Biomedicine & Pharmacotherapy 125 (2020) 109914

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Composite probiotics alleviate type 2 diabetes by regulating intestinal T

microbiota and inducing GLP-1 secretion in db/db mice
Yanming Wang1, Dinareer Dilidaxi1, Yuche Wu, Jialehasibieke Sailike, Xin Sun, Xin-hua Nabi*
Department of Pharmacology, Xinjiang Medical University, Urumqi, 830011, China

ARTICLE INFO ABSTRACT

Keywords: Backgroud/Aim: Previous studies have found that probiotic fermented camel milk has anti-diabetic effect by
Diabetes 2 mellitus inducing (glucagon-like peptide-1) GLP-1 secretion. Probiotics are valuable in prevention and treatment of
Composite probiotics diabetes. As a result, our team islolated 14 probiotics from fermented camel milk. These probiotics have ben-
Gut microbiota eficial characteristics, but the possible anti-diabetic mechanisms remains unclear. The present study aimed to
Short-chain fatty acids
explore the possoble anti-diabetic mechanisms of 14 probiotics.
Glucagon-like peptide-1
Methods: C57BL/Ks mice were normal group. The db/db mice were randomized into five groups: model group,
metformin group, liraglutide group, low-dose and high-dose probiotic group. Biochemical parameters were
determined by the respective assay kits. The levels of the short-chain fatty acids (SCFAs) and microbiota were
respectively determined by gas chromatography and qRT-PCR. HE staining and immunofluorescence were used
for histomorphological observation. Quantitative PCR and western-blot were determined the gene and protein
expression of Bax, Bcl-2, Caspase-3 and PI3K/AKT.
Results: Probiotics significantly improved blood glucose and blood lipid parameters, as well as the morpholo-
gical changes of pancreas, liver and kidney. Probiotics improved the gut barrier function through increasing the
levels of SCFA-producing bacteria and SCFAs as well as the expression of claudin-1 and mucin-2, and decreasing
Escherichia coli and LPS level. In additon, probiotics enhanced insulin secretion through glucose-triggered GLP-1
secretion by upregulating G protein-coupled receptor 43/41 (GPR43/41), proglucagon and proconvertase 1/3
activity. Forthermore, probiotics protected pancreas against apoptosis, which may be dependent on the upre-
gulation of PI3K/AKT pathway.
Conclusions: The anti-diabetic effect of 14 probiotics in db/db mice seem to be related to an increase of SCFA-
producing bacteria, the improvement of intestinal barrier function and the upregulation of GLP-1 production,
and indicate these probiotics might be a good candidate to prevent and treat diabetes.

1. Introduction is benefical to control blood glucose levels due to the downregulation

The prevalence of diabetes mellitus (DM), a metabolic disorder that
affects global health, shows a rising trend in both developed and de-
veloping countries [1]. The data of the World Health Organization
(WHO) shows that the incidence of diabetes continues to rise year by
year. The world prevalence of adult diabetes in 2010 is 285 million and
predicted to reach 439 million in 2030 [2]. Notably, T2D comprises 80
% of diabetes and is characterised by a combination of inadequate in-
sulin secretion and insulin resistance along with hyperglycaemia, dys-
lipidemia and glucose intolerance. Especially additional insulin therayp
level of insulin in later stages of T2D [3]. Glucagon-like peptide-1 (GLP-
1) is a hormone and secreted by intestinal L cells loacted mainly in the
distal ileum and colon. The absorption of nutrients, especially the
glucose or carbohydrates, can stimulate GLP-1 secretion [4]. GLP-1 can
normalize the glucose homeostasis by enhancing and sensitizing β cells
function in response to glucose-stimulated insulin secretion [5]. GLP-1
also plays an important role in controlling glucose homeostasis by sti-
mulating pancreatic β-cells to release insulin, thereby reducing the se-
cretion of glucagon in pancreatic α-cells and inhibiting the appetite [6].
Besides, GLP-1 also inhibits pancreatic β-cell apoptosis and contributes

