Applied Surface Science 490 (2019) 70–80

Contents lists available at ScienceDirect

Applied Surface Science

journal homepage: www.elsevier.com/locate/apsusc

Full length article

Drosophila melanogaster as an in vivo model to study the potential toxicity of T

cerium oxide nanoparticles
Vignesh Sundararajana, Pallavi Dana, Ajay Kumarb, G. Devanand Venkatasubbub,
⁎
Sahoko Ichiharac, Gaku Ichiharad, Sahabudeen Sheik Mohideena,
a
Department of Biotechnology, School of Bioengineering, SRM Institute of Science and Technology, Kattankulathur 603203, Tamil Nadu, India
b
Department of Physics and Nanotechnology, SRM Institute of Science and Technology, Kattankulathur 603203, Tamil Nadu, India
c
Department of Environmental and Preventive Medicine, Jichi Medical University, School of Medicine, Shimotsuke 329-0498, Tochigi, Japan
d
Department of Occupational and Environmental Health, Tokyo University of Science, Noda 278-8510, Chiba, Japan

A R T I C LE I N FO A B S T R A C T

Keywords: Cerium oxide nanoparticles (nCeO2) were synthesized via the hydroxide mediated approach using cerium nitrate
Drosophila hexahydrate and sodium hydroxide as precursors. The nanoparticle was characterized using TEM, XRD and FTIR
Cerium oxide nanoparticle analysis. Its toxicity at 0.1 mM and 1 mM doses was investigated using wild-type third instar larvae and adult
Nanotoxicity male flies (Oregon K strain) exposed to nCeO2 along with food for one month. Ascorbic acid (17 mM) was used as
Reactive oxygen species
a positive control. Results from the survival assay revealed that when compared to control, both 0.1 mM and
Catalase
1 mM doses were non-toxic for a period of one month, after which the 1 mM dose was more toxic than the
Superoxide dismutase
Acetylcholinesterase 0.1 mM dose. Dietary administration of nCeO2 at both the doses did not cause developmental and behavioral
defects. Important biochemical parameters such as ROS generation, superoxide dismutase activity, carbohydrate
and protein levels, and acetylcholinesterase activity were not significantly altered at both the doses of the na-
noparticle, when compared to control. The mRNA expression of antioxidant enzymes such as catalase and su-
peroxide dismutase also was not significantly altered in the third instar larvae that fed on nanoparticle-con-
taining food. The results from the above studies suggest that nCeO2 at 0.1 mM and 1 mM doses did not elicit any
significant toxicity in third instar larvae and adult flies when administered for a period of one month. This study
also suggests that nCeO2 can be used as a potential anti-oxidant compound and a beneficial drug carrier in
Drosophila disease models in future studies.

1. Introduction oxide nanoparticles (nCeO2) are commonly used as ingredients in pol-

The unique physiochemical properties of nanoparticles (NPs), which
range in size from 1 to 100 nm, over their bulk form have resulted in
their increased use in recent years [1–3]. Ironically, the toxicity elicited
by nanoparticles also depends on its physical and chemical properties,
such as size, shape and surface chemistry [4]. Nanoparticles, especially
metal oxide nanoparticles such as titanium dioxide and zinc oxide, have
a wide range of applications in industries and the biomedical field [3].
The most important routes of human exposure to NPs are via inhalation
and dermal contact, and the major sources of NP generation include
cooking and application of cosmetic and sunscreen products [3]. The
increased use of nanoparticles therefore raises serious concerns about
their safety and impact on human health.
Cerium oxide is a rare earth element. Cerium oxide and cerium
ishing agents, catalytic convertors, solid oxide fuel cells, sensors, fuel
catalysts, and also released into the atmosphere via diesel exhaust [5,6].
nCeO2 has gained a lot of interest among researchers due to its anti-
oxidant enzyme (such as SOD, catalase, oxidase and peroxidase) mi-
metic properties, ROS and free radical scavenging activities. These
properties of nCeO2 are mainly due to its ability to switch between
oxidation states (Ce4+ and Ce3+) and the interactions between surface
oxygen vacancies in its lattice structure and free radicals [7–9].
Therefore, nCeO2 is a promising therapeutic agent that warrants further
investigations in disease models wherein cells undergo enhanced oxi-
dative stress.
The safety profile of nCeO2 is contradictory, with nCeO2 exerting
both protective and detrimental effects. nCeO2 elicited protective ef-
fects in in vitro studies using RAW 264.7 murine macrophage cell line,

⁎
Corresponding author at: Department of Biotechnology, School of Biotechnology, SRM Institute of Science and Technology, Kattankulathur 603203, Tamil Nadu,
India.
E-mail address: sahabudeen.s@ktr.srmuniv.ac.in (S. Sheik Mohideen).

