly formed phago-
somes, while more mature phagosomes localize
toward the basal region [23–25]. The opossum
has two peaks in phagosome number: the main
one after lights-on and a second one during the
night. Interestingly, when phagosomes are classi-
fied according to their location along the apical–
basal axis of the RPE, the authors observed that
the night peak is mainly formed by apical phago-
somes, while the morning peak contains mostly
basal phagosomes; the number of new (apical)
phagosomes is similar at night and after
lights-on.
Young’s findings in the chick retina [15]
present a similar situation. The POS phagosome
peak after lights-on was formed by a greater
proportion of old phagosomes (in which the disk
membranes showed perturbed organization by
electron microscopy) compared with the peak
after lights-off.
These observations, based on a distinction
between new and old phagosomes, indicate that
the relationship between POS ingestion and deg-
radation differs between the two time periods.
Without having a direct measure of at least one of
the processes, however, it is unclear how it dif-
fers. For example, the increase in basal phago-
somes after lights-on could result from a decrease
in ingestion coupled with a decrease in the rate of
degradation, so that most of the phagosomes may
have been formed before lights-on and then
degraded slowly (i.e., an increase in phagosome
half-life). In this case, an increase in POS phago-
some number would occur when POS tip inges-
tion has decreased. However, an alternative
explanation is that an increase in ingestion after
lights-on was met by an increase in the rate of
maturation of new to old phagosomes.
Further insight into the process of phagosome
degradation could be gained by studying phago-
somes with markers that indicate different states
of maturation. For example, the degradation of
rhodopsin (RHO), the main protein present in
phagosomes from rods, has been shown to occur
in at least two different steps that can be identi-
518
fied with different antibodies against
RHO. Immunolabeling with RHO mAb 1D4,
which recognizes a C-terminal epitope, is limited
to new phagosomes; phagosomes lose this label-
ing quite quickly, while continuing to be labeled
with other RHO antibodies [24, 26]. This
approach has been used to examine defects in
phagosome degradation [8, 25].
4 POS Tip Ingestion
Although variation in POS tip ingestion,
according to a daily cycle, cannot be inferred
directly from a cycle in phagosome numbers,
there is evidence for such a daily variation. The
initial stage of ingestion of a POS tip involves
binding to the RPE apical surface, which is
facilitated by the integrin, αvβ5 [27]. In β5
integrin-deficient mice, POS phagosomes are
still evident in the RPE, but there is a smaller
daily variation in the number of phagosomes
(~two-fold, compared with ~five-­fold in wild-
type), with the number after lights-­on reduced
(by about half of that in wild-type) [28]. Since the
primary effect of the β5 integrin-­deficiency is
presumably on POS tip ingestion, rather than
degradation, this observation supports a daily
variation in POS tip ingestion.
With the relatively recent development of
retinal live imaging methods, attempts have been
made to detect correlates to the ingestion of the
POS tip. Changes in cone OS tip reflection, deter-
mined by adaptive optics-optical coherence
tomography (AO-OCT) of human retinas, were
presented to indicate a change in cone OS length
and thus removal of the cone OS tip. A transient
loss in the cone OS tip reflection occurred more
frequently during the morning than during the
afternoon or the evening. It was argued that this
change in reflection is an optical signature of
cone OS tip loss [29]. Another study measured
rod OS length in live mice, using OCT, at differ-
ent times of day. A 10% shortening of rod OS
length was detected over a 4.5-h period begin-
ning 0.5 h before lights-on [30]. Of course, just as
phagosome number is affected by the rate of
phagosome degradation as well as POS tip inges-
A. E. Paniagua et al.
tion, changes in POS length are affected by the
rate of disk membrane morphogenesis as well as
POS tip ingestion. So, while these studies on liv-
ing retinas provide important insight, they too
have their limitations. Also, unfortunately, nei-
ther report included measurements from
nighttime.
5 Conclusion
Earlier studies indicated a pattern of phagocytosis
of rod OS tips after lights-on and phagocytosis of
cone OS tips after lights-off. However, later
studies identified inconsistencies. Studies
reported rod and cone OS phagosomes occurring
at the same time, as well as elevated numbers of
both rod and cone OS phagosomes after lights-on
and during the night.
Variation in POS phagosome number clearly
demonstrates a daily cycle in POS tip phagocyto-
sis. However, a better understanding of the rela-
tionship between POS tip ingestion and the rate
of degradation of the ensuing phagosome is still
needed to be able to account for the mechanisms
underlying this daily variation in POS phago-
some number—despite the publication of the first
reports on this topic occurring 45 years ago.
Acknowledgments The authors are supported by a
BrightFocus Foundation postdoctoral fellowship (A.E.P.,
M2021004F) and NIH R01EY027442 grant.
References
1. Dowling JE, Gibbons IR. The fine structure of the
pigment epithelium in the albino rat. J Cell Biol.
1962;14:459–74.
2. Young RW. The renewal of photoreceptor cell outer
segments. J Cell Biol. 1967;33:61–72.
3. Young RW, Bok D. Participation of the retinal pigment
epithelium in the rod outer segment renewal process. J
Cell Biol. 1969;42:392–403.
4. Young RW. The renewal of rod and cone outer
segments in the rhesus monkey. J Cell Biol.
1971;49:303–18.
5. Besharse JC, Hollyfield JG. Turnover of mouse
photoreceptor outer segments in constant
light and darkness. Invest Ophthalmol Vis Sci.
1979;18:1019–24.
Revisiting the Daily Timing of POS Phagocytosis
6. Volland S, Esteve-Rudd J, Hoo J, Yee C, Williams
DS. A comparison of some organizational
characteristics of the mouse central retina and the
human macula. PLoS One. 2015;10:e0125631.
7. Gal A, Li Y, Thompson DA, Weir J, Orth U, Jacobson
SG, et al. Mutations in MERTK, the human orthologue
of the RCS rat retinal dystrophy gene, cause retinitis
pigmentosa. Nat Genet. 2000;26:270–1.
8. Esteve-Rudd J, Hazim RA, Diemer T, Paniagua AE,
Volland S, Umapathy A, et al. Defective phagosome
motility and degradation in cell nonautonomous RPE
pathogenesis of a dominant macular degeneration.
Proc Natl Acad Sci U S A. 2018;115:5468–73.
9. Williams DS, Fisher SK. Prevention of rod
disk shedding by detachment from the retinal
pigment epithelium. Invest Ophthalmol Vis Sci.
1987;28:184–7.
10. Lakkaraju A, Umapathy A, Tan LX, Daniele L, Philp
NJ, Boesze-Battaglia K, et al. The cell biology of
the retinal pigment epithelium. Prog Retin Eye Res.
2020:100846.
11. LaVail MM. Rod outer segment disk shedding in
rat retina: relationship to cyclic lighting. Science.
1976;194:1071–4.
12. Basinger S, Hoffman R, Matthes M. Photoreceptor
shedding is initiated by light in the frog retina.
Science. 1976;194:1074–6.
13. Young RW. The daily rhythm of shedding and
degradation of cone outer segment membranes in the
lizard retina. J Ultrastruct Res. 1977;61:172–85.
14. O'Day WT, Young RW. Rhythmic daily shedding
of outer-segment membranes by visual cells in the
goldfish. J Cell Biol. 1978;76:593–604.
15. Young RW. The daily rhythm of shedding and
degradation of rod and cone outer segment
membranes in the chick retina. Invest Ophthalmol Vis
Sci. 1978;17:105–16.
16. Tabor GA, Fisher SK, Anderson DH. Rod and cone
disc shedding in light-entrained tree squirrels. Exp
Eye Res. 1980;30:545–57.
17. Fisher SK, Pfeffer BA, Anderson DH. Both rod and
cone disc shedding are related to light onset in the cat.
Invest Ophthalmol Vis Sci. 1983;24:844–56.
18. Immel JH, Fisher SK. Cone photoreceptor shedding
in the tree shrew (Tupaia belangerii). Cell Tissue Res.
1985;239:667–75.
19. Anderson DH, Fisher SK, Erickson PA, Tabor
GA. Rod and cone disc shedding in the rhesus
monkey retina: a quantitative study. Exp Eye Res.
1980;30:559–74.
519
20. Bobu C, Hicks D. Regulation of retinal photoreceptor
phagocytosis in a diurnal mammal by circadian clocks
and ambient lighting. Invest Ophthalmol Vis Sci.
2009;50:3495–502.
21. Lewis TR, Kundinger SR, Link BA, Insinna C,
Besharse JC. Kif17 phosphorylation regulates
photoreceptor outer segment turnover. BMC Cell
Biol. 2018;19:25.
22. Herman KG, Steinberg RH. Phagosome movement
and the diurnal pattern of phagocytosis in the tapetal
retinal pigment epithelium of the opossum. Invest
Ophthalmol Vis Sci. 1982;23:277–90.
23. Gibbs D, Kitamoto J, Williams DS. Abnormal
phagocytosis by retinal pigmented epithelium that
lacks myosin VIIa, the Usher syndrome 1B protein.
Proc Natl Acad Sci U S A. 2003;100:6481–6.
24. Wavre-Shapton ST, Meschede IP, Seabra MC,
Futter CE. Phagosome maturation during
endosome interaction revealed by partial rhodopsin
processing in retinal pigment epithelium. J Cell Sci.
2014;127:3852–61.
25. Jiang M, Esteve-Rudd J, Lopes VS, Diemer
T, Lillo C, Rump A, et al. Microtubule motors
transport phagosomes in the RPE, and lack of
KLC1 leads to AMD-­like pathogenesis. J Cell Biol.
2015;210:595–611.
26. Esteve-Rudd J, Lopes VS, Jiang M, Williams DS. In
vivo and in vitro monitoring of phagosome maturation
in retinal pigment epithelium cells. Adv Exp Med
Biol. 2014;801:85–90.
27. Finnemann SC, Bonilha VL, Marmorstein AD,
Rodriguez-Boulan E. Phagocytosis of rod outer
segments by retinal pigment epithelial cells
requires alpha(v)beta5 integrin for binding but
not for internalization. Proc Natl Acad Sci U S A.
1997;94:12932–7.
28. Nandrot EF, Kim Y, Brodie SE, Huang X,
Sheppard D, Finnemann SC. Loss of synchronized
retinal phagocytosis and age-related blindness in
mice lacking alphavbeta5 integrin. J Exp Med.
2004;200:1539–45.
29. Kocaoglu OP, Liu Z, Zhang F, Kurokawa K, Jonnal RS,
Miller DT. Photoreceptor disc shedding in the living
human eye. Biomed Opt Express. 2016;7:4554–68.
30. Zhang P, Shibata B, Peinado G, Zawadzki RJ,
FitzGerald P, Pugh EN Jr. Measurement of diurnal
variation in rod outer segment length in vivo in mice
with the OCT optoretinogram. Invest Ophthalmol Vis
Sci. 2020;61:9.
 Inhibition of Bacterial
Peptidoglycan Cytopathy
by Retina Pigment Epithelial
PGRP2 Amidase
Marlyn P. Langford, Laura A. Perilloux-Lyons,
and A. Scott Kavanaugh
Abstract
Peptidoglycan (PGN) recognition protein 2
(PGRP2; N-acetylmuramyl-l-alanine amidase
(NAMAA)) activity in corneal epithelial cells
is thought to inhibit corneal inflammation by
reducing the PGN-induced cytokines. PGRP2
has not been reported in human retinal pig-
ment epithelial (RPE) cells. RPE cell lysate
NAMAA activity was measured densitometri-
cally via cleavage of FITC-tagged muramyl
dipeptide (FITCMDP). RPE lysate degradation
of the cytopathic activity of nucleotide-­
binding oligomerization domain (NOD)
receptor agonists was assessed by caspase-3
activation and DNA ladder detection and
quantitation. PGRP2/NAMAA protein was
detected in RPE cells by immunofluorescent
antibody assay. RPE lysate NAMAA cleaved
FITC
MDP in a dose- and time-dependent man-
ner. RPE lysate selectively inhibited PGN
cytopathic activity of NOD1 agonists contain-
ing d-γ-glutamyl-meso-diaminopimelic acid
and NOD2 containing l-alanyl-d-­
isoglutamine. The results suggest RPE PGRP2
amidase selectively degrades PGN that stimu-
M. P. Langford (*) · L. A. Perilloux-Lyons ·
A. S. Kavanaugh
Department of Ophthalmology, Louisiana State
University Health Sciences Center, Shreveport, LA,
USA
e-mail: marlyn.langford@lsuhs.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_76
late NOD-mediated cytopathic activity. The
failure of RPE NAMAA to degrade pro-­
inflammatory PGN may play a role in bacte-
rial retinopathies.
Keywords
Bacteria · Cytopathy · Meso-diaminopimelic
acid · Muramyl dipeptide · N-acetylmuramyl-­
l-alanine amidase · NOD agonist ·
Retinopathy
1 Introduction
Retinopathy is not associated with most bacterial
infections, but central serous chorioretinopathy
(CSCR) has been reported in association with
latent Mycobacterium tuberculosis (MTB) [1–3]
or Helicobacter pylori infection [4], supporting
the concept that chronic retinal infection and/or
shedding of bacterial cell wall peptidoglycan
(PGN) may play a role in CSCR.
Mammalian cells have two intracellular
PGN sensors, nucleotide-binding oligomeriza-
tion domain receptors (NOD1 and NOD2) and
four peptidoglycan (PGN) recognition proteins
(PGRP1–4), that can modulate the inflamma-
tory response during bacterial infection [5].
NOD1 activation by PGN containing γ-d-
glutamyl-­ meso-diaminopimelic acid and
521
522 M. P. Langford et al.

NOD2 activation by PGN containing reacted with 1:1000 dilution of rabbit (poly-
N-acetylmuramyl-l-alanyl-d-­i soglutamine clonal) anti-PGRP2 antibody (Fischer
induce pro-inflammatory cytokines [6, 7]. Scientific), and incubated for 6 h. Unreacted
While NODs exhibit no antibacterial activity, anti-PGRP2 antibody was removed and the RPE
PGRP 1, 3, and 4 have bactericidal a­ ctivity and cells rinsed 3× with PBS. Secondary FITC-
PGRP2 is an N-acetylmuramyl-l-alanine ami- tagged goat anti-­ rabbit IgG (1:1000 dilution;
dase (NAMAA) that cleaves the lactyl bond Jackson Laboratories, West Grove, PA) incu-
between N-acetyl muramic acid and l-alanine bated overnight at 4 °C on treated and control
of PGN [8, 9]. NAMAA reduces NOD- slides. The PGRP2 positive RPE cells were
dependent pro-inflammatory activity of bacte- visualized by fluorescent microscopy using the
rial PGN and is thought to protect against method previously described [11].
bacterial-induced inflammation by suppressing
the induction of pro-inflammatory cytokines
[9]. The objective of the current investigation
was to determine if human retinal pigmented Table 1 Peptidoglycan NOD agonists
epithelial (RPE) cells express PGRP2 and NOD Cell
exhibit NAMAA activity against PGN NOD Acronym Peptidoglycan agonist type deatha
agonists. iE-DAP d-γ-glutamyl-meso- 1 24 h
diaminopimelic acid
C12-iE-­ Lauroyl-d-γ-glutamyl- 1 4h
DAP meso-­diaminopimelic acid
2 Materials and Methods Tri-DAP l-alanyl-d-γ-glutamyl-­­ 1 6h
meso-diaminopimelic
2.1 Cell Culture acid
iE-Lys γ-d-glutamyl-l-lysine, 1 >24
Negative control
Human retinal pigmented epithelial (RPE; ARE-­ M-Tri-­ MurNAc-l-alanyl-d-γ-­­ 1/2 6h
19) cells and rabbit kidney (RK13) cells DAP glutamyl-meso-­
(American Type Culture Collection, Manassas, diaminopimelic acid
VA) were grown in 6-well culture dishes PGNEc Insoluble preparation of 1/2 24 h
(Starstedt, Inc., Fischer Scientific, fishersci.com) PGN from E. coli
MDP Muramyl dipeptide; 2 4h
in Dulbecco’s medium (Sigma-Aldrich, St. MurNAc-l-alanyl-d-
Louis, MO) supplemented with 10% calf serum isoglutamine
and antibiotics as previously reported [10]. DD-MDP MurNAc-d-alanyl-d- 2 >24
isoglutamine; Negative
control
L18-MDP Stearoyl-l-alanyl-d- 2 4h
2.2 Peptidoglycan Reagents isoglutamine
Dx-MDP 4-(2-acetamido-2-deoxy-β-­­ 2 6h
Fluorescein isothiocyanate (FITC)-labeled mur- d-glucopyranosyl-­
amyl dipeptide (FITCMDP) as well as five Nod1, MurNAc-­l-alanyl-d-­­
glutamate amide
seven Nod2, and two Nod1/2 agonists (InvivoGen,
M-Tri-­ MurNAc-l-alanyl-d- 2 4h
San Diego, CA) were dissolved in sterile water Lys isoglutaminyl-­Lys
(see Table 1). MBT Murabutide; 2 12 h
MurNAc-l-alanyl-d-
GlnOBu
MFT Liposomal muramyl 2 8h
2.3 Immunofluorescent Antibody
tripeptide [Mifamurtide]
Assay PGN Sa Insoluble preparation of 1/2 12 h
PGN from S. aureus
Slide cultures of RPE cells were fixed by 15 min a
Cell death, incubation period needed to detect >25%
exposure to 70% ethanol, rinsed with PBS (3×), nonviable RK13 cells at 1 μg/mL dose
Inhibition of Bacterial Peptidoglycan Cytopathy by Retina Pigment Epithelial PGRP2 Amidase 523

2.4 Cleavage of FITCMDP by RPE 2.6 Statistical Analysis

Lysate
RPE cells grown in 6-well tissue culture plates
for 24–48 h were rinsed with PBS (3×), cells har-
vested by plastic spatula into 150 μL PBS/cul-
ture, pipetted into Eppendorf vials, and frozen
(−80 °C). FITCMDP was added to PBS or RPE cell
lysate and incubated for up to 72 h at 37 °C. Five
microliters of sucrose (40% w/v) was added to all
RPE lysate/FITCMDP and FITCMDP/PBS samples
and vortexed before 30 μL of each was added to a
1% agarose gel lane and electrophoresed at
65 mV for 1.5 h. The gel was scanned under UV
light and digital images were obtained using a
Bio-Rad gel documentation system and Quantity
One software (Bio-Rad, Hercules, CA). A densi-
tometric analysis of the gel signals was generated
using free-download ImageJ software.
The mean and standard deviation were deter-
mined between triplicate experiments and statis-
tical inferences were based upon Student t-test
analysis; p-values <0.05 were considered
significant.
3 Results
3.1 Detection of RPE PGRP2
and NAMAA Activity
PGRP2 (NAMAA) was detected in RPE cells
(Fig. 1A). FITCMDP incubation with RPE cell
lysate (60 μg) for 24 h resulted in a > 75% shift in
FITC
MDP signal (Fig. 1B) consistent with genera-
tion of low molecular weight FITCMurNAc by
NAMAA cleavage (Fig. 1C).

2.5 NOD-Induced Cytopathy

Cytopathy, characterized by caspase-3 activation
(using the Caspase-3 Assay Colorimetric Kit as
per the instructions provided (Sigma)) and poly-
meric DNA fragmentation, was induced by the
1 μg/mL NOD1 and NOD2 agonists as previ-
ously reported [12]. The RK13 cell cultures were
viewed microscopically through 24 h for the
appearance of dead cells.
3.2 Concentration and Time-­
Dependent RPE Lysate
NAMAA Cleavage of FITCMDP
Incubation of FITCMDP with increasing RPE
lysate protein concentrations for 5 h at 37 °C
resulted in incremental increases in free
FITC
MurNAc consistent with concentration-­
dependent NAMAA activity (Fig. 2A). Similarly,

A B - + C FITCMDP Degradation by HRPE Lysate

200
RPE FITCMDP
180
FITCMDP
160
140
120
GSU

100
80
60
40
20
0
1

100
111
122
133
144
155
166
12
23
34
45
56
67
78
89

Fraction Number

Fig. 1 (A) Photomicrograph showing the PGRP2 cell lysate (60 μg). (C) Densitometric scan showing the
(NAMAA) in RPE cells. (B) Gel electrophoretic pattern >75% signal shift and the detection of FITCMurNAc
of FITCMDP alone (−) and incubated for 24 h with (+) RPE (arrows) after 24 h incubation
524
A. Dose-dependent cleavage
FITC
RPE (µg Protein) MDP
0 5 10 20 40 80 Ctl
Fig. 2 NAMAA dose- and time-dependency. (A) Agarose
gel showing the dependence of FITCMDP degradation on
RPE lysate protein concentration (mixtures incubated for
5 h at 37 °C). (B) Agarose gel showing the time-depen-
hourly incremental increases in the appearance of
free FITCMurNAc were detected through 6 h after
incubation of FITCMDP with RPE lysate consis-
tent with time-dependent degradation of FITCMDP
by RPE NAMAA (Fig. 2B).
3.3 RPE Lysate NAMAA Inhibition
of PGN Cytopathy
To determine if RPE lysate would inhibit the
RK13 cytopathy induced by NOD1 and NOD2
specific PGN, RPE lysate or PBS was incubated
with NOD1 and NOD2 agonist PGNs for 72 h at
37 °C. The mixtures were applied to cultures of
RK13 cells and incubated until cell death was
noted in agonist/PBS control. The levels of cas-
pase-­3 activity (Fig. 3A), polymeric DNA lad-
ders profiles (Fig. 3B), and DNA densitometry
(Fig. 3C) were determined. The results suggest
the cytopathic activity of some NOD1 and NOD2
agonists was inhibited by RPE lysate. Note that
iE-Lys and dd-MDP (inactive NOD1 and NOD2
agonists, respectively) did not induce caspase-3
or result in polymeric DNA fragmentation or
increase DNA ladder density. RPE lysate selec-
tively inhibited meso-diaminopimelic acid
NOD1 agonists (C12-iE-DAP, TriDAP, and
MTriDAP) and NOD2 agonists (FITCMDP, L18,
M-TriLys, and MBT) induced caspase-3 activa-
tion (Fig. 3A) as well as DNA fragmentation
(Fig. 3B, C ); consistent with endonuclease acti-
vation. Thus, RPE lysate NAMAA appears to
M. P. Langford et al.
B. Time-dependent cleavage
0 1 2 3 4 5 6h
dent degradation of FITCMDP by 30 μg RPE lysate protein.
Note the increase in FITCMurNAc cleavage signal (arrow)
with increasing RPE lysate concentration and time
selectively inhibit the cytopathic activity of some
NOD1 and NOD2 agonists.
4 Discussion
RPE cells were shown to express PGRP2 protein
and cleaved FITCMDP consistent with NAMAA.
The cleavage of FITCMurNAc from FITCMDP by
RPE lysate occurred in a concentration and time-­
dependent manner. Unexpectedly, RPE lysate
cleavage of FITCMDP did not inhibit its cyto-
pathic activity in RK13 cells characterized by
executioner caspase-3 activation and polymeric
DNA fragmentation. This result can be explained
if NOD2 is activated by the cleaved l-alanyl-d-­
isoglutamine moiety. Moreover, we observed
that RPE lysate inhibited the cytopathy of most
NOD1 agonists and some NOD2 agonists. The
results suggest RPE cells express an antibacte-
rial enzymatic activity that selectively cleaves
PGN NOD agonists. In this regard, Saha et al.
[13] reported that PGLYRP-2 and NOD2 are
both required for PGN-induced arthritis and
local inflammation. In addition, PGRP2-deficient
mice challenged with Pseudomonas aeruginosa
exhibit less severe keratitis and lower induction
of pro-inflammatory cytokines than wild-type
mice [14]. Taken together, our in vitro results
and these in vivo studies suggest that some
PGRP2 cleaved PGNs may be inactivated (i.e.,
unable to activate NOD) by RPE NAMAA,
while others may retain cytopathogenic/pro-
Inhibition of Bacterial Peptidoglycan Cytopathy by Retina Pigment Epithelial PGRP2 Amidase 525

A
Caspase-3 Activity
160
140 Control *
(Units/ml) 120
100 *
HRPE *
80 *
60
40
*
20
0

NOD1/2 Agonist NOD2 Agonists

B Control HRPE Lysate Control HRPE Lysate

C12-iE-DAP

C12-iE-DAP

MTriDAP
MTriDAP

DD,MDP

DD,MDP

Dx-MDP
Dx-MDP
MTriLys

MTriLys
iE-DAP

iE-DAP
TriDAP

TriDAP

PGNEc
PGNEc

PGNSa

PGNSa
iE-Lys
iE-Lys

MDP

MBT

MDP

MBT
MFT

MFT
L18

L18
C 70 NOD1 Agonists NOD2 Agonists
Control 70
60 * Control
DNA Density (GSU)

HRPE 60 HRPE
DNA Density (GSU)

50
*
50 *
40 * 40
30 30
* *
20 20
10 10
0 0

meso-Diaminopimelic Acid L-alanyl-D-isoglutamine

Fig. 3 Effect of RPE lysate on inhibition of (A) caspase- and NOD1/2 agonists. *p-values <0.05; significantly dif-
­3 activity, (B) DNA fragmentation, and (C) DNA density ferent from stimulated control
induced in RK13 cell cultures treated with NOD1, NOD2,

inflammatory activity. The selective resistance of References

PGN to RPE NAMAA may play a role in bacte-
ria-associated retinopathy. 1. Vayalambrone D, Ivanova T, Misra A. Atypical cen-
tral serous retinopathy in a patient with latent tuber-
Acknowledgments The authors thank Christopher culosis. BMJ Case Rep. 2012:bcr1120115231. https://
Duggan for his technical assistance and gratefully doi.org/10.1136/bcr.11.2011.5231.
acknowledge the support of Medical Student Research 2. Khan P, Khan L, Anjum N, et al. Central serous cho-
Program (L.A.P.). rioretinopathy secondary to tuberculosis: cause or
526
coincidence. BMJ Case Rep. 2017:bcr2016216471.
https://doi.org/10.1136/bcr-­2016-­216471.
3. Kavanaugh AS, Shaukat BA, Pan JT, et al. Bilateral
chronic central serous chorioretinopathy associated
with IGRA latent tuberculosis infection: a case report
and review. New Front Ophthalmol. 2020;6:1. https://
doi.org/10.15761/NFO.1000254.
4. Zavoloka O, Bezditko P, Lahorzhevska I, et al. Clinical
efficiency of helicobacter pylori eradication in the
treatment of patients with acute central serous cho-
rioretinopathy. Graefes Arch Clin Exp Ophthalmol.
2016;254:1737–42.
5. Sorbara MT, Philpott DJ. Peptidoglycan: a criti-
cal activator of the mammalian immune system
during infection and homeostasis. Immunol Rev.
2011;243:40–60.
6. Laroui H, Yan Y, Narui Y, et al. l-ala-γ-d-Glu-­­
meso-diaminopimelic acid (DAP) interacts directly
with leucine-rich region domain of nucleotide-­
binding oligomerization domain 1, increasing phos-
phorylation activity of receptor-interacting serine/
threonine-protein kinase 2 and its interaction with
nucleotide-binding oligomerization domain 1. J Biol
Chem. 2011;286:31003–13.
7. Inohara N, Ogura Y, Fontalba A, et al. Host recogni-
tion of bacterial muramyl dipeptide mediated through
NOD2. Implications for Crohn’s disease. J Biol
Chem. 2003;278:5509–12.
8. Hoijer MA, Melief MJ, Debets R, et al. Inflammatory
properties of peptidoglycan are decreased after degra-
M. P. Langford et al.
dation with human N-acetylmuramyl-L-alanine ami-
dase. Eur Cytokine Netw. 1997;8:375–82.
9. Wang ZM, Li X, Cocklin RR, et al. Human peptido-
glycan recognition protein-L is an N-acetylmuramoyl-­
l-alanine amidase. J Biol Chem. 2003;278:49044–52.
10. Langford MP, Foreman BD, Srur L, et al. Bilateral
acute pyogenic conjunctivitis with iritis induced by
unilateral topical application of bacterial peptidogly-
can muramyl dipeptide in adult rabbits. Exp Eye Res.
2013;116:324–36.
11. Langford MP, Chen D, Welbourne TC, et al. Stereo-­
isomer specific induction of renal cell apoptosis by
synthetic muramyl dipeptide (N-acetylmuramyl-­
l-alanyl-d-isoglutamine). Mol Cell Biochem.
2002;236:63–73.
12. Langford MP, McGee DJ, Ta KH, et al. Multiple
caspases mediate acute renal cell apoptosis induced
by bacterial cell wall components. Ren Fail.
2011;33:192–206.
13. Saha S, Qi J, Wang S, et al. PGLYRP-2 and Nod2
are both required for peptidoglycan-induced arthri-
tis and local inflammation. Cell Host Microbe.
2009;5:137–50.
14. Gowda RN, Redfern R, Frikeche J, et al. Functions
of peptidoglycan recognition proteins (Pglyrps) at
the ocular surface: bacterial keratitis in gene-targeted
mice deficient in Pglyrp-2, −3 and −4. PLoS One.
2015;10(9):e0137129. https://doi.org/10.1371/jour-
nal.pone.0137129.
 Understanding Ischemic
Retinopathies: The Role
of Succinate and Its Receptor
in Retinal Pigment Epithelium

