Mol Cell Biochem

DOI 10.1007/s11010-014-2081-8

The study of regulatory effects of Pdx-1, MafA and NeuroD1

on the activity of porcine insulin promoter and the expression
of human islet amyloid polypeptide
Xiao-Dan Liu • Jin-Xue Ruan • Ji-Han Xia •

Shu-Lin Yang • Jun-Hua Fan • Kui Li

Received: 13 March 2014 / Accepted: 3 May 2014

Ó Springer Science+Business Media New York 2014

Abstract The purpose of the present study was to Abbreviations

determine the activation of porcine insulin promoter (PIP) PIP Porcine insulin promoter
by three transcription factors: pancreatic and duodenal Pdx-1 p Pancreatic and duodenal homeobox 1
homeobox 1 (Pdx-1), v-maf musculoaponeurotic fibrosar- MafA v-maf musculoaponeurotic fibrosarcoma
coma oncogene (MafA) and neurogenic differentiation 1 oncogene
(NeuroD1) in non-beta islet cells cultured in vitro. In NeuroD1 Neurogenic differentiation 1
addition, the expression of the exogenous human islet hIAPP Human islet amyloid polypeptide
amyloid polypeptide (hIAPP) gene driving by PIP in por- PK15 Porcine kidney 15 cell
cine kidney 15 (PK15) cells co-transfected with these INS Insulin
transcription factors was also examined. In the present PCAF P300/CBP-associated factor
study, a series of vectors for gene overexpression were bHLH Basic helix-loop-helix
constructed, including pGL3-Pdx-1, pGL3-MafA, pGL3- qPCR Quantitative real-time polymerase chain
NeuroD1, pGL3-PIP-LUC and pcDNA3.1-PIP-hIAPP. The reaction
dual-luciferase reporter assay showed that the PIP activity CDS The coding DNA sequences
was increased in PK15 cells when overexpressing the NCBI The National Center for Biotechnology
exogenous transcription factors Pdx-1, MafA and NeuroD1. Information
Introducing the PIP-hIAPP expression vector into PK15 LUC The luciferase
cells combined with exogenous Pdx-1, MafA and NeuroD1 GAPDH Glyceraldehyde-3-phosphate dehydrogenase
resulted in the efficient expression of hIAPP at the gene RIP The rat insulin 1 promoter
level, but not the protein. The current systematic porcine HIP The human insulin promoter
insulin promoter analysis provided the basic information
for future utilization of porcine insulin.
Introduction
Keywords Insulin promoter  Transcription factor 
Luciferase  Human islet amyloid polypeptide  PK15 cell Type 2 diabetes mellitus is mainly characterized by insulin
resistance, which may be combined with impaired insulin
secretion. As type 2 diabetes progresses, insulin secretion
X.-D. Liu  J.-X. Ruan  J.-H. Xia  S.-L. Yang (&)  usually decreases to below normal levels, which is
J.-H. Fan  K. Li accompanied by insulin resistance [1]. Therefore, structural
Key Laboratory for Farm Animal Genetic Resources and and functional damage to pancreatic islet b cells and b cells
Utilization of Ministry of Agriculture of China, Institute of
apoptosis play important roles in the development and
Animal Science, Chinese Academy of Agricultural Science,
Beijing 100193, People’s Republic of China progression of type 2 diabetes. Due to the similarities
e-mail: yangshulin@caas.cn between pigs and humans in terms of anatomy, physiology
X.-D. Liu and nutritional metabolism, pigs have been considered a
e-mail: 857414958@qq.com suitable animal for modeling human metabolic diseases [2].