https://doi.org/10.1016/j.apsusc.2019.06.017
Received 20 December 2018; Received in revised form 6 May 2019; Accepted 2 June 2019
Available online 04 June 2019
0169-4332/ © 2019 Elsevier B.V. All rights reserved.
V. Sundararajan, et al.
BEAS-2B human bronchial epithelial cell line, HT22 mouse hippo-
campal neuronal cell line, and HepG2 cancer cell line treated with ac-
rylamide, by decreasing ROS production and conferring resistance
against oxidative stress [10–12]. nCeO2 also elicited anti-cancer and
anti-proliferative activity against cancer cell lines [13–17], and was
minimally toxic to normal cell lines [13,14]. The in vivo beneficial ef-
fects of nCeO2 have been investigated in a number of studies and it has
been reported that nCeO2 elicits dose-dependent antioxidant and anti-
genotoxic properties in mice and Drosophila [18,19], protects against
radiation-induced damage and 1-methyl-4-phenyl-1, 2, 3, 6-tetra-
hydropyridine (MPTP)-induced Parkinson's disease [20–22], free ra-
dical-induced degenerative changes in the brain [23], cardiac injury
[24], neurodegeneration of the retina [25], and diabetic embryopathy
[26]. Furthermore, because of its small diameter, nCeO2 can effectively
cross the blood-brain barrier to scavenge free radicals [23]. nCeO2 has
also been explored as a potential drug carrier in recent years [27–29].
Contradicting the above beneficial effects of nCeO2, a number of in
vivo studies have reported the toxic effects of nCeO2 such as lung in-
flammation, pulmonary toxicity, DNA damage, oxidative stress, cardi-
ovascular dysfunction and testicular dysfunction when administered via
different routes such as inhalation, intra-tracheal, and intra-peritoneal
administration [30–34]. nCeO2 also elicited oxidative stress leading to
increased ROS production, cell death by apoptosis in BEAS-2B human
lung epithelial cells and modulated degranulation in cultured primary
human neutrophils [35,36].
Drosophila is widely used as a model organism to study nanotoxicity
[4,37–39]. Drosophila and mammals have many biological and phy-
siological properties in common. The 75% sequence similarity in the
disease genes between humans and Drosophila, its short life cycle of
only 10–12 days at room temperature, and the ease of maintaining them
in vials containing a cornmeal diet have resulted in Drosophila widely
being used as an in vivo model [19,38,40,41]. Compared to other in vivo
models, using Drosophila as an in vivo model does not pose any major
ethical issues [40].
The current study was designed to evaluate the toxicity of nCeO2, at
0.1 mM and 1 mM doses on wild type Drosophila melanogaster, by using
behavioral assays, biochemical assays, and gene expression studies to
gain more clarity about the potential toxicity of nCeO2 and to account
for lack of sufficient in vivo studies using Drosophila. Furthermore, the
non-toxic dose determined from this study will be used as a drug carrier
in future studies using disease models of Drosophila.
2. Materials and methods
2.1. Chemicals
Agar-agar type I, sodium phosphate monobasic, and sodium phos-
phate dibasic were procured from HiMedia, Mumbai. D-glucose, 5,5′-
dithiobis-2-nitrobenzoic acid, copper sulphate, Folin & Ciocalteu's
phenol reagent, sodium carbonate, sodium potassium tartrate, po-
tassium chloride, sodium hydroxide, acetylthiocholine iodide, an-
throne, potassium chloride, yeast extract powder, chloroform, me-
thanol, NADH, phenazonium methosulphate, nitroblue tetrazolium,
glacial acetic acid and bovine serum albumin were purchased from SRL
Chemicals, Mumbai. Propionic acid was purchased from Merck Life
Sciences, Mumbai while methyl parahydroxy benzoate was purchased
from Rankem, New Delhi. 2′,7′-Dichlorofluorescein diacetate was pro-
cured from Sigma Aldrich, China. Orthophosphoric acid was purchased
from Thermo Fischer Scientific, Mumbai. All the chemicals used were of
analytical grade.
2.2. Synthesis of nCeO2
Cerium oxide nanoparticles were synthesized according to a pre-
viously described method [42]. Briefly, the synthesis involved the use
of cerium nitrate hexahydrate (0.1 M) taken in a beaker, to which
71
Applied Surface Science 490 (2019) 70–80
sodium hydroxide (0.3 M) taken in a burette was added drop-wise. After
constant stirring and heating for 2 h, a pinkish white precipitate was
obtained. Following centrifugation at 8000 rpm for 15 min, the pellet
obtained was washed with ethanol and distilled water, and dried in a
hot air oven at 80 °C for 1 h. It was further annealed at 270 °C for 24 h.
The resultant yellow colored mass is nCeO2.
2.3. Fly strains and culture
The wild-type strain, Oregon K, was used in the study. They were
reared at 25 ± 1 °C, 60% humidity, and a 12 h dark-light cycle on a
standard cornmeal diet consisting of corn flour, D-glucose, sugar, agar-
agar type 1, and yeast extract powder. Anti-fungal agents such as pro-
pionic acid, Tego (methyl parahydroxy benzoate dissolved in ethanol)
and orthophosphoric acid were added to the cornmeal diet at 55 oC
after autoclaving to prevent the growth of fungus.
2.4. Experimental setup
The experimental setup consisted of three replicates of control,
0.1 mM, and 1 mM of nCeO2/ml of food in vials, each containing 6 mL
of the cornmeal agar. A dispersion of nCeO2 (100 mM) in 0.05% BSA
was prepared and sonicated in a water bath supplemented periodically
with ice to obtain a uniform dispersion. The desired concentration of
the NP in food was obtained by adding appropriate volume from the
stock dispersion. After 24 h, 25 female flies and 10 male flies were
transferred to the treatment vials. Flies were discarded after 48 h and
the third instar larvae that emerged after approximately 7–10 days were
used. For biochemical assays that required one month oral exposure of
nCeO2, newly hatched adult male flies were used. Ascorbic acid
(17 mM) was used as a positive control according to a previously
published study [43].
2.5. Morphological characterization
The third instar larvae from the control and treatment groups were
observed under a stereo microscope to assess the effect of nCeO2 on
larval growth and development. Briefly, nine larvae from each vial were
kept in 4% formaldehyde for 1 h and their photos taken under a stereo
microscope at 20 x magnification. The length and breadth of the larvae
were measured using Adobe Photoshop software and statistical analysis
was performed to assess significance between the groups.
2.6. Survival assay
A survival assay was performed to assess the effect of chronic ex-
posure of flies to different doses of nCeO2, according to a previously
described method with slight modifications [44]. Briefly, 100 adult
male flies were maintained in control as well as nCeO2 food vials until
the flies died. The food vials were kept in a horizontal position and food
was changed twice weekly. The food vials were checked daily to count
the number of dead flies; flies that escaped and those that stuck to the
food were excluded from the count. When all the flies died, a survival
curve was plotted and the log-rank Mantel-Cox test performed, using
GraphPad Prism 6, for analyzing statistical significance between the
treatment groups.
2.7. Larval crawling assay
The larval crawling assay was performed based on a previously
described method [45]. Nine third instar larvae from control and
treatment groups were collected, washed with 1× PBS to remove any
food traces and transferred onto a glass petri plate coated with 2%
agarose. The larvae were allowed to crawl thrice on the agar surface
placed over a graph sheet for 1 min and the video was recorded. The
number of grid lines crossed in 1 min was counted and the distance
V. Sundararajan, et al.
covered in a minute per treatment group was obtained by calculating
the mean of the distance covered by 9 larvae.
2.8. Climbing assay
For the climbing assay, 25 adult male flies were transferred to food
vials containing different concentrations of nCeO2 and maintained for a
period of one month. The food was changed weekly once. After one
month, the flies were transferred into 10 cm vials containing a 3 cm
mark. The mouth of the vial was closed by a cotton plug and subse-
quently it was tapped 2–3 times to ensure that all the flies remained at
the bottom. The flies were then allowed to climb for 15 s and the video
was recorded. The number of flies that were able to climb beyond the
3 cm mark at the end of 10 s was counted from the video. This proce-
dure was repeated three times for each dose of food vial. The mean
value obtained from the number of flies that climbed beyond the 3 cm
mark was used to express the result in the form of percentage.
2.9. Estimation of superoxide dismutase (SOD) activity
The SOD activity in third instar larvae (n = 3, 20 larvae/group) was
estimated according to a previously described method with minor
modifications [46]. Briefly, 20 third instar larvae were homogenized in
0.5 mL of 0.1 M sodium phosphate buffer containing 0.15 M KCl
(pH 7.4) and centrifuged at 6000 rpm for 10 min at 4 °C. The reaction
was initiated at room temperature by adding 0.2 mL of 780 μM NADH
to a reaction mixture consisting of 1 mL of 0.052 M sodium pyropho-
sphate buffer (pH 8), 0.1 mL of 186 μM phenazine methosulphate,
0.3 mL of nitroblue tetrazolium, 0.2 mL of milliQ water, and 0.2 mL of
supernatant from larval homogenate. The reaction was stopped after
1 min at room temperature by adding 1 mL of acetic acid and the color
intensity of the chromogen was measured at 560 nm. Each sample was
run in duplicates and there were three food vials per dose. One unit of
enzyme activity denoted enzyme activity required inhibiting chro-
mogen production by 50% at room temperature and the final results
from three such experiments were expressed as units/min.
2.10. Estimation of acetylcholinesterase (AChE) activity
AChE activity in adult male flies (20 flies/group, three food vials per
dose) exposed to nCeO2 along with food for a period of one month was
estimated according to Ellman's method, based on a previously de-
scribed protocol with minor modifications [47]. Briefly, 20 male flies
were homogenized in 1 mL of 0.1 M sodium phosphate buffer con-
taining 0.15 M KCl (pH 7.4) and centrifuged at 6000 rpm for 10 min at
4 °C. 200 μL of this supernatant was added to a reaction mixture con-
taining 650 μL of 0.1 M sodium phosphate buffer (pH 7.4), 200 μL of
10 mM 5,5′-dithiobis-2-nitrobenzoic acid, and 20 μL of 0.075 M acet-
ylthiocholine iodide. The solution was mixed well and the change in
absorbance per min was read at 412 nm to calculate the enzyme ac-
tivity. Each sample was run in duplicates and there were three food
vials per dose.
2.11. Estimation of ROS production
The ROS generated in flies upon administration of nCeO2 along with
Drosophila food was estimated using 2′,7′-dichlorofluorescein diacetate
(DCHF-DA), based on a previously described method with some mod-
ifications [48]. Briefly, 20 male flies (three food vials per dose) that
were exposed to nCeO2 along with food for a period of one month were
anesthetized and homogenized in 1 mL of 20 mM Tris buffer (pH 7) and
centrifuged at 5000 rpm for 10 min at 4 °C. 100 μL of the supernatant
and 30 μL of 10 mM DCHF-DA was incubated for 60 min at room
temperature. The fluorescent product formed was measured using a
microplate fluorometer (Fluoroskan Ascent FL, Thermo Fisher Scien-
tific) at 488 and 525 nm, excitation and emission wavelengths,
72
Applied Surface Science 490 (2019) 70–80
respectively. The mean value of fluorescence emitted was calculated to
express the results in terms of arbitrary units. Each sample was run in
duplicates and there were three food vials per dose.
2.12. Estimation of glycogen content