Bilge Esin Ozturk

Abstract both normal retinal development and prolifer-

ative ischemic retinopathies.
Retinopathy is the general name for all condi-
tion of the eyes in which blood vessels that Keywords
supply oxygen to the retina are damaged.
Ischemic retinopathies · Succinate · G
These include diabetic retinopathy, retinopa-
protein-coupled receptor GPR91 · Retinal
thy of prematurity, hypertensive retinopathy,
pigment epithelium · Hypoxia
and arteriosclerotic retinopathy. Although the
initial trigger that leads to insufficient perfu-
sion of the retina may be different, once a
critical level of ischemia is achieved, all types
1 Introduction
of retinopathies seem to follow a common
sequence—oxidative stress, followed by
1.1 Role of the Retinal Pigment
hypoxia-induced formation of morphologi-
Epithelium (RPE) in the Eye
cally abnormal vessels. This preretinal vascu-
lar growth is the most severe aspect of the
The retinal pigment epithelium is a monolayer of
retinopathy, as the outcome is often retinal
pigment cells that form a part of the blood/retina
detachment and eventually blindness.
barrier. On the apical side, RPE faces the photo-
Regardless of which therapy strategy is fol-
receptor outer segments, consisting of apical
lowed, a deeper understanding of both normal
microvilli that surround the outer segments and
retinal growth and the underlying molecular
establish a structural complex, and on the baso-
mechanisms of retinopathies is needed in
lateral side RPE faces the Burch’s membrane,
order to come up with more effective thera-
which separates RPE from fenestrated epithelium
pies. This chapter focuses on the citric acid
of the choriocapillaris.
cycle intermediate succinate and its G protein-­
As a layer of pigmented cells, one of the main
coupled receptor SUCNR1 in ischemic reti-
functions of the RPE is to absorb the light energy
nopathies, which were identified as potent
focused by the lens on the retina [1, 2]. The RPE
mediators of vessel growth in the settings of
also facilitates the transport of various molecules
and products between the subretinal space and
the blood. This includes transport of ions, water,
B. E. Ozturk (*) and metabolic end products from the subretinal
Department of Ophthalmology, University of
Pittsburgh, Pittsburgh, PA, USA space to the blood [3, 4]. The RPE takes up nutri-
e-mail: beo20@pitt.edu ents such as glucose, retinol, and fatty acids from

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 527
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_77
528 B. E. Ozturk

the blood and delivers these nutrients to photore- guided by the same family of factors in the body.
ceptors. In addition, the RPE is able to secrete a One of the most important of these factors is the
variety of growth factors helping to maintain the class 3 semaphorins (Sema3). Sema3 has been
structural integrity of choriocapillaris found to regulate several cellular processes
­endothelium and photoreceptors. The secretory including neuronal guidance, endothelial and
activity of the RPE plays an important role in tumor cell survival, apoptosis, and migration [7].
establishing the immune privilege of the eye by Other growth factors that take part in neovas-
secreting immunosuppressive factors. With these cularization of the retina include fibroblast
complex different functions, the RPE is essential growth factor (FGF), hepatocyte growth factor
for visual function. A failure of any one of these (HGF), platelet-derived growth factor (PDGF),
functions can lead to degeneration of the retina, and erythropoietin (EPO) [8]. These findings
loss of visual function, and blindness. together suggested a more collaborative orches-
tration of disease progression where several fac-
tors are interrelated with each other. Therefore,
1.2 Molecular Pathways Involved understanding normal retinal vascular growth
in the Regulation of and understanding the events that lead to the ini-
Vascularization in the Retina tial vascular loss and the subsequent events that
aim to restore the oxygen homeostasis is critical
There are a number of important factors that play for developing new therapeutic approaches to
a role in the progression of oxidative stress-­ cure, or prevent several disorders including dia-
related retinopathies. These factors include vas- betic retinopathy, retinopathy of prematurity,
cular endothelial growth factor (VEGF), hypertensive retinopathy, and age-related macu-
insulin-like growth factor (IGF-1), insulin-like lar degeneration (AMD).
growth factor-binding protein 3 (IGFBP-3),
nitro-oxidative stress, trans-arachidonic acids
(TAAs), semaphorin 3 molecules, Omega-3 lip- 2 Succinate and Its Receptor
ids acting as modulators, and succinate signaling SUCNR1
via its succinate receptor SUCNR1 acting in
neuron-­mediated retinal neovascularization. The retina has high content of polyunsaturated
IGF-1 influences angiogenesis and the devel- fatty acids (PUFA) and has the highest oxygen
opment of retinal neovascularization through uptake and glucose oxidation relative to any other
interaction with locally produced factors such as tissue. This phenomenon renders retina more sus-
VEGF, acting as a permissive factor for maxi- ceptible to oxidative stress. Hypoxia is a well-­
mum VEGF stimulation of angiogenesis [5]. It established modulator of retinal vascularization.
was also demonstrated that low IGF-1 levels in The role of hypoxia inducible factor (HIF) and
serum is associated with retinopathy of prema- the hypoxia response genes including VEGF has
turity (ROP), which is associated with poor ini- been extensively studied in retinopathies.
tial vascular development, indicating that IGF-1 Although hypoxia triggered events have been
might be involved in human angiogenesis [5]. classically considered to depend on pathways
IGF-1, together with basic fibroblast growth involving HIF and VEGF, hypoxia can itself cre-
factor (bFGF), and other growth factors have ate a change in metabolites. Thus, exploring the
also been shown to stimulate DNA synthesis major intermediary energy metabolites is one of
and RPE cell proliferation, and are part of the the several approaches to elucidate the mecha-
repertoire of RPE and neuronal responses to nisms involved in regulating the expression of the
injury [6]. factors mentioned above. Recent studies have
It has been long conceived that vascular and revealed a role for succinate and its receptor
neural networks share architectural commonali- SUCNR1, in vascularization that occurs during
ties and interact physically in the body, and it has development and ischemia, both of which are
been realized that blood vessels and neurons are triggered by tissue hypoxia [9].
Understanding Ischemic Retinopathies: The Role of Succinate and Its Receptor in Retinal Pigment…
Succinate induces a vaso-proliferative
response in the retina by activating its G protein-
coupled receptor, SUCNR1 which was initially
classified as GPR91 [9]. Succinate is normally
present in the mitochondria as part of the tricar-
boxylic acid (Krebs) cycle to produce adenosine
triphosphate (ATP). However, differences or
imbalances between the energy state of cells and
the oxygen and nutrient supply result in the accu-
mulation of succinate in the mitochondria and
subsequent translocation from the mitochondria
to the cytosol, and the extracellular environment.
Succinate is increasingly produced and released
into the extracellular environment during hypoxic
conditions, most likely due to mitochondrial
adaptations to intracellular oxidative stress [10,
11]. The conditions that disrupt the energy and
supply state of the cell include hypoxia, diabetes,
and solid-tumor cancers [12].
Oxidative stress is known to trigger the release
of the citric acid cycle intermediate succinate in a
multitude of disorders [13]. The accumulation of
succinate due to increased reactive oxygen spe-
cies is an indicator of mitochondrial stress, but the
effect of succinate has been largely overlooked up
to date. However, early studies have successfully
demonstrated that even after short episodes of
hypoxia, tissue succinate sharply increases in
many organs while levels of other tricarboxylic
acid intermediates fall [14]. Recently, SUCNR1
was shown to promote neovascularization of the
retina in diabetes mellitus, a disease associated
with oxidative stress, through VEGF [9], which is
also crucial for neovascularization in AMD [15].
So far, several studies have linked increased suc-
cinate levels and consequent SUCNR1 activation
with various diseases ranging from diabetes,
hypertension [11], kidney diseases [11, 16], can-
cer, and retinopathies as well [17].
The expression of SUCNR1 has been demon-
strated in highly vascularized tissues, retinal gan-
glion cells (RGC) and RPE cells [9, 17]. More
importantly, the receptor was found to be
expressed only in the apical membrane of RPE
cells, and not in the basolateral membrane. This
exclusive cellular localization is functionally
important because the apical membrane faces the
neural retina, whereas the basolateral membrane
529
faces choroidal blood. Apical expression of
SUCNR1 therefore suggests that the receptor is
activated by succinate present in the retinal space.
Activation of SUCNR1 by succinate results in the
production and release of several proangiogenic
molecules, including VEGF, angiopoietin-1, and
angiopoietin-2. Levels of succinate increase sig-
nificantly in the retina after ischemic events. Even
though the levels of the receptor do not change,
the increase in the agonist levels ensures that the
downstream pathway is activated, leading to the
secretion of proangiogenic factors, and ultimately,
promotion of neovascularization. This makes
SUCNR1 a potentially interesting drug candidate
for the treatment of ischemic retinopathies.
3 Conclusion, Therapies,
and Prevention
Although ischemic retinopathies come in multi-
ple types and have different origins, their tissue,
cellular, and molecular determinants show clear
similarities. Elucidation of these determinants
may allow the development of novel preventive
therapies or pharmacological cures.
Current prevention methods include ablative
therapies that destroy tissue in the avascular area
of the retina, which also includes cells that gener-
ate VEGF, which promotes aberrant retinal neo-
vascularization. Despite the therapy, however,
visual acuity remains unaffected and peripheral
vision is inevitably lost [2]. Anti-­VEGF therapy
is another strategy to counter ischemic retinopa-
thies. In this therapy, a VEGF-specific neutraliz-
ing antibody is used to attenuate VEGF signaling,
thereby reducing the recurrence rate of preretinal
neovascularization.
Development of preventive and less-­
destructive therapies is needed to better deal with
retinopathies. These therapies should target the
initial stages of the disease, and can include sev-
eral strategies such as restricting tissue oxygen-
ation, nutritional supplements that decrease lipid
peroxidation, administration of EPO and/or
IGF-­ 1, and the use of Omega-3 fatty acids.
Exploring the mechanisms underlying the natural
vascular growth and retinopathies is required in
530
order to develop new and effective preventive
therapies.
Recent studies identified several molecular
mechanisms that contribute to the development of
ischemic retinopathies. New treatment methods are
emerging, and these include therapies directed
against VEGF. However, a better understanding of
how oxygen-induced retinopathies progress
through time, and a much clearer picture of how all
the underlying factors are interrelated during the
course of retinopathies is required before effective
therapies can be developed.
Vascularization is an important process for tis-
sue development and in restoration of damaged
tissues after ischemic injuries. Until recently, the
main focus of many studies about vascularization
was the direct effects of angiogenic growth fac-
tors. Although the central role of VEGF has long
been recognized in ischemic retinopathies, recent
research points to an additive effect of a collec-
tion of factors, both angiogenic (VEGF, IGF, and
EPO) and anti-angiogenic (TSP-1) in nature.
Moreover, other nutritional factors (PUFA) and
oxidative and nitro-oxidative stress-dependent
mediators (TAA) seem to be interrelated with the
factors stated above. The gaps and bridges
between these factors and pathways are only
recently being identified.
Hypoxia-driven succinate and its receptor
SUCNR1 is one such factor that acts as a potent
mediator in retinal angiogenesis, and provides
one of the missing bridges between a hypoxic
retina and the following vascularization pro-
cesses. The recent studies on succinate and its
receptor identified new cellular mechanisms and
signaling pathways that may be very important
in the progression of many diseases in different
organs. Future research on this topic may pro-
vide important information that is clinically
applicable to develop new drugs and diagnostic
approaches.
References
1. Bok D. The retinal pigment epithelium: a versatile
partner in vision. J Cell Sci. 1993;1993:189.
B. E. Ozturk
2. Chen J, Lois AE, Smith EH. Retinopathy of
prematurity.
3. Hamann S. Molecular mechanisms of water transport
in the eye. Int Rev Cytol. 2002;215.
4. Marmor MF, Tan F. Central serous chorioretinopathy:
bilateral multifocal electroretinographic abnormali-
ties. Arch Ophthalmol. 1999;117(2):184–8.
5. Hellstrom A, Perruzzi C, Ju M, Engström E, Hård
A-L, Liu J-L, et al. Low IGF-I suppresses VEGF-­
survival signaling in retinal endothelial cells: direct
correlation with clinical retinopathy of prematurity.
Proc Natl Acad Sci. 2001;98(10):5804–8.
6. Cao W, Li F, Steinberg RH, LaVail MM. Development
of normal and injury-induced gene expression of
aFGF, bFGF, CNTF, BDNF, GFAP and IGF-I in the
rat retina. Exp Eye Res. 2001;72(5):591–604.
7. Klagsbrun M, Eichmann A. A role for axon guidance
receptors and ligands in blood vessel development
and tumor angiogenesis. Cytokine Growth Factor
Rev. 2005;16(4–5):535–48.
8. Gariano RF, Gardner TW. Retinal angiogenesis in
development and disease. Nature. 2005;438:7070.
Available from: https://www.nature.com/articles/
nature04482
9. Sapieha P, Sirinyan M, Hamel D, Zaniolo K, Joyal
J-S, Cho J-H, et al. The succinate receptor GPR91 in
neurons has a major role in retinal angiogenesis. Nat
Med. 2008;14(10):1067–76. Available from: https://
www.nature.com/articles/nm.1873.
10. Weinberg JM, Venkatachalam MA, Roeser NF, Nissim
I. Mitochondrial dysfunction during hypoxia/reoxy-
genation and its correction by anaerobic metabolism
of citric acid cycle intermediates. Proc Natl Acad Sci.
2000;97(6):2826–31. Available from: https://www.
pnas.org/content/97/6/2826.
11. Toma I, Kang JJ, Sipos A, Vargas S, Bansal E,
Hanner F, et al. Succinate receptor GPR91 provides
a direct link between high glucose levels and renin
release in murine and rabbit kidney. J Clin Investig.
2008;118(7):2526–34. Available from: http://www.
jci.org.
12. Hebert SC. Orphan detectors of metabolism. Nature.
2004;429(6988):143–5. Available from: https://www.
nature.com/articles/429143a.
13. Deen PMT, Robben JH. Succinate receptors in
the kidney. J Am Soc Nephrol. 2011;22(8):1416–
22. Available from: https://jasn.asnjournals.org/
content/22/8/1416.
14. Krebs HA. The history of the tricarboxylic acid
cycle. Perspect Biol Med. 1970;14(1):154–72.
Available from: https://muse.jhu.edu/article/405199/
summary.
15. Khandhadia S, Lotery A. Oxidation and age-related
macular degeneration: insights from molecular biol-
ogy. Expert Rev Mol Med. 2010;12:e34. Available
from: https://www.cambridge.org/core/journals/
expert-­r eviews-­i n-­m olecular-­m edicine/article/
oxidation-­a nd-­a gerelated-­m acular-­d egeneration-­
Understanding Ischemic Retinopathies: The Role of Succinate and Its Receptor in Retinal Pigment… 531

insights-­from-­molecular-­biology/1976C60A7D37A4 17. Gnana-Prakasam JP, Ananth S, Prasad PD, Zhang M,

C2AB0C91EE43779D0C.
16. Ariza AC, Deen PMT, Robben JH. The succinate
receptor as a novel therapeutic target for oxidative and
metabolic stress-related conditions. Front Endocrinol.
2012;0(FEB):22.
Atherton SS, Martin PM, et al. Expression and iron-­
dependent regulation of succinate receptor GPR91 in
retinal pigment epithelium. Invest Ophthalmol Vis
Sci. 2011;52(6):3751–8.
 The Amphipathic Helix in Visual
Cycle Proteins: A Review

Sheetal Uppal, Eugenia Poliakov,

Susan Gentleman, and T. Michael Redmond

Abstract 1 Introduction

The visual cycle is a complex biological pro-
cess that involves the sequential action of pro-
teins in the retinal pigment epithelial (RPE)
cells and photoreceptors to modify and shuttle
visual retinoids. A majority of the visual cycle
proteins are membrane proteins, either inte-
gral or peripheral membrane proteins. Despite
significant progress in understanding their
physiological function, very limited structural
information is available for the visual cycle
proteins. Moreover, the mechanism of mem-
brane interaction is not yet clear in all cases.
Here, we demonstrate the presence of an
amphipathic helix in selected RPE visual
cycle proteins, using in silico tools, and high-
light their role in membrane association and
function.
Keywords
Visual cycle proteins · Membrane association ·
Amphipathic helix · Alpha (α)-helix ·
Retinoids · RPE65 · LRAT · RDH5 · CRALBP
S. Uppal · E. Poliakov · S. Gentleman ·
T. M. Redmond (*)
Laboratory of Retinal Cell and Molecular Biology,
National Eye Institute, National Institutes of Health,
Bethesda, MD, USA
e-mail: redmondd@helix.nih.gov
Retinol and its derivatives, collectively termed
retinoids, are highly hydrophobic molecules and
are shielded by several proteins during the visual
cycle process so that they can diffuse freely
between the photoreceptor and retinal pigment
epithelial (RPE) cells [32]. The RPE cells play a
crucial role in the regeneration of the visual chro-
mophore of rhodopsin, 11-cis retinal, thus pro-
viding a continuous supply to the photoreceptors
[31]. In the RPE, the visual cycle proteins
(RPE65, LRAT, CRALBP, and RDHs) are
membrane-­associated to perform their enzymatic
function, i.e., production and transport of 11-cis
retinal to photoreceptors [15, 17, 29, 33]. Recent
progress in the field of structural biology and
improvements in protein crystallization methods
have led to the structural determination of several
visual system proteins; however, the structures of
all the RPE visual cycle components has not been
determined, which impedes our understanding of
their underlying mechanisms of membrane
association.
Several reports have highlighted the role of
amphipathic helices as a membrane recognition
and binding motif in peripheral membrane pro-
teins [2, 6, 18]. By definition, amphipathic heli-
ces are secondary structural motifs that have
hydrophobic and hydrophilic amino acid residues
located on the opposite faces of the α-helix.
Diverse structural and functional roles have been

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 533
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_78
534
identified for membrane-interacting amphipathic
helices, and there are several bioinformatic tools
available, such as the HELIQUEST and 3D-HM
servers, which can predict the amphipathic seg-
ments in a protein sequence and calculate the
magnitude and orientation of the hydrophobic
moment and charge of the helices [5, 25]. Here,
we have examined the RPE-specific visual cycle
proteins using in silico tools to predict the puta-
tive amphipathic α-helix-forming sequences,
including a comparative analysis of their
amphipathic character, and structural visualiza-
tions of the predicted amphipathic helices. This
study will provide a better understanding of the
role of amphipathic α-helices in the mechanisms
of membrane binding of the different RPE-­
specific visual cycle proteins.
2 Materials and Methods
2.1 Amino Acid Sequence
Retrieval and Structure
Visualization
Sequences of RPE-specific proteins (RPE65,
LRAT, CRALBP, and RDHs) were collected
from NCBI (http://www.ncbi.nlm.nih.gov/).
2.2 Prediction for Amphipathic
α-Helix Segments
in the Protein
Both the HELIQUEST (https://heliquest.ipmc.
cnrs.fr/) and EMBOSS:hmoment (https://www.
bioinformatics.nl/cgi-­bin/emboss/hmoment) pro-
grams were employed for prediction and analysis
of segments with a potential for amphipathic
α-helix formation [3, 5]. For prediction, the sliding
window size of 18 amino acid residues and angle
of rotation of 100° (for α-helix) were used. The
sequence with the maximum hydrophobic moment
(μH) was reported for the proteins. Cecropin A,
Cecropin B, and Melittin were used as a reference
for surface proteins [28]. Rhodopsin, containing
seven transmembrane α-helices, was used as a ref-
erence for transmembrane helices [22].
S. Uppal et al.
3 Results
3.1 Retinal Pigment Epithelium-­
Specific 65 kDa (RPE65)
Protein
RPE65 is a non-heme iron-containing metallo-
protein, belonging to the carotenoid cleavage
dioxygenase (CCD) superfamily [14]. It is a reti-
noid isomerase that carries out the important
trans–cis isomerization of retinol step in RPE
cells [12, 20, 23, 24]. Despite the absence of any
hydrophobic transmembrane segments, RPE65
associates with the smooth endoplasmic reticu-
lum (sER) membrane to extract the stored all-­
trans retinyl palmitate and produce 11-cis retinol
[10, 21]. Understanding the mechanism of
RPE65-membrane binding is of utmost important
in the vision field for the development of small-­
molecule therapeutic compounds to treat RPE65-­
associated retinal dystrophies. Several reports
have suggested a role for the crystallographically
unresolved region, comprising of amino acid res-
idues (aa)108–125 together with the palmi-
toylation of the cysteine residue at the 112th
position, as being crucial to membrane associa-
tion of RPE65 protein [14, 16, 34, 35]. Our in
silico analysis reveals that RPE65 is a soluble
protein and that the crystallographically missing
region can form an amphipathic α-helix with the
C112 residue located in the hydrophobic face,
supporting previous observations (Fig. 1). The
predicted amphipathic α-helix of RPE65 is highly
hydrophobic in nature with a high hydrophobic
moment above 0.6, indicating its strong amphipa-
thic character (Table 1).
3.2 Lecithin:Retinol
Acyltransferase
Lecithin:retinol acyltransferase (LRAT) is a
vertebrate-­specific member of N1pc/P60
papain-­like thiol protease protein superfamily
localized in the ER membranes of RPE cells [7].
It is another crucial enzyme in the visual cycle
and catalyzes the esterification of the all-trans
retinol to produce all-trans retinyl esters, mainly
The Amphipathic Helix in Visual Cycle Proteins: A Review 535

Fig. 1 (a) Helical wheel

representations of AH
sequences of RPE-
specific visual cycle
proteins (RPE65, LRAT,
CRALBP, RDH5,
RDH10, and RDH11).
The numbers in
superscripts correspond
to the residue positions
of the predicted AH
motif. (b) Hydrophobic
moment plot for the
predicted AHs where
each point represents an
18-residue α-helix

all-­trans retinyl palmitate, the substrate for
RPE65. Biochemical studies show that it is a
single-pass integral membrane protein with a
C-terminal luminal orientation [19]. The com-
plete three-­dimensional structure of LRAT pro-
tein has not been solved; however, the structure
of a LRAT/HRASLS3 chimeric protein contain-
ing the unique 30 amino acids segment of LRAT
is available, which provides key structural infor-
mation into the function of LRAT. However, the
chimeric protein structure does not contain the
transmembrane C-terminal helical region,
which is proposed to play an important role in
substrate recognition in the phospholipid mem-
brane [7]. We predict that aa179–196 sequence
in the LRAT protein forms an amphipathic
α-helix (Fig. 1 and Table 1). This amphipathic
region is a part of cytoplasmic-facing topologi-
cal domain of LRAT, which might facilitate the
proper positioning of the transmembrane
domain (aa196–215) of LRAT.
3.3 Cellular Retinaldehyde-­
Binding Protein
CRALBP is a soluble 36 kDa retinoid-binding
protein highly expressed in RPE and Muller glial
cells of the retina [1, 26]. The three-dimensional
structure of CRALBP and its interaction with the
ligands has been determined by NMR and X-ray
crystallography [11, 36]. It has a higher binding
affinity for 11-cis retinoids compared to RPE65,
thus allowing the dissociation of 11-cis retinol
from RPE65 and facilitating its oxidation to 11-cis
retinal by retinol dehydrogenases (RDHs)
expressed in RPE. Biochemical and structural
studies revealed that interaction of the holo-­
536 S. Uppal et al.

Table 1 Comparison of the properties of predicted AH motif of RPE-specific visual cycle proteins
No. of Net
amino Residue Hydrophobic Hydrophobicity charge % non-polar % polar
Protein acids positions moment (μH) (H) (z) residues residues
RPE65 533 108–125 0.664 0.568 2 55.56 44.44
LRAT 230 179–196 0.515 0.372 1 55.56 44.44
CRALBP 317 173–190 0.555 0.683 −3 61.11 38.89
RDH5 318 241–258 0.563 0.606 2 55.56 44.44
RDH10 341 71–88 0.427 0.113 −2 33.33 66.67
RDH11 318 301–318 0.465 0.671 −1 61.11 38.89

CRALBP (bound to 11-cis retinal) with the acidic
phospholipids in the membrane bilayer triggers
the release of 11-cis retinal and have identified a
cluster of basic amino acid residues that might
interact with the membrane [27]. Keeping this in
mind, we examined the CRALBP sequence and
found that aa173–190, an α-helical sequence of
residues as determined from the crystal structure,
is predicted to be an amphipathic α-helix with high
hydrophobicity (H) value (Fig. 1 and Table 1).
3.4 Retinol Dehydrogenases
Retinol dehydrogenases (RDHs) are NAD+- or
NADP+-dependent oxidoreductases that belong
to the short-chain dehydrogenases/reductases
(SDRs) superfamily and contain the conserved
super secondary Rossman fold (βαβ) structure
[13, 17]. These enzymes are essential members
of the visual cycle in RPE where they catalyze
the final step, i.e., oxidation of 11-cis retinol to
11-cis retinal. Three RDHs (RDH5, RDH10,
and RDH11) expressed in RPE cells exhibit
11-cis retinol dehydrogenase activity [4, 9, 30].
To date, no structural information is available
for these RDHs and it has been reported that
RDH activity is membrane-associated because
of their high hydrophobic nature. A recent report
demonstrated that the C-terminus of photore-
ceptor RDH8 consists of an amphipathic
α-helical structure that contributes to the mem-
brane binding of RDH8 protein [8]. Our in silico
predictions revealed that all three RPE-
expressed RDHs contain amphipathic α-helices
(AHs) as shown in Fig. 1 and Table 1. We
assume that these AHs might play an important
role in the membrane association of these
RDHs, similar to the situation in RDH8.
4 Discussion
Amphipathic α-helices have gained considerable
attention recently due to their amphiphilic charac-
ter, behaving as a hidden motif in proteins, thus
facilitating binding to membranes. These AHs do
not have any specific signature sequence and exhibit
a wide variation in amino acid composition and
length that provides different interfacial properties
and cellular function. As the RPE-­specific visual
cycle proteins require an interfacial function to
access their substrates directly from the lipid–water
interface, this prompted us to analyze their
sequences for AHs. Our results reveal that predicted
AHs in the RPE-specific visual cycle proteins have
hydrophobic moments similar to AHs from surface-
active peptides and proteins such as the cecropins
and melittin. The seven transmembrane α-helices of
rhodopsin protein have low hydrophobic moment
and high hydrophobicity, which is a typical charac-
teristic for transmembrane AHs. Based on the avail-
able literature for the surface-active AHs, we can
conclude that the predicted AHs of RPE-specific
visual cycle proteins are surface-exposed and may
be involved in the membrane binding of the RPE-
specific visual cycle proteins. We propose that this
study provides a hint toward the role and function of
AHs in visual cycle proteins that should be investi-
gated in further detail.
Acknowledgments This study is supported by the
Intramural Research Program of the National Eye
Institute, NIH.
The Amphipathic Helix in Visual Cycle Proteins: A Review 537