Abbreviations: GLP-1, Glucagon-like peptide-1; GCG, Proglucagon; PC1/3, Proconvertase 1/3; TNF-α, Tumor necrosis factor α; IFN-γ, Interferon-γ; IL-1β,
Interleukin-1β; LPS, Lipopolysaccharide; GPR43/41, G protein-coupled receptor 43/41; PI3K/AKT, Phosphatidylinositol 3ʹ-kinase/protein kinase B; Bcl-2, B-cell
lymphoma 2; Bax, Bcl-2-associated X protein; SCFAs, Short-chain fatty acids
⁎
Corresponding author.
E-mail address: xinhuanabi@yeah.net (X.-h. Nabi).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.biopha.2020.109914
Received 5 October 2019; Received in revised form 10 January 2020; Accepted 12 January 2020
0753-3322/ © 2020 The Author(s). Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Y. Wang, et al.
to β-cell growth [7]. Therefore, GLP-1 might be as one of the potential
therapies in T2D by improving the pancreatic beta-cells function and
inducing insulin secretion.
There is increasing evidence showing that the relationship between
gut microbiota and diabetes is intertwined. Gut microorganisms are
part of an extremely sophisticated ecosystem. There are abundant,
multifarious microorganisms living in the intestines, such as
Fusobacteria, Actinobacteria, Firmicutes, and Bacteroidetes. Recent studies
have shown that the composition and abundance of gut microbiota in
healthy individuals are remarkably different from patients with T2D
[8]. The short-chain fatty acid (SCFA)-producing bacteria can produce
SCFAs (e.g., acetic acid, propionic acid, butyric acid) by the digestion,
fermentation and catabolism of nondigestible dietary fibers, proteins,
and glycoproteins. Studies in humans have reported that levels of bu-
tyrate-producing bacteria in T2D patients are significantly decreased
compared to healthy individuals [9]. Animal study has described si-
milar results indicating that the levels of SCFA-producing bacteria in
T2D model are significantly decreased compared to normal group [10].
The diabetic prevalence of Kazakh populations was lower than other
ethnic groups in Xinjiang of China, which has a colse relationship with
their custom of daily use of fermented dairy products for a long time,
such as fermented camel milk [11–13]. In the previous study, we have
found that the probiotic fermented camel milk has anti-diabetic effect
by inducing GLP-1 secretion in streptozotocin-induced DM rats [14].
Emerging evidence has shown that probiotics are expected to be a
promising therapeutic and preventive strategy for diabetes mellitus by
modifying intestinal microbiota, improving intestinal barrier function
and inhibiting insulin resistance [15]. Therefore, 14 probiotics were
isolated from Xinjiang traditional fermented camel milk and identified
by the Center for the Preservation of Chinese Industrial Microbial
Strains [14]. These probiotics have beneficial characteristics, including
acid resistance, bile tolerance, high self-aggregation ability, high ad-
hesion to Caco-2 cells and so on [16,17]. However, the possible anti-
diabetic mechanisms associated with these probiotics remain unclear.
The study aimed to explore the possible mechanisms involved in pro-
biotic-induced GLP-1 secretion in db/db mice.
2. Materials and methods
2.1. Probiotic growth and preparation
Fourteen probiotics were isolated from traditional fermented camel
milk in Xinjiang, China and identified by the Center for the Preservation
of Chinese Industrial Microbial Strains [14]. Probiotics were cultured
according to a previously reported method [18]. Briefly, ten Lactoba-
cillus strains were cultured in Man Rogosa Sharpe (MRS) broth at 37 ℃
for 48 h. Four yeast strains were cultured in modified-MRS broth at 37
℃ for 48 h. Cultured cells were harvested by centrifugation at 3000 rpm
(2570 × g) for 15 min and then washed twice with aseptic phosphate
buffered saline. The high-dose of probiotics includes 1 × 1010 colony-
forming units (CFU)/mL of ten Lactobacillus strains (Lactobacillus plan-
tarum, Lactobacillus helveticus, Lactococcus lactis, Lactobacillus pentosus,
Lactobacillus paracasei, Lactobacillus paracasei sbusp.tolerans, Lactoba-
cillus mucosae, Lactobacillus rhamnosus, Lactobacillus harbinensis and
Lactobacillus hilgardii) and 1 × 108 CFU/mL of 4 yeast strains (Is-
satchenkia orientalis, Candida ethanolica, Kluyveromyces marxianus and
Pichia membranifaciens). The low-dose of probiotics includes 1 × 108
colony-forming units (CFU)/mL of ten Lactobacillus strains and 1 × 106
CFU/mL of 4 yeast strains.
2.2. Animals and treatments
Specific pathogen free (SPF) grade male db/db mice and C57BL/KS
male mice were purchased from the Experimental Animal Center at
Xinjiang Medical University. The study was approved by the institu-
tional animal ethics committee (Approval Number: IACUC20160414-
2
Biomedicine & Pharmacotherapy 125 (2020) 109914
05). The experimental protocol complied with the ARRIVE guidelines
and was carried in compliance with National Institutes of Health guide
for the care and use of Laboratory animals (NIH Publications No. 8023,
revised 1978). The specific pathogen-free (SPF) grade male db/db mice
(∼35 g average bodyweight) and C57BL/Ks mice (∼20 g average
bodyweight) were at 6 weeks of age [19]. Normal chow diet and water
were provided ad libitum. The mice were housed in groups of three to
four per cage at 22 ℃ ± 1 ℃ with 50 % ± 5 % humidity and a 12-h
diurnal light cycle. The mice were acclimated for 1 week before the
experiment. C57BL/Ks mice were the normal (N) control group (n =
10) and orally fed physiological saline (0.5 mL/d) for 6 weeks. Diabetic
db/db mice were randomly divided into five groups: the diabetic model
(D) group (n = 10) was orally fed physiological saline (0.5 mL/d) for 6
weeks; the positive control groups (n = 10/group) received respec-
tively intragastric administration of metformin (M) (0.3 g/kg/d) (Novo
Nordisk Biotechnology Co Ltd., Denmark, cat# JVGR828-1) and in-
jection of liraglutide (L) (0.2 μg/g/d) (Sino-American Shanghai Squibb
Pharmaceutical Co., Ltd., Shanghai, China, cat# ABK5947) for 6 weeks
[20,21]. The probiotic groups (n = 10/group) were orally fed with the
low-dose of probiotics and high-dose probiotics once a day for 6 weeks
[22,23]. The low-dose of compounded probiotics in the 0.5 mL phy-
siological saline includes 10 Lactobacillus strains (1 × 108 CFU/mL) and
4 saccharomycetes (1 × 106 CFU/mL). The high-dose of compounded
probiotics in the 0.5 mL physiological saline includes 10 Lactobacillus
strains (1 × 1010 CFU/mL) and 4 saccharomycetes (1 × 108 CFU/mL).
All mice were given intervention at 11 o’clock in the morning once a
day for 6 weeks.
2.3. Fasting blood glucose (FBG) and Oral glucose tolerance test (OGTT)
The body weights of mice in different groups were recorded on the
first day of treatment administration and then thrice weekly until 6
weeks. For the fasting blood-glucose, the mice were fasted for 8 h from
10 o’clock in the morning to 6 o'clock in the afternoon at the Sunday of
every week for 6 weeks. The tail was sterilized by the alcohol sponge
and made a small cut at the tip of tail vein. The first drop of blood was
thrown away and then the second drop of blood was detected by the
glucometer (Roche Diagnostics, Mannheim, Germany). After being in-
tervention for 6 weeks, all mice were starved for 8 h and oral glucose
tolerance tests were carried out using 2 g/kg body weight of glucose (20
% solution). We collected the tail blood samples at 0, 30, 60, 90 and
120 min after glucose loading and detected the blood glucose value by
the glucometer (Roche Diagnostics, Mannheim, Germany). The area
under the glucose curve (AUC glucose) was determined from time
0–120 min (AUC 0–120 min) after glucose administration.
2.4. ELISA determination of total GLP-1 and insulin
Mice were performed by OGTT after fasting for 8 h. At 0 min, 15