123

However, the process of establishing pig diabetes models
and evaluating the diabetic phenotypes of the pigs is rather
lengthy. The study of the regulation of pancreatic b cell
function through genetic modifications at the individual
level is time consuming. In addition, b cells are terminally
differentiated somatic cells. It is difficult to achieve effi-
cient gene transfer to the isolated and cultured b cells.
Therefore, the construction of biological models using non-
b cells to study gene expression and regulation in b cells is
of great significance for generating genetically modified
pigs and for studying target gene functions.
The human islet amyloid polypeptide (hIAPP) and
insulin (INS) genes are specifically expressed in pancreatic
islet b cells. The cis-acting elements in porcine insulin
promoter (PIP) include A, C and E elements [3, 4], which
interact with the transcription factors pancreatic and duo-
denal homeobox 1 (Pdx-1), v-maf musculoaponeurotic
fibrosarcoma oncogene (MafA) and neurogenic differenti-
ation 1 (NeuroD1), respectively [3–6] The A box in the
insulin promoter consists of up to five regulatory elements
[7], including A5, A3, A2, A1 and GG2 [8]. The A box is
rich in adenine/thymine (A/T) bases. The DNA motif 50 -
CC [CT] TAAT [TG]-30 serves as a binding site for Pdx-1.
In the motif, TAAT is the core region that interacts with the
Pdx-1 protein [9], a member of the homeobox protein
family [3–7, 9, 10]. The transcription factor MafA binds to
the C1 element in the insulin promote [3–6, 11]. MafA is
mainly present in the nuclei of pancreatic islet b cells.
MafA binds to DNA as a dimer and interacts with other
transcription factors [4], such as NeuroD1, P300/CBP-
associated factor (PCAF) and Pdx-1, to stimulate tran-
scriptional activity. The core sequence of the E element is
50 -CANNTG-30 [12], which serves as the binding site for
proteins of the basic helix-loop-helix (bHLH) family. The
trans-acting factors that interact with the E element mainly
include NeuroD1 (also known as BETA2) [3–6, 13], E2/5,
E12 and E7. NeuroD1 is abundant in pancreatic islet,
whereas E2/5 and E47 are widely distributed. NeuroD1
forms heterodimers with other bHLH proteins such as E47
[3]. The heterodimers bind to the E element and stimulate
the transcriptional activity of the promoter [4]. Studies
have shown that all three transcription factors, Pdx-1,
MafA and NeuroD1, efficiently activate transcription from
murine and human insulin promoters. However, the three
transcription factors exert distinct effects on the insulin
promoters of different species [4].
Approximately 90 % of patients with type 2 diabetes
show hIAPP precipitation-induced b cell apoptosis in
pancreatic islets. The amyloid precipitates are primarily
composed of extracellular hIAPP multimers. hIAPP is
composed of 37 amino acids and is secreted simultaneously
with insulin [14–16]. Humans, non-human primates and
cats express a type of IAPP that forms amyloid protein,
123
Mol Cell Biochem
while IAPPs in rodents and pigs fail to form amyloid
protein. Interspecies variations in the amino acid sequence
of IAPP are mainly observed at residues 20–29 [15]. These
residues (AILSS) display the most prominent effect on
amyloid fibril formation. Studies have shown that both
hIAPP and insulin are synthesized and secreted by pan-
creatic b cells. Under physiological conditions, hIAPP
collaborates with blood sugar, regulating hormones such as
insulin to precisely control blood glucose levels in humans.
Studies have also indicated that hIAPP has a strong ten-
dency to misfold and form amyloid polypeptides [15]. hI-
APP is currently known to be one of the polypeptides with
the greatest capacity for the formation of amyloid aggre-
gates [15]. It is capable of interacting with the lipid
membrane and destroying the cell membrane barrier. In
addition, multimeric hIAPP interrupts b cell coupling and
induces b cell apoptosis [14, 15]. Therefore, the formation
of hIAPP amyloid deposition is considered to be an
important pathogenic factor for type 2 diabetes.
The present study focused on the regulatory effects of
the transcription factors Pdx-1, MafA and NeuroD1 on
transcription from PIP in non-b cells and the feasibility of
constructing a cellular model to control target gene
expression in non-b cells.
Materials and methods
Materials
The porcine kidney cell line (PK15) and the human pan-
creatic carcinoma cell line (Panc-1) were obtained from the
Research Center of Basic Medical Science at the Institute of
Basic Medical Sciences Chinese Academy of Medical
Sciences (IBMSCAMS, Beijing, China). The DH5a com-
petent bacterial cells were purchased from GeneWiz Bio-
