CANCER RESEARCH | MOLECULAR CELL BIOLOGY
MAFB Promotes Cancer Stemness and Tumorigenesis in
Osteosarcoma through a Sox9-Mediated Positive
Feedback Loop
Yanyan Chen1, Tao Wang2, Mengxi Huang1, Qin Liu2, Chao Hu3, Bin Wang2, Dong Han4, Cheng Chen1,
Junliang Zhang5, Zhiping Li4, Chao Liu6, Wenbin Lei7, Yue Chang1, Meijuan Wu1, Dan Xiang1, Yitian Chen1,
Rui Wang1, Weiqian Huang5, Zengjie Lei1, and Xiaoyuan Chu1
ABSTRACT
◥
Despite the fact that osteosarcoma is one of the most common
primary bone malignancies with poor prognosis, the mechanism
behind the pathogenesis of osteosarcoma is only partially known.
Here we characterized differentially expressed genes by extensive
analysis of several publicly available gene expression profile datasets
and identified musculoaponeurotic fibrosarcoma oncogene homo-
log B (MAFB) as a key transcriptional regulator in osteosarcoma
progression. MAFB was highly expressed in tumor tissues and
required for proliferation and tumorigenicity of osteosarcoma cells.
MAFB expression was elevated in osteosarcoma stem cells to
maintain their self-renewal potential in vitro and in vivo through
upregulation of stem cell regulator Sox9 at the transcriptional level.
Sox9 in turn activated MAFB expression via direct recognition of its
sequence binding enrichment motif on the MAFB locus, thereby
forming a positive feedback regulatory loop. Sox9-mediated feed-
Introduction
Osteosarcoma is one of the most common primary malignant bone
tumors with two incidence peaks, one in adolescence and another in
the elderly population, especially those above 75 years of age (1).
Chemotherapy combined with surgery has greatly improved clinical
1
Department of Medical Oncology, Affiliated Jinling Hospital, Medical School of
Nanjing University, Nanjing, Jiangsu Province, P.R. China. 2Department of
Gastroenterology, Daping Hospital, Third Military Medical University (Army
Medical University), Chongqing, P.R. China. 3Department of Orthopedics, 904
Hospital of PLA, North Xingyuan Road, Beitang District, Wuxi, Jiangsu, P.R.
China. 4Department of Medical Oncology, Jinling Hospital, Nanjing Clinical
School of Southern Medical University, Nanjing, Jiangsu Province, P.R. China.
5
Department of Orthopedics, Affiliated Jinling Hospital, Medical School of
Nanjing University, Nanjing, Jiangsu Province, P.R. China. 6Department of
Medical Oncology, Jinling Hospital, Nanjing Clinical School of Nanjing Medical
University, Nanjing, Jiangsu Province, P.R. China. 7Department of Orthopedics,
Tianshui Cooperation of Chinese and Western Medicine Hospital, Tianshui,
Gansu Province, P.R. China.
Note: Supplementary data for this article are available at Cancer Research
Online (http://cancerres.aacrjournals.org/).
Y. Chen, T. Wang, M. Huang, Q. Liu, and C. Hu contributed equally as the co-senior
authors of this article.
Corresponding Authors: Zengjie Lei, Jinling Hospital, School of Medicine,
Nanjing University, Nanjing, Jiangsu Province 210000, China. Phone: 8625-
8086-0131; E-mail: leizengjie@163.com; and Xiaoyuan Chu,
chuxiaoyuan000@163.com
Cancer Res 2020;80:2472–83
doi: 10.1158/0008-5472.CAN-19-1764

2020 American Association for Cancer Research.
back activation of MAFB was pivotal to tumorsphere-forming and
tumor-initiating capacities of osteosarcoma stem cells. Moreover,
expression of MAFB and Sox9 was highly correlated in osteosar-
Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023
coma and associated with disease progression. Combined detection
of both MAFB and Sox9 represented a promising prognostic
biomarker that stratified a subset of patients with osteosarcoma
with shortest overall survival. Taken together, these findings reveal a
MAFB–Sox9 reciprocal regulatory axis driving cancer stemness and
malignancy in osteosarcoma and identify novel molecular targets
that might be therapeutically applicable in clinical settings.
Significance: Transcription factors MAFB and Sox9 form a
positive feedback loop to maintain cell stemness and tumor growth
in vitro and in vivo, revealing a potential target pathway for
therapeutic intervention in osteosarcoma.
outcomes of patients with osteosarcoma, with the 5-year survival rate
up to 60% to 70%, whereas
20% of patients with osteosarcoma with
metastasis continue to have poor prognosis (2).
Increasing clinical and experimental evidence indicates that oste-
osarcoma stem cells, which derive from mesenchymal stem cells, may
be the cellular origin of osteosarcomas (3). Cancer stem cells (CSC)
share many similar properties with normal stem cells and are primarily
responsible for tumorigenesis in many cancers (4, 5). For example, a
subpopulation of self-renewing osteosarcoma cells, namely CSCs, are
endowed with intrinsic capacities for tumor initiation and drug
resistance (3, 6). These CSCs are regulated by several key transcription
factors and signal pathways, such as Oct3/4, Sox2, Nanog, and
Notch (7). Compared with differentiated cancer cells, CSCs are
generally more malignant and are critical determinants of the response
to chemotherapy and radiotherapy, and therefore the eradication of
osteosarcoma stem cells may be an effective treatment strategy (8, 9).
V-maf avian musculoaponeurotic fibrosarcoma oncogene homolog
B (MAFB) is a member of the MAF transcription factor family,
containing basic leucine zipper domains that bind to specific DNA
elements (10). The seven MAF members are separated into two classes
(small and large MAFs). Small MAF proteins (MAFF, MAFG, and
MAFK) have been shown to regulate antioxidant responses (11)
whereas large MAFs (MAFA, c-MAF, and MAFB) each contain a
similar transactivation domain and are strongly oncogenic (12, 13). In
the hematopoietic system, MAFB induces myelomonocytic differen-
tiation in immortalized myoblasts and macrophage differentiation and
maturation in mice (14). In podocyte differentiation and the main-
tenance of progression, aberrant podocyte foot process formation is
observed in a MAFB-mutant zebrafish embryo model (14). There is
also evidence that MAFB regulates osteoclast genesis and epidermal
keratinocyte differentiation (15, 16). Upregulation of MAFB increases
AACRJournals.org | 2472