min, 30 min and 45 min after glucose load, the blood collected from the
tail veins was immediately transferred into EDTA tubes containing a
dipeptidyl peptidase IV inhibitor (EMD Millipore, United States), and
then centrifuged at 1200 g for 15 min at 4 ℃. The plasma was im-
mediately dispensed into a new tube and subjected to enzyme im-
munoassay. The total GLP-1 and insulin levels in plasma were detected
by GLP-1 (Mesoscale, Rockville, MD) and insulin (Uscn life, Wuhan,
China) ELISA assays according to kit instructions.
2.5. Biochemical parameter analysis
The triglyceride (TG), total cholesterol (TC), high density lipopro-
tein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C)
and lipopolysaccharide (LPS) levels were determined by enzyme-linked
immunosorbent assay (ELISA) kits (Nanjing Jiancheng Biology Co.,
Ltd., Nanjing, China) according to the kit instructions. Haemoglobin
A1c (HbA1c) and C-peptide were detected by the ELISA kits (Wuhan
Y. Wang, et al.
Table 1
Sequences of primers used in bacterial expression analysis.
Target Forward and reverse primers Reference
Lactobacillus F: AGCAGTAGGGAATCTTCCA [36]
R: CACCGCTACACATGGAG
Bifidobacterium F: GTCAGCTCGTGTCGTGAG [36]
R: GTCGCATCCCGTTGTACC
Clostridium leptum F: GCACAAGCAGTGGAGT [36]
R: CTTCCTCCGTTTTGTCA
Roseburia F: GCGGTRCGGCAAGTCTGA [28]
R: CCTCCGACACTCTAGTMCGAC
Fusobacterium F: GTATGTCRCAAGCGTTATCC [28]
R: AACGCAATACRGAGTTGAGC
Prevotella F: CGAACAGGATTAGATACCC [28]
R: CTTTGAGTTTCACCGTTG
Escherichia coli F: GTTAATACCTTTGCTCATTGA [45]
R: ACCAGGGTATCTAATCCTGTT
All bacteria F: ACTCCTACGGGAGGCAGCAGT [45]
R: GTATTACCGCGGCTGCTGGCAC
Huamei Biological Co., Ltd., Wuhan, China). The level of 24 h urine
protein (24 h UP) was analyzed using an automatic clinical analyzer
(Hitachi High-Technologies Corporation, Tokyo, Japan).
2.6. Intestinal microbiota analysis
faeces were collected after consuming probiotics for 6 weeks and
stored at -80 ℃. DNA was extracted by QIAamp Fast DNA stool mini kit
(Qiagen, Hilden, Germany) according to the manufacturer instructions,
and quantification was evaluated using a NanoDrop ND-1000 spectro-
photometer (Thermo Scientific, Wilmington, DE). Different bacterium
in faeces samples were detected by real-time quantitative PCR, and
bacterium primers were synthesised by Dalian Bao Biotechnology Co.,
Ltd, as shown in supplementary materials Table 1. Amplification and
detection of DNA were performed with a QuantiFast SYBR Green PCR
kit (Bio-Rad, Hercules, USA). Results are expressed as the number of
bacteria per g of stool.
2.7. Short-chain fatty acids (SCFAs) analysis
The SCFAs of the feces were measured by the gas chromatography
method according to a previous study [24]. Fresh faecal samples were
collected and completely frozen in liquid nitrogen. Samples were
smashed by mortar-pestle and suspended in 1 mL of phosphoric acid 0.5
% per 100 mg of sample, and mixed with 2-ethylbutyradehyde added as
internal standard (IS) at a final concentration of 3 mM, diluted with
sterile water 1 mL, and centrifuged 10 min at 12,000 g. Supernatant was
collected, filtered using a 0.45 μm membrane and loaded onto a gas-
phase flask for SCFAs analysis. All analyses were carried out on a gas-
phase flask (GC 2010 plus, Japan). A polar HP-INNOWAX capillary
column (30 m × 0.32 mm i.d. × 0.5 μm film thickness) (Agilent
Technologies Inc., USA) was utilized for the separation. Concentrations
of acetic acid, propionic acid and butyric acid (three standards) were
200 mM, 100 mM and 100 mM respectively. A volume of 1 μL of aliquot
sample was automatically injected into the inlet. Hydrogen, air, and
nitrogen were mixed and used as a carrier gas with the flow rates of 30
mL/min, 300 mL/min and 40 mL/min, respectively. The oven program
was adopted at an initial temperature 110 ℃ for 2.5 min, increased to
150 ℃ at a rate of 20 ℃/min, and maintained at 150 ℃ for 8 min. The
ratio of the peak areas of the SCFAs from the spiked and non-spiked
sample against the peak area of the internal standard is used to de-
termine the concentration of SCFAs. The method was validated for
linearity, limit of detection (LOD), limit of quantification (LOQ), pre-
cision, recovery, and stability. The IS was used to correct for injection
variability between samples and minor changes in the instrument re-
sponse. Three independent replicate extractions were performed per
sample with two injections each.
3
Biomedicine & Pharmacotherapy 125 (2020) 109914
2.8. Haematoxylin and eosin (H&E) examination and
immunohistochemistry
Pancreas, liver, kidney and colon tissues were collected and fixed in
10 % formalin saline for 72 h, dewatered in different concentrations of
alcohol and embedded in paraffin. Samples were sectioned at 5 μm and
stained with haematoxylin and eosin. Pancreas and colon tissues were
placed into an incubator for 2 h at 70 ℃, followed by administration of
dimethylbenzene, different concentrations of ethylalcohol, distilled
water, 3 % hydorgen peroxide and citric acid. Pancreas or colon tissues
were incubated with 5 % BSA at 37 ℃ for 30 min and incubated with
anti-claudin-1 (Abcam, cat# ab15098, 1:50), anti-insulin (Abcam, cat#
ab181547, 1:1000), anti-Bax (Abcam, cat# ab32503, 1:100), anti-Bcl-2
(Abcam, cat# ab196495, 1:50), anti-NF-κB (Abcam, cat# ab16502, 5
μg/mL) (Abcam, Cambridge, MA, USA), anti-mucin-2 (Affinity, cat#
DF8309, 1:50) (Affinity Biotechnology Co., Ltd., Jiangsu, China) at 4 ℃
overnight, followed by incubation with anti-rabbit HRP (Abcam,
Cambridge, MA, USA) at 37 ℃ for 30 min. Samples were treated with a
DAB Elite kit (Beyotime Biotechnology, Shanghai, China) and photo-
graphed using optical microscopy (Olympus IX73, Shanghai, China) at
original magnification 100 ×, 200 × and 400 ×. The quantification of
immunohistochemistry was determined by the Image-pro plus 6.0
analysis. The area of interesting (AOI) was got by selecting the stained
area on the pictures. The integrated optical density (IOD) was mea-
sured, and then followed calculation of the ratio (IOD/AOI). The mean
and standard deviation of each photo of the same experimental group
slice were calculated, and then the relative ratio of proteins was ana-
lyzed by the Statistical Package for Social Sciences (SPSS) 11.5 soft-
ware.
2.9. Quantitative real-time PCR
Colon samples were collected and stored at -80 ℃. Total RNA was
extracted from colon tissues using Trizol reagent (Sangon Co.,
Shanghai, China). The cDNA was synthesised by a First Strand cDNA
Synthesis Kit (Thermo, NY, USA). Total RNA, OligodT (15), 5×reaction
buffer, dNTPs, ribonuclease inhibitor and reverse transcriptase were
successively added into the sterile enzyme-free EP tube. Reverse tran-
scription was performed at 42 ℃ for 60 min and then 70 ℃ for 5 min.
PCR reaction conditions were as follows: 95 ℃ for 5 min for initial
denaturation; 95 ℃ for 10 s and 72 ℃ for 30 s for 40 cycles; and ex-
tension at 65 ℃ for 10 s, followed by dissociation curve analysis.
Purified PCR products were cloned into pMD18-T and sequenced to
verify correct amplification. Each sample was analysed in triplicate.
Data were calculated based on the 2−ΔΔCt method. The mRNA expres-
sion of primers is listed in supplementary materials Table 2.
Table 2
Sequences of primers used in gene expression analysis.
Gene Forward and reverse primers
GPR43 F: CTGGCACAGTTCCTTGATCCTCAC
R: GGCAGCAGCAGCAACAGGAG
GPR41 F: TGCTCATCTTCTTCGTCTGCTTCG
R: GTCGGCTTGGAACTTGGAGGAAG
GCG F: ATTCAT TGCTTGGCTGGTGA
R: CCAGAATGGTGCTCATCTCG
PC1/3 F: ACATGGGGAGAGAATCCTGTAGGCA
R: CATGGCCTTTGAAGGAGTTCCTTGT
Claudin-1 F: CTGTGGATGTCCTGCGTTTC
R: TCATGCACTTCATGCCAATG
Mucin-2 F: CCCAGAAGGGACTGTGTATG
R: TGCAGACACACTGCTCACA
β-actin F: GGTCATCACTATTGGCAACG
R: ACGGATGTCAACGTCACACT
Y. Wang, et al.