References 18. Liu A, Sui D, Wu D, et al. The activation loop of

PIP5K functions as a membrane sensor essen-
tial for lipid substrate processing. Sci Adv.
1. Bunt-Milam AH, Saari JC. Immunocytochemical
2016;2:e1600925.
localization of two retinoid-binding proteins in verte-
19. Moise AR, Golczak M, Imanishi Y, et al. Topology
brate retina. J Cell Biol. 1983;97:703–12.
and membrane association of lecithin: retinol acyl-
2. Drin G, Antonny B. Amphipathic helices and mem-
transferase. J Biol Chem. 2007;282:2081–90.
brane curvature. FEBS Lett. 2010;584:1840–7.
20. Moiseyev G, Chen Y, Takahashi Y, et al. RPE65 is the
3. Eisenberg D, Weiss RM, Terwilliger TC. The hydro-
isomerohydrolase in the retinoid visual cycle. Proc
phobic moment detects periodicity in protein hydro-
Natl Acad Sci U S A. 2005;102:12413–8.
phobicity. Proc Natl Acad Sci U S A. 1984;81:140–4.
21. Nikolaeva O, Takahashi Y, Moiseyev G, et al. Purified
4. Farjo KM, Moiseyev G, Takahashi Y, et al. The
RPE65 shows isomerohydrolase activity after reas-
11-cis-retinol dehydrogenase activity of RDH10
sociation with a phospholipid membrane. FEBS J.
and its interaction with visual cycle proteins. Invest
2009;276:3020–30.
Ophthalmol Vis Sci. 2009;50:5089–97.
22. Palczewski K, Kumasaka T, Hori T, et al. Crystal
5. Gautier R, Douguet D, Antonny B, et al. HELIQUEST:
structure of rhodopsin: a G protein-coupled receptor.
a web server to screen sequences with specific alpha-­
Science. 2000;289:739–45.
helical properties. Bioinformatics. 2008;24:2101–2.
23. Redmond TM, Yu S, Lee E, et al. Rpe65 is necessary
6. Gimenez-Andres M, Copic A, Antonny B. The many
for production of 11-cis-vitamin a in the retinal visual
faces of amphipathic helices. Biomol Ther. 2018;8.
cycle. Nat Genet. 1998;20:344–51.
7. Golczak M, Sears AE, Kiser PD, et al. LRAT-­
24. Redmond TM, Poliakov E, Yu S, et al. Mutation of
specific domain facilitates vitamin A metabolism
key residues of RPE65 abolishes its enzymatic role as
by domain swapping in HRASLS3. Nat Chem Biol.
isomerohydrolase in the visual cycle. Proc Natl Acad
2015;11:26–32.
Sci U S A. 2005;102:13658–63.
8. Hadicke A, Coutinho A, Roy S, et al. Membrane bind-
25. Reisser S, Strandberg E, Steinbrecher T, et al. 3D
ing properties of the C-terminal segment of retinol
hydrophobic moment vectors as a tool to characterize
dehydrogenase 8. Biochim Biophys Acta Biomembr.
the surface polarity of amphiphilic peptides. Biophys
2021;1863:183605.
J. 2014;106:2385–94.
9. Haeseleer F, Jang GF, Imanishi Y, et al. Dual-
26. Saari JC. Vitamin A metabolism in rod and cone
substrate specificity short chain retinol dehydro-
visual cycles. Annu Rev Nutr. 2012;32:125–45.
genases from the vertebrate retina. J Biol Chem.
27. Saari JC, Nawrot M, Stenkamp RE, et al. Release
2002;277:45537–46.
of 11-cis-retinal from cellular retinaldehyde-binding
10. Hamel CP, Tsilou E, Pfeffer BA, et al. Molecular
protein by acidic lipids. Mol Vis. 2009;15:844–54.
cloning and expression of RPE65, a novel retinal pig-
28. Sato H, Feix JB. Peptide-membrane interactions and
ment epithelium-specific microsomal protein that is
mechanisms of membrane destruction by amphipa-
post-transcriptionally regulated in vitro. J Biol Chem.
thic alpha-helical antimicrobial peptides. Biochim
1993;268:15751–7.
Biophys Acta. 2006;1758:1245–56.
11. He X, Lobsiger J, Stocker A. Bothnia dystrophy is
29. Sears AE, Palczewski K. Lecithin:retinol acyltrans-
caused by domino-like rearrangements in cellular
ferase: a key enzyme involved in the retinoid (visual)
retinaldehyde-­binding protein mutant R234W. Proc
cycle. Biochemistry. 2016;55:3082–91.
Natl Acad Sci U S A. 2009;106:18545–50.
30. Simon A, Hellman U, Wernstedt C, et al. The retinal
12. Jin M, Li S, Moghrabi WN, et al. Rpe65 is the retinoid
pigment epithelial-specific 11-cis retinol dehydro-
isomerase in bovine retinal pigment epithelium. Cell.
genase belongs to the family of short chain alcohol
2005;122:449–59.
dehydrogenases. J Biol Chem. 1995;270:1107–12.
13. Jornvall H, Persson B, Krook M, et al. Short-chain
31. Strauss O. The retinal pigment epithelium in visual
dehydrogenases/reductases (SDR). Biochemistry.
function. Physiol Rev. 2005;85:845–81.
1995;34:6003–13.
32. Szuts EZ, Harosi FI. Solubility of retinoids in water.
14. Kiser PD, Golczak M, Lodowski DT, et al. Crystal
Arch Biochem Biophys. 1991;287:297–304.
structure of native RPE65, the retinoid isomer-
33. Tsilou E, Hamel CP, Yu S, et al. RPE65, the major
ase of the visual cycle. Proc Natl Acad Sci U S A.
retinal pigment epithelium microsomal membrane
2009;106:17325–30.
protein, associates with phospholipid liposomes. Arch
15. Kiser PD, Golczak M, Maeda A, et al. Key enzymes
Biochem Biophys. 1997;346:21–7.
of the retinoid (visual) cycle in vertebrate retina.
34. Uppal S, Poliakov E, Gentleman S, et al. RPE65 pal-
Biochim Biophys Acta. 2012a;1821:137–51.
mitoylation: a tale of lipid posttranslational modifica-
16. Kiser PD, Farquhar ER, Shi W, et al. Structure of
tion. Adv Exp Med Biol. 2019a;1185:537–41.
RPE65 isomerase in a lipidic matrix reveals roles for
35. Uppal S, Liu T, Poliakov E, et al. The dual roles of
phospholipids and iron in catalysis. Proc Natl Acad
RPE65 S-palmitoylation in membrane association
Sci U S A. 2012b;109:E2747–56.
and visual cycle function. Sci Rep. 2019b;9:5218.
17. Lhor M, Salesse C. Retinol dehydrogenases:
36. Wu Z, Yang Y, Shaw N, et al. Mapping the ligand
membrane-bound enzymes for the visual function.
binding pocket in the cellular retinaldehyde binding
Biochem Cell Biol. 2014;92:510–23.
protein. J Biol Chem. 2003;278:12390–6.
 The Retinal Pigment Epithelium:
Cells That Know the Beat!

Elora M. Vanoni and Emeline F. Nandrot

Abstract Keywords

Retinal pigment epithelium · Photoreceptor

The retinal pigment epithelium (RPE) ensures
different functions crucial for photoreceptor
survival, and thus for vision, such as photore-
ceptor outer segments (POS) phagocytosis
and retinal adhesion. Both follow a circadian
rhythm with an activity peak occurring respec-
tively 1.5–2 and 3.5 h after light onset.
Interestingly, we showed that two rodent mod-
els, β5−/− and Prpf31+/− mice, display distinct
alterations in both functions leading to differ-
ent phenotypes. Indeed, the phagocytic peak
totally disappears in β5 knockout mice but is
attenuated and shifted in Prpf31+/− mice.
Conversely, the retinal adhesion peak only
attenuated in β5−/− mice is lost in Prpf31+/−
mice. These distinct alterations have different
consequences on retinal homeostasis propor-
tional to the observed defects: β5−/− mice pro-
gressively lose vision and accumulate RPE
lipofuscin deposits, while Prpf31+/− mice
develop RPE metabolic dysfunctions and
gradual structural modifications indicative of
cellular stress. Hence, animal models are use-
ful to understand the importance of the proper
regulation of these functions.
E. M. Vanoni · E. F. Nandrot (*)
Therapeutics Department, Sorbonne Université,
INSERM, CNRS, Institut de la Vision, Paris, France
e-mail: emeline.nandrot@inserm.fr
outer segments · Phagocytosis · Retinal
adhesion · Metabolism · Circadian clock ·
Beta5 integrin · Prpf31 · Animal models
1 Introduction
Photoreceptor outer segments (POS) are in close
contact with the apical microvilli of the retinal
pigment epithelium (RPE), a monolayer com-
posed of pigmented, bi-nucleated (most often),
and hexagonal-shaped cells in a post-mitotic
state [35]. Each RPE cell apical microvilli closely
interact with around 22–30 photoreceptors (PRs).
The basal side of this epithelium, constituted of
membrane infoldings, faces the Bruch’s mem-
brane and the choroid.
RPE cells ensure crucial functions for PRs
survival and thus for vision, such as light absorp-
tion by melanin pigments, bi-lateral ions, nutri-
ents and trophic factors transport/secretion, and
recycling of visual cycle molecules. Besides,
POS, which have very few detoxification sys-
tems, are constantly submitted to light photons
generating oxidative attacks [43]. To fight these,
POS membranous disks are permanently renewed
and most oxidized POS tips are eliminated daily
by phagocytosis by RPE cells, which are the bus-
iest and biggest phagocytes in the body [16, 44].

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 539
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_79
540
It is important to note that 7–10 days are neces-
sary for full outer segment replacement.
Moreover, the RPE actively participates to retinal
adhesion, ensuring the tightness between RPE
apical microvilli and the full length of POS,
another daily function crucial for PRs survival
[22]. Interestingly, recent studies using different
mouse models have shown that the impact of the
perturbation of these two rhythmic functions can
be very different, allowing us to better under-
stand how RPE cells regulate their activities.
2 POS Phagocytosis
POS continuously submitted to light photons
need to be renewed and their oxidized parts elim-
inated. After their internalization, they are
degraded and components are either recycled in
the cell or returned to PRs. Thus, this function is
primordial for PR survival, retinal homeostasis,
and therefore for vision. In vivo, POS phagocyto-
sis has been described to be a circadian function
with an activity peak 1.5–2 h after light onset for
rods (Fig. 1a) [16, 21]. Indeed, when albino rats
were placed in constant darkness, POS phagocy-
tosis stays synchronized with a slow progressive
shift to a 25 h period, a rhythm typical of circa-
dian activities [16]. Of note, POS phagocytosis is
maintained when the retinohypothalamic tract is
severed, thus confirming the local control of the
rhythmicity of this function [37]. In addition, the
role of the pineal gland has been excluded [36].
The phagocytic machinery is composed of
two main receptors: the αvβ5 integrin and
MerTK, both located at the RPE apical mem-
brane. The αvβ5 integrin is associated with the
extracellular ligand MFG-E8 and is implicated in
POS binding and phagocytosis synchronization
[21, 23]. Its signaling pathways activate MerTK
by phosphorylation via the focal adhesion kinase
(FAK), thus triggering POS engulfment.
Conversely, MerTK and both its cognate
ligands —Gas6 and Protein S— are essential for
POS internalization in the RPE [4, 7, 9, 20, 42].
Previously, our team showed that MerTK expres-
sion levels change over time in RPE cells and
increase after the phagocytic peak, a time during
which MerTK receptors are used extensively
E. M. Vanoni and E. F. Nandrot
[17]. MerTK also controls the number of POS
bound to αvβ5 integrin receptors that can be
engulfed, possibly by the cleavage of its extracel-
lular domain [17, 24]. Gas6 and Protein S,
required for MerTK dimerization, activate and
inhibit phagocytosis, respectively, hence regulat-
ing MerTK activity [17].
Moreover, RCS (Royal College of Surgeons)
rats, bearing a genomic deletion encompassing
MerTK, display a total absence of POS phagocy-
tosis [4]. The lack of MerTK causes severe reti-
nal dystrophies in rodents (retinitis pigmentosa)
as well as in humans (rod-cone dystrophies with
an early macular implication), highlighting the
importance of POS phagocytosis for global reti-
nal health [1, 7, 9, 13, 20, 25, 40]. However, the
absence of integrin receptors leads to a totally
different phenotype. Indeed, β5−/− mice have
been studied to evaluate the effect of αvβ5
absence on both retina and RPE, β5 only associ-
ating with αv subunits and αvβ5 being solely
expressed at the RPE apical surface [11, 21]. The
absence of αvβ5 integrin receptors directly
impacts phagocytosis with a 75% decrease in
RPE primary cultures (Fig. 1a). Besides, the
phagocytic peak observed in wild-type (WT)
control mice, as well as associated FAK and
MerTK phosphorylation, totally disappears in
β5−/− mice and is replaced by a steady-state level
of activity (Fig. 1a).
We also studied the phagocytic profile of
Prpf31+/− mice, a model developed to understand
the pathogenesis of the second cause of autoso-
mic dominant retinitis pigmentosa linked to
mutations in the Pre-mRNA Processing Factor
genes family, including PRPF31 (RP11) [6, 10,
14]. The decrease in Prpf31 expression levels
leads to a 40% phagocytosis defect in RPE pri-
mary cultures (Fig. 1b). Interestingly, a similar
40% decrease is observed in a shRNA-treated
human (ARPE-19) and rat (unpublished data)
RPE cell lines, as well as in RPE cells derived
from induced pluripotent stem cells (RPE-iPSC)
from RP11 patients, thus confirming that analo-
gous mechanisms occur between species [10,
27]. Interestingly, mutation correction using the
CRISPR-Cas9 technology restores a normal
phagocytosis ratio similar to WT RPE-iPSC [27].
However, in contrast to what is observed in β5−/−
The Retinal Pigment Epithelium: Cells That Know the Beat!
Fig. 1 RPE circadian dysfunctions and associated pheno-
types in two mouse models. (a) An ~75% phagocytosis
decrease was detected in β5−/− RPE primary cultures (top-­
left panel). The phagocytic peak occurs 2 h after light
onset in WT mice (blue bars, WT) and totally disappears
in β5−/− mice (red bars, MUT) (top-right panel). Retinal
adhesion is attenuated in β5−/−mice (grey bars, MUT)
when compared to WT mice (black bars, WT) (bottom-­
left panel). The phagocytic peak is indicated with dashed
bars. β5−/− RPE cells accumulate autofluorescent deposits
(red) in contrast to WT RPE (bottom-right panel). RPE
nuclei are in blue. (b) An ~40% phagocytosis decrease
was detected in Prpf31+/− RPE primary cultures (top-left
panel). Circadian rhythms of both POS phagocytosis (top-­
mice, the phagocytic peak is still present but
attenuated and starting earlier (Fig. 1b) [10].
Thus, the phagocytic rhythmicity is disrupted in
Prpf31+/− mice, but in a different manner.
Interestingly, our team also demonstrated defects
in the localization of some of the receptors
involved in POS phagocytosis, including β5 inte-
grin receptors and their ligands MFG-E8 [10].
3 Retinal Adhesion
With their extended apical microvilli, RPE cells
maintain at all time close contacts with POS
referred to as retinal adhesion, which is of the
utmost importance to guarantee the feeding and
trash disposal, as well as overall homeostasis of
541
right panel) and retinal adhesion (bottom-left panel) were
disrupted in Prpf31+/− mice (white bars, MUT) when
compared to wild-type (black bars, WT). RPE ultrastruc-
ture abnormalities were observed by electron microscopy
in 18-month-old mutants (bottom-right panel, MUT) that
are absent in wild-type controls (WT). Modified from ©
[21], © [22], © [10], and © [14]; originally published in
(a) Journal of Experimental Medicine, https://doi.
org/10.1084/jem.20041447 and American Journal of
Physiology Cell Physiology, https://doi.org/10.1152/ajp-
cell.00480.2005, and (b) The American Journal of
Pathology, https://doi.org/10.1016/j.ajpath.2014.06.026
and Investigative Ophthalmology and Vision Science,
https://doi.org/10.1167/iovs.10-­5194, respectively.
PRs. Interestingly, retinal adhesion also follows a
circadian activity with a peak occurring 1.5 h
after the phagocytic peak [22]. Integrins also
being adhesive receptors, we wondered if the
αvβ5 integrin would participate in the process. To
evaluate retinal adhesion, we mechanically sepa-
rate the RPE from the retina and quantify the
transfer of RPE melanin pigments and RPE-­
specific RPE65 proteins onto the retina, which
translates the strength of RPE-POS attachment
[22].
β5−/− retinae display significantly less melanin
pigments at all studied timepoints and more par-
ticularly at the time when retinal adhesion peaks,
thus implying a crucial role of αvβ5 integrin
receptor in retinal adhesion (Fig. 1a) [22].
Moreover, retinal adhesion decreases with age
542
and the absence of β5 integrin receptors seems to
accelerate this process. These results confirm the
implication of αvβ5 integrin in retinal adhesion.
However, no retinal adhesion difference being
observed in mice lacking the MFG-E8 phago-
cytic ligand, hence the corresponding adhesion
ligand/s remain/s unknown at the present time
[23]. Interestingly, the adhesion peak disappears
in Prpf31+/− mice but the function remains nor-
mal the rest of the time (Fig. 1b) [10].
4 Potential Link
with the Intracellular
Circadian Clock
As RPE cells display several circadian-regulated
functions, the question is open as to what extent
they are related to the RPE intracellular clock.
Indeed, the RPE and the retina have been
described to act as peripheral clocks in relation
with the suprachiasmatic nuclei (SCN) of the
hypothalamus. Unlike the other peripheral
clocks, retinal photoreceptors synchronize the
central circadian clock by receiving and transmit-
ting the light information via the retinohypotha-
lamic tract [31]. In addition, the rd mouse model
characterized by an early rod photoreceptors
degeneration displays arrhythmic melatonin syn-
thesis after the degeneration, confirming the role
of photoreceptors as a peripheral clock [38]. In
addition to photoreceptors, it has been shown that
the mouse inner nuclear layer —one of the retinal
layers consisting of the bipolar, horizontal, and
amacrine cells— can also be considered as an
autonomous circadian clock [29]. At the RPE
level, a human cell line (HRPE) shows a circa-
dian rhythmic expression of PER1 and PER2
clock genes [26]. In addition, PER2::LUC RPE
cells continue to show a circadian rhythm of bio-
luminescence production after SCN lesions iso-
lating them from the central clock [2]. Recently,
a study showed that the transport of lactate to PRs
was under RPE circadian clock control [19].
The circadian clock is a transcriptional feed-
back loop composed of three main components:
an activator complex, a repressor complex, and a
secondary transcriptional loop [5, 8, 28]. The
E. M. Vanoni and E. F. Nandrot
activator complex includes Clock (Circadian
locomotor output cycles kaput), Bmal1 (Brain
and muscle ARNT-like protein 1), and Npas2
(Neuronal PAS domain protein 2), while Per1–3
(Period) and Cry1–2 (Cryptochrome) belong to
the repressor complex. The secondary transcrip-
tional loop is constituted of Rev-Erbα (also
known as Nr1d1, nuclear receptor subfamily 1
group D member 1) and Rorα-γ (RAR-related
orphan receptors). Other external proteins regu-
late the whole machinery such as DEC2 or
TWIST1 [18, 32].
As both POS phagocytosis and retinal adhe-
sion circadian rhythmicities are altered in
Prpf31+/− mice (Fig. 1b) [10], we hypothesized
that the RPE circadian clock might be disrupted
in this mouse model. Indeed, the circadian clock
is implicated in the pathogenesis of various dis-
eases such as Alzheimer’s disease, cancers,
hypertension, diabetes or obesity [3, 30, 34].
Interestingly, circadian clock disruptions have
been increasingly suggested to lead to some ocu-
lar diseases like glaucoma [39]. In addition, a
very recent study showed that Prpf8−/− mice dis-
play lengthened daily locomotor activity periods
and disruption of some clock genes expression
patterns, reinforcing the hypothesis of more cen-
tral intracellular clock defects [33]. We have been
studying the expression levels of RPE circadian
clock genes and proteins along the light:dark
cycle in Prpf31+/− mice. Our current unpublished
data suggest that circadian clock components
expression defects exist in mutant RPE compared
to control tissues. In vitro data also confirm that
disruption of the circadian clock by siRNA
silencing directly impacts RPE phagocytic
capacities.
5 Phenotypes Linked
to Deregulated Circadian
Functions
POS phagocytosis and retinal adhesion deregula-
tions are associated with some RPE structural
defects in both β5−/− and Prpf31+/− mice (Fig. 1a,
b) [10, 21]. Indeed, wide-field microscopy exper-
iments showed that aged β5−/− RPE cells contain
The Retinal Pigment Epithelium: Cells That Know the Beat!
much higher numbers of vesicular autofluores-
cent storage bodies suggestive of lipofuscin accu-
mulation in contrast to WT tissues (Fig. 1a) [21].
This is associated with gradual loss of electroret-
inogram responses with time, but no photorecep-
tor degeneration is observed. Additionally,
perturbation of the mitochondrial respiration and
ATP production are detected in freshly dissected
RPE/choroid tissues (unpublished data). On the
other hand, Prpf31+/− RPE cells display gross
ultrastructural defects with age, namely basal
infoldings thickening and cytoplasmic vacuoles
accumulation (Fig. 1b) [14]. These results sug-
gest the presence of cellular stress in RPE cells.
Our recent studies do show an increase in protein
and lipid oxidation with age associated with pro-
teasome activation, a sign of endoplasmic reticu-
lum stress. In young adults, we observe
mitochondrial defects and decreased energy pro-
duction from various cellular sources. Indeed, the
bioenergetic health index is modified and
Prpf31+/− RPE/choroid samples shift their status
from quiescent to energetic with age, whereas
WT samples remain glycolytic. However, we
detect neither peritoneal macrophages nor whole
body metabolism defects in mutant mice, con-
firming the tissue-specificity of the phenotype
already showed for the phagocytic defect.
6 Conclusion and Perspectives
The alteration of the rhythmicity of two circadian
functions in Prpf31+/− suggests a potential altera-
tion of the RPE circadian clock in this mouse
model [10]. Our current unpublished results seem
to confirm this hypothesis, and also show that cir-
cadian clock alterations directly impact POS
phagocytosis in vitro. Our ongoing experiments
aim at identifying if these effects are linked to
subcellular mislocalization of the circadian clock
members or altered transcription of their target
genes. This reinforces the link between the circa-
dian clock and ocular diseases that has already
been shown, and there might be some other reti-
nal activities related to the circadian clock that
have not been discovered yet [39].
β5−/− and Prpf31+/− mice both display POS
phagocytosis and retinal adhesion defects [10,
543
21, 22]. However, the phagocytosis decrease is
more important in β5−/− RPE primary cultures
and the rhythmicity of both functions is altered
differently. In addition to RPE functional defects,
both mutant mouse models display RPE struc-
tural defects. While β5−/− RPE cells defects
resemble some of AMD cardinal signs, Prpf31+/−
RPE cells show more widespread ultrastructural
defects indicative of cellular stress [14]. Indeed,
our unpublished data demonstrate overall pertur-
bated RPE energetic metabolism in Prpf31+/− at
an early age that is tissue-specific. Implication of
the mitochondrial and energetic metabolism in
RPE phagocytosis and in aging diseases such as
AMD is becoming more widespread and animal
models can prove being useful to identify cellular
targets and molecular mechanisms underlying
the different steps of pathological development
[12, 15, 41].
References
1. Audo I, Mohand-Said S, Boulanger-Scemama E, et al.
MERTK mutation update in inherited retinal diseases.
Hum Mutat. 2018;39(7):887–913.
2. Baba K, Sengupta A, Tosini M, et al. Circadian
regulation of the PERIOD2::LUCIFERASE biolu-
minescence rhythm in the mouse retinal pigment
epithelium-­choroid. Mol Vis. 2010;16:2605–11.
3. Bao AM, Swaab DF. The human SCN in health and
neuropsychiatric disorders: postmortem observations.
In: Gumz ML, editor. Physiology in health and dis-
ease “Circadian clocks: role in health and disease”.
New York: Springer; 2016. p. 117–52.
4. Bok D. The role of the pigment epithelium in the eti-
ology of inherited retinal dystrophy in the rat. J Cell
Biol. 1985;49:664–82.
5. Brown SA. Circadian clock-mediated control of stem
cell division and differentiation: beyond night and
day. Development. 2014;141(16):3105–11.
6. Bujakowska K, Maubaret C, Chakarova CF, et al.
Study of gene-targeted mouse models of splicing fac-
tor gene Prpf31 implicated in human autosomal domi-
nant retinitis pigmentosa (RP). Invest Opthalmol Vis
Sci. 2009;50:5927.
7. Burstyn-Cohen T, Lew ED, Través PG, et al. Genetic
dissection of TAM receptor-ligand interaction in
retinal pigment epithelial cell phagocytosis. Neuron.
2012;76:1123–32.
8. Chiou Y-Y, Yang Y, Rashid N, et al. Mammalian
period represses and de-represses transcription by
displacing CLOCK-BMAL1 from promoters in a
cryptochrome-dependent manner. Proc Natl Acad Sci
U S A. 2016;113(41):E6072–9.
544
9. D’Cruz PM, Yasumura D, Weir J, et al. Mutation
of the receptor tyrosine kinase gene Mertk in
the retinal dystrophic RCS rat. Hum Mol Genet.
2000;9(4):645–51.
10. Farkas MH, Lew DS, Sousa ME, et al. Mutations
in pre-mRNA processing factors 3, 8, and 31 cause
dysfunction of the retinal pigment epithelium. Am J
Pathol. 2014;184:2641–52.
11. Finnemann SC, Bonilha VL, Marmorstein AD, et al.
Phagocytosis of rod outer segments by retinal pig-
ment epithelial cells requires αvβ5 integrin for bind-
ing but not for internalization. Proc Natl Acad Sci.
1997;94:12932–7.
12. Fisher CR, Ferrington DA. Perspective on AMD
pathobiology: a bioenergetic crisis in the RPE. Invest
Ophthalmol Vis Sci. 2018;59(4):AMD41–7.
13. Gal A, Li Y, Thompson DA, Weir J, et al. Mutations
ins MERTK, the human orthologue of the RCS rat
retinal dystrophy gene, cause retinitis pigmentosa.
Nat Genet. 2000;26(3):270–1.
14. Graziotto JJ, Farkas MH, Bujakowska K, et al. Three
gene-targeted mouse models of RNA splicing factor
RP show late-onset RPE and retinal degeneration.
Invest Opthalmol Vis Sci. 2011;52:190–8.
15. Klipfel L, Cordonnier M, Thiébault L, et al. A splice
variant in SLC16A8 gene leads to lactate transport
deficit in human iPS cell-derived retinal pigment epi-
thelial cells. Cells. 2021;10(1):179.
16. LaVail MM. Rod outer segment disk shedding in
rat retina: relationship to cyclic lighting. Science.
1976;194:1071–4.
17. Law A-L, Parinot C, Chatagnon J, et al. Cleavage of
Mer tyrosine kinase (MerTK) from the cell surface
contributes to the regulation of retinal phagocytosis.
J Biol Chem. 2015;290:4941–52.
18. Meier D, Lopez M, Franken P, et al. Twist1 is a TNF-
inducible inhibitor of clock mediated activation of
period genes. PLoS One. 2015;10(9):e0137229.
19. Milićević N, Ten Brink JB, Ten Asbroeck ALMA,
et al. The circadian clock regulates RPE-mediated
lactate transport via SLC16A1 (MCT1). Exp Eye Res.
2020;190:107861.
20. Nandrot E, Dufour EM, Provost AC, et al.
Homozygous deletion in the coding sequence of the
c-mer gene in RCS rats unravels general mecha-
nisms of physiological cell adhesion and apoptosis.
Neurobiol Dis. 2000;7:586–99.
21. Nandrot EF, Kim Y, Brodie SE, et al. Loss of syn-
chronized retinal phagocytosis and age-related
blindness in mice lacking αvβ5 integrin. J Exp Med.
2004;200:1539–45.
22. Nandrot EF, Anand M, Sircar M, et al. Novel
role for alphavbeta5-integrin in retinal adhesion
and its diurnal peak. Am J Physiol Cell Physiol.
2006;290(4):C1256–62.
23. Nandrot EF, Anand M, Almeida D, et al. Essential
role for MFG-E8 as ligand for αvβ5 integrin in
E. M. Vanoni and E. F. Nandrot
diurnal retinal phagocytosis. Proc Natl Acad Sci.
2007;104:12005–10.
24. Nandrot EF, Silva KE, Scelfo C, et al. Retinal pigment
epithelial cells use a MerTK-dependent mechanism to
limit the phagocytic particle binding activity of αvβ5
integrin. Biol Cell. 2012;104:326–41.
25. Parinot C, Nandrot EF. A comprehensive review of
mutations in the MERTK proto-oncogene. Adv Exp
Med Biol. 2016;854:259–65.
26. Pavan B, Frigato E, Pozzati S, et al. Circadian
clock regulate adenylyl cyclase activity rhythms in
human RPE cells. Biochem Biophys Res Commun.
2006;350(1):169–73.
27. Rodrigues A, Slembrouck-Brec A, Nanteau C, et al.
Modeling PRPF31 retinitis pigmentosa using reti-
nal pigment epithelium and organoids combined
with gene augmentation rescue. NPJ Regen Med.
2022;7(1):39.
28. Ruan G-X, Zhang D-Q, Zhou T, et al. Circadian orga-
nization of the mammalian retina. Proc Natl Sci U S
A. 2006;103(25):9703–8.
29. Ruan G-X, Allen GC, Yamazaki S, et al. An autono-
mous circadian clock in the inner mouse retina by
dopamine and GABA. PLoS Biol. 2008;6(10):e249.
30. Rudic. Circadian rhythms and the circadian clock
in the cardiovascular system. In: Gumz ML, editor.
Physiology in health and disease “Circadian clocks:
role in health and disease”. New York, NY: Springer;
2016. p. 199–224.
31. Sadun AA, Schaechter JD, Smith LE. A retinohypo-
thalamic pathway in man: light mediation of circadian
rhythms. Brain Res. 1984;302(2):371–7.
32. Sato F, Kohsaka A, Bhawal UK, et al. Potential
Roles of Dec and Bmal1 Genes in Interconnecting
Circadian Clock and Energy Metabolism. Int J Mol
Sci. 2018;19(3):781.
33. Shakhmantsir I, Dooley SJ, Kishore S. RNA splic-
ing factors mutations that cause retinitis pigmentosa
result in circadian dysregulation. J Biol Rhythm.
2020;35(1):72–83.
34. Situala S, Amador A, Burris TP. The circadian clock
as a drug target. In: Gumz ML, editor. Physiology
in health and disease “Circadian clocks: role in
health and disease”. New York, NY: Springer; 2016.
p. 335–66.
35. Strauss O. The retinal pigment epithelium in visual
function. Physiol Rev. 2005;85:845–81.
36. Tamai M, Teirstein P, Goldman A, et al. The
pineal gland does not control rod outer segment
shedding and phagocytosis in the rat retina and
pigment epithelium. Invest Ophthalmol Vis Sci.
1978;17(6):558–62.
37. Teirstein PS, Goldman AI, O’Brien PJ. Evidence
for both local and central regulation of rat rod outer
segment disc shedding. Invest Ophthalmol Vis Sci.
1980;19(11):1268–73.
The Retinal Pigment Epithelium: Cells That Know the Beat!
38. Tosini G, Menaker M. The clock in the mouse retina:
melatonin synthesis and photoreceptor degeneration.
Brain Res. 1998;789(2):221–8.
39. Tosini G, Pozdeyev N, Sakamoto K, et al. The cir-
cadian clock system in the mammalian retina.
BioEssays. 2008;30(7):624–33.
40. Tschernutter M, Jenkins SA, Waseem NH, et al.
Clinical characterisation of a family with retinal dys-
trophy caused by mutation in the Mertk gene. Br J
Ophthalmol. 2006;90(6):718–23.
41. Vives-Bauza C, Anand M, Shiraz AK, et al. The age
lipid A2E and mitochondrial dysfunction synergisti-
545
cally impair phagocytosis by retinal pigment epithelial
cells. J Biol Chem. 2008;283(36):24770–80.
42. Vollrath D, Feng W, Duncan JL, et al. Correction of
the retinal dystrophy phenotype of the RCS rat by
viral gene transfer of Mertk. Proc Natl Acad Sci U S
A. 2001;98(22):12584–9.
43. Winkler BS. An hypothesis to account for the renewal
of outer segments in rod and cone photoreceptor cells:
renewal as a surrogate antioxidant. Invest Ophthalmol
Vis Sci. 2008;49:3259–61.
44. Young RW, Bok D. Participation of the retinal pig-
ment epithelium in the rod outer segment renewal pro-
cess. J Cell Biol. 1969;42:392–403.
 Part XIII
Stem Cell Models and Therapies
 Retinal Organoids: A Human
Model System for Development,
Diseases, and Therapies
Sangeetha Kandoi and Deepak A. Lamba
Abstract
Inherited retinal degenerations (IRD) encom-
passes a group of heterogeneous disorders
causing debilitating visual diseases and blind-
ness, affecting more than two million people
worldwide, in all age groups. The inheritance
patterns vary from autosomal dominant, auto-
somal recessive, X-linked, and sporadic with
mutations in over 260 genes identified to date.
Despite the significant advances in clinical
diagnosis, there is no effective treatment avail-
able. Human-induced pluripotent stem cells
(hiPSC) derived in vitro 3D retinal organoids
offer a powerful preclinical tool to investigate
the molecular mechanism(s) of inherited dis-
eases. Organoids have the potential for the
development of personalized therapies by
modeling the disease-specific and patient-­
specific IRD. This mini-review will elaborate
on the utility of the advanced culture model
system by focusing on staging the in vitro
human retinogenesis, modeling retinal dis-
eases, and as a tool for testing potential thera-
S. Kandoi (*) · D. A. Lamba
Department of Ophthalmology, University of
California San Francisco, San Francisco, CA, USA
Eli & Edythe Broad Center for Regeneration
Medicine and Stem Cell Research, University of
California San Francisco, San Francisco, CA, USA
e-mail: sangeetha.kandoi@ucsf.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_80
peutic approaches to restore or prevent vision
loss in affected individuals.
Keywords
Stem cells · Organoids · Mini-retinas ·
Inherited retinal degenerations · Disease-­
modeling · Precision medicine
1 Introduction
Embryonic stem cells and human-induced plu-
ripotent stem cells (hiPSC) are pluripotent stem
cell populations that have the capacity to gener-
ate cell types from all three germ layers (ecto-
derm, endoderm, and mesoderm). As opposed to
the conventional two-dimensional monolayer
cell cultures, which are immortalized and often
limited by the scarcity of primary tissues, iPSCs
can be established from any somatic cell source
and age groups [19]. Human organoids derived
from iPSC are defined as three-dimensional (3D),
self-organized, genetically stable in vitro tissues.
They are composed of heterogeneous cell types
along with adhesion proteins to provide struc-
tural support. They are also called “mini-organs”
that have been widely used to study the molecu-
lar mechanism(s), including the signals that are
needed in the development and maintenance of
any organ and for disease modeling [5].
Remarkably, they can model a complex tissue’s
549
550
architecture with the temporal and spatial
arrangement of cell types, thereby mimicking the
physiologically milieu that exists in vivo. The
development of organoid technology represents a
promising platform to overcome the drawbacks
of traditionally used cell lines and the historically
reliant animal models, which do not always effec-
tively recapitulate human physiology and dis-
eases. Lately, organoids have become mainstream
in vitro tools, highlighting their value for basic
biological research and numerous clinical appli-
cations including precision medicine, regenera-
tive medicine, biobanking, and high-throughput
toxicology studies.
2 Retinal Organoids:
“Mini-retinas”
The generation of iPSCs and their directed dif-
ferentiation to organoids has meant that the ana-
tomical development and the regulatory networks
that drive the formation of this scarcely available
human retinal tissue can now be studied “in a
dish.” The complex process of retinogenesis
involves three sequential processes: (i) specifica-
tion of the eye field, (ii) morphogenesis of the
optic cup, and (iii) differentiation to the different
retinal cell types [21]. Apart from the pioneering
work carried out by Yoshiki Sasai [9], a number
of groups have also shown that the retinogenesis
timeline in vitro through iPSC-derived retinal
organoids faithfully matches that of in vivo.
There are multiple protocols available in the lit-
erature for the differentiation of fully matured
laminated retinal organoids [3, 22, 25]. The most
commonly adopted culture scheme is using a
combination of 2D/3D approaches. A representa-
tive bright-field microscopy images of a matured
retinal organoid from hiPSC is shown in Fig. 1.
Differentiation of seven classes of postmitotic
retinal cell types (recognized by their markers)
progresses with the birth-dating similar to the
human retina in utero. The developmental order
begins with birth of ganglion cells (BRN3) at day
30; horizontal cells (LHX1, ONECUT1), cone
photoreceptors (OTX2, RCVRN, RXRG), and
amacrine cells (HuC/D) at days 40–70; rod photo-
S. Kandoi and D. A. Lamba
receptors (NRL, NR2E3 ) and bipolar cells (VSX1)
at days 90–150; and lastly Müller glial cells
(RLBP1, GS) by days 160–200. Maturation of
photoreceptors shows as brush-like projections
which are indicative of inner and outer segments
(containing opsins) on the laminated retina,
and occurs between days 160 and 200. This long
culture process of maintaining the “viable” organ-
oids is done with minimal manipulation. Recent
progress has been made in the construction of a
multi-organoid culture system termed “assemb-
loid,” a fusion of retinal and brain organoids. This
has the potential to enable us to study connectiv-
ity, ganglion cell axon guidance, and transmission
of visual signals from the developing eye to the
brain [10].
Staging cell types across the different devel-
opmental stages of retinal organoids have become
relatively easy with a range of techniques avail-
able. Some commonly utilized ones include
immunohistochemistry (IHC), quantitative real-­
time polymerase chain reaction (qRT-PCR), bulk
RNA sequencing, and transmission electron
microscopy (TEM). More recently, transcrip-
tomic signatures and gene regulatory networks
associated with cell types during organoid devel-
opment and comparison to human fetal tissue
have provided powerful insights using deep-­
sequencing techniques at the single-cell level
(scRNAseq) [24].
Retinal organoids, although a powerful
in vitro model for the human neural retina, have
some key components missing. Lack of orga-
nized accessory tissues and nonneural cell types,
such as vasculature, macula, fovea (cone-rich
central region of the retina), and immune cells
(such as microglia), remains a caveat in this
model. Lack of oxygen and nutrient diffusion
deficiency at the interior of the retinal organoids
affects the local microenvironment, increasing
the necrosis of early-differentiated ganglion
cells. Additionally, the well organized monolay-
ered retinal pigmented epithelium (RPE), which
physically interfaces and supports photoreceptor
function in vivo, is lacking in the retinal organ-
oids. RPE instead grows as a separate ectopic
patch of tissue adhering to one corner in the
­retinal organoid. While these challenges are not
Retinal Organoids: A Human Model System for Development, Diseases, and Therapies
hiPSC
Neural Induction Medium
2D 3D 2D
D0 D7
A B C D
Fig. 1 Schematic timeline, culture conditions, and the
representative bright-field microscopic images of
3D-retinal organoids differentiated from hiPSC using a
combination of 2D/3D approach. Undifferentiated hiPSC
(a) directed toward retinal fate using step-wise protocol to
insurmountable, they require further optimiza-
tion in the culture conditions.
3 Modeling Inherited Retinal
Degenerations Using Retinal
Organoids
Retinal degenerations include a group of hetero-
geneous diseases ranging from monogenic inher-
ited Retinitis Pigmentosa (RP), Leber congenital
amaurosis (LCA), and Cone-rod dystrophy (CRD)
to genetically complex age-related macular
degenerations (AMD). Significant advances have
been made to identify the cause of inherited reti-
nal degenerations (IRD) in patients using genetic
testing, whole-genome sequencing, and next-gen-
eration sequencing [8]. Mutation in over 260
genes has been identified to be the causative fac-
tor for the death of retinal neurons and RPE lead-
ing to progressive irreversible vision loss
(peripheral and central) and eventual blindness in
all age groups [1]. Many of these mutations are
located on the genes that encode the sensory
regions of the photoreceptors and can be feasibly
modeled using retinal organoids. These mutations
causes abnormal development of photoreceptors,
defects in the phototransduction mechanisms,
endoplasmic reticulum stress, protein mis-traf-
551
Retinal Differentiation
Retinal Induction Medium 3D-Retinal Induction Medium
3D
D25-28 D30 D180-200
E
F
generate self-forming embryoid bodies (b), embryoid
bodies with optic vesicles and cup-like structures (c),
laminated 3D-organoids (d), and organoids with fully
matured photoreceptors (e and f) displaying outer seg-
ments on the periphery/apical side of the organoids
ficking, and impairment of ciliary function lead-
ing to the degeneration of rods and cones.
Differentiation of iPSCs lines engineered with
a disease-specific mutation, or a patient’s own
iPSC’s line, into retinal organoids can be used to
decipher the molecular mechanisms and provide
clues into the pathogenesis of IRD. Studying the
pathophysiology of IRD using retinal organoids
has been particularly useful over animal models
as organoids mimic the human cellular composi-
tion, associates the phenotypes with patient phe-
notypes, and aid in understanding the disease
modifiers in the patient’s genome. Some of the
most recent IRDs, modeled using patient iPSC-­
derived retinal organoids carrying the specific
mutation candidates, are shown in Table 1. While
retinal organoids have been very useful for mod-
eling early-onset IRDs, a key challenge of retinal
organoid technology is the difficulty in modeling
late-onset diseases where patient’s phenotypes
appear in later decades of life. However, compar-
ing the patient organoids with the control organ-
oids can still provide some insights into the
mechanistic understanding of pathogenesis.
Finally, modeling of complex disorders like
AMD still remains challenging due to the involve-
ment of genetic components, aging-associated
risk factors, and external environmental factors
that contribute to the disease mechanisms.
552 S. Kandoi and D. A. Lamba