the risk of various human pathologies, such as diabetes and athero-
sclerotic disorders (17, 18). In addition, MAFB has been shown to
promote tumorigenesis, especially in the transformation of pancreatic
b cells (13, 19). MAFB chromosomal translocations occur more
frequently in human myeloma cells, and high expression of MAFB
is observed in patients with acute leukemia blast, hepatocellular
carcinoma, and colorectal carcinoma (14, 17). Finally, MAFB has
been shown to promote nasopharyngeal carcinoma cell proliferation
and migration (20).
Here, through high-throughput bioinformatic analysis of publicly
available transcriptome datasets we identified MAFB as a novel
regulator of osteosarcoma tumorigenesis. We demonstrate that MAFB
promotes tumorigenesis and self-renewal of osteosarcoma stem cells
via a Sox9-mediated feedback activation loop, which could be
exploited to eliminate the culprit cells in osteosarcoma.
Materials and Methods
Collection and processing of microarray gene expression data
Microarray gene expression data of 10 normal and 107 osteosar-
coma tissue samples were extracted from six datasets in the gene
expression omnibus (GEO) database: GSE14359, GSE16088,
GSE16091, GSE14827, GSE12865, and GSE73166. The intersection
genes of these three platforms were identified (11,808 genes). Combat
function was used for removing batch effects in high-throughput
experiments, the robust multiarray average (RMA) method was used
for data normalization using R software (R Foundation), and the
limma package (R Foundation) was used to analyze differently
expressed genes.
Patient specimens and IHC staining
All osteosarcomas and adjacent tissues were collected from patients
who were diagnosed as overall survival (OS) at the department of
Department of Surgery of Daping Hospital and Jinling Hospital. All OS
tissue was obtained from individual patients with written informed
consent. The protocols used in this study conformed to the ethical
guidelines of the 1975 Declaration of Helsinki and were approved by
the Ethical Review Committees of Daping Hospital and Jinling Hos-
pital. Blocked tissue samples were cut into 5 mm sections and stained
with hematoxylin and eosin, then incubated with primary antibodies.
Tumor staging was estimated according to the criteria for histologic
classification proposed by the International Union Against Cancer.
We followed a previously described protocol to quantify staining
intensity (21). Five representative fields of a section were evaluated
by two double-blinded pathologists. Final score of MAFB and Sox9 in
each sample was obtained by multiplying the strength score by the
distribution score. The cutoff score in various analyses was 8 for both
anti-MAFB and anti-MAFB staining intensity (high expression, IHC
scoring ≥8; low expression, IHC scoring <8).
Cell culture
Human osteoblast cell lines (hFOB1.19) and osteosarcoma cell lines
(MG63, U-2OS, 143B, HOS) were purchased from the Shanghai Cell
Collection. All cell lines were characterized by short tandem repeat
(STR) profiling within 6 months. 143B and MG63 were maintained in
MEM medium, whereas HOS and U-2OS was maintained in
RPMI1640 and MoCoy's 5a media respectively. hFOB1.19 was main-
tained in DMEM medium. All medium (HyClone) contained high
glucose, 10% FBS (HyClone) and 1% antibiotic/antimycotic solution
(Sigma-Aldrich). All cells were cultured at 37 C in a humidified
atmosphere containing 5% CO2.
AACRJournals.org
MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness
Multiple early-passage frozen stocks of each cell line in this study
were stored under liquid nitrogen: all cell lines were used in exper-
imentation for no longer than 10 passages from thaw. Cells were used
in the described experiments for approximately 6 months. All cell lines
were routinely tested for Mycoplasma contamination using MycoP-
robe Mycoplasma Detection Kit (R&D Systems, Inc.), and any con-
taminated cell line was treated with Plasmocin treatment (InvivoGen),
confirmed by negative detection of Mycoplasma before being used
again. The most recent testing was 3 months ago.
Lentivirus vectors and cell infection
The target gene sequence of small hairpin RNA (shRNA; shMAFB-a:
TACTGGATGGCGAGCAACTACCAGCAGAT, shMAFB-b: TCA
CCAAGGACGAGGTGATCCGCCTGAAG, shSox9-a: GTGCGCG-
TCAACGGCTCCAGCAAGAACAA, shSox9-b: CAGCGAACGCA-
CATCAAGACGGAGCAGCT) was cloned into the pLVT-Vector
(SBO Medical Biotechnology) and was used for the generation of
Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023
lentiviruses, which were mixed with lentiviral transfection enhancer
(Sigma-Aldrich) and applied to indicated cell lines. Puromycin was
then used to select and establish stable expression or knockdown
cell lines.
Western blotting
Total protein was extracted from osteosarcoma cell lines and clinical
samples using M-PER Mammalian Protein Extraction Reagent
(Thermo Fisher Scientific). Whole cell lysates were separated by
SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad).
Membranes were blocked with 5% skim milk or BSA and then
incubated with primary antibodies (see Supplementary Table S1A)
and subsequently with secondary antibodies (see Supplementary
Table S1A). Protein bands were visualized using the Immobilon
Western Chemiluminescent HRP Substrate detection reagent (Milli-
pore). GraphPad Prism 5.0 was used to measure the gray intensity of
protein bands and normalized the expression of control protein
(b-actin).
RT-PCR assays
Total RNA was isolated from osteosarcoma cell lines and clinical
samples using TRizol reagent (Invitrogen) and then treated with
DNase. Using a PrimeScript RT Kit (Takara), RNA was reverse
transcribed into cDNA to detect relative mRNA levels using qPCR
(Bio-Rad). The fold changes of target genes were normalized to
b-actin. The primer sequences for qPCR are provided in Supplemen-
tary Table S1B. All experiments were repeated three times.
Cell Counting Kit-8 assay
Cells were seeded in a 96-well plate with a density of 3,000 cells per
well and treated with indicated conditions. At 24 hours intervals, the
medium was removed and then incubated with CCK8 (Dojindo
Molecular Technologies) for 60 minutes. The absorbance was deter-
mined at 450 nm using a Varioskan Flash (Thermo Fisher Scientific).
Colony formation assay
For colony formation assays, approximately 500 cells were plated
into 60 mm culture dishes and incubated for 14 days. Colonies were
stained with 0.5% Crystal Violet in 6% glutaraldehyde solution. The
diameter of colonies consisting of ≥300 mm were counted.
Soft agar colony formation assay
Cells were harvested and suspended as single cells in culture
medium (105 cells/mL). 60-mm dishes were precoated with 0.75%
Cancer Res; 80(12) June 15, 2020 2473
 Chen et al.
agar in culture medium, and single cell suspensions were mixed with
0.35% agarose in culture medium and seeded into precoated 60-mm
dishes. After 12 to 30 days of incubation at 37 C, in 5% CO2, colonies
were stained, photographed, and counted.
RNA sequencing and analysis
Total RNA was extracted using using TRizol reagent (Invitrogen)
and sequenced with the cBot Cluster Generation System using a
TruSeq PE Cluster Kit v3-cBot-HS (Illumina). Raw reads were mapped
to the aligned reference genome using Hisat2, version 2.0.5 (https://
ccb.jhu.edu/software/hisat2/index.shtml) and read counts for each
transcript were calculated using featureCounts, version 1.5.0-p3
(https://www.rdocumentation.org/packages/Rsubread/versions/
1.22.2/topics/featureCounts). Differential gene expression analysis
was performed using the DESeq2 R package. Gene ontology (GO)
analysis was performed using the clusterProfiler R package.
Flow cytometric analysis
Trypsin digestion was used to produce individual cell suspensions,
followed by incubation in blocking solution (PBS þ 1% BSA þ 10%
FBS). Cells were then centrifuged, and pellets were resuspended and
incubated with primary antibody (see Supplementary Table S1A).
Cells were then analyzed or sorted using a BDAria II Sorter (BD
Biosciences).
Sox9 and MAFB promoter and luciferase activity assays
Cells were transfected with a firefly reporter vector containing
MAFB or Sox9 promoter, and the Renilla luciferase reporter vector
(pRL-TK) using Lipofectamine 2000 (Invitrogen). Cell samples were
collected after 48 hours and both MAFB or Sox9 firefly luciferase and
Renilla luciferase activities were detected using a Dual-Luciferase
Reporter Assay Kit (BMG Labtech). The Renilla luciferase fluorescence
intensity was utilized as an internal control.
Chromatin immunoprecipitation
Cells were cross-linked with 1% formaldehyde, lysed, and
sonicated into DNA fragments between 200 and 1,000 bp. The
DNA fragments were immunoprecipitated with antibodies against
MAFB or Sox9, and PCR with specific primers to detect the
relative sequence binding enrichment (SBE) motifs were used
(Supplementary Table S1B).
Tumor sphere formation assay
Osteosarcoma cells were isolated in ultra-low attachment 24-well
plates (Corning) with 200 cells per well and cultured in stem cell
medium [DMEM/F12 medium (Thermo Fisher Scientific) containing
20 ng/mL of EGF, 20 ng/mL FGF, and 10 ng/mL of HGF (PeproTech),
B27 supplement (Invitrogen), 4 mg/mL of insulin (Sigma-Aldrich), and
1% methyl cellulose (Sigma-Aldrich)] for 2 weeks. Fresh medium was
exchanged every 4 days, and the average diameters of tumor spheres
were determined using a microscope.
Tumorigenicity in vivo and limiting dilution assay
Nude mice, 4 weeks of age, were injected subcutaneously with stable
clones of cell suspensions in Matrigel (1:1; 106 cells/mouse). Xenografts
were allowed to grow for 5 weeks before being harvested for further
analysis. The tumor volumes were then measured and calculated using
the formula: V ¼ (length  width2)/2. The tumors were stored in 10%
buffered formalin for further analysis.
For limiting dilution assay (LDA) of tumorigenicity in vivo, cells
were diluted at defined doses (106 cells/100 mL to 103 cells/100 mL) and
2474 Cancer Res; 80(12) June 15, 2020
injected subcutaneously into nude mice. The tumor-initiating cell
frequency was calculated using ELDA software (http://bioinf.wehi.
edu.au/software/elda/; ref. 22). Data representing the number
of cells in each culture, number of cultures tested and number of
positive cultures was entered to determine the “tumor-initiating cell
frequency.” The cut-off value for determining tumor formation was
100 mm3 (23).
All animal experiments were approved by the Institutional Animal
Care and Use Committee of the Jinling Hospital and the Army Medical
University.
Immunofluorescence and confocal microscopy
Approximately 104 cells were grown on cover glass and cultured
overnight, and then fixed with 4% paraformaldehyde. After permea-
bilization of membranes using 0.5% Triton X-100, nonspecific anti-
body binding was blocked by preincubation with 1% BSA. Specific
antibodies were then incubated overnight followed by fluorescein
Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023
isothiocyanate-conjugated secondary antibodies and visualized using
confocal microscopy.
Availability of data and materials
Microarray gene expression data of ten normal and 107 osteosar-
coma tissue samples were extracted from six datasets in the GEO
database: https://www.ncbi.nlm.nih.gov/geo/. R software (R Founda-
tion) is a free software environment for statistical computing and
graphics (https://www.r-project.org). The datasets and the computer
code used and analyzed during the current study are available from the
corresponding author upon request.
Statistical analysis
All experiments were performed three or more times indepen-
dently under similar conditions. Statistical analyses were performed
using SPSS statistical software for Windows, version 17.0 (SPSS).
Data were expressed as the mean  SD or percentage, and analyzed
using Student t test, x2 test, or ANOVA. Survival data were
estimated using the Kaplan–Meier method and analyzed using the
log-rank test. The association between factors for survival was
determined by univariate and multivariate analyses using Cox
regression analysis. A value of P < 0.05 was considered statistically
significant.
Results
Elevated expression of MAFB in osteosarcoma
To better characterize the molecular underpinnings of osteosarco-
ma tumorigenesis, we systemically analyzed mRNA expression pro-
files from osteosarcomas and normal tissues. Expression profiles of 10
normal and 107 osteosarcoma samples were extracted from six
datasets in the GEO database: GSE14359, GSE16088, GSE16091,
GSE14827, GSE12865, and GSE73166. Because these data were from
three different platforms, we intersected the detected genes and found
11,808 genes in common. Combat function was used for removing
batch effects in high-throughput experiments, and the RMA method
was used for data normalization using R software. Using the limma
package, we identified 1,833 differentially expressed genes (DEG) with
P values < 0.05 and fold changes >1.5 (Supplementary Table S2A), and
shown in a volcano plot (Fig. 1A). We listed the top 100 upregulated
and downregulated genes (Supplementary Fig. S1A). Using GO
enrichment and pathway enrichment analysis of these DEGs (Sup-
plementary Figs. S1B and S1C; Fig. 1B), we found that the DEGs were
closely associated with transcriptional activity. Among these DEGs,
CANCER RESEARCH
 MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023