2.10. Western blot analysis
Pancreas samples were placed in phosphate buffered saline with
0.25 % collagenase containing Complete Mini Protease Inhibitor
Cocktail (Roche, Mannheim Germany) and lysed on ice using a tissue
homogeniser. Protein was collected by centrifuging at 12,000 g for 8
min at 4 ℃, and quantification was evaluated using the Bradford
method (Bio-Rad Protein Assay). A total of 50 μg of protein per sample
was separated using dodecyl sulfatepolyacrylamide gel electrophoresis
(SDS-PAGE) and transferred onto nitrocellulose membranes (MSI,
Flanders Ma) using a semi-dry transfer method. Membranes were
blocked with 5 % non-fat milk in Tris-buffered saline with Tween
(TBST) for 2 h and incubated with primary anti-bodies in 5 % milk/
TBST at 4 °C overnight, including anti-Bax (Abcam, cat# ab32503,
1:1000), anti-Bcl-2 (Abcam, cat# ab196495, 1:500), anti-Caspase-3
(Abcam, cat# ab13847, 1:500), anti-AKT (Abcam, cat# ab179463,
1:10000), anti-p-AKT (phospho S473) (Abcam, cat# ab81283, 1:5000),
anti-PI3Kinase p85 (anti-PI3K) (Abcam, cat# ab133595, 1:1000), anti-
PI3K (phospho Y607) (Abcam, cat# ab182651, 1:500), anti-interleukin
1β (anti-IL-1β) (Abcam, cat# ab9722, 0.1 μg/mL), anti-tumour necrosis
factor α (TNF-α) (Abcam, cat# ab6671, 1:500), anti-β-actin (Abcam,
cat# ab8227, 1:10,000) (Abcam, Cambridge, MA, USA) and anti-in-
terferon-γ (anti-IFN-γ, cat# BS3486, 1:500) (Bioworld Technology, Inc.,
USA). An enhanced chemiluminescent system (Amersham Pharmacia
Biotech) was applied to detect protein after incubation with horseradish
peroxidase-conjugated antibody for 1 h. The Image J analysis was used
to analyze the grayscale of the gel map and get the results of the gray
value. The ratio of the gray value of target protein against the gray
value of β-actin was the relative expression of protein. The Statistical
Package for Social Sciences (SPSS) 11.5 software was used to analyze
the relative gray value of proteins
2.11. Statistical analysis
The data were analyzed by using SPSS 11.5 software. Values were
presented as the means ± SD deviation. Differences among multiple
groups were compared by one-way analysis of variance (ANOVA).
Significant difference was indicated as p < 0.05 and p < 0.01, respec-
tively.
3. Results
3.1. Probiotics improved FBG, OGTT, AUC, HbA1c and C-peptide levels
Body weight in the D group was significantly increased, but there
was no difference in body weight between the D group and the pro-
biotic groups (P > 0.05) (Fig. 1 A). Compared with the N group, FBG,
OGTT, AUC and HbA1c levels were significantly increased (P < 0.01)
(Fig. 1 B–E), and C-peptide levels were decreased (P < 0.01) (Fig. 1 F)
in the D group. The low dose of composite probiotics decreased FBG
after 4 week and the high dose of composite probiotics decreased FBG
after 3 week compared to the D group (P < 0.05) (Fig. 1 B). There was a
dramatic decline over time in blood glucose levels in the probiotic
groups (Fig. 1 C). Compared with the D group, the AUC of glucose and
HbA1c values were notably diminished (P < 0.01; P < 0.05) (Fig. 1 D
and E), and C-peptide levels were increased in probiotic groups
(P < 0.05) (Fig. 1 F).
3.2. Probiotics modulated TG, TC, LDL-C, HDL-C, 24 h UP levels and
kidney index
Fig. 2 shows the effects of probiotics on blood lipid metabolism and
24 h UP. TG, TC and LDL-C concentrations in the D group were in-
creased compared to the N group (P < 0.01) (Fig. 2 A, B and D). Con-
versely, probiotics strikingly reduced TG, TC and LDL-C concentrations
(P < 0.01; P < 0.05), which were similar to the positive control M and
4
Biomedicine & Pharmacotherapy 125 (2020) 109914
L groups. However, there was no difference in HDL-C between the D
group and probiotic groups (P > 0.05) (Fig. 2C). Compared with the N
group, the kidney index and 24 h UP levels in the D group were sig-
nificantly upregulated (P < 0.01) (Fig. 2E and F). Probiotics sig-
nificantly decreased 24 h UP concentrations (P < 0.01; P < 0.05)
compared to the D group. However, there was no difference in the
kidney index between the D and probiotic groups (P > 0.05).
3.3. Effects of probiotics on histological changes in the pancreas, liver, and
kidney
As shown in Fig. 3 A, pancreatic histology in the N group was
normal, with orderly arrangement of pancreatic islet cells and distinct
edges of islets and outer tissues. However, pancreatic histology in the D
group showed significant damage, with histomorphological features
including unclear edges of the islets and outer tissues, atrophy of the
islets with inflammatory cell infiltration, and irregularly arranged
pancreatic islet cells. Compared with the D group, both the positive and
probiotic groups showed significant restoration of the pancreas archi-
tecture, such as reduced inflammatory cell infiltration. Liver histology
is shown in Fig. 3 B. Compared with the N group, abnormal histological
structures in the liver from the D group showed massive diffuse lipid
macrovesicles occupying most of the hepatocyte cytoplasm. Probiotics
significantly inhibited the formation of hepatic steatosis by reducing
lipid vesicles both in size and number. Renal histopathology results
were shown in Fig. 3 C. Renal histology in the D group showed ex-
cessive atrophy and fragmentation of the glomeruli, epithelial desqua-
mation and degeneration. Probiotics significantly reversed abnormal
renal histopathological changes. Overall, probiotics remarkably im-
proved histological changes in the pancreas, liver and kidney.
3.4. Probiotics augmented SCFA-producing bacteria and SCFAs levels
As shown in Fig. 4, Lactic acid bacteria, Bifidobacterium, Clostridium
leptum, Roseburia and Prevotella levels were downregulated (P < 0.01)
(Fig. 4 A–D and F), and Escherichia coli levels in the D group were
significantly upregulated compared to the N group (P < 0.01) (Fig. 4
G). Conversely, probiotics decreased the number of Escherichia coli and
increased the number of SCFA-producing bacteria, including Lactic acid
bacteria, Bifidobacterium, Clostridium leptum and Roseburia (P < 0.01),
which was similar to the positive control groups. In addition, there was
no significant difference in the concentration of Fusobacterium (Fig. 4
E), Prevotella (Fig. 4 F) and total bacteria (Fig. 4 H) between the D and
probiotic groups (P > 0.05). SCFAs levels in different groups were ob-
viously different. Compared with the N group, the levels of acetic acid,
propionic acid and butyric acid were significantly decreased in the D
group (Fig. 4 I–K) (P < 0.01). Probiotics remarkably increased the
concentration of propionic acid and butyric acid compared with the D
group (P < 0.01) (Fig. 4 J and K). Interestingly, acetic acid levels in
both the positive and probiotic groups were significantly decreased
compared to the D group (P < 0.01) (Fig. 4 I).
3.5. Effects of probiotics on total GLP-1 and insulin level in plasma
To determine whether the composite probiotics can stimulate GLP-1
secretion and promote insulin production. We evaluated the total GLP-1
and insulin levels of the plasma in different time after glucose feeding.
Fig. 5 A and B showed that the changes in total GLP-1 and insulin levels
in plasma from 0 min to 45 min after oral glucose load. The total GLP-1
levels in the D groups were higher than that in the N group, but there
was no significant difference between the D group and the N group
(P > 0.05) (Fig. 5 A). The total GLP-1 levels in the probiotic groups
were significantly increased at 15 min compared to the D group
(P < 0.05), but not 30 min and 45 min. The insulin levels in the D
groups were higher than that in the N group (P < 0.05) (Fig. 5 B). The
insulin levels in the high-dose of probiotic group were increased at 30
Y. Wang, et al. Biomedicine & Pharmacotherapy 125 (2020) 109914