Table 1 Patient-specific retinal organoids derived from various IRD for studying the mutation-specific phenotypes and
various therapeutic approaches tested in some studies
Inheritance Therapeutic
IRD Genes (mutation) pattern Retinal organoid phenotype intervention References
RP RP2 (RP2KO, X-linked Rod PR death (D150) and AAV gene Lane et al.
R120X) outer nuclear layer thinning augmentation [16]
(D180)
RP PDE6B Autosomal Elevated cGMP levels, – Gao et al.
recessive impaired synaptic [11]
connections and connecting
cilium in PR (D193, D230)

RP RPGR (frame-shift – Shortened cilium. Defects CRISPR-Cas9-­ Deng et al.

mutation) in PR (morphology, mediated [6]
localization, transcriptional correction
profiling, and
electrophysiological
activity)
LCA4 AIPL1 (Cys89Arg) – Low expression of AIPL1 – Lukovic
and PDE6alpha (weeks 21 et al. [18]
and 27)
LCA7 CRX (I138fs48, Autosomal Defective PR maturation AAV gene Kruczek
K88N) dominant and diminished expression augmentation et al. [14]
of visual opsins
LCA7 CRX (T155ins4, Autosomal Immature PRs (D180) Allele-specific Chirco
K88Q) dominant CRISPR/ et al. [4]
Cas9-based gene
editing
LCA10 CEP20 Autosomal Defective PR ciliation QR-110 (RNA Dulla et al.
(c.2991+1655A>G) recessive oligonucleotide) [7]
Achromatopsia ATF6 (biallelic – Do not form cone structures Small molecule Kroeger
variants—Y567N and and lack cone opsins ATF6 agonist, et al. [13]
R324C) AA147

4 Therapeutic Approaches ferentiating cultures [15]. Additionally, targeting

Using Retinal Organoids
Massive efforts are being made to utilize this
unique human model system for validating a
panel of therapeutic interventions. Some of these
include cell transplantation, small molecule
screening, antisense oligonucleotides, and
genome editing technologies. Since several IRD
primarily affects the postmitotic light-sensing
photoreceptors, transplanting the iPSC differenti-
ated photoreceptor precursors in the animal mod-
els with dysfunctional/lost photoreceptors has
been shown to rescue some level of vision [2,
17]. Genetically engineered hiPSC lines with
single or multiple fluorescent constructs (green
fluorescent protein (GFP) or mCherry) driven by
cell type-specific promotors (e.g., OTX2 or CRX)
allow for the tracking of photoreceptors in dif-
the signaling pathways like Notch by treatment
of retinal organoids with small molecule(s)
(PF4014, DAPT) promotes the supernumerary
formation of specific cell fates like cones in a
synchronized fashion, making them abundantly
available for IRD with cone deterioration [12].
Such strategies circumvent the limitations to gen-
erate cell types that are sparsely generated.
Continuous ongoing efforts are being made by
independent investigators to demonstrate the sur-
vival and integration of the transplanted photore-
ceptors within the host retina.
Retinal organoids have also been used as a
tool to identify novel therapeutics. For example,
retinal organoids from LCA10 patients with
CEP290 intronic mutation have been used to val-
idate antisense oligonucleotide therapeutics for
pre-mRNA splice modulation and to restore
Retinal Organoids: A Human Model System for Development, Diseases, and Therapies
the function [7]. Similarly, a frequently diag-
nosed deep-intronic mutation in
­USH2A-­associated retinal degeneration causing
the aberrant splicing of truncated nonfunctional
protein could potentially be splice corrected
using antisense oligonucleotide on patient-
derived fibroblast [23]. Such approaches can pre-
serve the survival and function of the cells under
diseased conditions. Likewise, genome editing of
the patient-specific iPSC lines with numerous
IRD is being carried out using CRISPR-Cas9 or
zinc finger nucleases (ZFN) to create an ideally
corrected isogenic control lines or for knocking
down dominant mutant alleles. These approaches
can strategically be used to validate the develop-
ment and amelioration of disease phenotypes
providing a proof-of-concept [4]. Finally, retinal
organoids can be very useful as effective drug
screening tools for toxicity testing. For example,
a research in our laboratory is currently focused
to validate a previously described NR2E3 inhibi-
tors in RHO copy number variant patient-specific
iPSC-derived retinal organoids [20]. Altogether,
the development of therapies using retinal organ-
oid model systems for numerous IRD provides a
proof-of-concept to inform the future clinical
therapies.
5 Conclusion
Significant advances made in the field of stem
cell biology over the last decade to generate 3D
organoids from patients offer them as a powerful
and efficient preclinical model that can substan-
tially complement or reduce the use of animal
models. Addressing the challenges of reproduc-
ibility and variability, time taken to mature cer-
tain cell types with a globally standardized
protocol and large-scale systematic analysis of
observed results is likely to significantly enhance
the utility of organoids in the near future.
Acknowledgments We thank the members of the Lamba
Lab for their valuable discussion and suggestions. The
writing of this mini-review is supported by the National
Eye Institute (U24 EY029891 and R01EY032197 to Dr.
Lamba), Foundation Fighting Blindness research grant to
553
Dr. Lamba, All May See postdoctoral fellowship to Dr.
Kandoi, Research to Prevent Blindness (unrestricted grant
to Department of Ophthalmology, University of California
San Francisco) and UCSF Vision core grant NIH/NEI P30
EY002162.
References
1. Anon RetNet: Summaries [Online]. Available at:
https://sph.uth.edu/retnet/sum-­dis.htm. Accessed 13
Nov 2021.
2. Assawachananont J, Mandai M, Okamoto S, et al.
Transplantation of embryonic and induced pluripotent
stem cell-derived 3D retinal sheets into retinal degen-
erative mice. Stem Cell Rep. 2014;2(5):662–74.
3. Capowski EE, Samimi K, Mayerl SJ, et al.
Reproducibility and staging of 3D human retinal
organoids across multiple pluripotent stem cell lines.
Development. 2019;146(1).
4. Chirco KR, Chew S, Moore AT, Duncan JL, Lamba
DA. Allele-specific gene editing to rescue dominant
CRX-associated LCA7 phenotypes in a retinal organ-
oid model. Stem Cell Rep, vol. 16; 2021. p. 2690.
5. Corrò C, Novellasdemunt L, Li VSW. A brief his-
tory of organoids. Am J Physiol Cell Physiol.
2020;319(1):C151–65.
6. Deng W-L, Gao M-L, Lei X-L, et al. Gene correction
reverses ciliopathy and photoreceptor loss in iPSC-­
derived retinal organoids from retinitis pigmentosa
patients. Stem Cell Rep. 2018;10(4):1267–81.
7. Dulla K, Aguila M, Lane A, et al. Splice-modulating
oligonucleotide QR-110 restores CEP290 mRNA and
function in human c.2991+1655A>G LCA10 models.
Mol Ther Nucleic Acids. 2018;12:730–40.
8. Duncan JL, Pierce EA, Laster AM, et al. Inherited ret-
inal degenerations: current landscape and knowledge
gaps. Transl Vis Sci Technol. 2018;7(4):6.
9. Eiraku M, Sasai Y. Self-organizing optic-cup morpho-
genesis in three-dimensional culture. Neurosci Res.
2011;71:e127–8.
10. Fligor CM, Lavekar SS, Harkin J, et al. Extension
of retinofugal projections in an assembled model of
human pluripotent stem cell-derived organoids. Stem
Cell Rep. 2021;16(9):2228–41.
11. Gao M-L, Lei X-L, Han F, et al. Patient-specific
retinal organoids recapitulate disease features of
late-onset retinitis pigmentosa. Front Cell Dev Biol.
2020;8:128.
12. Kaufman ML, Park KU, Goodson NB, et al.
Transcriptional profiling of murine retinas undergoing
semi-synchronous cone photoreceptor differentiation.
Dev Biol. 2019;453(2):155–67.
13. Kroeger H, Grandjean JMD, Chiang W-CJ, et al. ATF6
is essential for human cone photoreceptor develop-
ment. Proc Natl Acad Sci U S A. 2021;118(39).
14. Kruczek K, Qu Z, Gentry J, et al. Gene therapy of
dominant CRX-Leber congenital amaurosis using
554
patient stem cell-derived retinal organoids. Stem Cell
Rep. 2021;16(2):252–63.
15. Lam PT, Gutierrez C, Del Rio-Tsonis K, Robinson
ML. Generation of a retina reporter hiPSC line to
label progenitor, ganglion, and photoreceptor cell
types. Transl Vis Sci Technol. 2020;9(3):21.
16. Lane A, Jovanovic K, Shortall C, et al. Modeling and
rescue of RP2 retinitis pigmentosa using iPSC-derived
retinal organoids. Stem Cell Rep. 2020;15(1):67–79.
17. Lin B, McLelland BT, Mathur A, Aramant RB, Seiler
MJ. Sheets of human retinal progenitor transplants
improve vision in rats with severe retinal degenera-
tion. Exp Eye Res. 2018;174:13–28.
18. Lukovic D, Artero Castro A, Kaya KD, et al. Retinal
organoids derived from hiPSCs of an AIPL1-LCA
patient maintain cytoarchitecture despite reduced lev-
els of mutant AIPL1. Sci Rep. 2020;10(1):5426.
19. Malik N, Rao MS. A review of the methods for human
iPSC derivation. Methods Mol Biol. 2013;997:23–33.
20. Nakamura PA, Shimchuk AA, Tang S, et al. Small
molecule Photoregulin3 prevents retinal degeneration
in the RhoP23H mouse model of retinitis pigmentosa.
elife. 2017;6.
S. Kandoi and D. A. Lamba
21. O’Hara-Wright M, Gonzalez-Cordero A. Retinal
organoids: a window into human retinal development.
Development. 2020;147(24).
22. Ohlemacher SK, Iglesias CL, Sridhar A, Gamm DM,
Meyer JS. Generation of highly enriched popula-
tions of optic vesicle-like retinal cells from human
pluripotent stem cells. Curr Protoc Stem Cell Biol.
2015;32:1H.8.1–1H.8.20.
23. Slijkerman RW, Vaché C, Dona M, et al. Antisense
oligonucleotide-based splice correction for USH2A-­
associated retinal degeneration caused by a frequent
deep-intronic mutation. Mol Ther Nucleic Acids.
2016;5(10):e381.
24. Sridhar A, Hoshino A, Finkbeiner CR, et al. Single-­
cell transcriptomic comparison of human fetal ret-
ina, hPSC-derived retinal organoids, and long-term
retinal cultures. Cell Rep. 2020;30(5):1644–1659.
e4.
25. Wahlin KJ, Maruotti JA, Sripathi SR, et al.
Photoreceptor outer segment-like structures in long-­
term 3D retinas from human pluripotent stem cells.
Sci Rep. 2017;7(1):766.
 Modeling Retinitis Pigmentosa
with Patient-Derived iPSCs

Yeh Chwan Leong and Jane C. Sowden

Abstract 1 Introduction

Retinitis pigmentosa (RP) causes blindness in
1 out of 3000–4000 individuals worldwide.
Understanding the disease mechanism under-
lying the death of photoreceptors in RP patient
is crucial for the discovery and development
of therapies to prevent and stop the progres-
sion of retinal degeneration. Despite having
provided valuable insight into RP pathology,
several shortcomings of animal models war-
rant the need for a better modeling system.
This review discusses the current use of
patient-derived induced pluripotent stem cells
(iPSCs) to model RP and its advantages over
animal models. Further improvement to
enhance the representativeness of iPSC RP
models is also discussed.
Retinitis pigmentosa (RP) is the most common
form of inherited retinal diseases (IRDs) with a
prevalence of 1 in 3000 worldwide [1]. More
than 80 genes and loci exhibiting autosomal-­
dominant, autosomal-recessive, or X-linked
modes of inheritance have been identified to
cause RP [2]. Patients with RP first suffer
progressive loss of rod photoreceptor (PR) cells,
resulting in loss of peripheral vision and night
blindness. This is followed by cone PR
degeneration, leading to the loss of central vision
and eventual legal blindness [3].
2 Challenges in RP Disease
Modeling

Keywords To date, the molecular mechanisms leading to the

Retinitis pigmentosa · iPSC · Disease
modeling · Retina degenerative · Retinal
organoids · Photoreceptors · Disease
mechanisms
Y. C. Leong · J. C. Sowden (*)
Stem Cells and Regenerative Medicine Section, UCL
Great Ormond Street Institute of Child Health,
University College London and NIHR Great Ormond
Street Hospital Biomedical Research Centre,
London, UK
e-mail: j.sowden@ucl.ac.uk
onset of death of rod PR cells remain largely
elusive in RP. This is due to several major
challenges to model the disease, which include
the following.
1. The genetic heterogeneity of RP. Despite the
application of next-generation sequencing
(NGS) technologies, approximately 30% of
RP cases have an unidentified genetic
diagnosis [4]. Known RP genes are responsible
for diverse functions in the neural retina and
retinal pigment epithelium (RPE), and thus it
is challenging to attribute the cause of RP to