Figure 1.
Expression levels of MAFB is higher in osteosarcoma tissues compared with normal tissues. A, Volcano plot of DEGs between 10 normal and 107 osteosarcoma
samples from the GEO database. Blue, DEGs with P < 0.05 and fold changes >1.5. Red, not significant DEGs, with P ≥ 0.05 or fold change ≤1.5 (DESeq2, R software).
B, GO enrichment analysis of the molecular functions of these 1,833 DEGs. C, Heatmap of the top 10 upregulated and downregulated transcription factors represented
in the set of identified DEGs. D, The mRNA expression levels of MAFB in 10 normal and 107 osteosarcoma samples from the GEO database. E and F, The mRNA levels
(E) or the protein levels (F) of MAFB in 15 paired tumor and adjacent tissue samples from patients with osteosarcoma. The Western blotting bands were quantified
and normalized to b-actin to indicate relative levels of MAFB expression.  , P < 0.05.

there were 112 transcription factors (Supplementary Table S2B), with
the top 10 upregulated and downregulated transcription factors in
these DEGs shown in Fig. 1C.
Previous studies revealed that SATB2 and HEY1 were related to
osteosarcoma migration and metastasis (24, 25), TRPS1 was associated
with multidrug resistance of osteosarcoma, and HMGB2 suppressed
p53 transcriptional activity in osteosarcoma cells (26, 27). However,
less is known about the role of MAFB in osteosarcomas, therefore we
focused on the role of MAFB in osteosarcoma tumorigenesis. MAFB
was highly expressed in osteosarcoma samples utilized in the GEO
datasets analyzed above (Fig. 1D). From samples collected from
patients with osteosarcoma, we observed a similar pattern of elevated
MAFB expression in tumor tissue compared with adjacent normal
tissue (Fig. 1E and F). Together, these findings demonstrate that
MAFB is highly expressed in osteosarcoma tumors isolated from
patients.
MAFB promotes growth and tumorigenicity of osteosarcoma
cells
To test whether MAFB plays a role in the pathophysiology of
osteosarcoma, we first examined the expression of MAFB in osteo-
sarcoma cell lines. We found that MAFB protein levels were higher in
143B and HOS cells, but lower in U-2OS and MG63 cells (Supple-
mentary Fig. S2A). Depletion of MAFB led to impaired colony
formation capacity of cells suspended in soft agar (Fig. 2A and B;
Supplementary Figs. S2B–S2D), as well as cell proliferation in two-
dimensional culture conditions (Fig. 2C and D; Supplementary
Fig. S2E). Consistently, depletion of MAFB in these cells induced

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2475

 Chen et al.

Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023

Figure 2.
Overexpression of MAFB enhances malignant growth of osteosarcoma cells in vitro and in vivo. A, Protein levels of MAFB were detected in HOS and 143B
cells expressing control shRNA (shGFP), shMAFB (shMAFB-a, shMAFB-b), or vehicle (Blank ctrl). Numbers above blots are quantification of MAFB protein
expression normalized to b-actin. B, The cell proliferation capacity detected by the soft agar assay in HOS cells expressing control shRNA (shGFP), shMAFB
(shMAFB-a, shMAFB-b), or vehicle (Blank ctrl). C, Cell Counting Kit-8 assays indicate proliferation of HOS and 143B cells was inhibited following MAFB
depletion. D, Colony formation assay in HOS cells transfected with control shRNA (shGFP), shMAFB (shMAFB-a, shMAFB-b), or vehicle (Blank ctrl). E, In vivo
subcutaneous xenograft tumor formation performed on 4-week nude mice with cells expressing control shRNA (shGFP) or shMAFB (shMAFB-b). Tumors were
harvested after 5 weeks and representative images are shown (left) and tumor volumes were analyzed (right; n ¼ 6 per group). F, Protein levels of MAFB were
detected in MG63 and U-20S cells stably expressing Lv-ctrl, Lv-MAFB, or vehicle (Blank). Numbers above blots are quantification of MAFB protein expression
normalized to b-actin. G, Cell proliferation capacity was detected using soft agar assay in MG63 cells expressing Lv-ctrl, Lv-MAFB, or vehicle (Blank). H, Cell Counting
Kit-8 assay showing proliferation of MG63 and U-20S cells was promoted by MAFB overexpression. I, Colony formation assay showing cell proliferation capacity
of MG63 cells expressing Lv-ctrl, Lv-MAFB, or vehicle (Blank). J, In vivo subcutaneous xenograft tumor formation was conducted using cells expressing Lv-ctrl
or Lv-MAFB. Representative images are shown (left) and the tumor volumes were analyzed (right; n ¼ 6 per group).  , P < 0.05;   , P < 0.01.

2476 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH


smaller subcutaneous tumors in nude mice (Fig. 2E; Supplementary
Fig. S2F).
To further validate a potential oncogenic role of MAFB in osteo-
sarcoma, we ectopically expressed MAFB in MG63 and U-2OS
cells (Figs. 2F; Supplementary Fig. S2G). MAFB-overexpressing in
these cells led to increased colony formation in soft agar (Fig. 2G;
Supplementary Fig. S2H) and were more proliferative in anchorage-
dependent growth conditions (Fig. 2H and I; Supplementary Fig. S2I).
Consequently, MAFB-overexpressing cells show an increased ability to
induce the formation of solid tumors in mice (Fig. 2J). Expression of
MAFB in these subcutaneous tumors was validated by IHC analysis of
the dissected tumors (Supplementary Figs. S2F and S2J). Together,
these results demonstrate that MAFB plays an important oncogenic
role in osteosarcoma in vitro and in vivo.
MAFB binds to, and activates, the Sox9 promoter
CSCs have been identified as the “cell-of-origin” of osteosar-
comas (28), thus we hypothesized that a significant increase of
tumorigenicity in MAFB-expressing cells may be due to a higher
ratio of CSCs. To assess the potential effects of MAFB on cancer
cell stemness, we performed RNA-seq analysis of MAFB-depleted
and control cells. DEGs between these two groups are shown in a
volcano plot (Fig. 3A; Supplementary Table S2C). According to
GO analysis, we defined a list of markers related to CSC popu-
lation maintenance (Supplementary Table S2D). Six CSC markers
were differentially expressed after depletion of MAFB (Fig. 3B). In
the analyses of GEO datasets, we found 18 CSC markers differ-
entially expressed among osteosarcoma and normal samples;
with the top five upregulated markers being CD24, SPARC, Sox9,
KDR, and Sox4 (Supplementary Fig. S3A). Because the only CSC
marker showing differential expression both in GEO datasets and
RNA-seq analysis was Sox9 (Fig. 3C), we anticipated that Sox9
may be a key downstream target of MAFB to control cancer cell
stemness.
Consistent with this notion, ectopic expression of MAFB in
MG63 cells led to increased mRNA levels of Sox9, as well as CD44
and CD24, but not other CSC markers of osteosarcoma stem cells
(Supplementary Figs. S3B and S3C). Western blotting confirmed
that overexpression of MAFB increased the protein levels of CD44,
CD24, and Sox9 (Supplementary Fig. S3D). Conversely, depleting
MAFB in HOS cells significantly downregulated both the mRNA
and protein levels of CD44, CD24, and Sox9 (Supplementary Figs.
S3E and S3F).
We next determined whether there were any binding motifs of
MAFB in the promoter sequence of the Sox9 gene. As shown in
Supplementary Fig. S3G, there were six potential SBE motifs for the
MAFB transcription factor in the human Sox9 gene within the first
2kb upstream to the transcription start site. To confirm which SBEs
was directly recognized by MAFB, we generated six constructs with
Sox9 modified promoter sequences (P1–P6) upstream of luciferase.
We found that the relative luciferase activities of P1, P3, P4, and P5
were increased in the presence of MAFB (Fig. 3D), whereas
depletion of MAFB significantly decreased the activities of the same
promoter sequences (Supplementary Fig. S3H). These four con-
structs shared each contained the SBE1 element. Using chromatin
immunoprecipitation (ChIP), we found that binding of MAFB to
SBE1 and SBE3 elements was decreased in HOS cells after depletion
of MAFB (Fig. 3E). This was further confirmed in Lv-MAFB MG63
cells (Fig. 3F). These data suggests that MAFB binds to SBE1 and
SBE3 of the Sox9 promoter to transcriptionally activate Sox9
expression.
AACRJournals.org
MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness
Sox9 forms a feedback loop to enhance the transcriptional
activity of MAFB
Sox9 is also a transcription factor and upregulated in aggressive
osteosarcoma tissues with poor prognoses (29), therefore we specu-
lated that MAFB and Sox9 may regulate one another and form a
reciprocal feedback loop, as shown in other similar circumstances such
as GATA3/ZEB2 or p53/SET (30, 31). To this end, we established cell
lines with Sox9 either depleted or overexpressed (Supplementary Figs.
S3I and S3J). Using these cell lines, we found that MAFB levels
positively correlated with Sox9. MAFB protein and mRNA levels were
decreased upon depletion of Sox9 (Supplementary Fig. S3K) and
increased upon ectopic expression of Sox9 (Supplementary Fig. S3L).
To examine whether MAFB was directly regulated by Sox9, we
analyzed the Sox9 ChIP-seq dataset from HT29 human colorectal
cancer cells (GEO dataset GSE63629) and retrieved positive Sox9
binding peaks on the promoter of MAFB (Fig. 3G). Moreover, we also
found that there were six potential SBEs in the promoter domain of
Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023
MAFB (Supplementary Fig. S3M). We generated six constructs with
different promoter sequences of MAFB upstream of luciferase. and
found that the luciferase activity of P1, P2, and P3 were increased in the
presence of ectopic Sox9 (Fig. 3H), but significantly decreased in the
Sox9-depleted cells (Supplementary Fig. S3N). These results were
further confirmed by ChIP assays showing that the binding of Sox9
to SBE1 and SBE5 were significantly decreased following depletion of
Sox9 (Fig. 3I) and increased with ectopically expressed Sox9 (Fig. 3J).
Thus, Sox9 bound to SBE1 and SBE5 of the MAFB promoter sequence
and promoted MAFB expression.
Furthermore, we detected transcriptional activity of both the MAFB
and Sox9 promoters by luciferase report assay with overexpression of
either MAFB or Sox9. Not only the transcript activity of Sox9 promoter
increased after MAFB overexpression, but also the expression levels of
MAFB were induced by overexpression MAFB itself (Fig. 3K). Sim-
ilarly, both Sox9 and MAFB promoter activity were enhanced by Sox9
overexpression (Fig. 3K). Given that both proteins are able to bind the
promoters of each other, we concluded that MAFB and Sox9 consti-
tuted positive transcriptional regulatory loop in osteosarcoma cells.
The MAFB-Sox9 reciprocal regulatory axis maintains cancer
stemness and tumorigenicity
In light of the essential role of Sox9 in CSCs, we suspected that
MAFB may regulate cancer stemness through upregulating Sox9
expression in osteosarcoma. To support this notion, both MAFB and
Sox9 were highly expressed and colocalized in the nuclei of
CD44þCD24þ osteosarcoma stem cells compared with CD44CD24
differentiated cells (Fig. 4A and B). Moreover, ectopic expression of
MAFB in CD44CD24 cells promoted sphere formation, resulting in
an increase in both sphere number and size, whereas this phenotype
was inhibited by depleting Sox9 (Fig. 4C and D; Supplementary Figs.
S4A–S4C). Consistently, ectopic expression of MAFB induced an
expansion of CD44þCD24þ cells, while depleting Sox9 minimized
the stem cell pool (Fig. 4E; Supplementary Fig. S4D). Moreover, using
xenograft tumor formation and LDAs in vivo, we found that MAFB-
expressing cells formed larger tumors with higher tumor-initiating cell
frequencies, a phenotype that was dependent, in part, on its down-
stream target Sox9 (Fig. 4F and G; Supplementary Fig. S4E).
To further validate the potential roles of the MAFB and its down-
stream target Sox9 in CSCs, we depleted MAFB in CD44þCD24þ cells
using two independent shRNAs (Supplementary Figs. S4F and S4G).
Loss of MAFB in CSCs led to impaired sphere formation capacity while
re-introducing Sox9 rescued this stem cell function (Fig. 4H and I;
Supplementary Fig. S4H). Moreover, flow cytometry analysis revealed
Cancer Res; 80(12) June 15, 2020 2477
 Chen et al.

Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023

Figure 3.
MAFB and Sox9 form a transcriptional feedback loop to co-elevate their expression. A, Volcano plot of DEGs analyzed by RNA-seq between cells expressing control
shRNA (shGFP) or shMAFB (shMAFB-b; n ¼ 3 per group). B, Heatmap of expression levels of CSC markers identified in DEGs between cells expressing control shRNA
(shGFP) or shMAFB (shMAFB-b; n ¼ 3 per group). C, Venn diagrams of the common CSC markers between GEO datasets and RNA-seq. D, Luciferase assays showing
promoter activities of six Sox9 promoter sequences in MG63 cells expressing Lv-ctrl or Lv-MAFB. E and F, ChIP assay measuring MAFB binding to Sox9 SBEs in HOS
cells expressing control shRNA (shGFP), or shMAFB (shMAFB-b; E) and MG63 cells expressing Lv-ctrl or Lv-MAFB (F). G, ChIP-seq of Sox9 in HT29 human colorectal
cancer cells from the GEO dataset, GSE63629. H, Luciferase assays showing different promoter activities of six MAFB promoter sequences in MG63 cells transfected
with Lv-ctrl or Lv-Sox9. I and J, ChIP assay of Sox9 binding to MAFB SBEs in HOS cells expressing control shRNA (Kd-ctrl) or shSox9 (shSox9-b; I) and MG63 cells
expressing Lv-ctrl or Lv-Sox9 (J). K, Luciferase assays of Sox9 promoter and MAFB promoter in the MAFB overexpressing cells (left) or Sox9 overexpressing cells
(right).  , P < 0.05.

that the pool of CD44þCD24þ cells were reduced upon depletion of dilution tumor formation assays, we found that depleting MAFB in
MAFB and recovered upon overexpression of Sox9 (Fig. 4J; Supple- CSCs inhibited tumor formation and self-renewing potential, which
mentary Fig. S4I). Using in vivo xenograft tumor growth and limiting could be restored by reintroducing Sox9 (Fig. 4K; Supplementary Figs.

2478 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

 MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023

Figure 4.
MAFB promotes stemness and tumorigenicity of osteosarcoma cells in part through activating its downstream target Sox9. A, Immunofluorescence of MAFB and
Sox9 in CD44þCD24þ or CD44CD24 cells sorted MG63 cells. B, Protein levels of MAFB were detected in CD44þCD24þ or CD44CD24 MG63, U-2OS, 143B, and
HOS cells. Numbers above blots are quantification of MAFB protein expression normalized to b-actin. C and D, The average sphere diameter (C) and number (D)
generated by CD44CD24 MG63 or U-2OS cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together. E, Flow cytometry analysis of the percentage of
CD44þCD24þ cells in CD44CD24 MG63 cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together. F, Quantification of volumes of subcutaneous
xenograft tumors formed by CD44CD24 MG63 cells expressing Lv-ctrl, Lv-MAFB, and shSox9-b individually or together (n ¼ 6 per group). G, Quantification of
tumor-initiating cell frequency generated by MG63 CD44CD24 cells expressing Lv-ctrl, Lv-MAFB, shSox9-b individually or together (n ¼ 6 per group). H and I, The
average diameters (H) and numbers (I) of spheres generated by CD44þCD24þ MG63 or U-2OS cells expressing control shRNA (shGFP), shMAFB (shMAFB-b), Lv-
Sox9 individually, or together. J, Flow cytometry analysis of the percentage of CD44þCD24þ cells in CD44þCD24þ MG63 or U-2OS cells expressing control shRNA
(shGFP), shMAFB (shMAFB-b), Lv-Sox9 individually, or together. K, Quantification of volumes of subcutaneous xenograft tumors formed by CD44þCD24þ MG63
cells transfected with control shRNA (shGFP), shMAFB (shMAFB-b), Lv-Sox9 individually, or together (n ¼ 6 per group).  , P < 0.05;   , P < 0.01.

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2479

 Chen et al.

