The Journal of the Brazilian Society of Tropical Medicine

Detection of Arboviruses in Aedes aegypti through Transovarian Analysis: A Study in

Goiânia, Goiás

Running title:

Arbovirus Detection in Aedes aegypti: Transovarian Analysis in Goiânia, Goiás

Abstract

Background:

Arboviruses are a group of infectious diseases caused by viruses transmitted by arthropods,

mainly mosquitoes. These diseases, such as Dengue, Zika, Chikungunya, and Yellow Fever,

have a significant impact worldwide. In this context, entomological surveillance plays a

crucial role in the control and prevention of arboviruses, providing essential information on

the presence, distribution, and activity of vector mosquitoes. Based on entomological

surveillance, transovarian transmission provides information on the maintenance and

dissemination of arboviruses. The objective of this study was to detect these arboviruses in

Goiânia, Goiás, and analyze the occurrence of transovarian transmission.

Methods:

Aedes aegypti eggs were collected from different regions of Goiânia and cultivated under

controlled laboratory conditions until the emergence of adult mosquitoes. The adult females

were grouped into pools containing the head and thorax. These pools were subsequently

evaluated using a reverse transcription quantitative polymerase chain reaction assay.

Results:

A total of 157 pools (N=1570) were analyzed, with two pools testing positive for CHIKV and

one pool testing positive for ZIKV, indicating that the offspring resulting from transovarian

transmission are potentially infectious.

1
The Journal of the Brazilian Society of Tropical Medicine

Conclusions:

In summary, the demonstration of vertical transmission mechanisms of CHIKV and ZIKV in

Aedes aegypti serves as an alert to health authorities, as these diseases are still underreported,

and their primary urban vector has likely acquired this capacity, contributing to the

dissemination of these infections.

Keywords: Arboviruses, RT-qPCR, Vertical transmission, Monitoring.

Introduction

Arboviral diseases represent a group of infectious diseases caused by viruses

transmitted by arthropods, primarily members of the Culicidae family. These diseases,

including Dengue (DENV), Zika (ZIKV), Chikungunya (CHIKV), Oropouche (OROV),

Yellow Fever (YF), and viral encephalitis, pose a significant challenge to public health

worldwide1. In addition to impacting human health, arboviral diseases also have a significant

impact on society and the economy2. The social impact of arboviral diseases is marked by

human suffering caused by debilitating symptoms, such as high fever, intense joint pain, and

skin rashes1,3, as well as severe complications, such as Guillain–Barré syndrome [Pierson,

2018] and ZIKV-induced microcephaly in neonates4. Some arboviral diseases can also lead to

fatalities, such as Dengue Hemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS)5,6.

Vulnerable populations, including children, the elderly, and individuals with pre-existing

health conditions, are the most affected. Additionally, arboviral diseases impose a significant

burden on healthcare systems, as well as on individuals and their families. Direct costs

include medical treatment, hospitalization, and long-term care for patients with sequelae.

2
The Journal of the Brazilian Society of Tropical Medicine

There are also indirect costs, such as loss of productivity at work due to illness or disability,

which negatively impact the local and national economy7.

The primary vectors of arboviral diseases are mosquitoes belonging to the Aedes

genus. The A. aegypti and A. albopictus mosquitoes are the main vectors for DENV, ZIKV,

and CHIKV8,9. They are highly adapted to urban environments and primarily breed in

artificial containers that collect stagnant water, such as tires, plant pots, and household

containers10. Additionally, they have the capability for transovarial transmission11,12. The

larvae that emerge from the eggs are already infected, becoming adult mosquitoes capable of

transmitting the virus to other hosts, contributing to the persistence of arboviruses in urban

areas, even during periods of low human case incidence. This makes controlling these

diseases more challenging, as continuous transmission by infected mosquitoes from the larval

stage can perpetuate viral circulation13;14.