Fig. 1. Effects of the composite probiotics on body weight, FBG, OGTT, AUC, HbA1c and C-peptide. (A) The body weights of mice were recorded three times a week
from 0 week to 6 week (n = 10). (B, C)The levels of FBG (n = 7) and OGTT (n = 6) were detected by the glucometer. (D) Based on the OGTT result, the AUC was
performed (n = 6). (E, F) The levels of HbA1c and C-peptide were detected by ELISA kits (n = 6). Data are presented as mean ± SD values. ## P < 0.01 vs normal
group; * P < 0.05, ** P < 0.01 vs model group. Abbreviations: FBG, Fasting blood glucose; OGTT, Oral glucose tolerance; AUC, Area under the curve.

min and 45 min compared to the D group (P < 0.05), but not 15 min.
The insulin levels in the low-dose of probiotic group were increased at
30 min compared to the D group (P < 0.05), but not 15 min and 45 min
(Fig. 5 B). These results showed that the composite probiotics enhanced
insulin secretion through glucose-triggered GLP-1 secretion. Ad-
ditionally, mRNA expression of the G protein-coupled receptor 41
(GPR41), GPR43, proglucagon (GCG) and proconvertase 1/3 (PC1/3) in
the D group was significantly decreased compared to the N group
(P < 0.01) (Fig. 5C–F). Conversely, probiotics significantly increased
mRNA expression of GPR41, GPR43, GCG and PC1/3 compared to the D
group (P < 0.01; P < 0.05).
3.6. Probiotics improved intestinal mucosal barrier function
Colon histology showed a large number of goblet cells in the crypt of
the mucous layer, and there was no infiltration of inflammatory cells in
the laminae propria in the N group (Fig. 6 A and B). Conversely, colon
histological structures in the D group were crumbled, and the mucous
layer and laminae propria were infiltrated by massive inflammatory
cells, and the goblet cells of the crypt were reduced compared to the N
group. Probiotics significantly inhibited the infiltration of inflammatory
cells and restored the number of goblet cells. The mRNA expression of
claudin-1 and mucin-2 in the D group were significantly decreased
compared to the N group (P < 0.01; P < 0.05) (Fig. 6 E and F).