technology Co., Ltd (Beijing, China). The endotoxin-free
plasmid extraction kit was purchased from Tiangen Biotech
(Beijing, China) Co., Ltd. Restriction enzymes were pur-
chased from NEB (USA). The LipofectamineTM 2,000
liposomal transfection reagent was purchased from Invit-
rogen (USA). The Dual-Luciferase Reporter Assay kit was
purchased from Progema (USA). The high purity total RNA
extraction kit was purchased from Biotake (China). The
reverse transcription reagent kit was purchased from
Thermo Scientific (USA). SYBR Ò Premix Ex TaqTM was
purchased from Takara (Japan). The total cellular protein
extraction kit and protein assay kit were purchased from
Thermo Scientific (USA). The anti-hIAPP primary antibody
was purchased from Santa Cruz Biotechnology, Inc. (USA).
The anti-b-actin primary antibody was purchased from
Abcam (UK). All secondary antibodies were purchased
from Beijing Cowin Biosciences Co., Ltd (Beijing, China).
Mol Cell Biochem
Table 1 Primer information Gene name Primer name
Pdx-1 pdx1-f
pdx1-r
MafA mafa-f
mafa-r
NeuroD1 neurod1-f
neurod1-f
hIAPP hiapp-f
hiapp-r
GAPDH gapdh-f
gapdh-r
Gene expression in muscle, liver, pancreatic and kidney
tissues
Four types of tissue samples (muscle, liver, pancreas and
kidney) were collected from Wuzhishan miniature pigs.
Total RNA was extracted from the tissue samples. The
expression levels of the transcription factors Pdx-1, MafA
and NeuroD1 were analyzed by quantitative real-time
polymerase chain reaction (qPCR). The sequences of the
primers utilized in qPCR are summarized in Table 1.
Plasmids
The Pdx-1, MafA and NeuroD1 genes were synthesized by
Shanghai Generay Biotech Co., Ltd. (China) according to
the coding DNA Sequences (CDS) stored in the National
Center for Biotechnology Information (NCBI) database.
They were cloned into the NcoI/XbaI restriction sites of the
pGL3-control vector to replace the original luciferase
(LUC) gene. The resulting recombinant plasmid vectors
were named pGL3-Pdx-1, pGL3-MafA and pGL3-Neu-
roD1, respectively.
The PIP sequences [2] and hIAPP gene according to the
coding DNA Sequences (CDS) stored in the NCBI data-
base were synthesized by Shanghai Generay Biotech Co.,
Ltd. (China) They were cloned into the MfeI/Bst1107I
restriction sites of the pcDNA3.1(?) plasmid. The resulting
recombinant plasmid was named pcDNA3.1-PIP-hIAPP.
To construct vector of overexpression of reporter, the
following upstream and downstream primers were
designed and synthesized using the PIP-containing plasmid
pcDNA3.1-PIP-hIAPP:
F: 50 -gcGAGCTCGAGTTCAGCTGAGCT-30 ;
SacI
R: 50 -cccAAGCTTgggAGGACCTGGGGGAC-30 .
HindIII
Primer sequence (50 –30 ) Length of PCR product (bp)
AAGTCTACCAAGGCTCACGC 159
GCGCGGCCTAGAGATGTATT
AGGAGGAGGTCATCCGGCTC 187
TTGTACAGGTCCCGCTCTTTG
TCTTGCGTTCAGGCAAAAGC 117
AAGTCCGAGGATTGAGCTGC
ACCATCTGAAAGCTACACCCAT 122
GGCACCAAAGTTGTTGCTGG
AGGGCATCCTGGGCTACACT 166
TCCACCACCCTGTTGCTGTAG
The SacI and HindIII restriction enzyme sites were
added to the ends of the primers (lowercase letters indi-
cated the protected bases). A fraction of the PIP
approximately 1,500 bp in length was amplified by PCR.
The PCR products were verified by electrophoresis on a
1 % agarose gel, and the target fragment was recovered
from the gel. The recovered fragment was incubated with
the pGM-T cloning vector at 4 °C overnight to generate
the pGM-T-PIP recombinant plasmid, which was then
transformed into DH5a competent cells. The pGM-T-PIP
recombinant plasmid was extracted, digested with the
restriction endonucleases SacI and HindIII and subjected
to electrophoresis on a 1 % agarose gel. The DNA frag-
ment of approximately 1,500 bp was recovered from the
agarose gel. Meanwhile, the pGL3-basic plasmid was
digested with the restriction endonucleases SacI and
HindIII, and the resulting DNA fragments were separated
by electrophoresis on a 0.7 % agarose gel. A DNA
fragment of approximately 4,800 bp was recovered from
the agarose gel. The 1,500 and 4,800 bp fragments were
ligated overnight at 4 °C and transformed into DH5a
competent cells. The recombinant plasmid pGL3-PIP-
LUC was extracted.
Reporter assay
PK15 cells were cultured in 24-well cell culture plates to
80–90 % confluency and then subjected to transfection
using the lipofectamineTM 2000 reagent according to the
manufacturer’s instructions. The PK15 cells in each well
were transfected with a total of 1.6 lg plasmids, including
800 ng of pGL3-PIP-LUC, 200 ng of pRL-TK, 200 ng of
an expression vector encoding one of the transcription
factors and the pGL3-basic plasmid. In addition, the PK15
negative control group was transfected with pEGFP to
determine the transfection efficiency. The plasmids
123
 Mol Cell Biochem