Entomological surveillance focuses on these mosquitoes and plays a crucial role in the

control and prevention of arboviral diseases by providing essential information about the

presence, distribution, and activity of vector mosquitoes15. Through the placement of traps to

capture adult mosquitoes and the inspection of breeding sites to analyze eggs and larvae for

the presence of arboviruses, it is possible to identify areas with higher infestation, determine

the population density of vectors, and monitor the presence of arboviruses in mosquitoes16.

Continuous and comprehensive entomological surveillance is essential to monitor vector

activity, evaluate the effectiveness of control measures, and provide crucial information for

the planning and implementation of strategies to prevent and control arboviral diseases17.

Among the surveillance approaches used, surveillance by transovarial transmission in

vector mosquitoes is noteworthy. This type of surveillance enables the identification and

monitoring of arboviruses in mosquito populations from the larval stage to the adult phase,

3
The Journal of the Brazilian Society of Tropical Medicine

when they can transmit the disease. A systematic collection of eggs, larvae, and mosquitoes

allows for the identification of sites where transovarial transmission occurs and the estimation

of the viral infection rate in these populations18. Surveillance by transovarial transmission in

mosquitoes is a strategic and complementary approach to conventional entomological

surveillance, contributing to the interruption of the viral transmission chain and the effective

control of arboviral diseases19.

Considering that there was a 211% increase in confirmed DENV cases, a 430%

increase in CHIKV cases, and a 364.71% increase in ZIKV cases in 2022 compared to 2021,

as reported in the epidemiological bulletin of the state of Goiás, it is possible that this

increase is related to transovarial transmission20. Therefore, the objective of this study was to

monitor the arboviruses DENV, CHIKV, ZIKV, and OROV through the analysis of

transovarial transmission occurrence in A. aegypti mosquitoes in the city of Goiânia, Goiás.

Materials and Methods

Study area, collection and preservation of mosquitoes

Aedes aegypti eggs were laid in the city of Goiânia, Goiás (Latitude: −16.6799 and

Longitude: −49.255). The city is the most populous in the central region of Brazil, with more

than 1.5 million inhabitants. The semi-humid tropical climate contributes to the proliferation

of the vector of arboviruses, A. aegypti, causing Goiânia to register an increase in cases of

arboviruses annually, with regions of the municipality in a state of alert for epidemics.

Previous studies of transovarian transmission in A. aegypti were carried out in the city, where

the Mayaro virus (MAYV) was detected in vectors that were close to Basic Health Units

(UBS) in the municipality21. In view of this, three regions of the city were chosen for the

collection of A. aegypti eggs, North (N), Southwest (SW), and Northwest (NW), for the

analysis of transovarial transmission in this vector. The collection was carried out by agents

4
The Journal of the Brazilian Society of Tropical Medicine

of the Sanitary Surveillance of the State of Goiás (SVS/GO) from January to September

2022. Ovitraps were used as devices to capture the eggs (Figure 1). The collected eggs were

added to containers with distilled water and nutrients until the larvae hatched. The larvae

were collected using a sieve and placed in 2 L PET bottles containing sterile distilled water

and cat food, which were later sealed with cotton. Adult mosquitoes were captured by suction

using an aspirator and placed directly in falcon tubes lined with filter paper and immediately

stored in a −80°C freezer until the pools were assembled. All reagents used during the

manipulation of mosquitoes were tested using real-time PCR (RT-qPCR) to determine the

presence of internal contamination.

Figure 1. Flowchart showing the steps taken in this study. In general, this work includes steps to capture eggs in
the North, Northwest and Southwest regions of Goiânia, traps were inserted to capture A. aegypti eggs between
(steps 1 and 2) obtaining A. aegypti larvae and pupae in the laboratory from these eggs and identification of

5
The Journal of the Brazilian Society of Tropical Medicine

adult mosquitoes separated into pools of 10 individuals containing head and thorax (thorax and abdomen) for
maceration, RNA extraction and RT-qPCR (steps 3, 4, 5, 6 and 7).