Fig. 2. Effects of the composite probiotics on TG, TC, LDL-C, HDL-C, kidney index and 24 h UP. (A–D) The levels of TG, TC, LDL-C and HDL-C in the serum were
determined by ELISA kits (n = 6). The Kidney index and the 24 h UP level were detected by an automatic clinical analyzer (n = 8). Data are presented as mean ± SD
values. ## P < 0.01 vs normal group; * P < 0.05, ** P < 0.01 vs model group. Abbreviations: TC, Total cholesterol; TG, Triglyceride; LDL-C, Low density lipoprotein
cholesterol; HDL-C, High density lipoprotein cholesterol; UP, Urine protein.

5
Y. Wang, et al. Biomedicine & Pharmacotherapy 125 (2020) 109914

Fig. 3. Effects of the composite probiotics on pancreas, liver and kidney histology. (A, B, C) Hematoxylin-eosin (HE) stained pancreatic (original magnification 200
×), hepatic (original magnification 200 ×) and renal microsections (original magnification 400 ×) (n = 4 images/group).

Compared with the D group, probiotics increased mRNA expression of
claudin-1 and mucin-2 (P < 0.01). The immunohistochemistry (IHC-P)
results of claudin-1 and mucin-2 were consistent with mRNA analysis
data (Fig. 6C and D). As showed in the Fig. 6 G and H, The LPS levels of
feces and serum in the D group were higher than that in the N group
(P > 0.01) while probiotics significantly decreased the LPS levels in the
feces and serum compared to the D group (P < 0.05; P < 0.01).
immunohistochemical analysis. As shown in Fig. 7, insulin and Bcl-2
protein expression was decreased, and Bax and NF-κB protein expres-
sion was increased in the D group compared to the N group (P < 0.01).
Probiotics significantly increased insulin and Bcl-2 protein expression
(P < 0.01), and decreased Bax and NF-κB protein expression (P < 0.01)
compared to the D group (P < 0.01).

3.8. Probiotics modulated the PI3K/AKT pathways

3.7. Probiotics upregulated insulin secretion by inhibiting apoptosis in the
pancreas
Because insulin is a valuable hormone in regulating blood glyco-
metabolism, we measured insulin secretion function in the pancreas by
Compared with the N group, Caspase-3, Bax, TNF-α, IL-1β and IFN-γ
protein expression was obviously increased (P < 0.01), and Bcl-2 pro-
tein levels were inhibited in the D group (Fig. 8 A). Probiotics sig-
nificantly increased Bcl-2 protein levels and decreased Caspase-3, Bax,

Fig. 4. Effects of the composite probiotics on intestinal microbiota and SCFAs. (A–H)The levels of Lactic acid bacteria, Bifidobacterium, Clostridium leptum, Roseburia,
Fusobacterium, Prevotella, Escherichia coli and Total bacteria in the feces were determined by qRT-PCR (n = 6). (I–K) The levels of acetic acid, propionic acid and
butyric acid in the feces were determined by the gas-phase flask (n = 8). Data are presented as mean ± SD values. ## P < 0.01 vs normal group; * P < 0.05, **
P < 0.01 vs model group.

6
Y. Wang, et al. Biomedicine & Pharmacotherapy 125 (2020) 109914

Fig. 5. The composite probiotics enhanced insulin secretion through glucose-triggered GLP-1 secretion. (A, B) The total GLP-1 and insulin levels in the plasma were
determined by ELISA kits (n = 5). (C–F) The mRNA levels of GPR43, GPR41, GCG and PC1/3 in the colon tissue were determined by qRT-PCR (n = 5). Data are
presented as mean ± SD values. # P < 0.05, ## P < 0.01 vs normal group; * P < 0.05, ** P < 0.01 vs model group. Abbreviations: GLP-1, Glucagon-like peptide-1;
GCG, Proglucagon; PC1/3, Proconvertase 1/3; GPR43/41, G protein-coupled receptor 43/41.

Fig. 6. The composite probiotics improved intestinal mucosal barrier function. (A, B) The colon histology in HE staining (original magnification 100 × and 200 ×)
(n = 4 images/group). (C, D) The claudin-1 (original magnification 200 ×) and mucin-2 (original magnification 400 ×) protein expression of the colon tissue in
immunohistochemistry staining (n = 4 images/group). (E, F) The mRNA levels of claudin-1 and mucin-2 in the colon tissue were determined by qRT-PCR (n = 5).
(G, H) The levels of LPS in the faeces and serum were determined by ELISA kits (n = 6). Mean integral optical density values of claudin-1 and mucin-2 were analyzed
by Image-Pro Plus 6.0. Data are presented as mean ± SD values. ## P < 0.01 vs normal group; * P < 0.05, ** P < 0.01 vs model group.