Table 2 List of the plasmids transfected into various groups of PK15

cells
Experimental group 1 2 3 4 5 6 7 8

pGL3-PIP-LUC ? ? ? ? ? ? ? ?
pRL-TK ? ? ? ? ? ? ? ?
pGL3-Pdx-1 - ? - - ? ? - ?
pGL3-MafA - - ? - ? - ? ?
pGL3-NeuroD - - - ? - ? ? ?
‘‘ ? ’’ indicates that the plasmid was used to transfect PK15 cells,
‘‘ - ’’ indicates untransfected plasmid

Table 3 List of the plasmids transfected into various groups of cells

Experimental group 1 2 3 4 5 6 7 8 9
Fig. 1 The expression levels of the three transcription factors in
Cell type PK15 Panc-1 muscle, liver, kidney and pancreas
pcDNA3.1-PIP-hIAPP ? ? ? ? ? ? ? ? ?
pEGFP ? ? ? ? ? ? ? ? ? Data analysis
pGL3-Pdx-1 - ? - - ? ? – ? -
pGL3-MafA - - ? - ? - ? ? - Data analysis was performed using the SPSS version 19.0
pGL3-NeuroD - - - ? - ? ? ? - software. Mean values and standard deviations of the
luciferase assay data were calculated and utilized to con-
‘‘ ? ’’ indicates that the plasmid was transfected into the PK15 cells,
‘‘ - ’’ indicates untransfected plasmids struct bar graphs in Excel.

transfected into various groups of PK15 cells are summa- Results

rized in Table 2. Firefly and Renilla luciferase activities
were determined in extracts of transfected cells using the
Dual-Luciferase Reporter Assay System 48 h post-
transfection.
hIAPP expression analysis
The PK15 and Panc-1 cell lines were cultured in 24-well cell
culture plates to 80–90 % confluency and then subjected to
eukaryotic cell transfection using the lipofectamineTM 2000
reagent according to the manufacturer’s instructions. The
cells in each well were transfected with 800 ng of
pcDNA3.1-PIP-hIAPP plasmid, 200 ng of pRL-TK plasmid
and 200 ng of an expression vector encoding one of the
transcription factors. In addition, the cells were transfected
with the pGL3-basic plasmid, which brought the total
amount of the plasmids in the transfections to 1.6 lg. The
Panc-1 positive control group was transfected with 800 ng of
pcDNA3.1-PIP-hIAPP plasmid, 200 ng of pEGFP plasmid
and 600 ng of pGL3-basic plasmid. The cells were divided
into two large groups (groups I and II) for the analysis of the
RNA and protein expression levels. Each large group was
further divided into nine small subgroups. The plasmids
transfected into each group of cells are shown in Table 3.
Cells in group I were analyzed by qPCR 36 h post-trans-
fection, and cells in group II were analyzed by Western blot
and radioimmunoassays 36 h post-transfection.
The expression of transcription factors in the muscle,
liver, pancreatic and kidney tissues
The mRNAs expressed in the muscle, liver, pancreatic and
kidney tissues of the Wuzhishan miniature pigs were ana-
lyzed by qPCR. The gene expression levels of the transcrip-
tion factors Pdx-1, MafA and NeuroD1 in all four tissues are
shown in Fig. 1. The results showed that the gene expression
levels of the transcription factors Pdx-1, MafA and NeuroD1
in the pancreas were significantly higher than those in the
other three tissues, indicating that all three transcription fac-
tors were specifically expressed in pancreatic cells.
Restriction enzyme digestion of plasmids
The pGL3-Pdx-1, pGL3-MafA and pGL3-NeuroD1 plas-
mids were subjected to single restriction endonuclease
digestion with HindIII (Fig. 2A) and double restriction
endonuclease digestion with HindIII/XbaI (Fig. 2B). The
recombinant vector pGL3-PIP-LUC was subjected to sin-
gle restriction endonuclease digestion with HindIII and
double restriction endonuclease digestion with HindIII/
ScaI (Fig. 2C). The pcDNA3.1-PIP-hIAPP plasmid was
subjected to single restriction endonuclease digestion by
MfeI and double restriction endonuclease digestion by
MfeI/Bst1107I (Fig. 2D). The results of agarose gel