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 555
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_81
556
specific molecular processes or common
pathways. Furthermore, the function of many
RP genes has not been fully elucidated and in
some cases, missing links between experi-
mentally identified phenotypes and gene
functions are observed and warrant additional
research effort [5].
2. The lack of faithful animal models. A recent
review on mouse models of IRDs indicated that
only 40% of known IRD genes are currently
modeled in mice. Despite being the most fre-
quently used animal model for IRDs, major
interspecies differences in retinal architecture
and function exist between mouse and human
[6]. For instance, the mouse is nocturnal (with
less exposure to light throughout life ) and has
a rod-dominated retinae that lacks a macula. In
addition, the absence of human vision-related
genes, such as EYS and ARMS2, and the dis-
crepancy between rodent and human retinal
ageing patterns have also been reported [7].
These drawbacks become apparent when, for
example, several Usher syndrome type I mutant
mouse models (such as shaker 1 and deaf cir-
cler mice) fail to recapitulate the retinal degen-
eration typically observed in Usher patient,
despite showing deafness and vestibular dys-
function [8]. Other large animals, such as dog,
pig, and non-­human primates, have also been
utilized to investigate the pathogenesis and
develop therapeutic approaches for RP.
However, these models are cost-prohibitive
and time-­consuming for the generation of suf-
ficient colonies and the manifestation of dis-
ease phenotype owing to slow reproduction
rate and long life span. Besides, the fovea, a pit
within the macula that contains the most cone
PRs and contributes to the highest visual acu-
ity, is absent in most large animals [9].
3. Scarcity of human samples and their limitation
to study disease progression. The availability
of postmortem RP patient retinal samples is
scarce. Severely degenerative retina is not
ideal for disease modeling due to the rare
presence of cells of interest (i.e. rod PRs). In
addition, postmortem patient retina provides
only a snapshot of a particular disease stage
and provides limited information about
disease progression.
Y. C. Leong and J. C. Sowden
4. Complexity of genetic and epigenetic
interaction. The presence of distinct modifier
genes in different genetic backgrounds can have
a dramatic effect on the presentation of the RP
phenotype and its severity. For instance, the
simultaneous presence of Rpgr knockout and
heterozygous hypomorphic mutation of Cep290
in mice induced early onset of retinal degenera-
tion in comparison to Rpgr knockout alone
[10]. Besides, one of a pair of sisters harboring
USH2A homozygous mutations was reported to
have earlier onset of RP and a more degenera-
tive phenotype due to the presence of a frame-
shift mutation in PDZD7 [11]. In addition,
Walia et al. [12] reported two distinct clinical
observations of cone–rod dystrophy and
X-linked RP, respectively, in two brothers har-
boring the same RPGR mutation. Both former
cases highlight the additive effect of modifier
genes and the latter underscores intrafamilial
variability of the RP phenotype. Zhang et al.
[13] reported reduced severity of a degenerative
retinal phenotype in F2 Nr2e3 rd7/rd7 homozy-
gotes generated from outcrosses of B6.Cg-
Nr2e3rd7/rd7 mice to AKR/J, CAST/EiJ, and
NOD.NON-H2nb1 (all with distinct genetic
backgrounds) and subsequent intercross of the
F1 mice. Follow-­up studies identified Rev-erbα
(Nr1d1) as a modifier gene to Nr2e3 with sup-
pressive effects on retinal degeneration [14].
Collectively, these findings suggest the pres-
ence of intricate genetic and epigenetic interac-
tions within the disease network, highlighting
the importance of modeling RP with models of
the right genetic background, such as the
patients themselves.
3 Modeling RP with Patient-­
Derived iPSCs
Induced pluripotent stem cells (iPSCs) technology
was first introduced in 2006 [15] and utilized in
human cells in 2007 to revert somatic cells back to
an embryonic stem cell-like state via the overex-
pression of OCT4, SOX2, KLF4, and c-MYC tran-
scription factors [16]. Since then, it has been
extensively employed to derive iPSCs from patient
cells to serve a wide range of research purposes,
Modeling Retinitis Pigmentosa with Patient-Derived iPSCs
including modeling of simple and complex disor-
ders ranging from monogenic RP to cancers [17].
Patient derived iPSC are often used in conjunction
with robust differentiation protocols to generate
cells of specific lineages, representing disease-
affected cells in the in vivo setting. In IRDs,
numerous retinal differentiation protocols have
been reported to faithfully generate various retinal
cell types, including PRs and RPE [18]. Table 1
shows a summary of published RP disease model-
ing studies using patient iPSCs. Notably, many of
these use an insufficient number of iPSC lines to
determine if the reported effects are due to RP
gene mutations or are –inter-iPSC line variations
(discussed later) (Table 1).
3.1 Benefits of Patient iPSCs
for RP Disease Modeling
Comparison of different aspects (molecular,
cellular, and functional) of patient and healthy
retinal cells derived from their respective iPSCs in
vitro creates a powerful “disease in a dish” model.
Modeling RP with iPSCs circumvents caveats
met by classical animal models. First, it retains a
patient’s gene mutation, genetic background, and,
if existing, any potential modifier gene effects,
providing a genuine representation of RP ex vivo
at the molecular level. iPSCs are capable of divid-
ing indefinitely to enable, theoretically, an unlim-
ited supply of research material for disease
modeling [19]. The reproducibility and scalability
of iPSCs, in concert with the implementation of
rigorous current good manufacturing practice, is
exceptionally important for cell therapy, where
limited cell source is considered one of the big-
gest bottlenecks [20]. In addition, the use of
patient iPSCs bypasses interspecies differences
and avoids the application of gene editing proce-
dures to create transgenic animals carrying the
desired human RP gene mutation [21].
Nevertheless, under circumstances where gene
editing is required to generate isogenic mutant
(containing predicted pathogenic RP gene muta-
tion) or rescued (RP gene mutation corrected)
lines, iPSCs represent an easier option for manip-
ulation and screening for mutant clones than ani-
mal models [22]. Furthermore, the establishment
557
of iPSC banks/depositories in many countries,
such as the United States (WiCell), Japan
(RIKEN), and the United Kingdom (HipSci), has
made available an arsenal of patient and control
iPSCs to suit different experimental designs [23].
In particular, it streamlines the acquisition of
comprehensively characterized, sex- and age-
matched controls and patients of diverse genetic
backgrounds, which under normal circumstances,
are difficult to obtain [24].
3.2 Factors Important
for the Success of RP
Modeling with Patient iPSCs
In this section, factors crucial for the success of
RP disease modeling using patient iPSCs are dis-
cussed. They are as follows.
1. The generation of retinal organoids that
closely recapitulate the complexity of human
retina in vivo. The first modeling study of RP
using iPSC was described by the Takahashi
group involving five patients with mutations
in RP1, RP9, PRPH2, and RHO [25]. A
directed, 2D adherent differentiation protocol
was adopted to generate rod PR cells, which
showed some electrophysiological function.
Subsequently, various 3D platforms have
been established to generate retinal organoids
that better recapitulate in vivo retinogenesis
and contain various retinal cell types orga-
nized in pseudo-laminated retinal tissue, pro-
viding a more complex model to study RP
pathology. The 3D organoid models allow
long-term maintenance and maturation of PRs
to acquire subcellular structures, such as the
connecting cilium, which has enabled the
identification of cilia defects in RP modeling
studies concerning RPGR and PRPF31 muta-
tion [26, 27]. However, further improvements,
such as the generation of fully mature outer
segments, light-responsive PRs that generates
electrophysiological output, co-culture of
RPE overlaying PRs, and outer segment
phagocytosis, as well as the inclusion of vas-
cularization, would enhance resemblance to
the retina in vivo, benefiting the robustness
and representativeness of the model.
Table 1 A summary of RP disease modeling studies using patient iPSCs and experimental detail
Latest
Differentiation iPSC cell Reprogramming iPSC time Treatment/
Reference M.O.I. Mutated gene (mutation) protocol Major findings source Feeder approach characterization #Patient #Control point rescue
2D culture
[25] adRP RP1, axonemal [37] Elevation of various Skin Yes Retrovirus IF, karyotypic 5 1 – 150D α-Tocopherol,
microtubule associated stress markers, fibroblast analysis, (~21W) ascorbic acid,
(p.721Lfs722X) including ER stress, teratoma or β-carotene
RP9, pre-mRNA splicing DNA oxidation, and formation
factor (p.H137L) apoptosis
PRPH2, Peripherin 2
(p.W316G)
RHO, Rhodopsin (p.
G188R)
[38] arRP MAK, male germ [39] Identification of Alu Skin Yes Sendai virus IF, karyotypic 1 1 – 150D –
cell-associated kinase insertional mutation fibroblast analysis, (~21W)
(homozygous 353 bp Alu and impairment of teratoma
insertion in exon 9) retina-specific formation
MAK isoform
expression
[40] adRP RHO, Rhodopsin [41] Apoptosis, ER Skin No Lentivirus RT-PCR 1 2 1 33D CRISPR/Cas9
(c.562G>A, p.G188R) stress, and rod fibroblast non-­MAK (~5W) reported in
degeneration RP Burnight,
control Gupta [42]
[43] adRP RHO, Rhodopsin (p. [44] Apoptosis and ER Skin Yes Retrovirus IF, teratoma 2 2 1 isogenic 5W Rapamycin,
E181K) stress; antioxidant fibroblast formation mutant PP242,
treatment line/1 AICAR,
corrected NQDI-1, and
control salubrinal/
line HDAdV
correction
3D culture
[45] arRP USH2A, Usherin (IVS40, [39] Protein misfolding Keratinocyte No Sendai virus RT-PCR, 1 2 1 150D –
p.Arg4192His) and ER stress; teratoma non-­ (~21W)
transplantation formation USH2A
control
 Latest
Differentiation iPSC cell Reprogramming iPSC time Treatment/
Reference M.O.I. Mutated gene (mutation) protocol Major findings source Feeder approach characterization #Patient #Control point rescue
[46] arRP REEP6, receptor [47] Identified novel RP Skin No Episomal vector Not applicable 0 1 – 21W –
expression enhancer gene and retina- fibroblast
protein 6 (various, specific isoform
include p.Pro128Leu, p.
Leu135Pro, and p.
Val187Glyfs∗13)
[48] xlRP RP2, retinitis pigmentosa [47] Mislocalization of Skin No Episomal vector IF 1 1 – 21W TRIDs: G418
2 (c.519C>T, p.R120X) ciliary tip kinesins; fibroblast and PTC124
cilia defect; rescue
phenotypes with
TRIDs
[5] arRP TRNT1, tRNA [20] Autophagy defect; Skin No Sendai virus RT-PCR, IF, 3 1 Age-­ 90D –
nucleotidyl transferase, oxidative stress fibroblast karyotypic matched (~13W)
CCA-adding 1 (various, analysis, control
include TaqMan
c.127_129delGAA, scorecard assay
p.Glu43del3 GAA and
c.1252delA,
p.Ser418del1Afs)
[49] xlRP RPGR, retinitis [50] Actin Skin No Episomal vector qPCR, IF, 2 1 Patients 100D Overexpression
pigmentosa GTPase polymerization fibroblast spontaneous are (~14W) of gelsolin in
regulator defect differentiation brothers, hTERT-RPE
(g.ORF15+689−692del4) control is cells
unaffected
son/
nephew
(sex-
matched)

(continued)
Table 1 (continued)
Latest
Differentiation iPSC cell Reprogramming iPSC time Treatment/
Reference M.O.I. Mutated gene (mutation) protocol Major findings source Feeder approach characterization #Patient #Control point rescue
[27] xlRP RPGR, retinitis [51] Aberrant expression Urinary cell/ No Lentivirus/ AP, IF, 3 3 – 82W CRISPR/Cas9
pigmentosa GTPase of key retinal genes; skin episomal vector spontaneous (one patient
regulator (Patient1: various PR, cilia, fibroblast differentiation line)
c.1685_1686delAT; and
Patient2 and 3: ORF15 electrophysiological
c.2234_2235delGA and defects; CRISPR/
c.2403_2404delAG) Cas9 rescue
[26] adRP PRPF31, pre-mRNA [51] Pre-mRNA splicing Skin No Sendai virus IF, FACS, 4 3 Age-­ 43W CRISPR/Cas9
processing factor 3 and cilia defects; fibroblast karyotypic matched (one patient
(c.1115_1125del11 cell stress; analysis, SNP control line)
heterozygous or CRISPR/Cas9 array,
c.522_527+10del rescue spontaneous
heterozygous) differentiation,
teratoma
formation
[52] arRP USH2A, Usherin [51] Morphological, PR Urinary cell No Sendai virus IF, karyotypic 1 1 Age- and 86D –
(c.8559-2A > G, and RPE defects; analysis, sex-­ (~12W)
c.9127_9129delTCC) cell stress spontaneous matched
differentiation control
[53] arRP CRB1, crumbs [18] Outer limiting Skin No Lentivirus IF, spontaneous 3 3 Sex-­ 240D –
homolog-1 (various, membrane fibroblast differentiation matched (~34W)
includes c.3122T > C p. disruption;
(Met1041Thr) optimization of
homozygote) AAV transduction
[33] arRP PDE6B, cGMP-­ [47] Late-onset model; Peripheral No Episomal vector AP, IF, 1 1 – 230D –
phosphodiesterase type 6 mislocalization of blood spontaneous (33W)
(c.694G > A PR; impaired mononuclear differentiation
homozygous) cGMP hydrolysis cell
[54] xlRP RP2, retinitis pigmentosa [47]/[18] Thinning of outer Skin No Episomal vector IF 3 1 1 isogenic 300D AAV (one
2 (c.358C>T, p.R120X) nuclear layer and fibroblasts mutant (43W) isogenic line)
cell death; AAV line
rescue
M.O.I. mode of inheritance, adRP autosomal dominant RP, arRP autosomal recessive RP, xlRP X-linked RP, AP alkaline phosphatase, IF immunofluorescence staining, D day, W week
Modeling Retinitis Pigmentosa with Patient-Derived iPSCs
2. Varying capabilities of iPSC to generate
retinal cells have been well documented.
Cowan et al. [28] reported only 8 out of 23
iPSC lines successfully generated retinal cells
at day 100. The variation is largely attributable
to genetic variations between donors and/or
the epigenetic profiles of iPSCs [29]. Further
understanding of the variability in iPSC pro-
duction and developing means to bypass the
hurdle and to preselect iPSC with high retinal
differentiation potential would be hugely ben-
eficial to streamline RP modeling studies.
3. Another source of variation comes from the in
vitro retinal differentiation procedure. Most
protocols available rely on spontaneous occur-
rence of 3D retinal organoids [30] and/or
inconsistent microdissection [18] and scrap-
ing techniques [31] of 3D and 2D cultures,
resulting in high variability among organoids.
Improving the consistency of organoid pro-
duction and ensuring consistent differentia-
tion pace could help reduce the confounding
effects due to technical variations.
4. Greater understanding of each RP gene
function can better inform experimental
designs, such as in recent studies of RPGR
and RP2 in ciliogenesis and PRPH31 in pre-
mRNA splicing [26, 27].
5. Lastly, while the onset of RP can be as early
as 10 years of age, on average, RP patients
Fig. 1 Modeling retinitis pigmentosa with patient-derived induced pluripotent stem cells (iPSCs). (Figure was created
in BioRender.com)
561
are diagnosed at around 35 years old [32].
Accumulating evidence suggests that reti-
nal organoids acquire a developed state at
about 30 weeks, beyond which no further
maturation can be achieved using current
methodologies [28]. Although early disease
phenotypes have been successfully demon-
strated within the organoid model in various
instances (Table 1), this limited maturation
represents a major caveat for the modeling
of late-onset RP. To emphasize the impor-
tance of timing, Gao et al. [33] detected dis-
ease phenotype in patient retinal organoids
harboring PDE6H mutation only from day
180 of differentiation. Additional aberra-
tions relating to PDE6H function only
became apparent on day 230. Numerous
approaches have been tested in neurodegen-
erative studies of non-retinal ­disease to cap-
ture or reproduce aging effects by deriving
iPSCs from older donors and through
progerin overexpression [34], telomere
shortening [35], and the exposure to stress
agents [36]. Future studies will need to fur-
ther advance the authenticity of iPSC-
derived 3D retinal tissue models to realize
the potential of iPSC technology to under-
stand RP disease progression and to develop
and test therapies to prevent PR cell death
(Fig. 1).
562
Acknowledgments This work was supported by
GOSHCC, NewLife, and the NIHR GOSH BRC.
References
1. Hartong DT, et al. Retinitis pigmentosa. Lancet.
2006;368(9549):1795–809.
2. Bravo-Gil N, et al. Unravelling the genetic basis
of simplex retinitis pigmentosa cases. Sci Rep.
2017;7:41937.
3. Berger W, et al. The molecular basis of human retinal
and vitreoretinal diseases. Prog Retin Eye Res.
2010;29(5):335–75.
4. Gao FJ, et al. Genetic and clinical findings in a large
cohort of Chinese patients with suspected retinitis
Pigmentosa. Ophthalmology. 2019;126(11):1549–56.
5. Sharma TP, et al. Patient-specific induced pluripotent
stem cells to evaluate the pathophysiology of TRNT1-
associated retinitis pigmentosa. Stem Cell Res.
2017;21:58–70.
6. Artero Castro A, et al. Deciphering retinal diseases
through the generation of three dimensional stem
cell-derived organoids: concise review. Stem Cells.
2019;37(12):1496–504.
7. Kam JH, et al. Fundamental differences in patterns of
retinal ageing between primates and mice. Sci Rep.
2019;9(1):12574.
8. Fletcher EL, et al. Animal models of retinal disease.
Prog Mol Biol Transl Sci. 2011;100:211–86.
9. Winkler PA, et al. Large animal models of inherited
retinal degenerations: a review. Cells. 2020;9(4):882.
10. Rao KN, et al. Ciliopathy-associated protein CEP290
modifies the severity of retinal degeneration due to loss
of RPGR. Hum Mol Genet. 2016;25(10):2005–12.
11. Ebermann I, et al. PDZD7 is a modifier of retinal
disease and a contributor to digenic Usher syndrome.
J Clin Invest. 2010;120(6):1812–23.
12. Walia S, et al. Discordant phenotypes in fraternal
twins having an identical mutation in exon
ORF15 of the RPGR gene. Arch Ophthalmol.
2008;126(3):379–84.
13. Haider NB, et al. Mapping of genetic modifiers of
Nr2e3 rd7/rd7 that suppress retinal degeneration and
restore blue cone cells to normal quantity. Mamm
Genome. 2008;19(3):145–54.
14. Cruz NM, et al. Modifier genes as therapeutics: the
nuclear hormone receptor Rev Erb alpha (Nr1d1)
rescues Nr2e3 associated retinal disease. PLoS One.
2014;9(1):e87942.
15. Takahashi K, et al. Induction of pluripotent stem cells
from mouse embryonic and adult fibroblast cultures
by defined factors. Cell. 2006;126(4):663–76.
16. Takahashi K, et al. Induction of pluripotent stem cells
from adult human fibroblasts by defined factors. Cell.
2007;131(5):861–72.
17. Rowe RG, et al. Induced pluripotent stem cells in
disease modelling and drug discovery. Nat Rev Genet.
2019;20(7):377–88.
Y. C. Leong and J. C. Sowden
18. Zhong X, et al. Generation of three-dimensional
retinal tissue with functional photoreceptors from
human iPSCs. Nat Commun. 2014;5:4047.
19. Ahmad I, et al. Recapitulating developmental
mechanisms for retinal regeneration. Prog Retin Eye
Res. 2019;76:100824.
20. Wiley LA, et al. cGMP production of patient-specific
iPSCs and photoreceptor precursor cells to treat retinal
degenerative blindness. Sci Rep. 2016;6:30742.
21. Zhang XH, et al. Off-target effects in CRISPR/Cas9-­
mediated genome engineering. Mol Ther Nucleic
Acids. 2015;4:e264.
22. Engle SJ, et al. Best practices for translational disease
modeling using human iPSC-derived neurons.
Neuron. 2018;100(4):783–97.
23. Kim JH, et al. Report of the international stem cell
banking initiative workshop activity: current hurdles
and progress in seed-stock banking of human
pluripotent stem cells. Stem Cells Transl Med.
2017;6(11):1956–62.
24. Haston KM, et al. Clinical trials in a dish: the
potential of pluripotent stem cells to develop therapies
for neurodegenerative diseases. Annu Rev Pharmacol
Toxicol. 2016;56:489–510.
25. Jin ZB, et al. Modeling retinal degeneration using
patient-specific induced pluripotent stem cells. PLoS
One. 2011;6(2):e17084.
26. Buskin A, et al. Disrupted alternative splicing
for genes implicated in splicing and ciliogenesis
causes PRPF31 retinitis pigmentosa. Nat Commun.
2018;9(1):4234.
27. Deng WL, et al. Gene correction reverses ciliopathy
and photoreceptor loss in iPSC-derived retinal
organoids from retinitis pigmentosa patients. Stem
Cell Rep. 2018;10(6):2005.
28. Cowan CS, et al. Cell types of the human retina
and its organoids at single-cell resolution. Cell.
2020;182(6):1623–40. e34
29. Kilpinen H, et al. Corrigendum: common genetic
variation drives molecular heterogeneity in human
iPSCs. Nature. 2017;546(7660):686.
30. Gonzalez-Cordero A, et al. Recapitulation of human
retinal development from human pluripotent stem
cells generates transplantable populations of cone
photoreceptors. Stem Cell Rep. 2017;9(3):820–37.
31. Regent F, et al. A simple and efficient method
for generating human retinal organoids. Mol Vis.
2020;26:97–105.
32. Tsujikawa M, et al. Age at onset curves of retinitis
pigmentosa. Arch Ophthalmol. 2008;126(3):337–40.
33. Gao ML, et al. Patient-specific retinal organoids
recapitulate disease features of late-onset retinitis
pigmentosa. Front Cell Dev Biol. 2020;8:128.
34. Zhang Y, et al. Author correction: hypothalamic stem
cells control ageing speed partly through exosomal
miRNAs. Nature. 2018;560(7719):E33.
35. Vera E, et al. Generating late-onset human iPSC-
based disease models by inducing neuronal age-
related phenotypes through telomerase manipulation.
Cell Rep. 2016;17(4):1184–92.
Modeling Retinitis Pigmentosa with Patient-Derived iPSCs
36. Liu Y, et al. Protective effect of hydrogen on sodium
iodate-induced age-related macular degeneration in
mice. Front Aging Neurosci. 2018;10:389.
37. Osakada F, et al. Toward the generation of rod and
cone photoreceptors from mouse, monkey and
human embryonic stem cells. Nat Biotechnol.
2008;26(2):215–24.
38. Tucker BA, et al. Exome sequencing and analysis
of induced pluripotent stem cells identify the cilia-­
related gene male germ cell-associated kinase (MAK)
as a cause of retinitis pigmentosa. Proc Natl Acad Sci
U S A. 2011;108(34):E569–76.
39. Tucker BA, et al. Transplantation of adult mouse iPS
cell-derived photoreceptor precursors restores retinal
structure and function in degenerative mice. PLoS
One. 2011;6(4):e18992.
40. Jin ZB, et al. Integration-free induced pluripotent
stem cells derived from retinitis pigmentosa patient
for disease modeling. Stem Cells Transl Med.
2012;1(6):503–9.
41. Osakada F, et al. Stepwise differentiation of
pluripotent stem cells into retinal cells. Nat Protoc.
2009;4(6):811–24.
42. Burnight ER, et al. Using CRISPR-Cas9 to generate
gene-corrected autologous iPSCs for the treatment
of inherited retinal degeneration. Mol Ther.
2017;25(9):1999–2013.
43. Yoshida T, et al. The use of induced pluripotent stem
cells to reveal pathogenic gene mutations and explore
treatments for retinitis pigmentosa. Mol Brain.
2014;7:45.
44. Lamba DA, et al. Generation, purification and
transplantation of photoreceptors derived from
human induced pluripotent stem cells. PLoS One.
2010;5(1):e8763.
563
45. Tucker BA, et al. Patient-specific iPSC-derived
photoreceptor precursor cells as a means to investigate
retinitis pigmentosa. elife. 2013;2:e00824.
46. Arno G, et al. Mutations in REEP6 cause autosomal-­
recessive retinitis pigmentosa. Am J Hum Genet.
2016;99(6):1305–15.
47. Nakano T, et al. Self-formation of optic cups and
storable stratified neural retina from human ESCs.
Cell Stem Cell. 2012;10(6):771–85.
48. Schwarz N, et al. Arl3 and RP2 regulate the
trafficking of ciliary tip kinesins. Hum Mol Genet.
2017;26(17):3451.
49. Megaw R, et al. Gelsolin dysfunction causes
photoreceptor loss in induced pluripotent cell and
animal retinitis pigmentosa models. Nat Commun.
2017;8(1):271.
50. Mellough CB, et al. IGF-1 signaling plays an
important role in the formation of three-dimensional
laminated neural retina and other ocular structures
from human embryonic stem cells. Stem Cells.
2015;33(8):2416–30.
51. Kuwahara A, et al. Generation of a ciliary margin-like
stem cell niche from self-organizing human retinal
tissue. Nat Commun. 2015;6:6286.
52. Guo Y, et al. Modeling retinitis pigmentosa: retinal
organoids generated from the iPSCs of a patient
with the USH2A mutation show early developmental
abnormalities. Front Cell Neurosci. 2019;13:361.
53. Quinn PM, et al. Human iPSC-derived retinas
recapitulate the fetal CRB1 CRB2 complex
formation and demonstrate that photoreceptors and
Muller glia are targets of AAV5. Stem Cell Rep.
2019;12(5):906–19.
54. Lane A, et al. Modeling and rescue of RP2 retinitis
pigmentosa using iPSC-derived retinal organoids.
Stem Cell Rep. 2020;15(1):67–79.
 Primary Retinal Cell Cultures
as a Model to Study Retina Biology

Germán A. Michelis, Luis E. Politi,

and S. Patricia Becerra

Abstract Keywords

Since its inception, primary retinal cultures
have been an in vitro tool for modeling the
in vivo environment of the retina for biologi-
cal studies on development and disease. They
offer simple and controlled experimental
approaches when compared to in vivo models.
In this review we highlight the strengths and
weaknesses of primary retinal culture models,
and the features of dispersed retinal cell
cultures.
G. A. Michelis
Section of Protein Structure and Function, LRCMB,
NEI-NIH,
Bethesda, MD, USA
Department of Biology, Pharmacy and Biochemistry,
Instituto de Investigaciones Bioquímicas (INIBIBB),
Universidad Nacional del Sur (UNS)-CONICET,
Bahía Blanca, Argentina
L. E. Politi
Department of Biology, Pharmacy and Biochemistry,
Instituto de Investigaciones Bioquímicas (INIBIBB),
Universidad Nacional del Sur (UNS)-CONICET,
Bahía Blanca, Argentina
S. P. Becerra (*)
Section of Protein Structure and Function, LRCMB,
NEI-NIH,
Bethesda, MD, USA
e-mail: becerras@nei.nih.gov
Retina · Primary cultures · Cell lines ·
Organoids · In vivo models ·
In vitro models
1 Introduction
The selection of a relevant model that best
resembles the in vivo organism is key for suc-
cessful research. The use of in vivo animal mod-
els to study the retina is desirable given that they
contain the whole organ. However, they have
several caveats, such as their degree of com-
plexity and interdependence on other organ sys-
tems that indirectly affect the outcome of the
assays targeting the retina. Given the naturally
occurring variation among individuals, experi-
mental designs tend to include a high number of
animals, which in turn impacts on the cost of
resources and manpower to maintain an animal
colony, as well as on ethical concerns to reduce,
refine, and replace the use of research animals
[29]. The use of in cellulo models (e.g., dissoci-
ated cells from a tissue and cell lines) offers sev-
eral advantages. The in vitro environment allows
for additional experimental options over those
for the in vivo models, given their controlled
culturing conditions, which are more difficult to
achieve with live animals.