TNF-α, IL-1β and IFN-γ protein levels compared to the D group
(P < 0.01). The PI3K/AKT signalling pathway plays an important role
in regulating insulin secretion in the pancreas. As shown in Fig. 8B,
protein expression of p-PI3K/t-p-PI3K and p-AKT/t-AKT in the D group
was significantly decreased compared to the N group (P < 0.01;
P < 0.05). Compared with the D group, probiotics significantly upre-
gulated p-PI3K/t-p-PI3K and p-AKT/t-AKT protein levels (P < 0.01).
4. Discussion
Probiotics have many functions, including anti-oxidation, anti-
cancer, anti-inflammation, and improved metabolism and im-
munological function [28,25,26]. An increasing number of studies have
shown that probiotics have enormous potential in treating metabolic
diseases, such as diabetes and obesity [27,28]. Hsieh et al. reported that
Lactobacillus reuteri GMNL-263 improved insulin resistance by reg-
ulating T2D-related parameters in high fructose-fed rats, such as

7
Y. Wang, et al. Biomedicine & Pharmacotherapy 125 (2020) 109914

Fig. 7. Effects of the composite probiotics on the protein expression of insulin, Bax, Bcl-2 and NF-κB in the pancreas. (A–D) The protein levels of the insulin (original
magnification 200 ×), Bax (original magnification 400 ×), Bcl-2 (original magnification 400 ×) and NF-κB (original magnification 200 ×) in im-
munohistochemistry staining (n = 4 images/group). Mean integral optical density values of insulin, Bax, Bcl-2 and NF-κB were analyzed by Image-Pro Plus 6.0. Data
are presented as mean ± SD values. ## P < 0.01 vs normal group; ** P < 0.01 vs model group.

OGTTs, glycated haemoglobin and insulin [29]. In a similar study,
Balakumar et al. showed that a combination of Lactobacillus plantarum
and Lactobacillus fermentum improved insulin sensitivity and OGTTs in
C57BL/6 J mice fed a high fat diet [30]. The leptin receptor mutation of
the 4 chromosome in the C57BL/Ks strain mice causes obesity, hy-
perglycemia and islet resistant, which is very similar to the pathogen-
esis of human T2D [31,32]. Therefore, we used the C57BL/Ks mice as
the normal group and the db/db mice as the diabetic mice for exploring
the possible anti-diabetic mechanisms of 14 probiotics. Our results
showed that oral administration of 14 composite probiotics sig-
nificantly improved blood glucose and blood lipid related parameters,
including FBG, OGTT, HbA1c, C-peptide, TG, TC and LDL-C (Figs. 1 and
2).
The representative characteristics of intestinal microbiota in T2D
patients include a decrease in the number of SCFA-producing bacteria
and an increase in harmful bacteria. Okouchi et al. found that the levels
of Clostridiaceae, Bifidobacterium, Lactobacillus and Escherichia in the
normal diet mice were higher than other bacterial [33]. Some studies in

Fig. 8. The composite probiotics protected pancreas against apoptosis by upregulation PI3K/AKT. (A) The protein levels of Caspase-3, Bax, Bcl-2, TNF-α, IFN-γ and
IL-1β were detected by the Wester-blot (n = 5). (B) The protein levels of p-PI3K/t-PI3K and p-AKT/t-AKT were detected by the Wester-blot (n = 5). The gel map and
the gray value were analyzed by Image J. Data are presented as mean ± SD values. # P < 0.05, ## P < 0.01 vs normal group; * P < 0.05, ** P < 0.01 vs model group.
Abbreviations: TNF-α, Tumor necrosis factor α; IFN-γ, Interferon-γ; IL-1β, Interleukin-1β; PI3K/AKT, Phosphatidylinositol 3ʹ-kinase/protein kinase B; Bcl-2, B-cell
lymphoma 2; Bax, Bcl-2-associated X protein.