123
Mol Cell Biochem

Fig. 2 Electrophoretic bands of

plasmids after restriction
enzyme digestion. A pGL3-Pdx-
1, pGL3-MafA and pGL3-
NeuroD1 digested by single
restriction enzyme, B pGL3-
Pdx-1, pGL3-MafA and pGL3-
NeuroD1 digested by double
restriction enzyme, C pGL3-
PIP-LUC digested by restriction
enzyme, D pcDNA3.1-PIP-
hIAPP digested by restriction
enzyme, 1–5: pGL3-Pdx-1,
pGL3-MafA, pGL3-NeuroD1,
pGL3-PIP-LUC and pcDNA3.1-
PIP-hIAPP plasmid, s: single
restriction enzyme digestion, d:
double restriction enzyme
digestion

electrophoresis showed that sizes of the bands were con-

sistent with sizes of the corresponding restriction
fragments.

Dual-luciferase activity assay

At 48 h after transfection, the activities of the two lucif-

erase were examined. The relative luciferase activity in
each group of cells is shown in Fig. 3. Among these tran-
scription factors, MafA exerted the strongest stimulatory
effect on PIP when acting alone, resulting in an approxi-
mate 15-fold increase in PIP activity (P \ 0.05). Pdx-1
collaborated with either MafA or NeuroD1 and displayed a
cumulative effect on PIP activation. MafA and NeuroD1
interacted with each other and exerted a strong synergistic
stimulation of PIP activity, resulting in an approximate
40-fold activation of PIP compared with cells lacking any
transcription factor (P \ 0.05). All three transcription
factors might interact with PIP jointly. However, the
stimulatory effect on PIP activity was weaker than the
synergistic effect of MafA and NeuroD1. The results
demonstrated that the activity of the luciferase was sig-
nificantly increased in PK15 cells co-transfected with the
transcription factor overexpression vectors in comparison
with cells lacking the transcription factors.
Examine hIAPP expression in pcDNA3.1-PIP-hIAPP
transfected cells
qPCR was performed using hIAPP as the target gene and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as
the reference gene. The qPCR data were analyzed and
plotted using the 2-DDCt method, and the fluorescence-
based quantitative expression profile of the hIAPP gene is
Fig. 3 Examination of the activities of the dual-luciferase reporter
gene in PK15 cells
shown in Fig. 4A. The results of qPCR showed that the
expression level of the hIAPP gene was markedly
increased in PK15 cells transfected with the transcription
factor overexpression vectors. This result indicated that the
high level of hIAPP expression driven by PIP was achieved
in the presence of transcription factors that specifically
interacted with PIP.
The results of the Western blot analysis (Fig. 4B) and
radioimmunoassay (Fig. 4C) showed that there was no
significant differences in the expression levels of the
mature hIAPP protein in PK15 cells transfected with the
different transcription factors and control. In contrast, the
expression level of the mature hIAPP protein displayed an
approximate four fold increase in Panc-1 cells. Compared
with the results of qPCR shown in Fig. 4A, hIAPP
expression at the gene level did not positively correlate