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 565
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_82
566
2 Cell Lines
Retinal cell lines arise from primary cell cultures
and are used instead of them to study biological
processes. Examples include rat R28 [30], human
ARPE-19 [4], and mouse 661W [28] cell lines.
They are composed of a single cell type with low
internal variability. However, care must be taken
when interpreting the results because cell lines
are transformed to propagate indefinitely, gener-
ally with oncogenic pathways that often generate
artifacts that differ from the natural behavior of
cells in vivo. They can undergo genetic and phe-
notypic changes due to the cumulative mutations
with time in culture, causing deviation from the
progenitor cell and requiring regular validation to
monitor their genetic variation. The extended life
span of cell lines is beyond that of primary cells,
anticipating artificial death induction when lines
are used in retinal cell survival assays [3]. These
events in cell lines may not be extrapolated to
in vivo outcomes and require additional verifica-
tion by other models.
3 Primary Retinal Cell Cultures
Primary cultures are prepared from retinal tis-
sue of animals and have a limited life span [35].
They are a compromise between the in vivo
models and cell lines and provide a simplified
environment of the retina, enabling the study of
specific biological processes while guaranteeing
the identity of the cell components [35]. While
these models overcome hurdles inherent to the
in vivo and cell line alternatives, other limita-
tions arise that need attention at the planning
stage. Due to its clinical relevance and potential
as a model for the nervous system, the retina is
ideal to establish primary cell cultures.
Compared to the brain as a source of neurons,
the retina is relatively easy to access and has a
stratified architecture with a lower number of
cell types [19], lending itself for modeling neu-
ronal behavior [1, 2, 17]. The models of primary
G. A. Michelis et al.
retinal cultures have existed for over five
decades [18, 24].
The use of primary retinal cell cultures in
experimental design offers several advantages.
(1) Cell culture quality control, which refers to
measures taken to control the quality of the
reagents and cells during the maintenance of
these cellular models. (2) Reproducibility, in that
the experimental variables are more reproducible
and easier to replicate with cells in culture than
in vivo. (3) Penetration of testing drugs to reach
the target retinal cells in vitro without the risk of
unintended effects caused by the ocular delivery
itself in vivo. (4) Retinal cell identity. Generally,
primary cultures are more comparable to in vivo
than cell lines [35].
Great strides have been made to improve cul-
ture conditions of cells to resemble the environ-
ment in the retinal tissue in vivo. These advances
have allowed the development of organoids that
can survive for almost a year in culture [14, 41].
Despite the progress in this field, research to
make retinal organoids equivalent to their in vivo
counterparts is ongoing [32, 40]. While the
advantage of the use of primary retinal cell cul-
tures as models for retinal studies is in their
application to investigate interactions at a subcel-
lular and cell-to-cell levels, a disadvantage is that
there are processes or factors in vivo that are
likely missed in vitro [7]. For example, the lack
of extracellular cues present in the whole organ-
ism leads to a short life span in primary cells in
culture [6].
4 Dispersed Cell Cultures
The preparation of dispersed cell cultures requires
cell dissociation from dissected retinal tissue
through mechanical or enzymatic means, fol-
lowed by plating dissociated cells in a culture
dish. Table 1 lists primary retinal cell cultures
prepared from different species and by different
laboratories. Figure 1 shows representative
images of primary retinal cells in culture.
Primary Retinal Cell Cultures as a Model to Study Retina Biology 567

Table 1 Primary retinal cell cultures from different species

Animal species Retinal cell types in culture Reference

P8 mice Müller glial cells, photoreceptors Kretz et al. [12]
P2–4 Sprague-­Dawley rats Mixed: Glia, photoreceptors, neurons— Sia et al. [31]
Not retinal ganglion cells (RGCs)
P2–4 Sprague-­Dawley rats RGCs Sia et al. [31]
PN2 mice Photoreceptors, Amacrine cells Politi et al. [26]
E5–E14 chicken embryos RGCs Stanke and Fischer [33]
PN1 Long-­Evans rats Müller glial cells, Amacrine cells, Hicks and Courtois [9]
photoreceptors
PN4 C3H/HeA mice Photoreceptors, Amacrines cells, bipolar Zalis et al. [37]
cells, astrocytes, Müller glial cells
PN4–10 Sprague-­Dawley rats RGCs Fischer et al. [5]
E18 Sprague-­Dawley rats Retinal precursors, converted to RGCs James et al. [11]
E3 chickens Retinal precursors James et al. [11]
Adult Sprague-­Dawley rats or adult RGCs Grozdanov et al. [8]
C57/BL6 mice
E18 Wistar rats Photoreceptors, GABAergic neurons, Matteucci et al. [20]
Müller glial cells
Adult human eyes Müller glia, rod photoreceptors Hicks et al. [10]
PN3–5 Hooded-Lister rats RGCS Lilley and Robbins [17]
PN1 Sprague-­Dawley rats RGCs Li et al. [16]
Stage 25+ Xenopus embryos Retinal progenitors McDonough et al. [21]
10–12 weeks human embryos RGCs Zhang et al. [39]
16–18 weeks human embryos Retinal progenitors Wang et al. [36]
Adult tiger salamanders Müller glial cells, photoreceptors Kung et al. [13]

E18 Sprague-­Dawley rats Photoreceptors, Amacrine cells, RGCs Levine et al. [15]
PN22–25 Long-Evans rats Photoreceptors Zayas-­Santiago and Kang
Derwent [38]
Adult zebrafish Photoreceptors, bipolar cells, horizontal McMahon [22]
cells
E17–21 and PN2 Wistar-­Albino rats RGCs Turner [34]
PN1 Sprague-­Dawley rats RGCs Sarthy et al. [27]
PN2 Dutch rabbits Amacrine cells Osborne et al. [25]

5 Future Directions Retinal organoids are gaining increasing attention

Primary cultures are mainstay models in laborato-
ries worldwide that will continue to be valuable
for the advancement of our scientific knowledge
regarding retina physiology and pathology.
by the scientific community given their potential
of creating a more accurate representation of the
retina. Retinal organoids and primary cell cultures
will prove to be complementary in vitro models to
address different aspects of scientific questions.
568
Fig. 1 Photomicrographs of dispersed primary rat retinal
cells at 5 days in culture prepared according to Michelis
et al. [23]. Two cellular types are present: photoreceptors
(unmarked) and amacrine neurons (asterisks). Nuclei
For example, primary cell cultures serve to answer
questions associated with subcellular or cell-to-
cell events, while tissue-to-tissue interactions are
better investigated in organoids. Thus, combining
the in vitro models of primary cell cultures and
organoids in a complementary and synergistic
fashion will result in a powerful tool to advance
our knowledge about retina development under
normal or pathological conditions.
Acknowledgments This work was supported in part by
the Intramural Research Program of the National Eye
Institute, NIH (Project #EY000306, for S.P.B.), the
National Agency for Science and Technology, Argentina
(PICT-2016-0353, for L.E.P.), and the National Research
Council of Argentina (PIP 1­ 1220-­1101-­00827, for L.E.P.).
We thank Dr. Ivan Rebustini for carefully proof-reading
the manuscript.
References
1. Agranoff BW, Feldman EL, Heacock AM, Schwartz
M. The retina as a biochemical model of cen-
tral nervous system regeneration. Neurochem Int.
1980;1C:487–500.
G. A. Michelis et al.
were labeled with DAPI (blue) and TOPRO-3 (red).
Neurites were labeled with anti-acetylated tubulin anti-
body (green)
2. Ames A, Nesbett FB. In vitro retina as an experimen-
tal model of the central nervous system. J Neurochem.
1981;37:867–77.
3. Bullock J, Pagan-Mercado G, Becerra SP. Cell-based
assays to identify novel retinoprotective agents.
MethodsX. 2020;7:101026.
4. Dunn KC, Aotaki-Keen AE, Putkey FR, Hjelmeland
LM. ARPE-19, a human retinal pigment epithelial
cell line with differentiated properties. Exp Eye Res.
1996;62:155–69.
5. Fischer RA, Zhang Y, Risner ML, Li D, Xu Y,
Sappington RM. Impact of graphene on the efficacy
of neuron culture substrates. Adv Healthc Mater.
2018;7:e1701290.
6. Freshney RI. Preparation and sterilization. In: Culture
of animal cells: a manual of basic technique. 5th ed.
New York: Wiley; 2005. p. 145–73.
7. Ghareeb AE, Lako M, Steel DH. Coculture techniques
for modeling retinal development and disease and
enabling regenerative medicine. Stem Cells Transl
Med. 2020;9:1531–48.
8. Grozdanov V, Müller A, Sengottuvel V, Leibinger M,
Fischer D. A method for preparing primary retinal cell
cultures for evaluating the neuroprotective and neuri-
togenic effect of factors on axotomized mature CNS
neurons. Curr Protoc Neurosci. 2010;53:1. Chapter
3:Unit 3.22.
9. Hicks D, Courtois Y. Fibroblast growth factor stimu-
lates photoreceptor differentiation in vitro. J Neurosci.
1992;12:2022–33.
Primary Retinal Cell Cultures as a Model to Study Retina Biology
10. Hicks D, Forster V, Dreyfus H, Sahel J. Survival and
regeneration of adult human photoreceptors in vitro.
Brain Res. 1994;643:302–5.
11. James J, Das AV, Bhattacharya S, Chacko DM,
Zhao X, Ahmad I. In vitro generation of early-born
neurons from late retinal progenitors. J Neurosci.
2003;23:8193–203.
12. Kretz A, Marticke JK, Happold CJ, Schmeer C,
Isenmann S. A primary culture technique of adult
retina for regeneration studies on adult CNS neurons.
Nat Protoc. 2007;2:131–40.
13. Kung F, Wang W, Tran TS, Townes-Anderson
E. Sema3A reduces sprouting of adult rod pho-
toreceptors in vitro. Invest Ophthalmol Vis Sci.
2017;58:4318–31.
14. Lancaster MA, Knoblich JA. Organogenesis in a dish:
modeling development and disease using organoid
technologies. Science. 2014;345:1247125.
15. Levine EM, Roelink H, Turner J, Reh TA. Sonic
hedgehog promotes rod photoreceptor ­differentiation
in mammalian retinal cells in vitro. J Neurosci.
1997;17:6277–88.
16. Li N, Shang L, Wang SC, Liao LS, Chen D, Huang
JF, Xiong K. The toxic effect of ALLN on primary
rat retinal neurons. Neurotox Res. 2016;30:392–406.
17. Lilley S, Robbins J. The rat retinal ganglion cell in
culture: an accessible CNS neurone. J Pharmacol
Toxicol Methods. 2005;51:209–20.
18. Liss L, Wolter JR. Human retinal neurons in tissue
culture. Am J Ophthalmol. 1961;52:834–41.
19. Masland RH. The neuronal organization of the retina.
Neuron. 2012;76:266–80.
20. Matteucci A, Varano M, Gaddini L, Mallozzi C, Villa
M, Pricci F, Malchiodi-Albedi F. Neuroprotective
effects of citicoline in in vitro models of retinal neu-
rodegeneration. Int J Mol Sci. 2014;15:6286–97.
21. McDonough MJ, Allen CE, Ng-Sui-Hing NK, Rabe
BA, Lewis BB, Saha MS. Dissection, culture, and
analysis of Xenopus laevis embryonic retinal tissue.
J Vis Exp. 2012;70:4377.
22. McMahon DG. Modulation of electrical synaptic
transmission in zebrafish retinal horizontal cells. J
Neurosci. 1994;14:1722–34.
23. Michelis G, German OL, Villasmil R, Soto T, Rotstein
NP, Politi L, Becerra SP. Pigment epithelium-derived
factor (PEDF) and derived peptides promote survival
and differentiation of photoreceptors and induce
neurite-­outgrowth in amacrine neurons. J Neurochem.
2021;159:840.
24. Moscona A. Formation of lentoids by dissoci-
ated retinal cells of the chick embryo. Science.
1957;125:598–9.
25. Osborne NN, Beaton DW, Vigny A, Neuhoff
V. Localization of tyrosine-hydroxylase immunore-
active cells in rabbit retinal cultures. Neurosci Lett.
1984;50:117–20.
26. Politi LE, Lehar M, Adler R. Development of neo-
natal mouse retinal neurons and photoreceptors in
low density cell culture. Invest Ophthalmol Vis Sci.
1988;29:534–43.
569
27. Sarthy PV, Curtis BM, Catterall WA. Retrograde
labeling, enrichment, and characterization of reti-
nal ganglion cells from the neonatal rat. J Neurosci.
1983;3:2532–44.
28. Sayyad Z, Sirohi K, Radha V, Swarup G. 661W is
a retinal ganglion precursor-like cell line in which
glaucoma-­associated optineurin mutants induce cell
death selectively. Sci Rep. 2017;7:16855.
29. Schnichels S, Paquet-Durand F, Löscher M, Tsai T,
Hurst J, Joachim SC, Klettner A. Retina in a dish:
cell cultures, retinal explants and animal models for
common diseases of the retina. Prog Retin Eye Res.
2021;81:100880.
30. Seigel GM. Review: R28 retinal precursor cells: the
first 20 years. Mol Vis. 2014;20:301–6.
31. Sia PI, Wood JPM, Chidlow G, Casson R. Creatine
is neuroprotective to retinal neurons in vitro but not
in vivo. Invest Ophthalmol Vis Sci. 2019;60:4360–77.
32. Singh RK, Nasonkin IO. Limitations and promise
of retinal tissue from human pluripotent stem cells
for developing therapies of blindness. Front Cell
Neurosci. 2020;14:179.
33. Stanke JJ, Fischer AJ. Embryonic retinal cells and
support to mature retinal neurons. Invest Ophthalmol
Vis Sci. 2010;51:2208–18.
34. Turner JE. Promotion of neurite outgrowth and cell
survival in dissociated fetal rat retinal cultures by
a fraction derived from a brain extract. Brain Res.
1985;350:265–74.
35. Uysal O, Sevimli T, Sevimli M, Gunes S, Eker
SA. Cell and tissue culture: the base of biotechnology.
In: Omics technologies and bio-engineering: towards
improving quality of life. London: Academic; 2018.
p. 391–426.
36. Wang Z, Gao F, Zhang M, Zheng Y, Zhang F, Xu L,
Cao L, He W. Intravitreal injection of human retinal
progenitor cells for treatment of retinal degeneration.
Med Sci Monit. 2020;26:e921184.
37. Zalis MC, Johansson S, Englund-Johansson
U. Immunocytochemical profiling of cultured
mouse primary retinal cells. J Histochem Cytochem.
2017;65:223–39.
38. Zayas-Santiago A, Kang Derwent JJ. Preservation of
intact adult rat photoreceptors in vitro: study of dis-
sociation techniques and the effect of light. Mol Vis.
2009;15:1–9.
39. Zhang XM, Li Liu DT, Chiang SW, Choy KW, Pang
CP, Lam DS, Yam GH. Immunopanning purification
and long-term culture of human retinal ganglion cells.
Mol Vis. 2010;16:2867–72.
40. Zhang Z, Xu Z, Yuan F, Jin K, Xiang M. Retinal
organoid technology: where are we now? Int J Mol
Sci. 2021;22:10244.
41. Zhong X, Gutierrez C, Xue T, Hampton C, Vergara
MN, Cao LH, Peters A, Park TS, Zambidis ET, Meyer
JS, Gamm DM, Yau KW, Canto-Soler MV. Generation
of three-dimensional retinal tissue with functional
photoreceptors from human iPSCs. Nat Commun.
2014;5:4047.
 Generation of CRB1 RP
Patient-­Derived iPSCs
and a CRISPR/Cas9-­Mediated
Homology-Directed Repair
Strategy for the CRB1 c.2480G>T
Mutation

Bruna Lopes da Costa, Yao Li, Sarah R. Levi,

Stephen H. Tsang, and Peter M. J. Quinn

Abstract CRB1-associated diseases. This phenotypic

Mutations in the Crumbs-homologue-1
(CRB1) gene lead to a spectrum of severe
inherited retinal diseases, including retinitis
pigmentosa (RP). The establishment of a gen-
otype–phenotype correlation in CRB1 patients
has been difficult due to the substantial vari-
ability and phenotypic overlap between
modulation may be due to several factors,
including genetic modifiers, deep intronic
mutations, isoform diversity, and copy number
variations. Induced pluripotent stem cell
(iPSC)-derived patient retinal organoids are
novel tools that can provide sensitive,
quantitative, and scalable phenotypic assays.
CRB1 RP patient iPSC-derived retinal

B. L. da Costa
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University,
New York, NY, USA
Y. Li · S. R. Levi · P. M. J. Quinn (*)
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University,
New York, NY, USA
e-mail: pq2138@cumc.columbia.edu
S. H. Tsang
Department of Biomedical Engineering, Columbia
University, New York, NY, USA
Edward S. Harkness Eye Institute, Department of
Ophthalmology, Columbia University Irving Medical
Center/New York-Presbyterian Hospital,
New York, NY, USA
Jonas Children’s Vision Care, and Bernard & Shirlee
Brown Glaucoma Laboratory, Department of
Ophthalmology, Columbia University,
New York, NY, USA
Columbia Stem Cell Initiative, Columbia University,
New York, NY, USA
Department of Pathology & Cell Biology, Columbia
University, New York, NY, USA
Institute of Human Nutrition, Columbia University,
New York, NY, USA

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023 571
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_83
572
organoids have shown reproducible
phenotypes compared to healthy retinal
organoids. However, having genetically
defined iPSC isogenic controls that take into
account potential phenotypic modulation is
crucial. In this study, we generated iPSC from
an early-onset CRB1 patient and developed a
correction strategy for the c.2480G>T, p.
(Gly827Val) CRB1 mutation using CRISPR/
Cas9-mediated homology-­directed repair.
Keywords
Crumbs-homologue-1 (CRB1) · Gene editing
· Homology-directed repair (HDR) · Retinitis
pigmentosa (RP) · iPSC-derived retinal
organoids
1 Introduction
Mutations in the Crumbs-homologue-1 (CRB1)
gene cause a range of inherited retinal dystro-
phies (IRDs) that lead to visual impairment or
even complete blindness. Approximately 80,000
patients are affected worldwide, with no treat-
ment to date. CRB1-associated IRDs exhibit high
phenotypic variability and despite more than 489
different mutations being identified in the CRB1
gene (http://www.LOVD.nl/CRB1), there is still
no clear genotype–phenotype correlation [5].
Notably, one lab in particular, the Sallum lab,
was able to identify a direct relationship between
phenotype severity and the mutation effect on
protein functionality in a small Brazilian CRB1
cohort. However, the phenotypic modulation
seen in CRB1-associated IRDs may be due to
several genetic factors, including modifiers, deep
intronic mutations, isoform diversity, and copy
number variations [3].
Induced pluripotent stem cell (iPSC)-derived
patient retinal organoids can provide sensitive,
quantitative, and scalable phenotypic assays [2].
Mutations in CRB1 can cause retinitis pigmen-
tosa type 12 (RP12), which is characterized by
preservation of para-arteriolar retinal pigment
epithelium and progressive visual field loss from
early childhood [5]. CRB1 RP patient iPSC-­
B. L. da Costa et al.
derived retinal organoids have shown reproduc-
ible phenotypes compared to health control
retinal organoids [4]. However, it remains crucial
to account for potential phenotypic modulation in
these iPSC isogenic controls.
In this study, we generated iPSCs from a
CRB1 early-onset RP patient and describe a
clustered-­regularly interspaced short palindromic
repeats (CRISPR)/CRISPR-associated (Cas)-
mediated homology-directed repair (HDR) strat-
egy for the correction of the c.2480G>T, p.
(Gly827Val) CRB1 mutation.
2 Materials and Methods
2.1 Clinical Evaluation
A male patient with early-onset RP presented to
the Edward S. Harkness Eye Institute at Columbia
University (New York, NY) for examination. The
patient’s diagnosis was genetically confirmed,
revealing compound heterozygote mutations
c.2480G>T, p.(Gly827Val) and c.2843G>A, p.
(Cys948Tyr) in the CRB1 gene. The study was
conducted under Columbia University
Institutional Review Board approval (IRB
AAAF1849) and all procedures were performed
according to the tenets of the Declaration of
Helsinki. Informed consent was gathered accord-
ing to IRB AAAF1849. Lidocaine was adminis-
tered to a small region of the skin on the lower
back, and a biopsy skin punch (McKesson,
Virginia) was performed.
2.2 Cell Culture
Fibroblasts from the CRB1 RP patient were
reprogrammed into iPSCs using the CytoTune-­
iPS 2.0 Sendai Reprogramming Kit (Thermo
Fisher Scientific). The generated iPSCs were
tested for their quality and pluripotency by stem
cell marker staining and karyotyping, as previ-
ously described [1, 6]. All iPSC lines were pas-
saged using ReleSR (STEMCELL Technologies)
every 3–6 days, while being maintained in
mTeSR-plus medium (STEM CELL
Generation of CRB1 RP Patient-Derived iPSCs and a CRISPR/Cas9-Mediated Homology-Directed Repair… 573

Technologies). HEK293 cells were cultured single guide RNAs (sgRNAs) (sgRNA1:
using Dulbecco’s modified Earl’s medium 5 ′ - T T C TA C G T G G A A A AT C G A A A -­3 ′ ,
(Gibco), supplemented with 10% fetal bovine sgRNA2: 5′-GTAGATGTCATCTACATT
serum (Gibco), 1% Glutamax, and 1% (v/v) peni- GG-3′). The sgRNA’s were tested using an
cillin/streptomycin (Gibco). in vitro cleavage assay: Combined 125 ng
sgRNA, 500 ng Cas9, 200 ng template (amplified
HEK293 DNA using primers for the c.2480G>T,
2.3 DNA Extraction and PCR p.(Gly827Val) locus) and incubated at 37 °C for
Primers 4 h and subsequently cleavage products separated
on 2% agarose gel. CRB1 patient iPSCs and
The cells were detached from the wells by HEK293 cells were nucleofected with the P3
trypsin. The cells from each well were washed Primary Cell 4D-Nucleofector X Kit (Lonza) on
with Dulbecco’s phosphate-buffered saline an Amaxa Nucleofector 4D using the DS150 pro-
(DPBS) (without Ca2+ and Mg2+) and resuspended gram, according to the manufacturer’s instruc-
with 50 μL DPBS. The cells were then incubated tions. Briefly, 1 × 105 cells was resuspended in a
at 95 °C for 20 min. Subsequently, after cooling, 20 μL electroporation solution (16.4 μL of the P3
4 μL of 20 mg/mL Proteinase K (Promega) was nucleofector solution and 3.6 μL of the supple-
added to each sample. The samples were then ment) for each reaction, and subsequently 4 μM
incubated at 56 °C for 1 h followed by a 30-min single-stranded oligo donor (ssODN), 1.2 μL of
incubation at 95 °C to stop the Proteinase K Alt-R HDR Enhancer, and 5 μL of ribonucleo-
digestion. This crude extract of DNA is then protein mixture, which consists of 125 pmol
ready for PCR purpose. Primers used for PCR at Cas9 protein and 150 pmol gRNA, were added
the c.2480G>T, p.(Gly827Val) locus and transferred to nucleocuvette well. After
(Forward: 5′-GCTAGAGCGCG- nucleofection, 75 μL of prewarmed cell-specific
GCAGACTAG-3′,Reverse:5′-TGGATTGAGAGA- culture medium (DMEM: HEK293, mTeSR plus:
TGCATTGTTTGTTGG-­3′) and c.2843G>A, p. iPSCs) was added and subsequently cells were
(Cys948Tyr) locus (Forward: transferred to one matrigel-coated well (matrigel
5′-TTGGCATGCATTAGGATTTCACT GGA- coating only for iPSCs) of a 96-well plate con-
3′, Reverse: 5′-CCATCATTCACTGACT- taining 100 μL of cell-specific culture medium
GCAAACTTGT-­3′). with a further 2 μL of Alt-R HDR Enhancer.
Twenty-four hours after nucleofection, medium
was removed and fresh medium without Alt-R
2.4 CRISPR-Mediated Gene HDR Enhancer was added. mTeSR-plus medium
Correction with 10 μM ROCK inhibitor (Selleck Chemical)
was used for the iPSCs. Five days after nucleo-
For HDR of the c.2480G>T, p.(Gly827Val) fection, the cells were collected and genomic
CRB1 mutation, we used the Alt-R CRISPR-­ DNA extracted. Hpy188III (New England
Cas9 System and HDR donor oligo from Biolabs) was used to carry out restriction frag-
Integrated DNA Technologies (IDT): Alt-R S.p. ment length polymorphism (RFLP) assay. To
Cas9 Nuclease V3, Alt-R HDR Enhancer, Alt-R determine editing efficiency, we amplified the
HDR Oligo (5′-CAGTCTTCACAAA- CRB1 c.2480G>T, p.(Gly827Val) locus using
ACCTAGGATTTATTT CTG-CTTCTA- primers, performed dideoxy sequencing, and
CGTGGAAAATCGAG-AAAGGAGATGTCATC- finally determined editing efficiency by ICE
TACATTGGTG-GCCTACCTGACAAGCAA- Analysis: https://ice.synthego.com/#/.
GAGACTG-AACTTA-­3′), Alt-R CRISPR-Cas9
574
3 Results and Discussion
Mutations in the CRB1 gene lead to a spectrum of
IRDs [5]. In this study, we reprogrammed fibro-
blasts from a CRB1 patient with early-onset RP
to generate several iPSC clones and confirmed by
dideoxy sequencing that they were compound
heterozygote for the c.2480G>T, p.(Gly827Val)
and c.2843G>A, p.(Cys948Tyr) CRB1 mutations
(Fig. 1a). Upon verifying the iPSC clones’
genomic integrity using G-band karyotyping, we
found that clones 2 and 4 had a normal karyotype
(Fig. 1b). However, in clone 3, a small population
of the iPSCs were found to have a q11.2 duplica-
Fig. 1 Generation and validation of CRB1 retinitis
pigmentosa (RP) patient iPSCs. (a) Dideoxy sequencing
confirmed that iPSC clones established from a RP patient
with compound heterozygote mutations c.2480G>T, p.
(Gly827Val) and c.2843G>A, p.(Cys948Tyr) in the CRB1
gene had the expected genotype. (b) To verify genome
integrity, iPSC lines were analyzed by G-band karyotyp-
B. L. da Costa et al.
tion in chromosome 20, which could incur a pro-
liferative advantage and therefore this clone was
not taken forward for subsequent analysis.
Further, through immunostaining, we confirmed
that clones 2 and 4 were pluripotent, using mark-
ers Nanog and Oct3/4 (Fig. 1c), and that they
could form all three germ layers: Ectoderm
(Nestin and Pax6), Mesoderm (Brachyury and
NCAM), and Endoderm (FOX2A and Sox17)
(Fig. 1d).
Upon validation of these lines, we sought to
develop isogenic controls using CRISPR/Cas9-­
mediated HDR. It is, however, crucial to account
for potential phenotypic modulation within these
ing. (c) Pluripotency of iPSC lines was confirmed by
immunohistochemistry using markers Oct3/4 and Nanog.
(d) Germ layer potential of iPSC was confirmed by immu-
nohistochemistry: Ectoderm (Nestin and Pax6),
Mesoderm (Brachyury and NCAM), and Endoderm
(FOX2A and Sox17). Scale bars, 50 μm
Generation of CRB1 RP Patient-Derived iPSCs and a CRISPR/Cas9-Mediated Homology-Directed Repair…
Fig. 2 CRISPR/Cas9-mediated homology-directed
repair (HDR) strategy for the correction of the c.2480G>T,
p.(Gly827Val) CRB1 mutation. (a) Schematic of HDR
correction strategy for the c.2480G>T, p.(Gly827Val)
CRB1 mutation. (b) In vitro cleavage assay illustrating the
cutting of sgRNA’s 1 and 2. (c) Successful incorporation
controls, especially due to the high phenotypic
variability seen in CRB1-associated IRDs [3, 5].
We designed a HDR approach for the correction
of the c.2480G>T, p.(Gly827Val) CRB1 mutation
(Fig. 2a). We tested two possible sgRNAs via
in vitro cleavage assay (Fig. 2b). SgRNA1 was
taken forward and used in conjugation with a
106-bp ssODN, which included the wild-type
c.2480G and a silent mutation to introduce
575
of ssODN in bulk edited HEK293 cells. In these cells, we
introduced silent mutations to insert Hpy188III, for RFLP
assay, and also to mutate the PAM from sgRNA1. (d)
RFLP assay in bulk edited HEK293 cells shows success-
ful cleavage. (e) ICE analysis showing a 65% editing effi-
ciency in bulk edited HEK293 cells
Hpy188III for screening of future single clones
by RFLP. Further, a silent mutation was intro-
duced in the protospacer adjacent motif (PAM)
for sgRNA1 to prevent Cas9 from recutting the
genomic site. Successfully editing in bulk edited
HEK293 cells was verified 5 days after nucleo-
fection by dideoxy sequencing (Fig. 2c), RFLP
(Fig. 2d), and ICE analysis (Fig. 2e). ICE analy-
sis showed a 65% editing efficiency in bulk
576
edited HEK293 cells. Initial analysis on the bulk
edited patient iPSCs showed 5% editing effi-
ciency by ICE analysis but no cleavage products
could be seen by RFLP (data not shown). Our
next steps are to generate single clone isogenic
controls. Together, the work outlined in this study
creates a platform for the thorough analysis of
CRB1 RP patient iPSC-derived retinal
organoids.
Acknowledgments S.H.T. and The Jonas Children’s
Vision Care and Bernard & Shirlee Brown Glaucoma
Laboratory are supported by the National Institutes of
Health (P30EY019007, R01EY018213, R01EY024698,
R01EY026682, R24EY027285, U01EY030580),
National Cancer Institute Core (5P30CA013696),
Foundation Fighting Blindness (TA-NMT-0116-0692-
COLU), the Research to Prevent Blindness (RPB)
Physician-Scientist Award. B.L.D. is a recipient of the
Capes PhD scholarship. P.M.J.Q. is the current recipient
of a Curing Retinal Blindness Foundation (CRBF) grant,
a Knights Templar Eye Foundation (KTEF) Career Starter
grant, an Uplifting Athletes Young Investigator grant, and
a New York Stem Cell Foundation (NYSCF)—
Druckenmiller Fellowship.
Conflict of Interest Stephen H. Tsang receives
financial support from Abeona Therapeutics, Inc. and
Emendo. He is also the founder of Rejuvitas and is on
the scientific and clinical advisory board for Nanoscope
Therapeutics.
B. L. da Costa et al.
References
1. Li Y, Tsai YT, Hsu CW, Erol D, Yang J, Wu WH, Davis
RJ, Egli D, Tsang SH. Long-term safety and efficacy
of human-induced pluripotent stem cell (iPS) grafts in
a preclinical model of retinitis pigmentosa. Mol Med.
2012;18:1312–9.
2. Manafi N, Shokri F, Achberger K, Hirayama M,
Mohammadi MH, Noorizadeh F, Hong J, Liebau S,
Tsuji T, Quinn PMJ, Mashaghi A. Organoids and organ
chips in ophthalmology. Ocul Surf. 2020;19:1–15.
3. Motta FL, Salles MV, Costa KA, Filippelli-Silva R,
Martin RP, Sallum JMF. The correlation between
CRB1 variants and the clinical severity of Brazilian
patients with different inherited retinal dystrophy
phenotypes. Sci Rep. 2017;7:8654.
4. Quinn PM, Buck TM, Mulder AA, Ohonin C, Alves
CH, Vos RM, Bialecka M, van Herwaarden T, van Dijk
EHC, Talib M, Freund C, Mikkers HMM, Hoeben RC,
Goumans M-J, Boon CJF, Koster AJ, Chuva de Sousa
Lopes SM, Jost CR, Wijnholds J. Human iPSC-­derived
retinas recapitulate the fetal CRB1 CRB2 complex
formation and demonstrate that photoreceptors and
Müller glia are targets of AAV5. Stem Cell Rep.
2019;12:906–19.
5. Talib M, et al. Genotypic and phenotypic characteristics
of CRB1-associated retinal dystrophies: a long-term
follow-up study. Ophthalmology. 2017;124:884–95.
6. Tso A, Ragi S, Costa BLD, Fehnel A, Li Y, Quinn
PMJ. Generation of human iPSC-derived retinal
organoids for assessment of AAV-mediated gene
delivery. Methods Mol Biol. 2021; (in press).
 Inducing Neural Regeneration
from Glia Using Proneural bHLH
Transcription Factors
Levi Todd
Abstract
Endogenous regeneration strategies to replace
lost neurons hold great promise for treating
neurodegenerative disorders. In the majority
of cases, neural regeneration is induced by
converting resident glial cells into neurogenic
precursors. This review will outline how pro-
neural bHLH transcription factors can be used
to reprogram glia in the brain and retina into a
source for new neurons.
Keywords
Regeneration · Glia · Astrocyte · NG2 ·
Reprogramming · Müller glia · Retina ·
bHLH Transcription factor ·
Neurodegeneration
1 Introduction
Neurodegenerative diseases result in permanent
disability because once neurons are lost they are
not replaced. Cell replacement strategies aim to
restore lost neurons and offer therapeutic hope to
patients in late-stage neurodegenerative diseases.
L. Todd (*)
Department of Biological Structure, University of
Washington,
Seattle, WA, USA
e-mail: ljtodd@uw.edu
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1_84
Replacement of lost neurons is being pursued
through both exogenous and endogenous
strategies [33]. In exogenous strategies, either
stem cells or differentiated neurons are
transplanted into the diseased nervous system
with hopes that these cells can wire into existing
circuitry and restore lost function. In endogenous
strategies, tissue resident cells are targeted to
serve as a source of new neurons. The primary
approach in endogenous regeneration is to
reprogram glial cells into neurogenic precursors.
Glia-to-neuron reprogramming occurs
naturally in regenerative species [34]. For
example, in the retina of zebrafish, Müller glia
respond to injury by reinitiating a molecular
program akin to retinal progenitor cells [20].
These reprogrammed Müller glia then go onto
regenerate retinal neurons capable of restoring
lost vision [12]. In mammals, glia do not
spontaneously reprogram after CNS injury but
instead initiate an inflammatory response [7].
Therefore, the goal in regenerative neuroscience
is to develop strategies in the mammal that can
steer glia into a neurogenic response when neural
loss occurs. To achieve this goal, our group and
others have been using developmental
transcription factors (TFs) to revert glia back into
a neurogenic progenitor state [6, 13, 34]. This
mini-review will outline strategies using
proneural basic helix-loop-helix (bHLH) TFs to
induce glia-to-neuron conversion in the brain and
retina.
577
578
Proneural bHLH TFs are anciently conserved
across the animal kingdom and are crucial for
neuronal differentiation. The proneural bHLH
TFs that have been used in glial reprogramming
in the mammalian CNS can be grouped into four
subfamilies: (1) Achaete-Scute complex-like
(Ascl1), (2) Neurogenin (Neurog2), (3) Atonal–
homolog (Atoh1 and 7), and (4) Neurod
(Neurod1) [1]. This review will summarize how
each of these classes of proneural factors have
been used to engineer glial reprogramming
in vivo in the injured nervous system.
2 Ascl1
In development, Ascl1 promotes proliferation
and neural differentiation of progenitor cells
across the brain and retina [16, 21]. This neuro-
genic capacity of Ascl1 has been leveraged by
multiple groups to induce progenitor-like charac-
teristics in mature glial cells (see Table 1). In the
retina, lentivirus-mediated overexpression of
Ascl1 can reprogram Müller glia into a neuro-
genic state in vitro [31]. In follow-up studies, a
transgenic mouse was created that allowed for
in vivo inducible expression of Ascl1, specifi-
cally in Müller glia [39]. After retinal injury,
Ascl1 was capable of stimulating neural regen-
eration from Müller glia in young mice but not in
adults [39]. However, combining Ascl1 overex-
pression with a histone deacetylase inhibitor to
allow for more open chromatin led to neural
regeneration in the adult mouse retina [22]. These
glial-derived neurons are capable of functionally
integrating into the damaged retinal circuit, sug-
gesting a future therapeutic avenue for cell resto-
ration in diseased retinas [22, 23].
In cortical glia, Ascl1 is typically ineffective
or only stimulates a small amount of neurogene-
sis [14, 18, 28]. Although in the midbrain Ascl1
alone has been reported to convert astrocytes into
neurons in vivo [25], this report failed to find
Brdu+ neurons, suggesting Ascl1 did not induce
a proliferating progenitor state in astrocytes.
Ascl1 can significantly potentiate glial-mediated
L. Todd
neurogenesis when combined with other factors.
Ascl1 in combination with Sox2, Brn2, Lmx1a of
Mytl1 can induce neurons (typically GABAergic)
from both astrocytes and NG2 glia [18, 30, 37,
38]. Additionally, when cellular stress pathways
are mitigated by overexpression of Nurr1, Ascl1
is capable of inducing neural conversion from
cortical astrocytes on its own [28]. In a recent
study, a retrovirus was used to infect dividing glia
to overexpress Ascl1 and Dlx2 in hippocampal
glia in a model of temporal lobe epilepsy [24].
The combination of Ascl1 and Dlx2 was suffi-
cient to regenerate GABAergic neurons that were
lost to seizures and these new cells were capable
of integrating into circuitry and reducing seizure
frequency [24]. These studies combined with
findings in the retina demonstrate the therapeutic
potential of Ascl1-mediated reprogramming in
the diseased nervous system.
3 Neurogenin (Neurog2)
Neurog2 is expressed in neurogenic progenitors
in the brain and retina where it promotes differ-
entiation and subtype specification [2, 32].
In the brain, Neurog2 is the most efficient
proneural bHLH at inducing neural conversion
from glia [11, 19]. Neurog2, while sufficient to
induce neural reprogramming, is a significant
stressor to cells [11]. Combining Neurog2 with
factors to reduce cellular stress pathways or
inhibit apoptosis significantly enhances glial-to-
neuron conversion [11, 14, 19, 28]. Interestingly,
in the brain, Neurog2 seems to bias glial-induced
neurons to a glutamatergic fate [11, 28]. This is
consistent with Neurog2’s role in development
where it biases progenitors to an excitatory fate
[15]. These data suggest that the particular bHLH
TF used will influence the ultimate fate
acquisition in vivo. This has been confirmed with
astrocytes in vitro where Ascl1 induces
GABAergic fates and Neurog2 induces
glutamatergic fates through distinct downstream
targets [27]. The ability of Neurog2 to reprogram
Table 1 Studies reporting in vivo glia to neuron reprogramming in brain and retina
Type
TF used Area of CNS reprogrammed Neuron type induced Fate mapping Citation
Ascl1 Retina Müller glia Bipolar Cre-lineage tracing, EdU Jorstad et al. [22, 23] and
labeling Todd et al. [35]
Ascl1 (+Dlx2) Hippocampus Astrocytes, NG2 GABAergic Retrovirus with BrdU labeling Lentini et al. [24]
Ascl1 Midbrain, striatum, Astrocytes GABAergic + glutamatergic AAVs with GFAP promoter Liu et al. [25]
somatosensory neurons
Ascl1 (+Brn2/Myt1l) Striatum Astrocytes NeuN+ Lentivirus with Cre Torper et al. [37]
Ascl1 (+Sox2) Cortex Astrocytes, NG2 Immature neurons Cre-lineage tracing Heinrich et al. [18]
Ascl1 (with Nurr1) Cortex Astrocytes Undetermined AAV virus combined with Mattugini et al. [28]
Cre-mice + EdU
Ascl1 (with Striatum NG2 glia Parvalbumin interneurons AAV virus combined with Pereira et al. [30] and
Lmx1a + Nurr1) Cre-lineage Torper et al. [38]
Atoh1 or 7 (with Retina Müller glia Bipolars, amacrines, ganglion-like Cre-lineage tracing, EdU Todd et al. [36]
Ascl1) neurons labeling
NeuroD1 Cortex Astrocytes, NG2 Astros = glutamatergic Retrovirus Guo et al. [17]
NG2 = glutamatergic and
GABAergic
NeuroD1 Cortex Astrocytes Excitatory and inhibitory neurons AAV with GFAP promoter Chen et al. [10]
Neurog2 Cortex Astrocytes Glutamatergic Retrovirus Gascon et al. [11]
Inducing Neural Regeneration from Glia Using Proneural bHLH Transcription Factors