The glycogen content in flies exposed to different concentrations of
nCeO2 for a period of one month was estimated according to a pre-
viously described protocol [49]. Briefly, 5 flies were homogenized in
500 μL of 2% sodium sulfate. To 20 μL of the homogenate, 46 μL of
sodium sulfate and 934 μL of chloroform/methanol in the ratio of 1:1
was added and the mixture was centrifuged at 13,500 rpm for 10 min.
The pellet containing glycogen was air dried for 10 min, after which
500 μL of anthrone reagent (0.2% in concentrated sulphuric acid) was
added and vortexed. The mixture was then heated in water bath at 90 °C
for 20 min during which the tubes were vortexed for every 5 min. The
color of the mixture changed from yellow to green on heating. After
cooling the tubes on ice, the absorbance of the mixture was read at
620 nm and the concentration of the unknown was interpolated using a
D-glucose standard curve. Each sample was run in duplicates and there
were three food vials per dose.
2.13. Protein estimation
Protein estimation in adult flies was performed according to a
previously described method using bovine serum albumin as a standard
[50]. Each sample was run in duplicates and there were three food vials
per dose.
2.14. Gene expression studies by quantitative Real-Time PCR
The mRNA expression of catalase and SOD genes was analyzed in
the third instar larvae from control and nCeO2 food vials via quantita-
tive real-time PCR. Total RNA was isolated from 20 third instar larvae
from control and nCeO2 treatment groups (3 food vials per dose) using
TRIzol reagent (Invitrogen) by following the manufacturer's protocol.
Using NanoDrop Lite (Thermo Scientific), the concentration and purity
of RNA was measured. By following the manufacturer's protocol, 1 μg of
RNA was then used for cDNA synthesis using the iScript cDNA synthesis
kit (Bio-Rad) on a MyCycler Thermal Cycler (Bio-Rad). cDNA synthesis
was performed under the following conditions: 42 °C for 60 min, fol-
lowed by 85 °C for 5 min. The relative mRNA expression of the above-
mentioned genes was analyzed using comparative CT (ΔΔCT) method on
a QuantStudio 5 Real-Time PCR system (Applied Biosystems) using
RP49 as the internal control. The 20 μL reaction mixture consisted of
10 μL of 2x SYBR Green master mix (GoTaq qPCR Master Mix,
Promega), 6 μL of nuclease free water, 2 μL of cDNA, and 1 μL each of
gene-specific forward and reverse primers. Each sample was run in
duplicates. The following reaction conditions were used for all the
genes: 95 °C for 5 min, 40 cycles of 95 °C for 15 s and 59 °C for 35 s. The
melt curve stage consisted of 95 °C for 15 s, 60 °C for 1 min and 95 °C for
1 s. The primers for catalase, SOD and RP49 were designed using
Primer3 Plus website (Table 1).
Table 1
List of primers used in qRT-PCR experiments.
Gene Forward primer Reverse primer
SOD1 GTGACAACACCAATGGCTGC CTCAATGTTGCCCAGATCGC
Catalase GGAATCAAGGATGCCTCCC TGGGTGATGTCATGGGTCAC
RP49 CCCAAGGGTATCGACAACAGA CGATCTCGCCGCAGTAAAC
V. Sundararajan, et al.
2.15. Transmission Electron Microscopy (TEM) imaging of larval and fly
gut
In order to demonstrate the uptake of nCeO2 in larval as well as fly
gut, TEM imaging of the gut was performed. The gut of control and
treated larva as well as fly were dissected and transferred onto copper
grids, air dried, and imaged under JEOL TEM 2100 Plus at an accel-
erating voltage of 200 kV.
2.16. Statistical analysis
The values expressed are mean ± SEM, unless stated otherwise.
Statistical analysis was performed using GraphPad Prism 6.0, followed
by Dunnett's multiple comparison test to compare the significance of
treatment groups with control. Significance was set to P < 0.05.
3. Results
3.1. Characterization of nCeO2
The nanoparticles were characterized using TEM imaging, XRD
analysis, and FTIR spectrum analysis. TEM imaging showed that the
particles were spherical in shape and crystalline in nature. The particles
ranged in size from 20 to 25 nm (Fig. 1). The FTIR spectrum of nCeO2
recorded in the number range of 500–5000 cm−1 showed the presence
of water and hydroxyl stretches at bands 1622 and 3421 cm−1, re-
spectively. The CeeO stretch was observed at the wavenumber
550.84 cm−1. The NeO stretch obtained at wavenumber 1382 cm−1
was due to the presence of nitrate (Fig. 2). The XRD profile confirmed
the polycrystalline nature of nCeO2, when scanned between 10 and 80
degrees at the scan rate of 2θ min−1. At 28.53, 33.09, 47.5, 56.26, high
intensity peaks were observed with respect to the 111, 200, 220, 311
crystal planes. The crystal planes were marked using the JCPDS No: 34-
0394 of CeO2 crystal. The diffraction peaks in these XRD spectra in-
dicates the pure cubic fluorite structure (Fig. 3).
3.2. Effect of nCeO2 on morphology and development of third instar larvae
The third instar larvae emerged in control and nCeO2 treatment
groups after a similar time period (~ 7–10 days) with no change in
morphology and there was no developmental delay. The mean length of
third instar larvae from the control, nCeO2 0.1 mM and nCeO2 1 mM
groups was 572.65 μm, 533.23 μm, and 482.43 μm, respectively
(Fig. 4a). A statistically significant difference (P < 0.05) in the length
of the third instar larvae alone was seen in the nCeO2 1 mM treatment
group. The mean width of the third instar larvae from the control,
nCeO2 0.1 mM and nCeO2 1 mM treatment groups was 95.73 μm,
97.22 μm, and 90.77 μm, respectively (Fig. 4b). No significant differ-
ence in the breadth of the larvae between the control and the treatment
groups was seen.
3.3. Survival assay
In order to assess the chronic oral toxicity of nCeO2, a survival assay
was performed with 100 newly hatched male flies in each dose and
changed weekly twice until all the flies died. It was seen that for a
period of approximately 30–35 days, the survival curves for control and
treatment groups did not exhibit any significant difference. However,
beyond this time point, the survival curve of nCeO2 1 mM alone started
to diverge and was statistically significant at the end of the study
(P < 0.05), when compared to control (Fig. 5). Based on this finding,
all biochemical assays using adult male flies were performed after one
month exposure of nCeO2.
73
Applied Surface Science 490 (2019) 70–80
3.4. Crawling assay
The distance covered by larvae from control, AA, nCeO2 0.1 mM and
nCeO2 1 mM was 59 mm/min, 66 mm/min, 51 mm/min, and 52 mm/
min, respectively. No statistically significant difference in the distance
covered was observed in the treatment groups, when compared to
control (Fig. 6).
3.5. Negative geotaxis assay
The percentage of flies that were able to cross the 3 cm mark in 15 s
(three times/vial; three food vials per dose) after one month in control,
AA, nCeO2 0.1 mM and nCeO2 1 mM treatment groups were 64%, 69%,
73%, and 66%, respectively. Again, no statistical significance was seen
between control and the treatment groups (Fig. 7).
3.6. SOD activity
The enzyme activity expressed as units/min for third instar larvae
exposed to dietary nCeO2 in control, AA, nCeO2 0.1 mM and nCeO2
1 mM treatment groups was 0.97, 1.26, 0.74, and 0.52, respectively.
Compared to control, there was no significant increase in the activity of
SOD to indicate nanoparticle-mediated toxicity; however, the nCeO2
treatment groups exhibited a trend of decrease in SOD activity with
increase in nCeO2 concentration (Fig. 8).
3.7. ROS estimation
ROS production in the fly homogenate after one month exposure to
dietary nCeO2 was estimated using DCHF-DA. It was observed that
dietary administration of nCeO2 at 0.1 mM and 1 mM doses to flies for a
period of one month did not elicit any significant difference in DCF
fluorescence and hence ROS production when compared to control.
However, a significant decrease in DCF fluorescence was seen in
homogenate of flies exposed to ascorbic acid (P < 0.05). The relative
fluorescence intensity for control, AA, nCeO2 0.1 mM and nCeO2 1 mM
treatment groups was 774, 678, 723, and 715, respectively (Fig. 9).
3.8. AChE activity
The AChE activity estimated in flies using the Ellman's method re-
vealed no significant difference between control and treatment groups,
which suggests that one month dietary exposure of nCeO2 at 0.1 mM
and 1 mM doses did not elicit neurotoxicity (Fig. 10). The enzyme ac-
tivity/min in fly homogenate from control, AA, nCeO2 0.1 mM and
nCeO2 1 mM treatment groups was 5.6, 6.5, 5.8, and 5.3 min/
mix × 10−6, respectively.
3.9. Estimation of glycogen and protein content
The glycogen and protein contents in adult flies exposed to dietary
nCeO2 were estimated using Anthrone and Lowry's methods, respec-
tively. There was no significant difference in the glycogen and protein
contents of flies when compared to control. However, a trend of in-
crease in protein concentration was seen with increase in nCeO2 dose
and also with AA. The glycogen content (μg/fly) in control, AA, nCeO2
0.1 mM and nCeO2 1 mM treatment groups was 0.015, 0.012, 0.0136,
and 0.0138, respectively (Fig. 11a). The protein content (mg/mL) in
control, AA, nCeO2 0.1 mM and nCeO2 1 mM treatment groups was
0.066, 0.11, 0.085, and 0.11, respectively (Fig. 11b). Interestingly, both
AA and nCeO2 (1 mM) produced similar level of increase in protein
content. This suggests that nanoparticle administration did not affect
the feeding pattern of flies to cause depletion in energy reserves.
V. Sundararajan, et al.
Fig. 1. TEM image of nCeO2 shows the spherical shape and the particle size (20–25 nm).
3.10. Gene expression studies
In order to assess the effect of dietary nCeO2 administration to third
instar larvae on the antioxidant enzymes at the molecular level, the
mRNA expression of SOD and catalase genes in the larval homogenate
was analyzed. Similar to the results of the biochemical and behavioral
assays, no significant change in the mRNA expression was seen for both
the doses of nCeO2 for SOD as well as catalase (Fig. 12).
3.11. TEM imaging of gut
The uptake of nCeO2 in the gut of larvae and adult fly was suc-
cessfully demonstrated via TEM imaging. While the gut of control larva
and fly did not show any presence of nCeO2, the gut of nCeO2− treated
larva and fly showed the presence of nCeO2. Moreover, the presence of
lattice fringes when viewed at lower magnification (5×) confirmed the
presence of nCeO2 in the gut (Fig. 13).
74
Applied Surface Science 490 (2019) 70–80
4. Discussion
In the present study, the toxicity of nCeO2 was evaluated using
Drosophila melanogaster as an in vivo model. Because of the increased use
of nanoparticles in industries and other fields, and the subsequent ex-
posure of the nanoparticles to humans, it is necessary to investigate the
toxic effects elicited by it. As mentioned in earlier sections, the toxicity
of nCeO2 is contradictory. While some studies report that nCeO2 pro-
tects cells from toxicity via its antioxidant effects, others report that
nCeO2 also elicits toxicity. Moreover, there is only one published study
available to the best of authors' knowledge, using Drosophila melano-
gaster as an in vivo model. Considering the contradictory status of
toxicity elicited by nCeO2, the current study was performed to in-
vestigate its toxicity in wild type flies and subsequently use the non-
toxic dose as a drug carrier in diseases models using transgenic flies in
future studies. The overall results of the current study highlighting the
non-toxic nature and beneficial effects of nCeO2 at 0.1 mM and 1 mM
doses for one month and 0.1 mM dose the until the flies died are in
agreement with the results of a previous study on Drosophila [19] and
V. Sundararajan, et al. Applied Surface Science 490 (2019) 70–80