123

Fig. 4 Examination of hIAPP gene expression in PK15 cells. qPCR (A), Western blot (B), Radioimmunoassay (C)
with hIAPP expression at the protein level in PK15. These
results indicated in PK15 cells hIAPP mRNA failed to
produce the mature hIAPP protein efficiently.
Discussion
The cis-acting elements in PIP interact with trans-acting
factors that are expressed in a tissue-specific and time-
specific fashion to regulate insulin gene transcription.
Various transcription factor binding sites are located
300–400 bp upstream of the insulin gene and interact with
transcription factors primarily expressed in the pancreas.
The transcription factors Pdx-1, MafA and NeuroD1 bind
to the A, C and E elements in the insulin promoter [3, 4],
respectively, and regulate the transcriptional activity of the
insulin promoter [4, 7, 17, 18]. In mammals, the sequences
of the cis-acting elements in the insulin promoter are highly
conserved. A large number of studies investigated the
effects of the transcription factors Pdx-1 [19–22], MafA
[22, 23] and NeuroD1 [20, 22] on the activities of the
mouse and human insulin promoters [7, 20]. These tran-
scription factors, alone or together, interact with the murine
and human insulin promoters and effectively enhance the
expression of the downstream target genes [7]. A dual-
luciferase activity assay was performed in the present
study, and the results indicated that all three transcription
factors, Pdx-1, MafA and NeuroD1, activated PIP to a
certain extent. These results indicated that the three tran-
scription factors, acting alone or in collaboration, enhanced
123
Mol Cell Biochem
to varying degrees the transcription of the luciferase gene
under the control of PIP. When all three transcription
factors interacted with PIP jointly, the stimulatory effect
was weaker compared with the synergistic effect of MafA
and NeuroD1. The mechanisms underlying this phenome-
non might involve competition between Pdx-1 and MafA
or NeuroD1 or the inhibition of the synergistic effect of
MafA and NeuroD1 by Pdx-1. Hilary at el reported that
Pdx-1 mediates the maximal transcriptional activation at
the rat insulin 1 promoter (RIP) and the human insulin
promoter (HIP) in Hela cells, resulting in four fold and
40-fold activation, respectively [4].In contrast, the other
transcription factors exhibited significantly weaker effects
on promoter activation [4]. Pdx-1, MafA and NeuroD1
exert a synergistic effect on the RIP but an addictive effect
on HIP [4]. The results of the present study are somewhat
inconsistent with the results obtained by Hilary et al. on
RIP and HIP [4]. These inconsistent observations suggest
that the transcription factors Pdx-1, MafA and NeuroD1
exert distinct regulatory effects on insulin promoters of
different species, which might be related to nucleic acid
sequences of cis-acting elements in different insulin pro-
moters and secondary structures between the elements.
Alternatively, these different regulatory effects may be
related to the other factors in cells [12].
The translation of hIAPP mRNA in pancreatic islet b
cells is a complex process that involves a variety of key
enzymes. In pancreatic islet b cells, PC1/3 and PC2 are the
key enzymes involved in hIAPP translation that are mainly
expressed in the endocrine and neuroendocrine cells [17,
Mol Cell Biochem
24, 25]. The expression of PC2 and PC1/3 is restricted to
endocrine or neuroendocrine cells during hormonal bio-
synthesis [26]. In cells lacking PC2 and PC 1/3, hIAPP
mRNA cannot be translated into a mature protein. Signif-
icant differences were observed in hIAPP translation
between the PK15 cells and the pancreatic islet b cells. The
results of the protein expression analysis shown in Fig. 3
were compared to those in Fig. 4b, c. The transfection of
PK15 cells with an exogenous luciferase vector containing
PIP resulted in high-efficiency expression of the firefly
luciferase protein. In contrast, PK15 cells transfected with
an exogenous hIAPP expression vector containing PIP
failed to produce the hIAPP protein efficiently. These
results indicated the presence of specific regulatory path-
ways for the translation of the hIAPP gene. Paulsson et al.
transfected the GH4C1 and COS7 cell lines that lack PC2
and PC1/3 expression with an h-proIAPP expression vector
and then stained the cells with an antiserum specific for
hIAPP. The results revealed the presence of large amounts
of precipitate particles around the nucleus. In addition,
after the AtT-20 cell line that expresses PC1/3 but not PC2
was transfected with exogenous h-proIAPP expression
vector, the immunofluorescence assay detected a small
amount of precipitate particles in the vicinity of the