Assembly of pools and extraction of viral RNA

Morphological identification was performed at the genus and species levels, as

described by Forattini et al.22. The sexing of adult mosquitoes was carried out by observing

characteristics such as the plumage of the insects’ antennae, as shown in Supplementary

Material 1. The females were separated and organized into pools of 10 individuals containing

the head and thorax for analysis of the salivary gland and stored in 1.5 mL tubes (Axygen,

USA). Mosquito pools were macerated with a plastic pestle in 300 µL of H2O MilliQ

autoclaved directly in tubes, and the macerate was centrifuged for 2 min at 500×g. The

supernatant was collected and transferred to new tubes and stored at −80°C until viral RNA

extraction. Viral extraction was performed with a MagMAX™ Viral/Pathogen Nucleic Acid

Isolation Kit (Thermo Fisher, Scientific, Waltham, Massachusetts, USA), according to the

manufacturer’s instructions.

Molecular detection of DENV, CHIKV, ZIKV and OROV

The detection of arboviruses DENV, ZIKV, and CHIKV was performed using the

primers and probes synthesized according to the CDC (Center for Disease Control and

Prevention, USA) and employed the GoTaq® Probe 1-Step RT-qPCR system (Promega, WI,

USA). The primers for OROV were based on the work of Rojas et al.23 (Table 1). A set of

primers and probes that amplify the actin gene of Aedes spp. was used as an endogenous

control of the RT-qPCR reaction.

Table 1. Sequence of primers/probes for identification of DENV, CHIKV, ZIKV and OROV
arboviruses and the endogenous control actin gene of Aedes sp.

Target Primer forward Primer reverse Probe

6
The Journal of the Brazilian Society of Tropical Medicine

Actin 5'GACYGACTACCTGATGAAGATC 3' 5'GTTCATAAGACT 5'

TCTCCAGGG 3' SUNCTGGACTTCGAGCAGGAA
ATGG 3' IowaBlack

OROV 5' GACAAGTSCTCAATGCTGGTGT 3' 5'CGTTGTCCGGSA 5'TGGTTGACCTYACTTTTGGTG

CTGGATT 3' GGGT 3' FAM/ZEN TM IBFQ

DENV 5'-GGTTAGAGGAGACCCCTCCC-3' 5'GAGACAGCAGG 5'/56FAM/AAACAGCAT/ZEN/ATT

ATCTCTGGTCT-3' GACGCTGGGA/3iABkFQ/3'

ZIKV 5'-CCGCTGCCCAACACAAG-3' 5'CCACTAACGTTC 5'-/56FAM/AGCCTACCT/ZEN/TG

TTTTGCAGACAT-3 ACAAGCAGTCAGACACTCAA/3
' lABkFQ/-3'

CHIKV 5'-AAAGGGCAAACTCAGCTTCAC-3' 5'GCCTGGGCTCAT 5'-/56FAM/CGCTGTGAT/ZEN/AC

CGTTATTC-3' AGTGGTTTCGTGTG/3lABkFQ/-3'

Gblocks (Integrated DNA Technologies, Coralville, IA, USA), synthetic DNA

fragments from DENV (GenBank: OK040058.1), CHIKV (GenBank: MW581885.1), ZIKV

(GenBank: OK054487.1), and OROV (GenBank: HQ830492.1) were designed and used as

positive controls to establish standard curves for absolute quantification in RT-qPCR

reactions. Subsequently, a second Gblock was designed to contain the primer-binding regions

for OROV and for the actin gene, as shown in Supplementary Material 2.

The total volume of RT-qPCR was 10 μL (5 μL GoTaq® Probe 1-Step RT-qPCR System

kit, 0.2 μL Go Script RT Mix for 1-Step RT-qPCR, 0.8 μL Nuclease-Free Water, 0.5

primers/probe, and 2.5 µL of RNA) (Promega, Madison, Wisconsin, USA). Nuclease-free

water for molecular biology (Sigma-Aldrich) was used as a negative control. RT-qPCR was

performed using the AriaMX Real-Time PCR System (Agilent, CA, USA). The amplification

program consisted of one cycle at 45°C for 15 minutes for reverse transcription, one cycle at

95°C for 2 minutes for reverse transcriptase denaturation and DNA polymerase activation,

followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 min for denaturation and

amplification.