Fig. 2. The FTIR spectrum of nCeO2.

Fig. 4. Effect of dietary administration of nCeO2 on a) height and b) width of

third instar larvae. Values represented are mean ± SEM and statistical sig-
nificance was set at P < 0.05 when compared to control, by ANOVA followed
by Dunnett's multiple comparison (n = 9).

other in vivo models [18–21,23–29].

A previous study by Alaraby et al. using Drosophila reported that
nCeO2 dispersed in 0.05% BSA was non-toxic up to 10 mM. The authors
reported the high stability of the NP in BSA suspension, based on the
low amount of the NPs released to the ionic form in the dispersion
medium [19]. Hence, in the present study, 0.1 mM and 1 mM doses of
nCeO2 were dispersed in 0.05% BSA and added to Drosophila food. The
results of the survival assay with wild type flies indicated that both
0.1 mM and 1 mM doses were non-toxic up to 30 days, after which the
1 mM dose was more toxic. Moreover, in a previous study using
transgenic models proposed to be used in the later stages of the current
study [44], the maximum period of drug administration was for one
month. Considering these factors, it was decided to fix the maximum
treatment period for one month.
Nanoparticles such as oral magnetite nanoparticles caused a de-
Fig. 3. The XRD profile of nCeO2.
velopmental delay in Drosophila by affecting egg-pupae and pupae-
adult transformations [51]. Therefore, in order to assess if nCeO2 oral
administration would also elicit developmental delay, the number of
days it took for third instar larvae development and subsequent

75
V. Sundararajan, et al. Applied Surface Science 490 (2019) 70–80

Fig. 5. Survival assay curve of flies treated with nCeO2 (100 male flies per
treatment group). Mantel-Cox test was performed to check for statistical sig-
nificance, using GraphPad Prism 6 and values were considered statistically
significant when P < 0.05. The curves of control and 1 mM treatment ex-
hibited a statistically significant difference (P = 0.0220, *). The curves of
0.1 mM and 1 mM also exhibited a statistically significant difference
(P = 0.0329, *).
Fig. 7. Behavioral studies of adult male flies using negative geotaxis assay after
one month of nCeO2 treatment. Values represented are mean ± SEM and sta-
tistical significance was set at P < 0.05 when compared to control, by ANOVA
followed by Dunnett's multiple comparison (n = 3 and 20 male flies per
treatment group).