S4J and S4K). IHC staining of xenograft tumor tissues confirmed that
MAFB and Sox9 enhanced expression of both MAFB and Sox9 in vivo
(Supplementary Figs. S4L and S4M), which was consistent with the
model that MAFB and Sox9 form a functional regulatory loop in
osteosarcoma stem cells.
We next asked how Sox9-mediated feedback activation of MAFB
contributed to CSC maintenance. To this end, introducing Sox9 in
CD44CD24 cells enhanced sphere formation and self-renewal in a
LDA, as well as expansion of the CSC pool, while depleting MAFB
attenuated these stemness properties (Fig. 5A–C; Supplementary Figs.
S5A–S5D). Moreover, depleting endogenous Sox9 in CD44þCD24þ
cells inhibited tumorsphere formation and self-renewing capacity of
CSCs, which was partially recovered by reintroducing MAFB
(Fig. 5D–F), suggesting that Sox9 functions in a MAFB-dependent
manner to sustain stemness properties of osteosarcoma cells.
Furthermore, we examined whether the MAFB–Sox9 feedback
regulatory axis contributed to chemoresistance, a hallmark of CSCs.
We found that enforced expression of either MAFB or Sox9 in
CD44CD24 cells conferred resistance to Cisplatin, a commonly
used chemotherapy agent (Supplementary Fig. S5E). Consistently,
Cisplatin treatment enriched CD24þCD44þ CSCs that expressed high
levels of MAFB and Sox9 (Fig. 6A; Supplementary Fig. S5F). Together,
these data demonstrate that reciprocal regulation between MAFB and
Sox9 in osteosarcoma stem cells to maintain their stemness potential,
chemoresistance, and tumorigenicity.
MAFB expression levels correlate with Sox9 in a subgroup of
human osteosarcoma tissues
To further validate the correlation between MAFB and Sox9
expression in CSCs, immunofluorescence staining revealed that both

Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023

Figure 5.
Sox9-mediated feedback activation of MAFB maintains stem-like properties of osteosarcoma cells. A and B, Average sphere diameter (A) and number (B) generated
by CD44CD24 MG63 or U-2OS cells expressing Lv-ctrl, Lv-Sox9, and shMAFB-b alone or both lv-Sox9 and shMAFB-b. Representative images of spheres are shown
(A, left). C, Quantification of tumor-initiating cell frequency generated by CD44CD24 MG63 or U-2OS cells expressing Lv-ctrl, Lv-Sox9, and shMAFB-b individually
or together (n ¼ 6 per group). D and E, Average sphere diameter (D) and number (E) generated by CD44þCD24þ MG63 or U-2OS cells expressing Lv-ctrl, Lv-MAFB,
and shSox9-b individually or together. Representative images of spheres are shown (D, left). F, Quantification of tumor-initiating cell frequency generated by
CD44þCD24þ MG63 or U-2OS cells expressing Lv-ctrl, Lv-MAFB, shSox9-b individually or both (n ¼ 6 per group; three repeats).   , P < 0.01.

2480 Cancer Res; 80(12) June 15, 2020 CANCER RESEARCH

 MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness

Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023

Figure 6.
MAFB expression levels were positively correlated with Sox9 in a subgroup of osteosarcoma tissues. A, Immunofluorescence analysis of MAFB and Sox9 in MG63 cells
from subcutaneous xenografts. B, The mRNA levels of Sox9 in 10 normal and 107 osteosarcoma samples from the GEO database. C, IHC analysis of MAFB and Sox9 in
tumor tissue and adjacent normal tissue from patients. D, IHC score of Sox9 expression was positively correlated with MAFB levels (n ¼ 83). E, Kaplan–Meier survival
analysis of overall survival in MAFB high-expressed patients and MAFB low-expressed patients (n ¼ 83). F, Kaplan–Meier survival analysis of overall survival in Sox9
high-expressed patients and Sox9 low-expressed patients (n ¼ 83). G, Kaplan–Meier survival analysis of overall survival in MAFBlowSox9low and MAFBhighSox9high
patients. H, Summary of the MAFB–Sox9 positive feedback loop and its effects in promoting cancer stem cell stemness and promoting xenograft tumor growth in vivo.

, P < 0.01;    , P < 0.001.

MAFB and Sox9 were highly expressed and colocalized in a subset
of human osteosarcoma cells in vivo (Fig. 6A). Analysis of datasets
from the GEO database also demonstrated that the mRNA levels of
Sox9 was higher in tumors compared with normal tissue (Fig. 6B).
Consistently, the protein levels of both Sox9 and MAFB were co-
elevated in osteosarcoma compared with adjacent normal tissues.
Moreover, expression of MAFB positively correlated with Sox9 in
osteosarcoma specimens (Fig. 6C and D). Immunofluorescence
staining of primary tumor tissues also revealed that MAFB and
Sox9 were coexpressed by a subset of tumor cells (Supplementary
Fig. S5G).
Clinical pathologic analyses revealed that both the expression of
MAFB and Sox9 were correlated with higher histologic grades. More-
over, increased expression of MAFB and Sox9 was observed in patients
with high-grade tumors (G3 and G4 patients) compared with those
with low-grade tumors (G1 and G2 patients; Supplementary
Table S3A). Furthermore, higher expression levels of either MAFB
or Sox9 in osteosarcoma is associated with shorter patient survival
(Fig. 6E and F; Supplementary Table S3B). For subgroup analysis,
patients were divided into four subgroups according to the expression
levels of MAFB and Sox9. Owing to the limit numbers of
patient samples with MAFBlowSox9high and MAFBhighSox9low, we
were unable to draw statistically significant conclusions from these
two subgroups (Fig. 6G; Supplementary Fig. S5H). However, patients
with MAFBhighSox9high tumors show poor survival compared with
patients with MAFBlowSox9low tumors (Fig. 6H). Taken together,
MAFB and Sox9 form a positive feedback loop fueling CSC self-
renewal to support malignant growth and tumorigenesis (Fig. 6H),
suggesting that this regulatory axis maybe a unique therapeutic
vulnerability for a subgroup of osteosarcoma.