7
The Journal of the Brazilian Society of Tropical Medicine

Results and Discussion

A total of 1.570 A. aegypti females were captured in the three major regions of

Goiânia and distributed in 157 pools. This resulted in 83 (52.9%) pools from the Northwest

region, 48 (30.6%) from the Southwest region, and 26 (16.6%) pools from the North region.

Two pools from the North region were positive for CHIKV. The Southwest region had a

positive pool for ZIKV. The Northwest region did not show any positive pools. DENV and

OROV were not detected in this study (Figure 2).

a
Identification of positive pools.
b
Location of the regions of Goiânia-Go Brasil, selected for
egg collection
c
Structure of female A. aegypti mosquitoes used for the
study
d
Virus that was detected in the pool
e
Amplification cycle value obtained by RT-qPCR
f
The viral load obtained and its number of copies
determined by the standard Gblock curve

Figure 2. (A) Percentage of pools mosquitoes of A. aegypti used for detection of molecular arboviruses
by localization in Goiânia-Goias. (B) Summary of positive samples for CHIKV and ZIKV in the head
and thorax of A. aegypti obtained from larvae collected in three regions of Goiânia-Goiás, Brazil.

The transmission of arboviruses by the urban vector A. aegypti represents an

important public health challenge due to its ability to cause diseases that have significant

social and economic impacts. The transmission of arboviruses occurs horizontally in

competent mosquitoes, where the virus must be able to infect different anatomical regions of

the vector, overcoming the physical barriers of the midgut and multiplying in secondary

organs, such as the ovaries and salivary glands, present in the region of the mosquito head

8
The Journal of the Brazilian Society of Tropical Medicine

and thorax. Thus, when obtaining a blood meal, the mosquito transmits the virus to another

susceptible vertebrate25. The detection of CHIKV and ZIKV in the head and thorax pools

suggests viral replication in the salivary glands of the mosquito; that is, the progeny resulting

from vertical transmission is potentially infectious and already capable of transmission after

birth.

Another form of transmission of arboviruses is vertical, in which eggs are infected

during oviposition or by transovarial transmission by the infected female mosquito26. This

mechanism plays an important role in the persistence, dissemination, and maintenance of the

virus in nature between interepidemic periods, as eggs can persist in the environment under

adverse conditions, and in favorable environmental conditions, they hatch and generate

infected progeny27.

Vertical transmission in A. aegypti has already been identified for arboviruses

CHIKV28,29, DENV12;30, ZIKV12,31,32 and MAYV12,21 through the analysis of eggs, larvae, and

males of A. aegypti, experimentally, using adult A. aegypti fed with infected blood and

stimulated to spawn. Contaminated environments used as a source of oviposition for A.

aegypti and Aedes albopictus, such as sewage and urine, can also contaminate the larvae and

pupae of these insects, as reported for ZIKV26.

Goiânia, capital of the state of Goiás, showed a significant increase in the number of

DENV and CHIKV cases in 2022 compared to previous years. Especially in comparison with

2020 and 2021, in which there was a significant reduction in the number of cases of these

diseases compared to previous periods, probably due to the impact of the pandemic caused by

the Sars-CoV-2 virus. The municipality presented high risk and medium risk for the

occurrence of DENV cases in all regions of the city, while CHIKV presented medium risk in

the North regions, where a positive pool was detected, and in the Southwest region. ZIKV

9
The Journal of the Brazilian Society of Tropical Medicine

cases decreased, with only one case in the city, which can be understood as underreporting

cases or difficulty in diagnostic suspicion20.