Fig. 8. Determination of SOD activity in third instar larvae exposed to dietary

nCeO2. SOD activity is calculated on the basis of inhibition of reduction of ni-
troblue tetrazolium (NBT) by superoxide anion radical. 1 SOD unit is equivalent
Fig. 6. Comparison of the distance covered by larvae that fed on different doses
to 50% inhibition of NBT reduction per min. Values represented are
of nCeO2 with respect to control. Values represented are mean ± SEM and
mean ± SEM and statistical significance was set at P < 0.05 when compared
statistical significance was set at P < 0.05 when compared to control, by
to control, by ANOVA followed by Dunnett's multiple comparison (n = 3 and 20
ANOVA followed by Dunnett's multiple comparison (n = 9).
third instar larvae per treatment group).

transformation into pupa was noted. The larvae from the control, AA
of body wall musculature, which is in turn under the control of motor
and nCeO2 treatment groups reached the third instar stage at about the
neurons present in the dorsal region of the ventral ganglion [52].
same day (~ 8–10 days and all of them transformed into pupae and
Therefore, any damage to the neurons as a result of exposure to toxic
then hatched into flies). Therefore, this suggests that oral administra-
drugs/nanoparticles can compromise the larval crawling activity. In the
tion of nCeO2 did not elicit any developmental delay in Drosophila.
current study, the distance covered by larvae from control, AA, and
The larval crawling assay is commonly used to test neuronal func-
nCeO2 treatment groups did not show any significant difference, thus
tion since the movement of Drosophila larva is mainly by the contraction

76
V. Sundararajan, et al.
Fig. 9. Estimation of ROS generation in response to dietary administration of
nCeO2 for a period of one month. ROS production is calculated using fluores-
cence emitted by Dichlorofluorescein (DCF). Values represented are
mean ± SEM and statistical significance was set at P < 0.05 when compared
to control, by ANOVA followed by Dunnett's multiple comparison (n = 3 and 20
male flies per treatment group).
Fig. 10. Estimation of AChE activity in response to dietary administration of
nCeO2 for a period of one month. AChE activity was estimated using Ellman's
method. Values represented are mean ± SEM and statistical significance was
set at P < 0.05 when compared to control, by ANOVA followed by Dunnett's
multiple comparison (n = 3 and 20 male flies per treatment group).
suggesting the non-toxic nature of nCeO2 administered along with
Drosophila food. The negative geotaxis assay is a behavioral assay per-
formed to assess neurodegeneration and the presence of climbing def-
icits in flies, since it is the normal response of flies to climb upwards
when tapped to the bottom of the vial [53–55]. The absence of any
77
Applied Surface Science 490 (2019) 70–80
Fig. 11. Metabolic assays in adult flies to assess the effect of dietary adminis-
tration of nCeO2 for a period of one month. a) Glycogen content was estimated
using anthrone method (n = 3 and 5 male flies/per treatment group) b) Protein
content was estimated using Lowry's method (n = 3 and 20 male flies/per
treatment group). Values represented are mean ± SEM and statistical sig-
nificance was set at P < 0.05 when compared to control, by ANOVA followed
by Dunnett's multiple comparison.
significant changes in the climbing activity suggests that administration
of dietary nCeO2 for one month did not cause neurodegenerative
changes in the flies.
Cells are subjected to oxidative stress due to increased production of
ROS and this can be reversed by the use of antioxidants, which act as
free-radical scavengers [56]. A number of studies have reported that the
main mechanism behind NP-induced toxicity is oxidative stress as a
result of enhanced production of ROS [38,57,58]. The homogenate of
adult flies used to measure ROS after one month exposure to nCeO2 did
not reveal any statistically significant change in ROS levels at both the
doses, which suggests that the nanoparticle did not elicit any overt
oxidative stress. Interestingly, the homogenate of flies exposed to
V. Sundararajan, et al. Applied Surface Science 490 (2019) 70–80

increase in nCeO2 dose was seen. Since nCeO2 mimic the activity of
SOD enzyme, the decrease in SOD activity, although not significant,
could most likely be due to its antioxidant property and superoxide
radical scavenging ability [61].
Neurotoxicity refers to degenerative changes in cells of cerebellum
such as granular cells and Purkinje cells, adverse effects on myelination,
decrease in number of oligodendrocytes and significant reduction in
AChE activity when exposed to neurotoxic agents [62,63]. AChE assay
is used to evaluate the activity of AChE, an enzyme that hydrolyzes
acetylcholine to choline and acetic acid [64]. A reduction in the levels
of AChE has been reported to adversely affect the motor function and
behavior in honeybees [65] and this assay has been previously used to
assess the neurotoxic potential of NPs on Drosophila [47]. The results of
the AChE study did not reveal any significant changes in the activity of
the enzyme and therefore, this suggests the absence of neurotoxicity
upon dietary administration of nCeO2 at 0.1 mM and 1 mM doses for
one month. The effect of nCeO2 ingestion on the metabolism of flies was
studied. It has been previously reported that ingestion of silver NPs at
higher doses affected the energy reserve of flies such as glycogen and
protein, by altering the feeding behavior [66]. In order to check if in-
gestion of nCeO2 for one month also affected the energy reserves and
feeding behavior in flies, the glycogen and protein contents were esti-
mated. Similar to results of other biochemical assays, there was no
significant change in the energy reserves of flies, which reiterates that
nCeO2 can be used as a drug carrier in future studies.
Finally, the mRNA expression of SOD and catalase genes was eval-
uated in third instar larvae to assess if NP administration induced
oxidative stress and altered the antioxidant enzyme levels. SOD and
catalase are important antioxidant enzymes that help in the neu-
tralization of oxidative stress. These two enzymes along with glu-
tathione peroxidase form the first line of defense in the breakdown of
free radicals. Catalase is particularly important for the breakdown of
hydrogen peroxide and reactive nitrogen species [67,68]. According to
previous studies, the mRNA expression of SOD and catalase increased
significantly in Drosophila upon exposure to pesticides [69,70]. In the
current study, the lack of any statistically significant change in the
mRNA expression of catalase and SOD genes of third instar larvae ex-
posed to nCeO2 at both the doses indicates the lack of overt toxicity.
These results suggest that dietary administration of nCeO2 did not elicit
any significant oxidative stress to the third instar larvae.