Neurog2 (with Nurr1) Cortex Astrocytes Pyrimadial neurons AAV virus combined with Mattugini et al. [28]
Cre-mice + Edu
Neurog2 (with Bcl2) Cortex + thalamus Astrocytes Cortical neurons or thalamic Retrovirus + BrdU-labeling Herrero-Navarro et al. [19]
neurons
579
580
glia in the adult retina in vivo has yet to be
explored.
4 Atonal–Homolog
Atonal genes (Atoh1/7) are deeply conserved
regulators of neurogenesis in both the retina and
the brain [3, 8]. Unlike Ascl1 and Ngn2, Atoh7 is
not expressed in cycling progenitors but is
induced as cells terminally differentiate into neu-
rons [9]. The ability of Atonal factors to repro-
gram glia in the brain has yet to be explored.
Although Atoh1 was identified as the most effec-
tive factor in a recent screen of all human tran-
scription factors able to direct induced pluripotent
stems cells into neuron [29]. This suggests Atonal
factors are an attractive target for neural regener-
ation strategies in the brain. In the retina, Atoh7
has been demonstrated to neurogenically repro-
gram glia in the medaka fish. Unlike zebrafish,
Müller glia in the medaka do not spontaneously
reprogram into progenitors in response to injury
[26]. Interestingly, forced overexpression of
Atoh7 is sufficient to stimulate neurogenesis
from Medaka retinal glia [26]. Recently, our
group tested whether Atonal transcription factors
could aid in glia-to-neuron reprogramming in the
mammalian retina. Atoh7 overexpression in
Müller glia in vitro induced a progenitor state
capable of neurogenesis [36]. The ability of
Atoh7 to reprogram retinal glia in vivo remains to
be determined. However, we found that Atoh1, a
closely related TF to Atoh7, significantly
enhanced Ascl1-mediated Müller glia repro-
gramming in the adult mouse retina. The combi-
nation of Ascl1:Atoh1 also redirected the fate of
induced neurons from what is typically seen with
Ascl1 [36]. Ascl1 induces Müller glia to take on
a bipolar neuron fate, while Ascl1:Atoh1 stimu-
lates regeneration of primarily retinal ganglion-­
like cells [36]. This study provides a proof of
principle that combinations of proneural bHLH
TFs are ideal candidates for improving glial
reprogramming as well as influencing the ulti-
mate neural cell type generated in the retina.
L. Todd
5 NeuroD
Similar to Atonal genes, NeuroD factors are
upregulated in postmitotic cells where they poten-
tiate neural differentiation [5]. NeuroD1 delivered
via retrovirus to infect dividing glia was reported
to reprogram both astrocytes and NG2 glia in a
mouse model of Alzheimer’s disease [17].
Interestingly, NeuroD1 induced neurons with a
glutamatergic fate from astrocytes but repro-
grammed NG2 glia to both glutamatergic and
GABAergic fate [17]. This suggests that in addi-
tional to the TF used, the cell type of origin sig-
nificantly influences the induced cell fate choice.
Using Adeno-associated viruses (AAVs) with
a Glial fibrillary acidic protein (GFAP) promoter,
NeuroD1 was reported to induce neurons from
glia at an unprecedented efficacy rate (>90%
infected astrocytes) after ischemic stroke and
facilitate functional recovery [10]. While this
finding potentially highlights the therapeutic rel-
evance of this approach, concerns have clouded
interpretations of AAV-mediated glial reprogram-
ming [6, 40]. A recent report demonstrated that
despite GFAP being a glial specific marker, an
AAV using the GFAP promoter to drive NeuroD1
surprisingly lead to labeling of endogenous neu-
rons [40]. Using classical developmental biology
techniques such as EdU labeling, transgenic lin-
eage tracing, and retrograde tracing, it was con-
vincingly shown that AAVs using the GFAP
promoter to drive NeuroD1 labeled already exist-
ing neurons and not newly generated cells [40].
More concerning, when stringent controls were
used to induce NeuroD1, specifically and reliably
in astrocytes, no neural reprogramming was
observed [40]. This leaves NeuroD as a factor
capable of inducing neuronal reprogramming in
doubt.
6 Outlook
Despite the significant setback of methodological
concerns regarding AAV-mediated glial repro-
graming, multiple lines of evidence suggest that
glia-to-neuron conversion is a bona fide phenom-
enon that has the potential to be harnessed for
therapeutic cell replacement. In vitro, live imag-
Inducing Neural Regeneration from Glia Using Proneural bHLH Transcription Factors
ing has definitively shown that astrocytes can be
reprogrammed into neural cells by delivery of
neurogenic TFs [4, 11]. In vivo, because neurons
are postmitotic, reprogrammed glial cells that go
through a proliferating progenitor state can be
labeled with BrdU or EdU. Labeling for BrdU+
or EdU+ neurons demonstrate whether neurons
are newly derived or existing cells being artefac-
tually labeled. Multiple studies have demon-
strated BrdU/EdU labeled neurons after glia
reprogramming, both in the brain and retina [14,
19, 23, 24, 28, 35, 36]. Furthermore, classical
transgenic glial-lineage tracing with Cre-ERT2
mice have been used to convincingly demonstrate
the glial-origin of new neurons [18, 20, 22, 28,
36]. Finally, scRNA-seq technologies can be lev-
eraged to observe intermediate molecular profiles
while glia are in the process of reprogramming to
neurogenic progenitors. Indeed, this has been
observed in both the brain and retina, further con-
firming the ability to stimulate neural regenera-
tion from glia in vivo [20, 23, 36, 41]. The table
included in this review summarizes reprogram-
ming studies, describes which factor was used,
where is the CNS, and what lineage-tracing con-
trols were employed (Table 1).
The first report of in vivo reprogramming of
glial cells in the mammalian CNS is less than a
decade old [37]. Since then, the field has rapidly
developed, discovering diverse strategies to
reprogram glial cells in various regions of the
nervous system. This body of work highlights
exciting future opportunities to repair the dam-
aged brain and retina. With important method-
ological concerns now being considered, the field
should now be able to press forward with more
reliable technical approaches as we rapidly
advance to developing strategies that may one
day be used in human diseases.
References
1. Baker NE, Brown NL. All in the family: proneural
bHLH genes and neuronal diversity. Development.
2018;145:dev159426.
2. Bassett EA, Wallace VA. Cell fate determination in the
vertebrate retina. Trends Neurosci. 2012;35:565–73.
3. Ben-Arie N, Bellen HJ, Armstrong DL, McCall
AE, Gordadze PR, Guo Q, Matzuk MM, Zoghbi
581
HY. Math1 is essential for genesis of cerebellar
granule neurons. Nature. 1997;390:169–72.
4. Berninger B, Costa MR, Koch U, Schroeder T,
Sutor B, Grothe B, Gotz M. Functional properties of
neurons derived from in vitro reprogrammed postnatal
astroglia. J Neurosci. 2007;27:8654–64.
5. Bertrand N, Castro DS, Guillemot F. Proneural genes
and the specification of neural cell types. Nat Rev
Neurosci. 2002;3:517–30.
6. Blackshaw S, Sanes JR. Turning lead into gold:
reprogramming retinal cells to cure blindness. J Clin
Invest. 2021;131:e146134.
7. Bringmann A, Iandiev I, Pannicke T, Wurm A,
Hollborn M, Wiedemann P, Osborne NN, Reichenbach
A. Cellular signaling and factors involved in Muller
cell gliosis: neuroprotective and detrimental effects.
Prog Retin Eye Res. 2009;28:423–51.
8. Brown NL, Patel S, Brzezinski J, Glaser T. Math5
is required for retinal ganglion cell and optic nerve
formation. Development. 2001;128:2497–508.
9. Brzezinski JAT, Prasov L, Glaser T. Math5 defines
the ganglion cell competence state in a subpopulation
of retinal progenitor cells exiting the cell cycle. Dev
Biol. 2012;365:395–413.
10. Chen YC, Ma NX, Pei ZF, Wu Z, Do-Monte FH,
Keefe S, Yellin E, Chen MS, Yin JC, Lee G, et al. A
NeuroD1 AAV-based gene therapy for functional brain
repair after ischemic injury through in vivo astrocyte-­
to-­neuron conversion. Mol Ther. 2020;28:217–34.
11. Gascon S, Murenu E, Masserdotti G, Ortega F,
Russo GL, Petrik D, Deshpande A, Heinrich C,
Karow M, Robertson SP, et al. Identification and
successful negotiation of a metabolic checkpoint
in direct neuronal reprogramming. Cell Stem Cell.
2016;18:396–409.
12. Goldman D. Muller glial cell reprogramming
and retina regeneration. Nat Rev Neurosci.
2014;15:431–42.
13. Gotz M, Bocchi R. Neuronal replacement: concepts,
achievements, and call for caution. Curr Opin
Neurobiol. 2021;69:185–92.
14. Grande A, Sumiyoshi K, Lopez-Juarez A, Howard
J, Sakthivel B, Aronow B, Campbell K, Nakafuku
M. Environmental impact on direct neuronal
reprogramming in vivo in the adult brain. Nat
Commun. 2013;4:2373.
15. Guillemot F. Cell fate specification in the mammalian
telencephalon. Prog Neurobiol. 2007;83:37–52.
16. Guillemot F, Hassan BA. Beyond proneural: emerging
functions and regulations of proneural proteins. Curr
Opin Neurobiol. 2017;42:93–101.
17. Guo Z, Zhang L, Wu Z, Chen Y, Wang F, Chen
G. In vivo direct reprogramming of reactive glial
cells into functional neurons after brain injury and
in an Alzheimer’s disease model. Cell Stem Cell.
2014;14:188–202.
18. Heinrich C, Bergami M, Gascon S, Lepier A, Vigano
F, Dimou L, Sutor B, Berninger B, Gotz M. Sox2-­
mediated conversion of NG2 glia into induced
neurons in the injured adult cerebral cortex. Stem Cell
Rep. 2014;3:1000–14.
582
19. Herrero-Navarro A, Puche-Aroca L, Moreno-Juan V,
Sempere-Ferrandez A, Espinosa A, Susin R, Torres-­
Masjoan L, Leyva-Diaz E, Karow M, Figueres-
Onate M, et al. Astrocytes and neurons share
region-­specific transcriptional signatures that confer
regional identity to neuronal reprogramming. Sci Adv.
2021;7:eabe8978.
20. Hoang T, Wang J, Boyd P, Wang F, Santiago
C, Jiang L, Yoo S, Lahne M, Todd LJ, Jia M,
et al. Gene regulatory networks controlling
vertebrate retinal regeneration. Science.
2020;370:eabb8598.
21. Imayoshi I, Kageyama R. bHLH factors in self-­
renewal, multipotency, and fate choice of neural
progenitor cells. Neuron. 2014;82:9–23.
22. Jorstad NL, Wilken MS, Grimes WN, Wohl SG,
VandenBosch LS, Yoshimatsu T, Wong RO, Rieke
F, Reh TA. Stimulation of functional neuronal
regeneration from Muller glia in adult mice. Nature.
2017;548:103–7.
23. Jorstad NL, Wilken MS, Todd L, Finkbeiner C,
Nakamura P, Radulovich N, Hooper MJ, Chitsazan
A, Wilkerson BA, Rieke F, et al. STAT signaling
modifies Ascl1 chromatin binding and limits neural
regeneration from Muller glia in adult mouse retina.
Cell Rep. 2020;30:2195–2208.e5.
24. Lentini C, d’Orange M, Marichal N, Trottmann
MM, Vignoles R, Foucault L, Verrier C, Massera C,
Raineteau O, Conzelmann KK, et al. Reprogramming
reactive glia into interneurons reduces chronic seizure
activity in a mouse model of mesial temporal lobe
epilepsy. Cell Stem Cell. 2021;28:2104–2121.e10.
25. Liu Y, Miao Q, Yuan J, Han S, Zhang P, Li S, Rao Z,
Zhao W, Ye Q, Geng J, et al. Ascl1 converts dorsal
midbrain astrocytes into functional neurons in vivo. J
Neurosci. 2015;35:9336–55.
26. Lust K, Sinn R, Perez Saturnino A, Centanin L,
Wittbrodt J. De novo neurogenesis by targeted
expression of atoh7 to Muller glia cells. Development.
2016;143:1874–83.
27. Masserdotti G, Gillotin S, Sutor B, Drechsel D,
Irmler M, Jorgensen HF, Sass S, Theis FJ, Beckers
J, Berninger B, et al. Transcriptional mechanisms of
proneural factors and REST in regulating neuronal
reprogramming of astrocytes. Cell Stem Cell.
2015;17:74–88.
28. Mattugini N, Bocchi R, Scheuss V, Russo GL, Torper
O, Lao CL, Gotz M. Inducing different neuronal
subtypes from astrocytes in the injured mouse cerebral
cortex. Neuron. 2019;103:1086–1095.e5.
29. Ng AHM, Khoshakhlagh P, Rojo Arias JE, Pasquini G,
Wang K, Swiersy A, Shipman SL, Appleton E, Kiaee
K, Kohman RE, et al. A comprehensive library of
human transcription factors for cell fate engineering.
Nat Biotechnol. 2021;39:510–9.
L. Todd
30. Pereira M, Birtele M, Shrigley S, Benitez JA, Hedlund
E, Parmar M, Ottosson DR. Direct reprogramming of
resident NG2 glia into neurons with properties of fast-­
spiking parvalbumin-containing interneurons. Stem
Cell Rep. 2017;9:742–51.
31. Pollak J, Wilken MS, Ueki Y, Cox KE, Sullivan JM,
Taylor RJ, Levine EM, Reh TA. ASCL1 reprograms
mouse Muller glia into neurogenic retinal progenitors.
Development. 2013;140:2619–31.
32. Schuurmans C, Armant O, Nieto M, Stenman
JM, Britz O, Klenin N, Brown C, Langevin LM,
Seibt J, Tang H, et al. Sequential phases of cortical
specification involve Neurogenin-dependent and
-independent pathways. EMBO J. 2004;23:2892–902.
33. Stern JH, Tian Y, Funderburgh J, Pellegrini G, Zhang
K, Goldberg JL, Ali RR, Young M, Xie Y, Temple
S. Regenerating eye tissues to preserve and restore
vision. Cell Stem Cell. 2018;23:453.
34. Todd L, Reh TA. Comparative biology of vertebrate
retinal regeneration: restoration of vision through
cellular reprogramming. Cold Spring Harb Perspect
Biol. 2021;14:a040816.
35. Todd L, Finkbeiner C, Wong CK, Hooper MJ, Reh
TA. Microglia suppress Ascl1-induced retinal
regeneration in mice. Cell Rep. 2020;33:108507.
36. Todd L, Hooper MJ, Haugan AK, Finkbeiner C,
Jorstad N, Radulovich N, Wong CK, Donaldson PC,
Jenkins W, Chen Q, et al. Efficient stimulation of
retinal regeneration from Muller glia in adult mice
using combinations of proneural bHLH transcription
factors. Cell Rep. 2021;37:109857.
37. Torper O, Pfisterer U, Wolf DA, Pereira M, Lau
S, Jakobsson J, Bjorklund A, Grealish S, Parmar
M. Generation of induced neurons via direct
conversion in vivo. Proc Natl Acad Sci U S A.
2013;110:7038–43.
38. Torper O, Ottosson DR, Pereira M, Lau S, Cardoso
T, Grealish S, Parmar M. In vivo reprogramming of
striatal NG2 glia into functional neurons that integrate
into local host circuitry. Cell Rep. 2015;12:474–81.
39. Ueki Y, Wilken MS, Cox KE, Chipman L, Jorstad
N, Sternhagen K, Simic M, Ullom K, Nakafuku
M, Reh TA. Transgenic expression of the proneural
transcription factor Ascl1 in Muller glia stimulates
retinal regeneration in young mice. Proc Natl Acad
Sci U S A. 2015;112:13717–22.
40. Wang LL, Serrano C, Zhong X, Ma S, Zou Y, Zhang
CL. Revisiting astrocyte to neuron conversion with
lineage tracing in vivo. Cell. 2021;184:5465–5481.
e16.
41. Zamboni M, Llorens-Bobadilla E, Magnusson JP,
Frisen J. A widespread neurogenic potential of
neocortical astrocytes is induced by injury. Cell Stem
Cell. 2020;27:605–617.e5.
 Index

A Autophagy, 11, 51, 144, 208, 211, 212, 320–322, 344,

AAV gene therapy, 125 385, 386, 404, 495, 497, 559
AAV serotypes, 119–121, 132, 133, 144 Avian myeloblastosis virus (AMV), 109–113
ABCA4-associated retinopathy, 289–294 Axonal degeneration, 224, 226
Abelson helper integration site 1 (AHI1), 178–180 Axonal transport, 223–226
Achromatopsia, 270, 293, 348, 354, 552
Actin cytoskeleton, 313, 509
Adeno-associated virus (AAV), 117–121, 125, 126, 129, B
132, 133, 138, 139, 270, 273, 328, 354, 552, 560, Bacteria, 15, 525
579, 580 Basal laminar deposit (BLamD), 5–7, 51, 68, 209, 337,
ADP-ribosylation factor-like 3 (ARL3), 177–180 339
Aerobic glycolysis, 429, 432, 435–438, 440 Base editing, 104, 105
Age-related macular degeneration (AMD), 4, 7, 9–12, β-catenin, 241–244, 246, 247
17, 22–24, 27–31, 37–46, 50–52, 55–57, 61–65, Beta5 integrin, 518
68, 70, 73–76, 84, 88–92, 133, 160, 161, 165, bHLH transcription factor, 577–581
167, 207–212, 231, 232, 249, 258–260, 298, 311, Biomarkers, 56, 81–84, 90–92, 166, 169, 170, 224, 226,
312, 321–322, 328–331, 339, 340, 359, 361, 362, 259, 430
371–374, 404, 462, 488–490, 528, 529, 543, 551 Bisretinoids, 16–19
Aging, 17, 23, 27, 50, 51, 68, 70, 170, 210, 225, 226, Blindness, v, vii, 7, 37, 41–43, 55, 65, 73, 83, 104, 113,
359, 360, 373, 374, 462, 490, 543, 561 137, 143, 166, 167, 189, 207, 219, 242, 254, 260,
Alpha (α)-helix, 29, 286, 501, 502, 533–536 270, 271, 293, 303, 330, 340, 342, 358, 371, 372,
Amphipathic helix, 533–536 377, 387, 404, 407, 415, 425, 446, 473, 490, 510,
AMV RT Prime Editors, 110 528, 551, 553, 555, 572
Amyloid, 31, 90, 265–267 Blood-retinal barrier (BRB), 200, 231, 241, 242, 244,
Animal models, vi, 23, 31, 65, 92, 121, 136, 138, 139, 246, 249, 250, 304, 471, 488, 490
169, 190, 202, 203, 218, 225, 226, 231, 272, 310, Bruch’s membrane, 5, 12, 27, 31, 41, 51, 61, 90, 208,
322, 343, 366, 368, 372, 390, 391, 421, 445, 446, 310–312, 321, 336, 337, 339, 359–361, 373, 539
452, 453, 457, 458, 543, 550–553, 556, 557, 565
Anti-AAV immune response, 118–121
Anti-diabetic drugs, 76 C
Antioxidant, 10, 16, 19, 75, 444–446 Capsid, 117, 120, 121, 132, 133, 354
Antioxidant response, 444 Carotenoids, 15–20, 534
Apolipoprotein A1 (ApoA1), 56, 391, 392 Cav1 complexes, 250–254
Apoptosis, 16, 57, 82, 91, 169, 198, 199, 202, 224, 225, Cav1.4, 269–271
270, 303–305, 354, 357, 365, 528, 558, 578 Caveolae, 244, 249, 252
Arl3, 283–287 Caveolin-1 (Cav1), 244–246, 249–254
Arl13B, 177, 283, 284, 286, 287 Cavin1/PTRF, 252
ARMS2, 28–31, 64, 328, 556 CD68, 200, 207–212
Aryl hydrocarbon receptor (Ahr), 209 CD163, 208
Astrocyte, 230, 231, 473–476, 578–580 Cell death, 17, 75, 90–92, 169, 191, 198, 199, 216, 218,
ATP Binding Cassette Subfamily A Member 4 (Abca4), 224, 231, 236, 237, 242, 284, 298, 303–305, 321,
17, 18, 167, 289–293 322, 344, 349, 351, 424, 445, 446, 474, 480, 481,
ATP-binding cassette transporter A1 (ABCA1), 56–57 509, 524, 560, 561

© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature 583
Switzerland AG 2023
J. D. Ash et al. (eds.), Retinal Degenerative Diseases XIX, Advances in Experimental Medicine
and Biology 1415, https://doi.org/10.1007/978-3-031-27681-1
584 Index