Despite reports of vertical transmission of DENV in A. aegypti, both experimentally and

natural33;34, Goiânia presents a high incidence of DENV cases (300 cases/100,000 inhabitants)

in all regions of the city, mainly in the Northwest region35. In this work, pools of A. aegypti

infected with DENV were not found. This may be related to the fact that transovarial

transmission occurs at a low frequency for DENV, not exceeding the rate of 20% in nature36,

and that the highest rates of vertical transmission for DENV are related to mosquito A.

albopictus compared to A. aegypti37.

Cases of ZIKV and CHIKV are frequently underreported, mainly due to the mild or

asymptomatic symptoms that can occur in infected individuals. In addition, lack of

awareness, proper diagnosis, and efficient surveillance systems contribute to the

underreporting of these viruses. This can lead to a mistaken perception that the

epidemiological situation is under control when there is a continuous circulation of viruses in

the mosquito population. Our findings underscore the importance of ongoing surveillance and

comprehensive monitoring of viral transmission. This highlights the need to strengthen public

health systems, improve diagnostic methods, and promote collaboration among researchers,

health professionals, and government officials to effectively detect and respond to

mosquito-borne virus outbreaks.

Cases of ZIKV and CHIKV are frequently underreported, mainly due to the mild or

asymptomatic symptoms that can occur in infected individuals. In addition, lack of

awareness, proper diagnosis and efficient surveillance systems contribute to underreporting

of these viruses. This can lead to a mistaken perception that the epidemiological situation is

under control, when in reality there is a continuous circulation of virus in the mosquito

population. Our finding underscores the importance of ongoing surveillance and

10
The Journal of the Brazilian Society of Tropical Medicine

comprehensive monitoring of viral transmission. This highlights the need to strengthen public

health systems, improve diagnostic methods, and promote collaboration among researchers,

health professionals, and government officials to effectively detect and respond to

mosquito-borne virus outbreaks.

Conclusion

The occurrence of vertical transmission of ZIKV and CHIKV arboviruses in A.

aegypti mosquitoes detected through the analysis of pools of A. aegypti females containing

the head and thorax indicates the formation of infectious progeny. Monitoring mosquitoes for

the presence of arboviruses is crucial in preventing the spread of these infectious diseases.

Mosquito surveillance programs can identify areas where infected mosquitoes are present,

allowing public health officials to implement targeted control measures, such as insecticide

spraying, removing standing water, and public education campaigns. Early detection and

rapid responses can help prevent outbreaks and reduce the transmission of arboviruses,

making mosquito monitoring an essential tool for protecting public health.

Conflict of Interest

The authors declare that they have no competing interests.

References

1. Azevedo RDSDS, Oliveira CS, Vasconcelos PFDC. Chikungunya risk for Brazil. Rev

Saúde Pública. 2015;49(1):1-6.

2. Donalisio MR, Freitas ARR, Zuben APBV. Arboviruses emerging in Brazil:

challenges for clinic and implications for public health. Rev Saúde Pública.

2017;51(1):30.

11
The Journal of the Brazilian Society of Tropical Medicine

3. Morrison TE. Reemergence of chikungunya virus. J Virol. 2014;88(20):11644-47.

4. Triunfol M. Microcephaly in Brazil: confidence builds in Zika connection. Lancet

Infect Dis. 2016;16(5):527-28.

5. Uno N, Ross TM. Dengue virus and the host innate immune response. Emerg Microbes

Infect. 2018;7(1):1-11.

6. Andrioli DC, Busato MA, Lutinski JA. Características da epidemia de dengue em

Pinhalzinho, Santa Catarina, 2015-2016.Epidemiol Serv Saúde. 2020;29(4):1-7.

7. Deng X, Yan R, Li Zq, Tang Xw, Zhou Y, He H. Carga econômica e de doenças da

encefalite japonesa na província de Zhejiang, 2013–2018. PLoS Negl Trop Dis

2021;15(6): e0009505.

8. Souza-Neto JA, Powell JR, Bonizzoni M. Aedes aegypti vector competence studies: A

review. Infect Genet Evol. 2019;67(67):191-209.