5. Conclusion

The results of the behavioral and biochemical assays performed in

the current study suggest that nCeO2 administration along with food for
a period of one month at 0.1 mM and 1 mM did not elicit oxidative
stress, behavioral defects, neurotoxicity and decrease in the energy
reserves. Since all the assays used in the current study were restricted
Fig. 12. The relative mRNA expression of antioxidant enzymes in third instar
only for a period of one month, the reason behind why the 1 mM dose
larvae that fed on nCeO2 –containing food. a) SOD b) catalase. The gene ex-
was toxic beyond approximately 30–35 days is unknown. Future studies
pressions were normalized using RP49 and presented compared to control va-
using Drosophila and other in vivo models are warranted to investigate
lues. Data represent the mean ± SEM of 20 larvae each from three food vials/
per dose, run in duplicates. Statistical significance was set to P < 0.05 when the chronic toxicity of nCeO2 and the mechanism behind it.
compared to control, by ANOVA followed by Dunnett's multiple comparison. Nonetheless, because of non-toxic effects of nCeO2, it has the potential
to be used as a beneficial drug carrier in Drosophila disease models in
future studies.
ascorbic acid for a period of one month exhibited a significant decrease
in ROS production, which can be attributed to antioxidant activity of
Acknowledgements
ascorbic acid [59]. SOD is one of the major antioxidant defense me-
chanisms against superoxide anion and consists of three isoforms, dif-
Dr. Sahabudeen acknowledges the financial support from the
fering in their subcellular localization. The main function of SOD is to
Department of Science and Technology (DST)–Science and Engineering
catalyze the conversion of superoxide anion into hydrogen peroxide
Research Board (FILE NO. ECR/2016/000490), Government of India.
[60]. Measurement of SOD activity has been used to assess NP toxicity
The authors acknowledge the SRM-DBT Platform for Advanced Life
and any significant increase in SOD activity tells us about the toxic
Sciences and the HRTEM FACILITY at SRMIST set up with support from
nature of NP [46]. When the SOD activity was assessed in the third
MNRE (Project No. 31/03/2014-15/PVSE-R&D),Government of India.
instar larvae that fed on nCeO2 supplemented food, no significant
The authors also acknowledge the assistance of undergraduate student
change was seen, although a trend of decrease in SOD activity with
M. Aasha in RNA isolation.