AACRJournals.org Cancer Res; 80(12) June 15, 2020 2481

 Chen et al.
Discussion
Osteosarcoma remains a major challenge due to poorly defined
mechanisms of tumorigenesis and limited treatment options. Here, we
identified a critical role of MAFB in osteosarcoma tumorigenesis via a
Sox9-mediated positive feedback loop, which reciprocally promote
expression of MAFB to induce cell proliferation, maintenance of CSCs,
and tumorigenesis. MAFB was highly expressed and positively cor-
related with osteosarcoma progression, as revealed by analysis of GEO
datasets and paired clinical osteosarcoma samples. Previous studies
demonstrated that other large MAF family members, such as MAFA,
c-MAF, and NRL, also regulate tumorigenesis in humans (10). For
example, c-MAF enhances cell proliferation and metastasis in lym-
phoma and breast cancer (17, 32). Moreover, MAFB promotes cell-
cycle progression and tumor growth in multiple myeloma, nasopha-
ryngeal carcinoma, hepatocellular carcinoma, and colorectal carcino-
ma (14, 20, 33, 34). Consistent with these studies, MAFB supports
proliferation and colony formation of osteosarcoma cells in vitro and
tumor growth in vivo in nude mice, suggesting a previously unrec-
ognized oncogenic role in human osteosarcoma.
Our study identifies Sox9 as a functional downstream transcrip-
tional target of MAFB. Sox9 is known to play versatile roles in
tumorigenesis. It is upregulated in lung, breast, and liver cancers and
its expression levels are frequently associated with poor clinical
outcomes (35–38). However, Sox9 also inhibits tumorigenesis in
melanoma (39). For osteosarcomas, Sox9 expression is upregulated
and associated with disease progression and poor prognosis (29).
However, it remains unclear how Sox9 expression is regulated by
upstream mechanisms. In this study, we identified that Sox9 is
transcriptionally activated by MAFB through direct binding to the
SBE1 and SBE3 elements on the Sox9 promoter. Moreover, Sox9 could
also promote MAFB expression by directly binding to the SBE4
element on the MAFB promoter, thereby generating a reciprocally
regulated positive feedback loop in osteosarcoma cells.
We demonstrate that the MAFB–Sox9 feedback loop as an essential
signaling node controlling self-renewal and tumorigenicity of osteo-
sarcoma stem cells. Sox9 is a transcription factor that plays important
roles in normal stem cells and CSCs. Sox9, as well as two additional
CSC markers, CD24 and CD44, were elevated upon ectopic expression
of MAFB, suggesting that the MAFB–Sox9 feedback loop may be an
important regulatory pathway of cancer stemness in osteosarcoma. To
test this hypothesis, we purified osteosarcoma stem cells using CD24
and CD44 as biomarkers (2, 40) and detected elevated expression levels
of MAFB in CD24þCD44þ CSCs. By overexpressing or knocking
down MAFB expression, we found that MAFB maintains tumor
sphere formation and tumor initiation capacity of CSCs in vitro and
in vivo through activating it downstream target Sox9. Moreover, we
observed that Sox9-associated self-renewal of osteosarcoma stem cells
were largely dependent on MAFB. Thus, coordinated reciprocal
activation between MAFB and Sox9 represents an essential mechanism
underlying stemness maintenance in human osteosarcoma.
Furthermore, both MAFB and Sox9 may serve as potential bio-
markers to inform clinical outcomes of patients with osteosarcoma.
References
1. Isakoff MS, Bielack SS, Meltzer P, Gorlick R. Osteosarcoma: current treatment
and a collaborative pathway to success. J Clin Oncol 2015;33:3029–35.
2. Otoukesh B, Boddouhi B, Moghtadaei M, Kaghazian P, Kaghazian M. Novel
molecular insights and new therapeutic strategies in osteosarcoma. Cancer Cell
Int 2018;18:158.
2482 Cancer Res; 80(12) June 15, 2020
IHC analyses of osteosarcoma tissues revealed that MAFB expression
positively correlates with Sox9. More importantly, expression of both
MAFB and Sox9 were associated with poor outcomes of these patients.
Strikingly, the patients with MAFBhigh Sox9high tumors displayed the
shortest survival, as compared with those with MAFBlowSox9low
tumors. MAFBlowSox9high or MAFBhighSox9low tumors also show a
trend towards better survival compared with MAFBhigh Sox9high,
although the small sample size precluded a statistically robust analysis.
Thus, combined detection of the MAFB-Sox9 feedback loop represents
a potential alternative method by which to stratify patients with
osteosarcoma with increased prognostic ability of disease progression
and mortality.
In conclusion, our study identifies a MAFB–Sox9 reciprocal regu-
latory loop that sustains stem cell properties of osteosarcoma cells
in vitro and in vivo. Given their essential roles in maintaining
osteosarcoma CSCs, this signaling axis could be exploited to design
novel therapeutic strategies against this deadly bone malignancy.
Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023
Moreover, simultaneous examination of MAFB and Sox9 expression
status may help provide prognostic value in clinical settings.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors’ Contributions
Conception and design: Y. Chen, B. Wang, T. Wang, W. Lei, D. Xiang, Z. Lei, X. Chu
Development of methodology: C. Hu, W. Lei, D. Xiang, Z. Lei, X. Chu
Acquisition of data (provided animals, acquired and managed patients, provided
facilities, etc.): Y. Chen, C. Hu, Q. Liu, D. Han, J. Zhang, Z. Li, W. Lei, D. Xiang,
R. Wang, W. Huang, Z. Lei, X. Chu
Analysis and interpretation of data (e.g., statistical analysis, biostatistics,
computational analysis): Y. Chen, M. Huang, T. Wang, C. Chen, Z. Li, C. Liu,
W. Lei, Y. Chang, M. Wu, D. Xiang, Y. Chen, Z. Lei
Writing, review, and/or revision of the manuscript: Y. Chen, B. Wang, M. Huang,
T. Wang, D. Han, C. Chen, C. Liu, W. Lei, Y. Chang, M. Wu, Y. Chen, Z. Lei, X. Chu
Administrative, technical, or material support (i.e., reporting or organizing data,
constructing databases): Y. Chen, W. Lei, W. Huang, X. Chu
Study supervision: Y. Chen, B. Wang, W. Lei, D. Xiang, Z. Lei
Acknowledgments
This work was supported by the National Natural Science Foundation of China
(81572457 and 81872042 to X. Chu; 81702442 to Z. Lei; 81822032 to B. Wang;
81972332 to Y. Chen), the Natural Science Foundation of Jiangsu province
(BK20170623 to Z. Lei), the Jiangsu Planned Projects for Postdoctoral Research
Funds (2018K090B to Z. Lei), the Natural Science Foundation Project of CQ CSTC
(cstc2019jcyjjqX0027 to B. Wang), and the funding from the Army Medical Uni-
versity (Nos. 2019XQY19, 2018XLC2023, and 2019CXLCA001 to B. Wang; Nos.
2018XLC3059 and 2019CXLCC005 to T. Wang).
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
Received June 5, 2019; revised February 6, 2020; accepted March 24, 2020;
published first March 31, 2020.
3. Brown HK, Tellez-Gabriel M, Heymann D. Cancer stem cells in osteosarcoma.
Cancer Lett 2017;386:189–95.
4. Wang T, Wu H, Liu S, Lei Z, Qin Z, Wen L, Liu K, et al. SMYD3 controls a Wnt-
responsive epigenetic switch for ASCL2 activation and cancer stem cell main-
tenance. Cancer Lett 2018;430:11–24.
CANCER RESEARCH