9. Lozano-Fuentes S, Kenney JL, Varnado W, Byrd BD, Burkhalter KL, Savage HM.

Susceptibility and vectorial capacity of American Aedes albopictus and Aedes aegypti

(Diptera: Culicidae) to American Zika virus strains. J Med Entomol.

2019;56(1):233-40.

10. Kraemer MU, Reiner JrR C, Brady OJ, Messina JP, Gilbert M, Pigott DM, et al. Past

and future spread of the arbovirus vectors Aedes aegypti and Aedes albopictus. Nat

Microbiol. 2019;4(5):854-63.

12
The Journal of the Brazilian Society of Tropical Medicine

11. da Costa CF, Dos Passos RA, Lima JBP, Roque RA, de Souza Sampaio V, Campolina

TB, et al. Transovarial transmission of DENV in Aedes aegypti in the Amazon basin:

a local model of xenomonitoring. Parasit Vectors. 2017;10(1):249-58.

12. Maia LMS, Bezerra MCF, Costa MCS, Souza EM, Oliveira MEB, Ribeiro ALM, et

al. Natural vertical infection by dengue virus serotype 4, Zika virus and Mayaro virus

in Aedes (Stegomyia) aegypti and Aedes (Stegomyia) albopictus. Med Vet Entomol.

2019;33(3):437-42.

13. Lequime S, Fontaine A, Ar Gouilh M, Moltini-Conclois I, Lambrechts L. Genetic

drift, purifying selection and vector genotype shape dengue virus intra-host genetic

diversity in mosquitoes. PLoS genetics. 2016;12(6):1006-111.

14. Izquierdo-Suzán M, Zárate S, Torres-Flores J, Correa-Morales F, González-Acosta C,

Sevilla-Reyes EE, et al. Natural vertical transmission of Zika virus in larval Aedes

aegypti populations, Morelos, Mexico. Emerg Microbes Infect. 2019;25(8):1477.

15. Campos KB, Alomar AA, Eastmond BH, Obara MT, Dias LDS, Rahman RU, et al.

Assessment of insecticide resistance of Aedes aegypti (Diptera: Culicidae)

populations to insect growth regulator pyriproxyfen, in the northeast region of Brazil.

J Vetor Ecol. 2023;48(1):12-8.

16. Moura MCBDM, de Oliveira JV, Pedreira RM, Tavares ADM, de Souza TA, de Lima

KC, et al. Spatio‐temporal dynamics of Aedes aegypti and Aedes albopictus

oviposition in an urban area of northeastern Brazil. Trop Med Int Health.

2020;25(12):1510-21.

17. Macêdo, S. F. D., Silva, K. A., Vasconcelos, R. B. D., Sousa, I. V. D., Mesquita, L. P.

S., Barakat, R. D. M., ... & de Oliveira Lima, J. W. Scaling up of eco-bio-social

13
The Journal of the Brazilian Society of Tropical Medicine

strategy to control aedes aegypti in highly vulnerable areas in Fortaleza, Brazil: A

cluster, non-randomized controlled trial protocol. International Journal of

Environmental Research and Public Health, 2021;18(3), 1278.

18. Zeidler, J. D., Acosta, P. O. A., Barrêto, P. P., & Cordeiro, J. D. S. Dengue virus in

Aedes aegypti larvae and infestation dynamics in Roraima, Brazil. Revista de saude

publica, 2008;42():986-91.

19. Bona, A. C. D., Twerdochlib, A. L., & Navarro-Silva, M. A. Detecção do vírus da

dengue em populações naturais de mosquitos. Boletín de Malariología y Salud

Ambiental, 2011;51(2):107-16.

20. Ministério da Saúde (MS). Secretaria de Vigilância em Saúde. Sistema Nacional de

Vigilância em Saúde - Relatório de Situação: Goiânia. 08ª edição. Brasília: MS; 2022.
39 p.

21. Boletim Epidemiológico Arboviroses. Secretaria Municipal de Saúde / Prefeitura de

Goiânia Edição nº 08/Março 2022.