78
V. Sundararajan, et al.
Fig. 13. TEM imaging of gut to demonstrate the uptake of nCeO2. a) Control larval gut b) nCeO2-treated larval gut.
c) Control fly gut d) nCeO2-treated fly gut. Insets in b) and d) show the lattice fringes of nCeO2 when imaged at lower magnification.
Declaration of Competing Interest
The authors declare that they have no conflict of interest.
References
[1] I. Khan, K. Saeed, I. Khan, Nanoparticles: properties, applications and toxicities,
Arab. J. Chem. (2017), https://doi.org/10.1016/j.arabjc.2017.05.011.
[2] G. Dan, X. Guoxin, L. Jianbin, Mechanical properties of nanoparticles: basics and
applications, J. Phys. D. Appl. Phys. 47 (1) (2014) 013001.
[3] G.J. Nohynek, J. Lademann, C. Ribaud, M.S. Roberts, Grey goo on the skin?
Nanotechnology, cosmetic and sunscreen safety, Crit. Rev. Toxicol. 37 (3) (2007)
251–277.
[4] G. Vecchio, A. Galeone, V. Brunetti, G. Maiorano, L. Rizzello, S. Sabella,
R. Cingolani, P.P. Pompa, Mutagenic effects of gold nanoparticles induce aberrant
phenotypes in Drosophila melanogaster, Nanomedicine 8 (1) (2012) 1–7.
79
Applied Surface Science 490 (2019) 70–80
[5] S. Das, J.M. Dowding, K.E. Klump, J.F. McGinnis, W. Self, S. Seal, Cerium oxide
nanoparticles: applications and prospects in nanomedicine, Nanomedicine (Lond) 8
(9) (2013) 1483–1508.
[6] S.J. Snow, J. McGee, D.B. Miller, V. Bass, M.C. Schladweiler, R.F. Thomas,
T. Krantz, C. King, A.D. Ledbetter, J. Richards, J.P. Weinstein, T. Conner, R. Willis,
W.P. Linak, D. Nash, C.E. Wood, S.A. Elmore, J.P. Morrison, C.L. Johnson,
M.I. Gilmour, U.P. Kodavanti, Inhaled diesel emissions generated with cerium oxide
nanoparticle fuel additive induce adverse pulmonary and systemic effects, Toxicol.
Sci. 142 (2) (2014) 403–417.
[7] M.S. Wason, J. Zhao, Cerium oxide nanoparticles: potential applications for cancer
and other diseases, Am. J. Transl. Res. 5 (2) (2013) 126–131.
[8] C. Xu, X. Qu, Cerium oxide nanoparticle: a remarkably versatile rare earth nano-
material for biological applications, Npg Asia Materials 6 (2014) e90.
[9] A. Dhall, W. Self, Cerium oxide nanoparticles: a brief review of their synthesis
methods and biomedical applications, Antioxidants (Basel) 7 (8) (2018).
[10] T. Xia, M. Kovochich, M. Liong, L. Mädler, B. Gilbert, H. Shi, J.I. Yeh, J.I. Zink,
A.E. Nel, Comparison of the mechanism of toxicity of zinc oxide and cerium oxide
nanoparticles based on dissolution and oxidative stress properties, ACS Nano 2 (10)
V. Sundararajan, et al.
(2008) 2121–2134.
[11] D. Schubert, R. Dargusch, J. Raitano, S.-W. Chan, Cerium and yttrium oxide na-
noparticles are neuroprotective, Biochem. Biophys. Res. Commun. 342 (1) (2006)
86–91.
[12] A. Azari, M. Shokrzadeh, E. Zamani, N. Amani, F. Shaki, Cerium oxide nanoparticles
protects against acrylamide induced toxicity in HepG2 cells through modulation of
oxidative stress, Drug Chem. Toxicol. 42 (1) (2019) 1–6.
[13] M. Pešić, A. Podolski-Renić, S. Stojković, B. Matović, D. Zmejkoski, V. Kojić,
G. Bogdanović, A. Pavićević, M. Mojović, A. Savić, I. Milenković, A. Kalauzi,
K. Radotić, Anti-cancer effects of cerium oxide nanoparticles and its intracellular
redox activity, Chem. Biol. Interact. 232 (2015) 85–93.
[14] E. Alpaslan, H. Yazici, N.H. Golshan, K.S. Ziemer, T.J. Webster, pH-dependent ac-
tivity of dextran-coated cerium oxide nanoparticles on prohibiting osteosarcoma
cell proliferation, ACS Biomater Sci Eng 1 (11) (2015) 1096–1103.
[15] S. Khan, A.A. Ansari, C. Rolfo, A. Coelho, M. Abdulla, K. Al-Khayal, R. Ahmad,
Evaluation of in vitro cytotoxicity, biocompatibility, and changes in the expression
of apoptosis regulatory proteins induced by cerium oxide nanocrystals, Sci.
Technol. Adv. Mater. 18 (1) (2017) 364–373.
[16] S. Mittal, A.K. Pandey, Cerium oxide nanoparticles induced toxicity in human lung
cells: role of ROS mediated DNA damage and apoptosis, Biomed. Res. Int. 2014
(2014) 14.
[17] Y.F. Xiao, J.M. Li, S.M. Wang, X. Yong, B. Tang, M.M. Jie, H. Dong, X.C. Yang,
S.M. Yang, Cerium oxide nanoparticles inhibit the migration and proliferation of
gastric cancer by increasing DHX15 expression, Int. J. Nanomedicine 11 (2016)
3023–3034.
[18] S.M. Hirst, A. Karakoti, S. Singh, W. Self, R. Tyler, S. Seal, C.M. Reilly, Bio-dis-
tribution and in vivo antioxidant effects of cerium oxide nanoparticles in mice,
Environ. Toxicol. 28 (2) (2013) 107–118.
[19] M. Alaraby, A. Hernandez, B. Annangi, E. Demir, J. Bach, L. Rubio, A. Creus,
R. Marcos, Antioxidant and antigenotoxic properties of CeO2 NPs and cerium sul-
phate: studies with Drosophila melanogaster as a promising in vivo model,
Nanotoxicology 9 (6) (2015) 749–759.
[20] J. Colon, L. Herrera, J. Smith, S. Patil, C. Komanski, P. Kupelian, S. Seal,
D.W. Jenkins, C.H. Baker, Protection from radiation-induced pneumonitis using
cerium oxide nanoparticles, Nanomedicine 5 (2) (2009) 225–231.
[21] S. Das, C.J. Neal, J. Ortiz, S. Seal, Engineered nanoceria cytoprotection in vivo:
mitigation of reactive oxygen species and double-stranded DNA breakage due to
radiation exposure, Nanoscale 10 (45) (2018) 21069–21075.
[22] C.E. Dillon, M. Billings, K.S. Hockey, L. DeLaGarza, B. Rzigalinski, Cerium oxide
nanoparticles protect against MPTP-induced dopaminergic neurodegeneration in a
mouse model for Parkinson's disease, TechConnect Briefs 3 (2011) 451–454.
[23] K.L. Heckman, W. DeCoteau, A. Estevez, K.J. Reed, W. Costanzo, D. Sanford,
J.C. Leiter, J. Clauss, K. Knapp, C. Gomez, P. Mullen, E. Rathbun, K. Prime,
J. Marini, J. Patchefsky, A.S. Patchefsky, R.K. Hailstone, J.S. Erlichman, Custom
cerium oxide nanoparticles protect against a free radical mediated autoimmune
degenerative disease in the brain, ACS Nano 7 (12) (2013) 10582–10596.
[24] J. Niu, A. Azfer, L.M. Rogers, X. Wang, P.E. Kolattukudy, Cardioprotective effects of
cerium oxide nanoparticles in a transgenic murine model of cardiomyopathy,
Cardiovasc. Res. 73 (3) (2007) 549–559.
[25] L. Fiorani, M. Passacantando, S. Santucci, S. Di Marco, S. Bisti, R. Maccarone,
Cerium oxide nanoparticles reduce microglial activation and neurodegenerative
events in light damaged retina, PLoS One 10 (10) (2015) e0140387.
[26] Z. Vafaei-Pour, M. Shokrzadeh, M. Jahani, F. Shaki, Embryo-protective effects of
cerium oxide nanoparticles against gestational diabetes in mice, Iran J Pharm Res
17 (3) (2018) 964–975.
[27] S. Patil, S. Reshetnikov, M.K. Haldar, S. Seal, S. Mallik, Surface-derivatized nano-
ceria with human carbonic anhydrase II inhibitors and fluorophores: a potential
drug delivery device, J. Phys. Chem. C 111 (24) (2007) 8437–8442.
[28] J. Das, Y.-J. Choi, J.W. Han, A.M.M.T. Reza, J.-H. Kim, Nanoceria-mediated de-
livery of doxorubicin enhances the anti-tumour efficiency in ovarian cancer cells via
apoptosis, Sci. Rep. 7 (1) (2017) 9513.
[29] I. Kalashnikova, J. Mazar, C.J. Neal, A.L. Rosado, S. Das, T.J. Westmoreland, S. Seal,
Nanoparticle delivery of curcumin induces cellular hypoxia and ROS-mediated
apoptosis via modulation of Bcl-2/Bax in human neuroblastoma, Nanoscale 9 (29)
(2017) 10375–10387.
[30] D. Schwotzer, H. Ernst, D. Schaudien, H. Kock, G. Pohlmann, C. Dasenbrock,
O. Creutzenberg, Effects from a 90-day inhalation toxicity study with cerium oxide
and barium sulfate nanoparticles in rats, Part Fibre Toxicol 14 (1) (2017) 23.
[31] A. Poma, A.M. Ragnelli, J. de Lapuente, D. Ramos, M. Borras, P. Aimola, M. Di
Gioacchino, S. Santucci, L. De Marzi, In vivo inflammatory effects of ceria nano-
particles on CD-1 mouse: evaluation by hematological, histological, and TEM
analysis, J Immunol Res 2014 (2014) 14.
[32] A. Nemmar, P. Yuvaraju, S. Beegam, M.A. Fahim, B.H. Ali, Cerium oxide nano-