nucleus. Both types of transfected cell lines were also
stained with Congo red. After staining, the precipitate
particles displayed strong green fluorescence under polar-
ized light, indicating that the particles were amyloid pro-
tein multimers. In the absence of PC1/3, PC2 also exhibited
the ability to cleave proIAPP to some extent. The trans-
fection of the GH3 cell line that solely expresses PC2 with
vectors expressing h-proIAPP resulted in the appearance of
aggregates in the cytoplasm. No precipitate particles were
observed near the nucleus. An immunofluorescence ana-
lysis showed that these aggregates were different from the
ones found in the GH4C1, COS7 and AtT-20 cell lines.
Moreover, the aggregates could not be stained with Congo
red, indicating that these particles were not amyloid protein
multimers [26]. Non-b cells such as PK15 lack the regu-
lated secretory pathway and enzymes (PC2 and PC1/3) that
convert the IAPP propeptide to mature IAPP. Therefore,
large amounts of proIAPP accumulate in the vicinity of the
nucleus. Immature hIAPP and proIAPP form early human
islet amyloid protein multimers in the vicinity of the
nucleus, resulting in decreased secretion of monomeric
hIAPP protein into the cytoplasm. In the present study, the
results of the Western blot analysis and radioimmunoassay
only showed mature monomeric IAPP. Therefore, the
results shown in Fig. 4b, c showed the expression levels of
mature monomeric hIAPP in the cells, which accounted for
the lack of a positive correlation between the level of IAPP
protein expression and level of IAPP gene expression. The
transfection efficiencies in different groups of cells might
vary, which would have an impact on the final results. In
addition, oxidative stress would affect hIAPP aggregation
in the cells [26, 27].
The present study showed that the transcription factors
Pdx-1, MafA and NeuroD1 effectively stimulated the
transcriptional activity of PIP. In addition, the transfection
of non-b cells with the hIAPP overexpression vector
resulted in the expression of hIAPP mRNA but not the
mature hIAPP protein. Therefore, the successful construc-
tion of transgenic animals must take into account whether
the constructed exogenous target gene can be efficiently
transcribed into mRNA and subsequently translated into
functional protein to exert physiological functions in the
target cells.
Acknowledgments We thank Bingjun Hu and Siyuan Kong for
tissue preparation. This research was supported by the National
Natural Science Foundation of China (31372276), the Agricultural
Science and Technology Innovation Program (ASTIP-IAS05),
Development Program of China (SQ2011AAJY2795), National Key
Technology Support Program (2012BAI39B04, 2011BAI15B02), The
National Basic Research Program (2011CBA01005), National Sci-
ence and Technology Major Project (2014ZX08010-003).
References
1. Alberti KG, Zimmet PZ (1998) Definition, diagnosis and classi-
fication of diabetes mellitus and its complications. Part 1: diag-
nosis and classification of diabetes mellitus provisional report of
a WHO consultation. Diabet Med 15(7):539–553
2. Grzech M, Dahlhoff M, Herbach N et al (2010) Specific transgene
expression in mouse pancreatic b-cells under the control of the
porcine insulin promoter. Mol Cell Endocrinol 315(1–2):219–224
3. Han S, Yasuda K, Kataoka K (2011) ATF2 Interacts with b-Cell-
enriched transcription factors, MafA, Pdx1, and Beta2, and activates
insulin gene transcription. J Biol Chem 286(12):10449–10456
4. Docherty HM, Hay CW, Ferguson LA et al (2005) Relative
contribution of PDX-1, MafA and E47/b2 to the regulation of the
human insulin promoter. Biochem J 389(Pt3):813–820
5. Shao SY, Fang Z, Yu XF et al (2009) Transcription factors
involved in glucose-stimulated insulin secretion of pancreatic
beta cells. Biochem Biophys Res Commun 384(4):401–404
6. Barrow J, Hay CW, Ferguson LA et al (2006) Transcription
factor cycling on the insulin promoter. FEBS Lett 580(2):
711–715
7. Al-Quobaili F, Montenarh T (2008) Pancreatic duodenal
homeobox factor-1 and diabetes mellitus type 2 (Review). Int J
Mol Med 21(4):399–404
8. Aramata S, Han S, Yasuda K et al (2005) Synergistic activation
of the insulin gene promoter by the b-cell enriched transcription
factors MafA, Beta 2, and Pdx1. J Biol Chem 286(12):
10449–10456
9. Kaneto H, Miyatsuka T, Kawamori D et al (2007) Pleiotropic
roles of PDX-1 in the pancreas. Rev Diabet Stud 4(4):209–225
10. Rudnik A, Ling TY, Odagiri H et al (1994) Pancreatic b ells
express a diverse set of homeobox genes. Proc Natl Acad Sci
USA 91:12203–12207
11. Kaneto H, Matsuoka T, Kawashima S et al (2009) Role of MafA
in pancreatic b-cells. Adv Drug Deliv Rev 61:489–496
123