22. de Curcio JS, Salem-Izacc SM, Neto LMP, Nunes EB, Anunciação CE, de Paula

Silveira-Lacerda E. Detection of Mayaro virus in Aedes aegypti mosquitoes

circulating in Goiania-Goias-Brazil. Emerg Microbes Infect. 2022;24(4):104948.

23. Forattini, O. P., Kakitani, I., Santos, R. L. C. D., Kobayashi, K. M., Ueno, H. M., &

Fernandez, Z. Adults Aedes albopictus and Ae. scapularis behavior (Diptera: Culidae)

in southeastern Brazil. Rev Saúde Pública. 2000;34():461-67.

24. Rojas A, Stittleburg V, Cardozo F, Bopp N, Cantero C, López S, et al. Real-time

RT-PCR for the detection and quantitation of Oropouche virus. Diagn Microbiol Infect

Dis. 2020;96(1):114894.

14
The Journal of the Brazilian Society of Tropical Medicine

25. De Sousa FB, de Curcio JS, do Carmo Silva L, da Silva DMF, Salem-Izacc SM,

Anunciação CE, et al. Report of natural Mayaro virus infection in Mansonia

humeralis (Dyar & Knab, Diptera: Culicidae). Parasit Vectors. 2023;16(1):140.

26. Hardy JL, Houk EJ, Kramer LD, Reeves WC. Intrinsic factors affecting vector

competence of mosquitoes for arboviruses. Annu Rev Entomol. 1983;28(1):229-62.

27. Ciota AT, Bialosuknia SM, Ehrbar DJ, Kramer LD. Vertical transmission of Zika virus

by Aedes aegypti and Ae. albopictus mosquitoes. J Emerg Infect Dis. 2017;23(5):880.

28. Pepe VLE, Albuquerque MVD, Osorio-de-Castro CGS, Pereira CCDA, Oliveira

CVDS, Reis LGDC, et al. Proposta de análise integrada de emergências em saúde

pública por arboviroses: o caso do Zika vírus no Brasil. Saúde debate.

2021;44():69-83.

29. Honório, N. A., Wiggins, K., Eastmond, B., Câmara, D. C. P., & Alto, B. W..

Experimental vertical transmission of chikungunya virus by brazilian and florida

aedes albopictus populations. Viruses, 2019;11(4):353.

30. Ribeiro Cruz, A. C., Pinto Nunes Neto, J., Patroca da Silva, S., Vieira Pinto da Silva,

E., Juscely Galvão Pereira, G., Maia Santos, M., ... & Carício Martins, L.

Chikungunya virus Detection in Aedes aegypti and Culex quinquefasciatus during an

Outbreak in the Amazon Region. Viruses, 2020;12(8):853.

15
The Journal of the Brazilian Society of Tropical Medicine

31. Martins, VEP, Alencar, CH, Kamimura, MT, de Carvalho Araujo, FM, De Simone,

SG, Dutra, RF, & Guedes, MIF. Ocorrência de transmissão vertical natural dos vírus

dengue-2 e dengue-3 em Aedes aegypti e Aedes albopictus em Fortaleza, Ceará,

Brasil. PloS um , 2012;7 (7): e41386.

32. Costa, C. F. D., Silva, A. V. D., Nascimento, V. A. D., Souza, V. C. D., Monteiro, D.

C. D. S., Terrazas, W. C. M., ... & Naveca, F. G. Evidence of vertical transmission of

Zika virus in field-collected eggs of Aedes aegypti in the Brazilian Amazon. PLoS

Neglected Tropical Diseases, 2018;12(7): e0006594.

33. Comeau, G., Zinna, R. A., Scott, T., Ernst, K., Walker, K., Carrière, Y., & Riehle, M.

A. Vertical transmission of Zika Virus in Aedes aegypti produces potentially

infectious progeny. The American Journal of Tropical Medicine and Hygiene,

2020;103(2):876.

34. Cecílio, A. B., Campanelli, E. S., Souza, K. P. R., Figueiredo, L. B., & Resende, M.

Natural vertical transmission by Stegomyia albopicta as dengue vector in Brazil.