particles in lung acutely induce oxidative stress, inflammation, and DNA damage in
various organs of mice, Oxidative Med. Cell. Longev. 2017 (2017) 12.
[33] V.C. Minarchick, P.A. Stapleton, D.W. Porter, M.G. Wolfarth, E. Ciftyurek,
M. Barger, E.M. Sabolsky, T.R. Nurkiewicz, Pulmonary cerium dioxide nanoparticle
exposure differentially impairs coronary and mesenteric arteriolar reactivity,
Cardiovasc. Toxicol. 13 (4) (2013) 323–337.
[34] O.A. Adebayo, O. Akinloye, O.A. Adaramoye, Cerium oxide nanoparticle elicits
oxidative stress, endocrine imbalance and lowers sperm characteristics in testes of
balb/c mice, Andrologia 50 (3) (2018).
[35] E.J. Park, J. Choi, Y.K. Park, K. Park, Oxidative stress induced by cerium oxide
nanoparticles in cultured BEAS-2B cells, Toxicology 245 (1–2) (2008) 90–100.
[36] K. Babin, F. Antoine, D.M. Goncalves, D. Girard, TiO2, CeO2 and ZnO nanoparticles
and modulation of the degranulation process in human neutrophils, Toxicol. Lett.
221 (1) (2013) 57–63.
[37] D. Sabat, A. Patnaik, B. Ekka, P. Dash, M. Mishra, Investigation of titania nano-
particles on behaviour and mechanosensory organ of Drosophila melanogaster,
Physiol. Behav. 167 (2016) 76–85.
80
Applied Surface Science 490 (2019) 70–80
[38] S.A. Pappus, B. Ekka, S. Sahu, D. Sabat, P. Dash, M. Mishra, A toxicity assessment of
hydroxyapatite nanoparticles on development and behaviour of Drosophila mela-
nogaster, J. Nanopart. Res. 19 (4) (2017) 136.
[39] P.P. Pompa, G. Vecchio, A. Galeone, V. Brunetti, S. Sabella, G. Maiorano, A. Falqui,
G. Bertoni, R. Cingolani, In vivo toxicity assessment of gold nanoparticles in
Drosophila melanogaster, Nano Res. 4 (4) (2011) 405–413.
[40] U.B. Pandey, C.D. Nichols, Human disease models in Drosophila melanogaster and
the role of the fly in therapeutic drug discovery, Pharmacol. Rev. 63 (2) (2011)
411–436.
[41] C. Ong, L.Y. Yung, Y. Cai, B.H. Bay, G.H. Baeg, Drosophila melanogaster as a model
organism to study nanotoxicity, Nanotoxicology 9 (3) (2015) 396–403.
[42] M. Chelliah, J.B.B. Rayappan, U. Maheshwari Krishnan, Synthesis and character-
ization of cerium oxide nanoparticles by hydroxide mediated approach, J. Appl. Sci.
12 (16) (2012) 1734–1737.
[43] B. Kaya, Anti-genotoxic effect of ascorbic acid on mutagenic dose of three alkylating
agents, Turk. J. Biol. 27 (4) (2003) 241–246.
[44] S.S. Mohideen, Y. Yamasaki, Y. Omata, L. Tsuda, Y. Yoshiike, Nontoxic singlet
oxygen generator as a therapeutic candidate for treating tauopathies, Sci. Rep. 5
(2015) 10821.
[45] Nichols CD, Becnel J, Pandey UB. Methods to assay Drosophila behavior. Journal of
Visualized Experiments: JoVE. 2012(61):3795.
[46] M. Ahamed, R. Posgai, T.J. Gorey, M. Nielsen, S.M. Hussain, J.J. Rowe, Silver na-
noparticles induced heat shock protein 70, oxidative stress and apoptosis in
Drosophila melanogaster, Toxicol. Appl. Pharmacol. 242 (3) (2010) 263–269.
[47] Y.H. Siddique, M. Haidari, W. Khan, A. Fatima, S. Jyoti, S. Khanam, F. Naz, Ali
F. Rahul, B.R. Singh, T. Beg, A.H. Mohibullah Naqvi, Toxic potential of copper-
doped ZnO nanoparticles in Drosophila melanogaster (Oregon R), Toxicol. Mech.
Methods 25 (6) (2015) 425–432.
[48] F. Valeria Soares de Araujo Pinho, G. Felipe da Silva, G. Macedo, K. Raquel Muller,
I. Martins, A. Paula Lausmann Ternes, J.G. Costa, M. Linde Athayde, A. Augusti
Boligon, D.J.P. Kamdem, J. Franco, I.R. Menezes, T. Posser, Phytochemical con-
stituents and toxicity of Duguetia furfuracea hydroalcoholic extract in Drosophila
melanogaster, J Evid Based Complementary Altern Med 2014 (2014).
[49] P. Dan, V. Sundararajan, H. Ganeshkumar, B. Gnanabarathi, A.K. Subramanian,
G.D. Venkatasubu, S. Ichihara, G. Ichihara, S. Sheik Mohideen, Evaluation of hy-
droxyapatite nanoparticles - induced in vivo toxicity in Drosophila melanogaster,
Appl. Surf. Sci. 484 (2019) 568–577.
[50] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Protein measurement with the
Folin phenol reagent, J. Biol. Chem. 193 (1) (1951) 265–275.
[51] H. Chen, B. Wang, W. Feng, W. Du, H. Ouyang, Z. Chai, X. Bi, Oral magnetite
nanoparticles disturb the development of Drosophila melanogaster from oogenesis
to adult emergence, Nanotoxicology 9 (3) (2015) 302–312.
[52] D.L. Glanzman, Ion pumps get more glamorous, Nat. Neurosci. 13 (1) (2010) 4–5.
[53] Y.O. Ali, W. Escala, K. Ruan, R.G. Zhai, Assaying locomotor, learning, and memory
deficits in Drosophila models of neurodegeneration, J. Vis. Exp. (49) (2011) e2504.
[54] M.B. Feany, W.W. Bender, A Drosophila model of Parkinson's disease, Nature 404
(6776) (2000) 394–398.
[55] J.A. Linderman, M.C. Chambers, A.S. Gupta, D.S. Schneider, Infection-related de-
clines in chill coma recovery and negative geotaxis in Drosophila melanogaster,
PLoS One 7 (9) (2012) e41907.
[56] I. Kalyana Sundaram, D.D. Sarangi, V. Sundararajan, S. George, S. Sheik Mohideen,
Poly herbal formulation with anti-elastase and anti-oxidant properties for skin anti-
aging, BMC Complement. Altern. Med. 18 (1) (2018) 33.
[57] A. Nel, T. Xia, L. Mädler, N. Li, Toxic potential of materials at the nanolevel, Science
311 (5761) (2006) 622.
[58] S.R. Choudhury, J. Ordaz, C.L. Lo, N.P. Damayanti, F. Zhou, J. Irudayaraj, From the
cover: zinc oxide nanoparticles-induced reactive oxygen species promotes multi-
modal cyto- and epigenetic toxicity, Toxicol. Sci. 156 (1) (2017) 261–274.
[59] G.-C. Yen, P.-D. Duh, H.-L. Tsai, Antioxidant and pro-oxidant properties of ascorbic
acid and gallic acid, Food Chem. 79 (3) (2002) 307–313.
[60] T. Fukai, M. Ushio-Fukai, Superoxide dismutases: role in redox signaling, vascular
function, and diseases, Antioxid. Redox Signal. 15 (6) (2011) 1583–1606.
[61] E.G. Heckert, A.S. Karakoti, S. Seal, W.T. Self, The role of cerium redox state in the
SOD mimetic activity of nanoceria, Biomaterials 29 (18) (2008) 2705–2709.
[62] S.S. Mohideen, S. Ichihara, K. Subramanian, Z. Huang, H. Naito, J. Kitoh,
G. Ichihara, Effects of exposure to 1-bromopropane on astrocytes and oligoden-
drocytes in rat brain, J. Occup. Health 55 (1) (2013) 29–38.
[63] G.R. Reddy, B.C. Devi, C.S. Chetty, Developmental lead neurotoxicity: alterations in
brain cholinergic system, NeuroToxicology 28 (2) (2007) 402–407.
[64] P. Taylor, S. Camp, Z. Radić, Acetylcholinesterase, in: L.R. Squire (Ed.),
Encyclopedia of Neuroscience, Academic Press, Oxford, 2009, pp. 5–7.
[65] S. Williamson, C. Moffat, M. Gomersall, N. Saranzewa, C. Connolly, G. Wright,
Exposure to acetylcholinesterase inhibitors alters the physiology and motor func-
tion of honeybees, Front. Physiol. 4 (2013) 13.
[66] A. Raj, P. Shah, N. Agrawal, Sedentary behavior and altered metabolic activity by
AgNPs ingestion in Drosophila melanogaster, Sci. Rep. 7 (1) (2017) 15617.
[67] C. Glorieux, P.B. Calderon, Catalase, a remarkable enzyme: targeting the oldest
antioxidant enzyme to find a new cancer treatment approach, Biol. Chem. 398 (10)
(2017) 1095–1108.
[68] O.M. Ighodaro, O.A. Akinloye, First line defence antioxidants-superoxide dismutase
(SOD), catalase (CAT) and glutathione peroxidase (GPX): their fundamental role in
the entire antioxidant defence grid, Alexandria J Med 54 (4) (2018) 287–293.
[69] J.H. Sudati, F.A. Vieira, S.S. Pavin, G.R. Dias, R.L. Seeger, R. Golombieski,
M.L. Athayde, F.A. Soares, J.B. Rocha, N.V. Barbosa, Valeriana officinalis attenuates
the rotenone-induced toxicity in Drosophila melanogaster, Neurotoxicology 37
(2013) 118–126.
[70] O. Doganlar, B. Doganlar, Responses of antioxidant enzymes and heat shock pro-
teins in drosophila to treatment with a pesticide mixture, Arch. Biol. Sci., Belgrade.
67 (3) (2015) 869–876.