12. Wolf G, Hessabi B, Karkour A et al (2010) The activation of the
rat insulin gene by BETA2 and PDX-1 in Rat Insulinoma Cells Is
Repressed by Pax6. Mol Endocrinol 24(12):2331–2342
13. Song YD, Lee EJ, Yashar P et al (2007) Islet cell differentiation
in liver by combinatorial expression of transcription factors
neurogenin-3, BETA2, and RIPE3b1. Biochem Biophys Res
Commun 354(2):334–339
14. Westemark P (2011) Amyloid in the islets of Langerhans:
thoughts and some historical aspects. Ups J Med Sci 116(2):81–89
15. Kurganov B, Doh M, Arispe N (2004) Aggregation of liposomes
induced by the toxic peptides Alzheimer’s, human amylin and
prion(106–126): facilitation by membrane-bound GMI ganglio-
side. Peptides 25(2):217–232
16. Matveyenko AV, Butler PC (2006) Islet amyloid polypeptide
(IAPP) transgenic rodents as models for type 2 diabetes. ILAR J
47(3):225–233
17. Raikwar SP, Zavazava N (2012) PDX1-engineered embryonic
stem cell-derived insulin producing cells regulate hyperglycemia
in diabetic. Transplant Res 1(1):19
18. Hang Y, Stein R (2011) MafA and MafB activity in pancreatic b
cells. Trends Endocrinol Metab 22(9):364–373
19. Keller DM, McWeeney S, Arsenlis A et al (2007) Characteriza-
tion of pancreatic transcription factor Pdx-1 binding sites using
promoter microarray and serial analysis of chromatin occupancy.
J Biol Chem 282(44):32084–32092
123
Mol Cell Biochem
20. Babu DA, Chakrabarti SK, Garmey JC et al (2008) Pdx1 and
BETA2/NeuroD1 participate in a transcriptional complex that
mediates short-rang DNA looping at the insulin gene. J Biol
Chem 283(13):8164–8172
21. Bernardo AS, Hay CW, Docherty K et al (2008) Pancreatic
transcription factors and their role in the birth, life and survival of
the pancreatic b cell. Mol Cell Endocrinol 294(1–2):1–9
22. Fu Z, Gilbert ER, Liu D (2013) Regulation of insulin synthesis
and secretion and pancreatic Beta-cell dysfunction in diabetes.
Curr Diabetes Rev 9(1):25–53
23. Zhao L, Guo M, Matsuoka TA et al (2005) The islet b Cell-
enriched MafA activator is a key regulator of insulin gene tran-
scription. J Biol Chem 280(12):11887–11894
24. Marzban L, Rhodes CJ, Steiner DF et al (2006) Impaired NH2-
terminal processing of human proislet amyloid polypeptide by the
prohormone convertase PC2 leads to amyloid formation and cell
death. Diabetes 55(8):2192–2201
25. Watanabe M, Umeyama K, Kawano HO et al (2007) The pro-
duction of a diabetic mouse using constructs encoding porcine
insulin promoter-driven mutant human hepatocyte nuclear factor-
1. J Reprod Dev 53(2):189–200
26. Paulsson JF, Westermark GT (2005) Aberrant processing of
human proislet amyloid polypeptide results in increased amyloid
formation. Diabetes 54(7):2117–2125
27. Bonner-Weir S, O’Brien TD (2008) Islet in type 2 diabetes. In
honor of Dr. Robert C. Turner. Diabetes 57(11):2899–2904