Cell lines, 30, 31, 65, 89, 92, 216, 219, 250, 503, 540, Disease mechanisms, 62, 65, 166, 169, 180, 293, 366,
542, 550, 565, 566 452, 453, 551
Cellular retinaldehyde binding protein (CRALBP), 208, Disease-modeling, 549
534–536 Disease progression, 10, 41, 84, 137, 139, 200, 203, 209,
Cellular stress, 543, 578 259, 300, 310, 344, 366, 369, 405, 528, 556, 561
CEP290, 174–176, 180, 186, 266, 372, 396, 398, 400, Diseasome, 166–170
401, 552 DNA damage, 17, 57, 88
Ceramide, 39, 40, 303–305 Dolichol, 449–453
Ceramide synthases, 304 Dolichyl phosphate (Dol-P), 450, 451, 453
Cholesterol, 11, 51, 56, 57, 328, 391, 449, 451, 452, 468, DOLK, 450, 451, 453
470 DOLPP1, 450, 451, 453
Choroid, 19, 20, 23, 28, 31, 63–65, 68–70, 207, 311, 312, Dominant negative effects, 136, 137
321, 359–362, 539, 543 Drug, 46, 52, 62, 73–76, 149, 151–153, 165, 166,
Choroidal neovascularization (CNV), 22, 23, 27, 56, 68, 168–170, 186, 267, 331, 369, 404, 467–469,
70, 208, 209, 462 474–475, 490, 529, 530, 553, 566
Cilia, 174, 177, 279, 283, 284, 396–402, 507, 509, 557, Drug repurposing, 75, 76
560
Circadian clock, 542, 543
Clusterin (CLU), 216–219 E
Cnga3, 270, 349–351, 354 Elastin, 68–70, 310, 362
Collagen, 68, 310–314 Electroretinography (ERG), 68, 136, 189–191, 202, 259,
Complement, 10–12, 17, 22, 28, 29, 31, 51, 62, 68–70, 271, 273, 290, 291, 293, 343, 344, 348–351, 366,
73, 75, 90, 160, 161, 197, 200, 208, 290, 367, 373, 374, 390, 391, 405, 407, 416, 417,
360–362, 373, 380, 385, 476, 553 422–425, 488, 489
Condensate, 263–267 ELOVL4, 258–260
Cone, 5, 28, 56, 98, 118, 136, 137, 143–146, 176, 177, Endoplasmic reticulum-associated degradation (ERAD),
184, 190–192, 199, 230, 236, 269–273, 290–293, 357, 358, 494, 497
298, 299, 312, 321, 328, 329, 342, 343, 347–351, Endoplasmic reticulum (ER) calcium homeostasis, 354,
354–358, 367, 368, 377, 380, 390, 404–407, 436, 357
444, 451, 508, 516–518, 551, 552, 555, 556 Endoplasmic reticulum stress, 444, 446, 543, 551
Cone photoreceptors, 5, 52, 144, 190–193, 236, 284, Enhanced S-cone Syndrome (ESCS), 189–193
285, 328, 329, 348, 353, 354, 365, 424, 489, 516, Exonic splicing enhancers (ESEs), 184–186
550 Exonic variants, 184, 186
Connecting cilium (CC), 61, 68, 174, 245–247, 265–266, Exosomes, 45, 46, 81, 82, 88, 90, 91
372, 396, 398, 401, 508, 552, 557 Expansion microscopy (ExM), 396–402
Connectomics, 297–300 Expression quantitative trait loci (eQTL), 62–65, 373
Connexins (Cx), 229–231 Extracellular matrix (ECM), 5, 22–24, 28, 31, 51, 62, 68,
Crumbs-homologue-1 (CRB1), 104–106, 200, 560, 90, 216, 309–314, 321, 360–362, 380, 457, 461
572–576 Extracellular vesicles (EVs), 45–46, 81–84, 88–92, 279,
CRX mutations, 136, 139 391, 392
CTRP5/C1QTNF5, 340 Eye development, 328, 330
Cyclic nucleotide-gated (CNG), 269–272, 353–355, 357, Eye diseases, vi, 31, 83, 120, 191, 259, 260, 328, 330, 331
358
Cyclic nucleotide-gated channel, 349
Cytokine, 11, 50, 69, 70, 197–201, 207–210, 216, 218, F
250, 328, 329, 380, 411, 412, 446, 490, 522, 524 Fam161a, 366–369
Cytopathy, 523, 524 Fixed, 38, 40, 242, 293, 378, 399, 401, 405, 417, 422,
430, 469, 470, 501, 516, 522
Fluoxetine, 75
D Free-energy, 158–161
D477G, 416, 417 Functional genomics, 378, 381
Daily rhythm, 516 Fundus autofluorescent spots, 337, 338
DHDDS, 450–452
Diabetes, 50, 76, 331, 404, 489, 490, 529, 542
Disc, 185, 224, 266, 277–280, 285, 338, 339, 389–392, G
401, 500, 507–510 Gap junctions, 229–231, 299
Disc enclosure, 266, 279, 280, 509 Gene augmentation, 104, 105, 135–140, 552
Disc membrane, 17, 266, 269, 390–392, 508 Gene editing, 83, 99, 110, 176, 552, 557
Disc rim, 266, 278–280 Gene expression regulation, 62, 65, 218
Index 585

Gene knock-out mouse model, 336, 339 Intercellular communication, 82, 83, 229
Gene regulatory networks, 137, 550 Interphotoreceptor matrix (IPM), 310, 312, 391, 429,
Gene therapy, vii, 83, 104, 117–121, 125, 131–132, 166, 457–459, 461, 462
169, 231, 232, 270, 303, 328, 366, 369, 377, 404, Intracellular complement factor H (CFH), 10–12, 28, 64,
406 68, 161, 362
Genetics, 10, 22, 23, 28, 30, 31, 51, 55, 57, 61–65, 68, In vitro models, 550, 567, 568
76, 83, 119, 140, 158, 160, 165–169, 173, 174, In vivo models, 23, 530, 565, 566
180, 184, 200, 207, 209, 242, 272, 290, 291, 320, Ion channels, 269, 271, 273
328, 330, 342, 354, 359, 372, 373, 377, 383, 391, IPSC-derived retinal organoids, 99, 550, 551, 553, 572,
410, 416, 422, 444, 446, 450, 479, 483, 500, 503, 576
551, 555–557, 561, 566, 572 Ischemic retinopathies, 529, 530
Genome-wide association studies (GWAS), 61–65
Genotype, 10, 30, 63, 64, 180, 289–294, 337, 379, 384,
422, 574 J
Genotype-phenotype correlation, 166, 180, 290–292 Joubert syndrome (JBTS), 173–180, 285–287
Geographic atrophy (GA), 10, 22, 23, 27, 44, 46, 75,
208, 336, 462
Glaucoma, 83, 84, 113, 165, 224–226, 231, 232, 249, K
311, 313, 321, 371, 373, 404, 542 Knockout, 50, 51, 127, 139, 145, 190, 211, 236, 237,
Glia, 5, 91, 249–253, 297, 310–312, 377–381, 439, 473, 250, 258–260, 270–272, 284, 285, 354, 366, 384,
475, 476, 489, 567, 577–581 390, 396, 416, 452, 490, 509, 510, 556
Glutathione, 467–471 Kv2.1, 269, 271–273
GPR91, 527–530 Kv8.2, 269, 271–273
GPR143, 44–46, 74
G-protein coupled receptor (GPCR), 44, 500
L
Laminin, 310, 312, 313
H Large animal models, 118
HCN1, 269, 271–272 Late-onset retinal degeneration (L-ORD), 336, 339, 340
High density lipoprotein (HDL), 56, 57, 451 Late-stage treatment, 404
Higher-order assembly, 263 LC-MS/MS, 38–42, 251, 360, 391–393, 458
Homology Directed Repair (HDR), 571–576 L-DOPA, 74
HTRA1, 28–31, 64, 328, 361, 362 Leber congenital amaurosis (LCA), 104, 136, 167,
Hyperoxia, 444 174–176, 179, 180, 200, 266, 270, 371, 415, 551
Hypoxia, 51, 433, 444, 489, 490, 529 Lecithin retinol acyl transferase (LRAT), 18, 372,
534–536
Linkage disequilibrium (LD), 28, 62
I Lipid accumulation, 56, 57, 321
Immune system, 10, 68, 91, 201, 344, 361, 362 Lipid homeostasis, 41, 390, 391
Immunization, 68–70 Lipids, 4–6, 10–12, 16, 17, 38–42, 45, 46, 50, 51, 55–57,
Immunoprecipitation (IP), 244, 250–253, 392, 494 62, 68, 76, 81, 82, 88, 145, 223, 249, 252, 257,
IMPG2, 312, 457–459, 461, 462 266, 283, 284, 304, 311, 321, 339, 361, 372, 374,
Induced pluripotent stem cell (iPSC), 31, 51, 65, 98, 99, 101, 380, 389–393, 401, 444–446, 452, 453, 462, 468,
187, 259, 540, 549–553, 556–562, 572–574, 576 501–503, 508, 509, 528, 530, 543
Inflammation, 10, 12, 17, 31, 41, 51, 57, 69, 75, 76, Lipofuscin, 16, 17, 19, 258, 289–291, 321, 322, 543
90–92, 118, 199, 209, 211, 236, 329, 330, 362, Liposome, 279, 467–470
372, 444, 446, 522, 524 Liver X receptor (LXR), 57
Inherited retinal degenerations (IRDs), 83, 165, 173, 217, Luminance, 192, 416, 417
272, 285, 289, 365, 390, 479, 551, 552 Lysine, 28, 494–497
Inherited retinal diseases (IRDs), 98, 110, 136, 149, Lysosomal dysfunction, 320–322
183–187, 278, 347, 555, 572
Inherited retinal dystrophy (IRD), 404, 444–446
Inherited retinopathy (IR), 415 M
Innate immunity, 410, 411 Macrophages, 56, 57, 69, 197, 202, 203, 208–211, 328,
Inner limiting membrane (ILM), 16, 132, 265, 310, 311, 329, 361, 411, 421–423, 543
313 Macula, 9, 10, 15, 16, 19, 27, 31, 44, 61, 63, 118, 167,
Inositol polyphosphate-5-phosphatase E gene (INPP5E), 191, 202, 259, 270, 273, 285, 336, 404, 416, 457,
178–180, 287 550, 556
Integrin, 82, 132, 133, 311, 313, 518, 540–542 Macular pigments (MPs), 15, 16, 19, 445
586
Mass spectrometry (MS), 3–7, 250–254, 362, 391, 458, 509
Matrix assisted laser desorption ionization imaging mass
spectrometry (MALDI IMS), 4–6
Matrix metalloproteinases (MMPs), 21–24, 216–218
Mechanisms, 10, 11, 22, 23, 31, 41, 46, 50, 62, 65, 69,
70, 73, 82, 83, 90–92, 105, 136, 144–146, 151,
168, 169, 184, 186, 192, 201, 208, 219, 224, 236,
237, 252, 265, 271, 285, 287, 290, 300, 310, 312,
313, 336, 340, 342–344, 348, 351, 358, 366, 368,
391, 416, 446, 451, 467, 488–490, 497, 500, 501,
504, 509, 518, 528, 530, 534, 540, 543, 549, 551,
555
Medical record database, 74, 76
Melanin, 44, 539, 541
Membrane association, 534, 536
Meso-diaminopimelic acid, 524
Metabolic flux, 436
Metabolism, 11, 50, 52, 55–57, 68, 74, 91, 144, 209, 249,
304, 305, 321, 328, 361, 372, 380, 391, 429, 430,
433, 436, 439, 445, 449–453, 459, 461, 462, 481,
543
Metabolite, 4, 207, 305, 321, 429, 431, 433, 437, 439,
449, 457–462, 528, 529
Metabolomics, 145, 360, 430, 458, 459, 462
Metformin, 74–76, 290, 404–406
Microglia, 29, 197–203, 208–212, 231, 328, 329, 331,
380, 411, 421–425, 440, 444, 446, 458, 462, 476,
550
MicroRNA (miRNA), 56, 57, 82–84, 88
Mini-retinas, 550–551
Mitochondria, ix, 5, 11, 69, 75, 144, 145, 169, 223, 225,
226, 236, 432, 433, 435, 438, 440, 462, 529
Motor protein, 223, 226, 500, 501, 504
Mouse, 19, 20, 29–31, 50–52, 56, 57, 68–70, 75, 76, 83,
104, 120, 121, 126–128, 136–140, 144, 145, 169,
177, 190, 198–202, 208–211, 216, 236, 237,
242–247, 250, 258–260, 264, 265, 270–273, 279,
284–286, 304, 305, 310, 328–331, 336–340,
342–344, 348, 350, 351, 354–357, 359–362,
365–369, 372–374, 378, 381, 383–387, 390–392,
396–402, 405–407, 409–411, 413, 416–418,
422–424, 430–432, 436, 437, 439, 440, 444–446,
452, 458, 459, 461, 462, 468–470, 475, 476, 480,
488–490, 497, 500, 510, 515–518, 524, 540–543,
556, 566, 567, 578, 580, 581
Mouse models, 11, 19, 29, 31, 51, 57, 75, 104, 137, 190,
198, 200, 202, 203, 208–211, 225, 226, 236, 237,
243, 259, 270, 284, 305, 328, 336, 339, 340,
342–344, 348, 354, 360, 366–369, 372–374, 384,
404–406, 410, 416, 422–425, 452, 453, 468, 481,
540–543, 556, 580
mRNA splicing, 183, 552, 558, 560, 561
Müller glia, 273, 310
Muramyl dipeptide (MDP), 522
Mutations, vi, vii, 17, 29, 30, 44, 83, 98–101, 104, 105,
110–113, 125, 133, 136, 137, 139, 143–145, 149,
151, 158–161, 165–169, 174, 177, 180, 184–186,
190, 191, 198–200, 202, 224, 225, 236, 242, 258,
270–272, 277–278, 280, 285–287, 291, 305, 312,
321, 336, 338, 341–344, 347, 354, 359, 365–367,
372, 377, 390, 392, 404–406, 410, 411, 413, 415,
Index
416, 422, 444, 451–453, 457, 479, 481, 494, 497,
500, 501, 503, 540, 551–553, 556–558, 561, 566,
572–575
Myeloid cells, 211, 410, 411, 413
MYO7A, 125–129
Myosin 1C, 499–504
N
32:6 n-3, 259
N-acetylmuramyl-L-alanine amidase (NAMAA),
522–525
NanoLC-MS/MS, 38–42
Network medicine, 166–170
Neural networks, 297, 298, 528
Neurodegeneration, 52, 83, 165, 226, 273, 297–300, 373
Neuron, 52, 133, 216, 218, 223–226, 230, 237, 243, 269,
271, 297, 299, 300, 304, 309–310, 329, 351, 389,
423, 424, 439, 467, 473, 475, 476, 488, 528, 551,
566–568, 577–581
Neuronal reprogramming, 580
Neutralizing antibodies (NABs), 118–121, 133, 530
NG2, 578–580
Nicotinamide adenine dinucleotide (NAD+), 235–237,
430, 436–438, 536
NMNAT1, 236, 237, 392
NOD agonist, 522, 524
Nonsense mutations, 149, 151, 186, 198, 202
Non-syndromic IRD, 173–180
Norrin, 241–244, 246–248
N-retinylidene-N-retinylethanolamine (A2E), 17
Nuclear receptor, 189
Nuclear Receptor Subfamily 2 Group E Member 3
(NR2E3), 139, 189–191, 193, 202, 550, 553, 556
Nuclear receptors, 49, 51, 201, 327, 542
NUS1, 450–453
O
Ocular diseases, 6–7, 62, 81–84, 169, 321, 330, 373, 415,
542, 543
Optic atrophy 1 (OPA1), 225, 226
Oral-Facial-Digital 1 (OFD1), 177–180
Organoids, 313, 549–551, 553, 561, 566, 568
Organotypic retinal explant culture, 430, 432, 468, 470,
481
Outer segments (OSs), 5, 46, 50, 56, 98–100, 137, 144,
145, 202, 257, 265, 266, 269–272, 277–280, 284,
285, 299, 312, 342, 343, 366, 368, 372, 384,
389–393, 401, 423, 451, 461, 470, 494, 499, 500,
504, 507–510, 516, 518, 527, 540, 550, 551, 557
Oxidative damage, 16, 75, 322, 444, 445
Oxidative stress, 11, 16, 22, 23, 41, 50, 57, 68, 90–91,
197, 200, 217, 218, 304, 312, 321, 322, 372, 373,
444–446, 529, 559
P
P23H, 343, 372, 384, 385, 391, 411, 494–497
Palmitoylation, 390, 534
Pathoconnectome, 299, 300
Index
Peripherin-2 (PRPH2), 98–101, 111–113, 167, 277–280,
557, 558
PGC-1alpha, 49–52, 75, 321
Phagocytosis, 10, 17, 29, 46, 50, 55, 199, 201, 202, 207,
218, 321, 390, 515, 518, 539–543, 557
Phagosome, 17, 201, 321, 322, 385, 386, 515–518
Pharmacological, 231, 232, 236, 271, 451, 474, 476, 480,
483, 530
Phospholipids, 257, 391, 393, 535, 536
Photo-oxidation, 16–19
Photoreceptor function, 193, 349, 405, 422, 445, 462,
487–490, 501
Photoreceptor outer segments (POSs), 5, 10, 16–18, 46,
50, 55, 91, 98, 173, 185, 200, 202, 207, 310, 311,
321, 337, 499, 515–518, 527, 539–543
Photoreceptors (PRs), 4, 5, 12, 16, 19, 22, 24, 27, 30, 37,
44, 46, 49–51, 55–57, 61, 68, 88–91, 100, 104,
133, 135, 137–139, 143–145, 166, 167, 173, 174,
177, 180, 184, 190–193, 198–203, 208, 216, 230,
231, 236, 237, 242, 248, 257, 265, 266, 269–273,
277–280, 284, 285, 287, 298–299, 303–305, 310,
312, 321, 328–330, 337, 341, 348, 349, 354, 358,
365, 366, 368, 372, 377, 378, 380, 383, 384,
389–393, 396–402, 404–407, 410, 411, 415,
422–425, 429–433, 436–440, 444–446, 451, 452,
457, 458, 461, 462, 469, 479–481, 483, 488, 489,
493, 499, 500, 504, 507–510, 515, 516, 528, 536,
539, 542, 543, 550, 555, 567
Photoreceptor transduction, 354
Pigmentation, 44, 46, 342
Poly-ADP ribose polymerase (PARP), 235–237
Precision medicine, 550
Preclinical models, 120, 553
Primary cultures, 540, 541, 543, 566, 567
Prime editing, 98–101, 104–105, 110, 111, 113
Progressive rod cone degeneration (PRCD), 390–393
Proliferation, 56, 57, 91, 191, 201, 202, 313, 329,
473–476, 528, 578
Propensity matching, 76
Protein aggregation, 264–266
Protein glycosylation, 449–453
Protein localization, 504
Proteins, 10, 11, 16, 17, 23, 28–31, 45, 46, 50, 51, 56,
57, 68, 81–84, 88–92, 104, 106, 125–128, 132,
135–137, 139, 145, 146, 150, 151, 153, 158–161,
167, 173, 174, 177, 180, 183–186, 197, 199–202,
208, 211, 216–219, 225, 226, 229, 237, 241, 244,
245, 249–252, 254, 257, 258, 264–266, 270–272,
277–278, 280, 283–287, 290, 305, 310, 312, 313,
320, 322, 337, 338, 341–344, 348, 349, 353–358,
360–362, 366, 368, 369, 372, 380, 383–387, 389,
390, 392, 396, 399, 401, 402, 404, 405, 416, 423,
424, 444, 446, 449, 451–453, 479, 488, 493–497,
499–504, 508, 509, 517, 521, 523, 524, 528,
533–536, 540–543, 549, 551–553, 558, 559, 572,
573
Protein translation, 383, 385, 386
Proteome, 62, 84, 88–92, 169, 218, 251, 360, 362, 383
Proteomics, 88–90, 92, 254, 360, 389, 391
Proteostasis, 387
587
Prpf31, 540–543, 557, 560
Pyruvate kinase M2 (PKM2), 436, 479–481, 483
R
Race, 28, 44–46, 372
rd1, 52, 144, 145, 169, 198, 199, 202, 216, 236, 237,
348–351, 366, 368, 369, 380, 430–433, 445, 458
rd10 mouse model, 199, 424
RDH5, 63, 64, 535, 536
Reactive oxygen species (ROS), 16, 49–51, 198, 257,
321, 322, 444, 451, 518, 529
Regeneration, 18, 68, 197, 309–314, 473, 577, 578, 580,
581
Reprogramming, 198, 310, 404, 405, 425, 473–476, 558,
572, 577–581
Retina, ix, 4, 5, 10, 11, 15, 16, 19, 22, 23, 27, 30, 31, 38, 41,
50, 51, 56, 57, 61–65, 74, 83, 84, 88–92, 99, 100, 104,
118, 132, 133, 137–139, 144, 145, 150, 165–167,
169, 173, 180, 186, 187, 190–192, 197, 202, 207–209,
216, 218, 219, 229–231, 236, 237, 241–250,
257–260, 265, 266, 269–273, 284, 285, 289, 290,
297–300, 304, 305, 309, 310, 312, 313, 321, 328, 329,
331, 336–339, 341–343, 348, 355–357, 360, 366,
368, 374, 377–381, 383–386, 390–393, 396–401,
405, 406, 410–413, 416, 417, 421, 422, 425, 429–433,
436–440, 444–445, 451–453, 458, 459, 461, 462,
467–470, 473, 474, 476, 479–481, 488, 494, 500,
508, 509, 515, 516, 518, 527–530, 535, 540–542,
550, 552, 555–557, 565–568, 577–581
Retina degeneration, 417
Retinal adhesion, 540–543
Retinal and RPE pathology, 339
Retinal capillaries, 243, 246
Retinal degenerations, v, vi, ix, 12, 16, 51, 75, 83, 92,
104, 125, 139, 165, 167, 169, 173–180, 189–191,
197, 199–203, 211, 216, 217, 235–237, 259, 272,
280, 285–287, 298–300, 303, 342–344, 366–369,
384, 390, 404, 416, 423, 425, 446, 451, 452, 468,
473, 479, 483, 497, 551–553, 556
Retinal degeneration slow (RDS), 98, 372
Retinal degenerative diseases, ix, 22, 159, 160, 166, 189,
237, 266, 272, 299, 304, 310, 341, 367, 391, 421,
446
Retinal dystrophies, 31, 104, 174, 180, 200, 287, 312,
404, 410, 444, 452, 534, 540, 572
Retinal explant cultures, 185, 430, 470
Retinal gene therapy, 121, 131–133, 137
Retinal homeostasis, 10, 11, 88, 92, 235–237, 372, 424, 540
Retinal metabolism, 462
Retinal organoids, 98, 99, 101, 133, 187, 259, 313,
550–553, 557, 561, 566, 567, 572
Retinal pigment epithelial cells, 216–219, 230, 231
Retinal pigment epithelium (RPE), 4–6, 10–12, 16–20,
22–24, 27, 29–31, 37–39, 41, 44–46, 49–52,
55–57, 61–65, 68–70, 74, 75, 84, 88–92, 99, 100,
133, 139, 144, 145, 166, 186, 190, 200, 202,
207–212, 216–219, 230, 236, 242, 243, 249, 258,
265, 273, 289, 310–312, 321, 322, 336–340, 343,
359, 360, 362, 372, 373, 389, 404, 415, 416, 422,
588
424, 425, 429, 452, 457, 458, 461, 462, 469,
515–518, 522–525, 527–529, 534–536, 539–543,
550, 551, 555, 557, 560, 572
Retinal pigment epithelium (RPE) cells, 529
Retinal regeneration, 231, 310, 311, 476
Retinal remodeling, 298, 378, 380
Retinal vascular development, 528
Retinal vascular diseases, 331
Retina pigmented epithelium 65kDa protein (RPE65), 16,
18, 161, 208, 243, 372, 415–417, 534–536, 541
Retinitis pigmentosa/retinal pigmentosa (RP), v–vii, 56,
83, 98–101, 104, 136, 139, 143–146, 158, 160,
167, 184–186, 189–191, 200, 211, 216, 218, 236,
270, 272, 278, 280, 283, 298, 299, 312, 341–343,
348, 365–369, 371–374, 377, 378, 380, 390–392,
404–406, 409–411, 413, 415, 416, 422–425,
444–446, 451, 479–481, 483, 494, 497, 501, 540,
551, 552, 555–562, 572, 574, 576
Retinoic acid receptor-related orphan receptors (RORs),
327–331
Retinoids, 201, 202, 208, 354, 534, 535
Retinopathies, 46, 51, 74, 76, 136, 137, 165, 224, 232,
237, 248, 249, 272, 305, 451, 521, 525, 528–530
Retinopathy, 328–331
Reverse cholesterol transport (RCT), 56, 57
Rhodopsin (RHO), vi, 16, 89, 136, 159–161, 184, 185,
257, 266, 279, 285, 299, 342–344, 349, 384,
390–392, 423, 424, 451, 493–497, 500–504, 517,
534, 536, 558
Rhodopsin densities, 390–392
Rho-P23H, 236, 342–344
RNA, 56, 75, 81–84, 88, 98, 105, 110, 112, 140, 177,
186, 187, 203, 216, 217, 348, 354, 380, 410, 412,
550, 552
ROM1, 277–280, 372
RORα, 327–331
RORβ, 327–331
RORγ, 327, 328, 330–331
RP2, 177, 283, 284, 286, 287, 552, 559–561
Ryanodine receptor (RyR), 354–358
S 126, 143–145, 165–167, 170, 177, 184, 189, 190,
S-cones, 189–193, 329
Serotonin receptor agonist, 75
Serotype, 117–121, 132–133
Single-cell RNA sequencing (scRNAseq), 378, 380, 381,
550
Small molecule, 75, 236, 265–267, 475, 476, 534, 552
Smoking, 10, 28, 51, 68–70, 322, 372
Spectroscopy, 18, 431, 433
Sphingolipid metabolism, 304
Splice sites, 99, 175, 180, 184–186
SRD5A3, 450–453
Stargardt disease (STGD1), 17, 167, 289–294
Stargardt-3 macular dystrophy (STGD3), 258–259
Stem cells, 30, 114, 133, 313, 342, 407, 423, 475, 549,
553, 572, 577
Stop codons, 29, 105, 150–152, 202, 405
Sub-retinal immune cells, 208–211
Subretinal space, 23, 202, 279, 310, 421, 422, 527
Index
Sub-RPE deposits, 23, 337, 339
Succinate, 438, 528–530
Super-resolution, 396, 401, 402
Systems biology, 92, 166
T
Tet-On, 137
Thioflavin T (ThT), 264, 265
Tissue Inhibitor of Metalloproteinase-1, 216–219
TLR, 411
TLR2, 409–411, 413
Tolerance, 39, 69, 70, 139
Transcription factor EB (TFEB), 320–322
Transcriptome, 62, 169, 203, 218, 378, 479, 481
Transcriptomics, 203, 377–381, 439, 550
Transferase dUTP nick end labeling (TUNEL), 351, 480
Translational readthrough (TR), 127–129, 149, 151–153
Translation termination, 150–151
Tropism, 132, 133, 139
Txnip, 144–146
U
Ubiquitin-proteasome system (UPS), 11, 383–385
Ubiquitylation, 495–497
Ultrastructure, 279, 337, 339, 391, 541
Uncoupling, 436, 438, 440
Usher’s Syndrome type 1B (USH1B), 125, 129
Usher syndrome, 186, 366, 556
V
Variants, ix, 10–12, 28–31, 51, 62–65, 68, 100, 104–106,
117, 118, 120, 121, 136, 158–161, 167, 173–180,
184–187, 189–191, 285–287, 289–294, 328, 359,
552, 553
Vascular endothelial growth factor (VEGF), 23, 45, 46,
51, 73, 250, 331, 444, 487–490, 528–530
Very-long-chain polyunsaturated fatty acids (VLC-­
PUFAs), 257–260
Vision, 17, 22, 27, 38, 44, 68, 69, 83, 90, 113, 118, 125,
192–193, 224–226, 230, 236, 242, 258, 259, 264,
267, 270, 271, 273, 290, 303, 304, 309, 321, 328,
338, 342, 348, 351, 354, 365, 378, 383, 384, 390,
400, 404–406, 410, 415, 416, 422, 424, 430, 444,
457, 462, 479, 530, 534, 539–541, 551, 552, 555,
577
Vision defects, 272
Visual cycle, 10, 16, 18, 207, 290, 311, 372, 380, 490,
534, 536, 539
Visual cycle proteins, 534–536
Visual function, 50, 75, 136, 137, 191–193, 293, 351,
389, 391, 416, 417, 421–425, 446, 473, 489, 490,
499, 500, 504, 528
Vitelliform macular dystrophy (VMD), 457
W
Warburg effect, 429