Brazilian Journal of Biology, 2009;69():123-27.

35. Vilela AP, Figueiredo LB, dos Santos JR, Eiras AE, Bonjardim CA, Ferreira PC,

Kroon EG. Dengue virus 3 genotype I in Aedes aegypti mosquitoes and eggs, Brazil,

2005-2006. Emerg Infect Dis. 2010 Jun;16(6):989-92.

36. Boletim Epidemiológico Arboviroses. Secretaria Municipal de Saúde / Prefeitura de

Goiânia Edição nº 19/Maio 2021.

37. Joshi, V., Mourya, D. T., & Sharma, R. C.. Persistence of dengue-3 virus through

transovarial transmission passage in successive generations of Aedes aegypti

16
The Journal of the Brazilian Society of Tropical Medicine

mosquitoes. The American journal of tropical medicine and hygiene,

2002;67(2):158-61.

38. Rosen, L. Mechanism of vertical transmission of the dengue virus in mosquitoes.

Comptes rendus de l'Academie des sciences. Serie III, Sciences de la vie,

1987;304(13):347-50.

39. Gibrail, M. M., Fiaccadori, F. S., Souza, M., Almeida, T. N. V., Chiang, J. O., Martins,
L. C., ... & Cardoso, D. D. D. D. P.. Detection of antibodies to Oropouche virus in
non-human primates in Goiânia City, Goiás. Revista da Sociedade Brasileira de
Medicina Tropical, 2016;49():357-60.

40. Pinheiro, F. P., Hoch, A. L., Gomes, M. L., & Roberts, D. R. . Oropouche virus. IV.

Laboratory transmission by Culicoides paraensis. The American journal of tropical

medicine and hygiene, 1981;30(1):172-76.

41. McGregor, B. L., Connelly, C. R., & Kenney, J. L. Infection, dissemination, and

transmission potential of North American Culex quinquefasciatus, Culex tarsalis, and

Culicoides sonorensis for Oropouche virus. Viruses, 2021;13(2):226.

42. Pereira-Silva, J. W., Ríos-Velásquez, C. M., Lima, G. R. D., Marialva dos Santos, E.

F., Belchior, H. C. M., Luz, S. L. B., ... & Pessoa, F. A. C. Distribution and diversity

of mosquitoes and Oropouche-like virus infection rates in an Amazonian rural

settlement. Plos one, 2021;16(2): e0246932.

Legend of the figures

Figure 1. Flowchart showing the steps taken in this study. In general, this work includes steps to capture eggs in

the North, Northwest and Southwest regions of Goiânia, traps were inserted to capture A. aegypti eggs between

(steps 1 and 2) obtaining A. aegypti larvae and pupae in the laboratory from these eggs and identification of

17
The Journal of the Brazilian Society of Tropical Medicine

adult mosquitoes separated into pools of 10 individuals containing head and thorax (thorax and abdomen) for

maceration, RNA extraction and RT-qPCR (steps 3, 4, 5, 6 and 7).

Figure 2. (A) Percentage of pools mosquitoes of A. aegypti used for detection of molecular arboviruses by

localization in Goiânia-Goias. (B) Summary of positive samples for CHIKV and ZIKV in the head and thorax of

A. aegypti obtained from larvae collected in three regions of Goiânia-Goiás, Brazil.

Legend of the tables

Table 1. Sequence of primers/probes for identification of DENV, CHIKV, ZIKV and OROV arboviruses and the

endogenous control actin gene of Aedes sp.

Table 2. Gblock sequence used for RT-qPCR tests.

Supplementary figure subtitles

Figure 1. Adult A. aegypti obtained by hatching eggs collected in the North, Northwest and Southwest regions

of Goiânia, Goiás. The females were separated and used to assemble the pools. Sexing was performed by

analyzing the antenna of the insects, indicated by the arrow. (A) Male of A. aegypti. (B) Female of A. aegypti.

18