5. Lytle NK, Ferguson LP, Rajbhandari N, Gilroy K, Fox RG, Deshpande A, et al. A
multiscale map of the stem cell state in pancreatic adenocarcinoma. Cell 2019;
177:572–86.
6. Takahashi N, Nobusue H, Shimizu T, Sugihara E, Yamaguchi-Iwai S, Onishi
N, et al. ROCK inhibition induces terminal adipocyte differentiation and
suppresses tumorigenesis in chemoresistant osteosarcoma cells. Cancer Res
2019;79:3088–99.
7. Cooper J, Giancotti FG. Integrin signaling in cancer: mechanotransduction,
stemness, epithelial plasticity, and therapeutic resistance. Cancer Cell 2019;35:
347–67.
8. Yan G-N, Lv Y-F, Guo Q-N. Advances in osteosarcoma stem cell research and
opportunities for novel therapeutic targets. Cancer Lett 2016;370:268–74.
9. Miao Y, Zhang H, Pan Y, Ren J, Ye M, Xia F, et al. Single-walled carbon nanotube:
One specific inhibitor of cancer stem cells in osteosarcoma upon downregulation
of the TGFbeta1 signaling. Biomaterials 2017;149:29–40.
10. Pai EL, Vogt D, Clemente-Perez A, McKinsey GL, Cho FS, Hu JS, et al. Mafb and
c-Maf have prenatal compensatory and postnatal antagonistic roles in cortical
interneuron fate and function. Cell Rep 2019;26:1157–73.
11. Blank V. Small Maf proteins in mammalian gene control: mere dimerization
partners or dynamic transcriptional regulators? J Mol Biol 2008;376:913–25.
12. Nishizawa M, Kataoka K, Vogt PK. MafA has strong cell transforming ability but
is a weak transactivator. Oncogene 2003;22:7882–90.
13. Pouponnot C, Sii-Felice K, Hmitou I, Rocques N, Lecoin L, Druillennec S,
et al. Cell context reveals a dual role for Maf in oncogenesis. Oncogene 2006;
25:1299–310.
14. Yang L, Liu Y, Zhu L, Xiao M. DNMT3A R882 mutation is associated with
elevated expression of MAFB and M4/M5 immunophenotype of acute myeloid
leukemia blasts. Leuk Lymphoma 2015;56:2914–22.
15. Smink JJ, Begay V, Schoenmaker T, Sterneck E, de Vries TJ, Leutz A. Tran-
scription factor C/EBPbeta isoform ratio regulates osteoclastogenesis through
MafB. EMBO J 2009;28:1769–81.
16. Miyai M, Hamada M, Moriguchi T, Hiruma J, Kamitani-Kawamoto A,
Watanabe H, et al. Transcription factor MafB coordinates epidermal
keratinocyte differentiation. J Invest Dermatol 2016;136:1848–57.
17. Pettersson AM, Acosta JR, Bjork C, Kratzel J, Stenson B, Blomqvist L, et al. MAFB
as a novel regulator of human adipose tissue inflammation. Diabetologia 2015;
58:2115–23.
18. Hamada M, Nakamura M, Tran MT, Moriguchi T, Hong C, Ohsumi T, et al.
MafB promotes atherosclerosis by inhibiting foam-cell apoptosis. Nat Commun
2014;5:3147.
19. Tsuchiya M, Misaka R, Nitta K, Tsuchiya K. Transcriptional factors, Mafs and
their biological roles. World J Diabetes 2015;6:175–83.
20. Li Y, Min D, Wang K, Yin S, Zheng H, Liu L. MicroRNA152 inhibits cell
proliferation, migration and invasion by directly targeting MAFB in nasopha-
ryngeal carcinoma. Mol Med Rep 2017;15:948–56.
21. Qin ZY, Wang T, Su S, Shen LT, Zhu GX, Liu Q, et al. BRD4 promotes gastric
cancer progression and metastasis through acetylation-dependent stabilization
of snail. Cancer Res 2019;79:4869–81.
22. Hu Y, Smyth GK. ELDA: extreme limiting dilution analysis for comparing
depleted and enriched populations in stem cell and other assays. J Immunol
Methods 2009;347:70–8.
23. Casta~ no Z, San Juan BP, Spiegel A, Pant A, DeCristo MJ, Laszewski T, et al. IL-1b
inflammatory response driven by primary breast cancer prevents metastasis-
initiating cell colonization. Nat Cell Biol 2018;20:1084–97.
AACRJournals.org
MAFB-Sox9–Positive Feedback Loop Promotes OS Stemness
24. Seong BK, Lau J, Adderley T, Kee L, Chaukos D, Pienkowska M, et al. SATB2
enhances migration and invasion in osteosarcoma by regulating genes involved
in cytoskeletal organization. Oncogene 2015;34:3582–92.
25. Tsuru A, Setoguchi T, Matsunoshita Y, Nagao-Kitamoto H, Nagano S, Yokouchi
M, et al. Hairy/enhancer-of-split related with YRPW motif protein 1 promotes
osteosarcoma metastasis via matrix metallopeptidase 9 expression. Br J Cancer
2015;112:1232–40.
26. Jia M, Hu J, Li W, Su P, Zhang H, Zhang X, et al. Trps1 is associated with the
multidrug resistance of osteosarcoma by regulating MDR1 gene expression.
FEBS Lett 2014;588:801–10.
27. Stros M, Ozaki T, Bacikova A, Kageyama H, Nakagawara A. HMGB1 and
HMGB2 cell-specifically down-regulate the p53- and p73-dependent sequence-
specific transactivation from the human Bax gene promoter. J Biol Chem 2002;
277:7157–64.
28. Dean M, Fojo T, Bates S. Tumor stem cells and drug resistance. Nat Rev Cancer
2005;5:275–84.
29. Zhu H, Tang J, Tang M, Cai H. Upregulation of SOX9 in osteosarcoma and its
association with tumor progression and patients' prognosis. Diagn Pathol 2013;
8:183.
Downloaded from http://aacrjournals.org/cancerres/article-pdf/80/12/2472/2872761/2472.pdf by guest on 30 November 2023
30. Si W, Huang W, Zheng Y, Yang Y, Liu X, Shan L, et al. Dysfunction of
the reciprocal feedback loop between GATA3- and ZEB2-nucleated repression
programs contributes to breast cancer metastasis. Cancer Cell 2015;27:822–36.
31. Wang D, Kon N, Lasso G, Jiang L, Leng W, Zhu WG, et al. Acetylation-regulated
interaction between p53 and SET reveals a widespread regulatory mode. Nature
2016;538:118–22.
32. Pavlovic M, Arnal-Estape A, Rojo F, Bellmunt A, Tarragona M, Guiu M, et al.
Enhanced MAF oncogene expression and breast cancer bone metastasis. J Natl
Cancer Inst 2015;107:djv256.
33. Yu H, Jiang HL, Xu D, Jin JZ, Zhao ZM, Ma YD, et al. Transcription factor MAFB
promotes hepatocellular carcinoma cell proliferation through up-regulation of
cyclin D1. Cell Physiol Biochem 2016;39:700–8.
34. Yang LS, Zhang XJ, Xie YY, Sun XJ, Zhao R, Huang QH. SUMOylated MAFB
promotes colorectal cancer tumorigenesis. Oncotarget 2016;7:83488–501.
35. Drivdahl R, Haugk KH, Sprenger CC, Nelson PS, Tennant MK, Plymate
SR. Suppression of growth and tumorigenicity in the prostate tumor cell
line M12 by overexpression of the transcription factor SOX9. Oncogene
2004;23:4584–93.
36. Zhou CH, Ye LP, Ye SX, Li Y, Zhang XY, Xu XY, et al. Clinical significance of
SOX9 in human non-small cell lung cancer progression and overall patient
survival. J Exp Clin Cancer Res 2012;31:18.
37. Riemenschnitter C, Teleki I, Tischler V, Guo W, Varga Z. Stability and
prognostic value of Slug, Sox9 and Sox10 expression in breast cancers treated
with neoadjuvant chemotherapy. SpringerPlus 2013;2:695.
38. Guo X, Xiong L, Sun T, Peng R, Zou L, Zhu H, et al. Expression features of SOX9
associate with tumor progression and poor prognosis of hepatocellular carci-
noma. Diagn Pathol 2012;7:44.
39. Passeron T, Valencia JC, Namiki T, Vieira WD, Passeron H, Miyamura Y,
et al. Upregulation of SOX9 inhibits the growth of human and mouse
melanomas and restores their sensitivity to retinoic acid. J Clin Invest
2009;119:954–63.
40. La Noce M, Paino F, Mele L, Papaccio G, Regad T, Lombardi A, et al. HDAC2
depletion promotes osteosarcoma's stemness both in vitro and in vivo: a
study on a putative new target for CSCs directed therapy. J Exp Clin Cancer
Res 2018;37:296.
Cancer Res; 80(12) June 15, 2020 2483