8
Y. Wang, et al.
human reported that Prevotella, Roseburia, Eubacterium halii, Bacteroides
fragilis and Faecalibacterium prauznitzii concentrations were decreased
and that Lactobacillus gasseri, Streptococcus mutans and Escherichia coli
were increased in T2D patients [34,35]. Several animal studies have
shown that the number of Lactobacillus, Bifidobacterium, Clostridium
leptum, Bacteroides and Prevotella was significantly decreased in a T2D
rat model induced by a high fat diet and streptozotocin injection
[35,36]. Previous studies have shown that probiotics remarkably in-
creased the levels of these SCFA-producing bacteria and decreased the
levels of Escherichia [26]. The SCFA-producing bacteria benefit to the
host by inhibiting the level of harmful bacterial through struggling for
the limited nutrients and living space, preventing the pathogen invasion
from mucosa and mitigating inflammation [37]. In the study, 14 pro-
biotics significantly decreased Escherichia coli levels and increased the
number of SCFA-producing bacteria in db/db mice (Fig. 4). In fact,
changes in intestinal microbiota are strikingly different in different
individuals due to diversified influential factors, including genetics,
diet, species and more [38]. Another reason for differences in intestinal
microbiota is that research subjects may be different and studies are
typically performed under various experimental conditions [39].
SCFAs play an important role in postponing T2D progression by
imprving the function of the intestinal mucosa barrier. SCFAs can
supply energy for enterocytes and reduce production of toxic substances
and inflammation by inhibiting the growth of harmful bacteria [40].
Additionally, SCFAs can repaire and improve the function of intestinal
mucosa barrier by pormoting the synthesis of intestinal mucosin and
mucus secretion of intestinal epithelial cells, inhibting the pro-in-
flammatory factors secretion, increasing anti-inflammatory IL-10 pro-
duction and activing Treg cell activity [41,42]. Some studies reported
that SCFAs induced by Lactobacillus strengthened the function of the
intestinal mucosa barrier by upregulating tight junction protein ex-
pression and inhibiting lipopolysaccharide (LPS) or endotoxin infiltra-
tion, thus upregulating insulin sensitivity [43]. It is reported that LPS
mainly from the Gram-negative bacteria (Escherichia coli) can enter the
bloodstream through the leaky gut, then inducing the insulin-intensive
organs (pancreas, liver and kidney) inflammation [36,44]. Thus the
serum LPS levels can indirectly reflect the intestinal permeability. These
reports are consistent with our results in that probiotics improved the
gut barrier fuction by increasing SCFAs levels, upregulating claudin-1
and mucin-2 expression and downregulating LPS levels (Figs. 4 and 6).
In the intestine, GPR43 and GPR41 benefit to regulate the nenegy
homeostasis by affecting the incretion hormones secretion and nutrients
absorption. It is reported that the SCFAs can active the G protein-cou-
pled receptors (GPR43/41) expressed by L cells in the colon [45,46].
GPR43 and GPR41 were SCFA receptors that respectively comple with
Gq- or Gi/o family G proteins and Gi-family G proteins [47]. Acetate,
propionate and butyrate are important metabolic production of in-
testinal microbiota. GPR41 is sensitive to propionate and butyrate while
GPR43 is more sensitive to acetate and propionate than to butyrate
[48]. Some studies have reported that these SCFA-producing bacteria
(mainly Lactobacillus and Bifidobacterium) can promote the GLP-1 se-
cretion by upregulating GPR43/41 activity in the intestine, followed by
GLP-1-induced insulin secretion, which effectively adjusts and controls
blood glucose metabolism [49,50]. In the study, we found that the
number of these SCFA-producing bacteria was increased by the com-
posite probiotics. Additionally, levels of propionic acid and butyric acid
were significantly increased in the composite probiotic groups as well
as the upregulation activity of GPR43 and GPR41. These results in-
dicated that 14 probiotics promoted GLP-1 secretion might be depen-
dent on the upregultaion of GPR43/41 activity. In addition, GLP-1 can
be produced by the pathway in which proglucagon (GCG) is cleaved by
the enzyme proconvertase 1/3 (PC1/3). Rohden et al. found that lower
PC1/3 gene expression can attenuate bioactivation of pro-glucose de-
pendent insulinotropic peptide and proglucagon in T2D patients [51].
Liu et al. found that the CGC mRNA level of intestine tissue in STZ-
induced ICR diabetic mice was lower than the normal group. However,
9
Biomedicine & Pharmacotherapy 125 (2020) 109914
the GCG mRNA level of intestine tissue in the leptin-resistant 2 diabetic
model mice (db/db mice) was higher than the normal group (C57BL/
KsJ mice) [52]. Lu et al. have a similar report that the GCG mRNA level
of the ileum in the STZ-induced diabetic rat (Sprague-Dawley rat) was
higher than the normal group, but there was no difference [53]. Mor-
imoto et al. reported that there is no difference in the GCG mRNA levels
of the terminal ileum between the C57BL/6 J mice receiving high-fat
diet and the C57BL/6 J mice receiving the normal diet [54]. Our resluts
showed that the GCG and PC1/3 mRNA levels were significantly de-
creased in the D group compared to the N group while probiotics in-
creased GCG and PC1/3 mRNA levels. The changes in the GCG mRNA
expression are strikingly different might due to diversified influential
factors, including the pathophysiological characteristics of animal
model, the examination of tissue location, feeding time and various
experimental conditions.
The pancreas is an important organ in regulating glycometabolism
because it is the only tissue that secretes insulin. High expression of
tumour necrosis factor-α (TNF-α), interleukin-1β, and interferon-γ in-
duced β-cell apoptosis and dysfunction [55]. β-cell apoptosis in strep-
tozocin-induced diabetic rats was inhibited by inactivating NF-κB ac-
tivity, which improved β-cell function and morphology [56].
Accumulating evidence has demonstrated that the PI3K/AKT cascade is
essential for ameliorating insulin sensitivity and protecting β-cells
against apoptosis by regulating the expression of Bcl-2 and Bax [57].
Cheng et al. found that LY294002, a PI3K/AKT inhibitor, obviously
reduced anti-apoptotic effects on Min6 cells by blocking PI3K/AKT
activation [58]. These reports are consistent with the results of the
present study, 14 probiotics significantly reduced protein expression of
inflammatory factors TNF-α, IL-1β and IFN-γ, inhibited pro-apoptotic
protein expression (Bax and caspase-3) and increased anti-apoptotic
Bcl-2, PI3K/AKT protein expression (Fig. 8), suggesting that 14 pro-
biotics might improve β-cell function and protect β-cells against
apoptosis by upregulating PI3K/AKT activation. Notably, Hansen et al.
found that prebiotics could portect against autoimmune destruction of
β cells by regulating T cell activity and improving the gut barrier fuc-
tion in NOD mice with autoimmune diabetes, but not the regulation of
glucose-insulin and the production of GLP-1 and SCFAs [59]. Dolpady
et al. had a simlilar study that Lactobacillaceae-enriched probiotic
VSL#3 could alleviate T1D by modulating the microbiota composition
and Teff/Treg cell balance and restoring gut immunue homeostasis
[60]. These studies suggest that probiotics and prebiotics might have
differences in improvement of GLP-1 secretion depened on different
signal pathways, which might be related with the development and
pathophysiological processes of T1D and T2D [61].
The study may aid the understanding of the mechanisms underling
14 probiotics treatment for T2D. However, there are still many ob-
stacles in the clinical applications of probiotics in T2D therapy. First,
there are differences in the stability and environment of gut microbiota
due to the species and individual differences between rodents and hu-
mans [62]. Second, the appropriate dosages and the colonization sta-
bility of these probiotics in human intestinal tract are not clear. Third,
there are multifarious metabolites produced by the host’ microbiota are
involved in the regulation of metabolic pathways, immune-in-
flammatory pathways and so on [63]. These intricate regulatory me-
chanisms are not entirely clear. Dispite theses challenges, It's still worth
trying to unlock the secrets of probiotics to host, which has important
therapeutic potential for metabolic diseases and other disease.
5. Conclusion
These probiotics effectively improved blood glucose and blood lipid
parameters so as to delay the development of T2D. Probiotics improved
the gut barrier function through increasing the levels of SCFA-produ-
cing bacteria and SCFAs as well as the expression of cluaudin-1 and
mucin-2, and decreasing Escherichia coli and LPS levels. Probiotics sig-
nificantly promoted GLP-1 secretion by upregulating the activities of
Y. Wang, et al.
GPR43/41, GCG and PC1/3. Furthermore, probiotics improved pan-
creatic function and inhibited apoptosis in the pancreas by upregulating
PI3K/AKT activation. These results indicated that 14 composite pro-
biotics might be considered to be a potential treatment option for
treating patients with T2D.
Declaration of Competing Interest
No competing interests are associated with study.
Acknowledgments
This project was supported by the funds from University Scientific
Research Plan of Xinjiang Uygur Autonomous Region, China
(XJEDU2020I012) and Graduate Innovation and Entrepreneurship
Project of Xinjiang Uygur Autonomous Region, China (XJ2019G177).
References
[1] R. Tojo, A. Suárez, M.G. Clemente, et al., Intestinal microbiota in health and dis-
ease: role of bifidobacteria in gut homeostasis, World J. Gastroenterol. 20 (2014)
15163–15176.
[2] J.E. Shaw, R.A. Sicree, P.Z. Zimmet, Global estimates of the prevalence of diabetes
for 2010 and 2030, Diabetes Res. Clin. Pract. 87 (2010) 4–14.
[3] Y.S. Lee, H.S. Jun, Anti-diabetic actions of glucagon-like peptide-1 on pancreatic
beta-cells, Metabolism 63 (2014) 9–19.
[4] T.D. Müller, C. Clemmensen, B. Finan, et al., Glucagon-like peptide 1 (GLP-1),
Pharmacol. Rev. 70 (2018) 712–746.
[5] K. Timper, E. Dalmas, E. Dror, et al., Glucose-dependent insulinotropic peptide
stimulates glucagon-like peptide 1 production by pancreatic islets via interleukin 6,
produced by a cells, Gastroenterology 151 (2016) 165–179.
[6] L. Wang, P. Li, Z. Tang, et al., Structural modulation of the gut microbiota and the
relationship with body weight: compared evaluation of liraglutide and saxagliptin
treatment, Sci. Rep. 6 (2016) 33251.
[7] J. Zhang, H. Su, Q. Li, et al., Oral administration of Clostridium butyricum
CGMCC0313-1 inhibits beta-lactoglobulin-induced intestinal anaphylaxis in a
mouse model of food allergy, Gut Pathog. 9 (2017) 11.
[8] F. Hendijani, V. Akbari, Probiotic supplementation for management of cardiovas-
cular risk factors in adults with type II diabetes: a systematic review and meta-
analysis, Clin. Nutr. 37 (2018) 532–541.
[9] J. Qin, Y. Li, Z. Cai, et al., A metagenome-wide association study of gut microbiota
in type 2 diabetes, Nature 490 (2012) 55–60.
[10] J.F. Garcia-Mazcorro, N.N. Lage, S. Mertens-Talcott, et al., Effect of dark sweet
cherry powder consumption on the gut microbiota, short-chain fatty acids, and
biomarkers of gut health in obese db/db mice, Peer J. 6 (2018) e4195.
[11] L. Wang, Y. Tao, Z. Xie, et al., The metabolic syndrome in Uygur and Kazak po-
pulations/Prevalence of metabolic syndrome, insulin resistance, impaired fasting
blood glucose,and dyslipidemia in Uygur and Kazak populations, J. Clin. Hypertens.
Greenwich (Greenwich) 12 (2010) 741–745.
[12] N. Li, H. Wang, Z. Yan, et al., Ethnic disparities in the clustering of risk factors for
cardiovascular disease among the Kazakh, Uygur, Mongolian and Han populations
of Xinjiang: a cross-sectional study, BMC Public Health 12 (2012) 499.
[13] W.L. Yan, X.S. Li, Q. Wang, et al., Overweight, high blood pressure and impaired
fasting glucose in Uyghur, Han, and Kazakh Chinese children and adolescents, Ethn.
Health 20 (2015) 365–375.
[14] T. Manaer, L. Yu, Y. Zhang, et al., Anti-diabetic effects of shubat in type 2 diabetic
rats induced by combination of high-glucose-fat diet and low-dose streptozotocin, J.
Ethnopharmacol. 169 (2015) 269–274.
[15] R.A. Bagarolli, N. Tobar, A.G. Oliveira, et al., Probiotics modulate gut microbiota
and improve insulin sensitivity in DIO mice, J. Nutr. Biochem. 50 (2017) 16–25.
[16] D. Dinareer, L. Lu, S. Jialehasibieke, et al., Probiotic characteristics of the lactic acid
bacteria and yeasts in Xinjiang-traditional fermented dairy products, China
Microecology J. 30 (2018) 5-9+13.
[17] S. Jialehasibieke, S. Xin, J. Amanguli, et al., Probiotic characteristics of probiotics in
Xinjiang traditional fermented dairy products, China Microecology J. 31 (2019)
502–508.
[18] H.A. Lee, H. Kim, W.K. Lee, et al., Dead Lactobacillus plantarum stimulates and
skews immune responses toward t helper 1 and 17 polarizations in RAW 264.7 cells
and mouse splenocytes, J. Microbiol. Biotechnol. 26 (2016) 469–476.
[19] L.S. Dalbøge, D.L. Almholt, T.S. Neerup, et al., Characterisation of age-dependent
beta cell dynamics in the male db/db mice, PLoS One 8 (2013) e82813.
[20] K.H. Kim, I.S. Lee, J.Y. Park, et al., Cucurbitacin B induces hypoglycemic effect in
diabetic mice by regulation of AMP-Activated protein kinase alpha and glucagon-
like Peptide-1 via bitter t aste receptor signaling, Front. Pharmacol. 9 (2018) 1071.
[21] P. Chen, L. Li, X. Xu, et al., Liraglutide improved inflammation via mediating IL-23/
Th-17 pathway in obese diabetic mice with psoriasiform skin, J. Dermatolog. Treat.
23 (2019) 1–21.
[22] S.E. Jang, M.J. Han, S.Y. Kim, et al., Lactobacillus plantarum CLP-0611 ameliorates
colitis in mice by polarizing M1 to M2-like macrophages, Int. Immunopharmacol.
21 (2014) 186–192.
10
Biomedicine & Pharmacotherapy 125 (2020) 109914
[23] M. Le Barz, F.F. Anhê, T.V. Varin, et al., Probiotics as complementary treatment for
metabolic disorders, Diabetes Metab. J. 39 (2015) 291–303.
[24] L.L. Wang, H.H. Guo, S. Huang, et al., Comprehensive evaluation of SCFA pro-
duction in the intestinal bacteria regulated by berberine using gas-chromatography
combined with polymerase chain reaction, J. Chromatogr. B Analyt. Technol.
Biomed. Life Sci. 2015 (2017) 70–80.
[25] J.Y. Yoo, S.S. Kim, Probiotics and prebiotics: present status and future perspectives
on metabolic disorders, Nutrients 8 (2016) 173.
[26] S. Singh, R.K. Sharma, S. Malhotra, et al., Lactobacillus rhamnosus NCDC17 ame-
liorates type-2 diabetes by improving gut function, oxidative stress and in-
flammation in high-fat-diet fed and streptozotocintreated rats, Benef. Microbes 8
(2017) 243–255.
[27] M.C. Mekkes, T.C. Weenen, R.J. Brummer, et al., The development of probiotic
treatment in obesity: a review, Benef. Microbes 5 (2014) 19–28.
[28] A.N. Payne, C. Chassard, M. Zimmermann, et al., The metabolic activity of gut
microbiota in obese children is increased compared with normal-weight children
and exhibits more exhaustive substrate utilization, Nutr. Diabetes 18 (2011) e12.
[29] F.C. Hsieh, C.L. Lee, C.Y. Chai, et al., Oral administration of Lactobacillus reuteri
GMNL-263 improves insulin resistance and ameliorates hepatic steatosis in high
fructose-fed rats, Nutr. Metab (Lond). 10 (2013) 35.
[30] M. Balakumar, D. Prabhu, C. Sathishkumar, et al., Improvement in glucose toler-
ance and insulin sensitivity by probiotic strains of Indian gut origin in high-fat diet-
fed C57BL/6J mice, Eur. J. Nutr. 57 (2018) 279–295.
[31] M.S. Islam, Animal models of diabetic neuropathy: progress since 1960s, J. Diabetes
Res. 2013 (2013) 149452.
[32] K.P. Hummel, M.M. Dickie, D.L. Coleman, Diabetes, a new mutation in the mouse,
Science 153 (1966) 1127–1128.
[33] R. Okouchi, S.E. Yamamoto K.et al., Simultaneous intake of Euglena gracilis and
vegetables exerts synergistic anti-obesity and anti-inflammatory effects by mod-
ulating the gut microbiota in diet-induced obese mice, Nutrients 11 (2019).
[34] M. Sedighi, S. Razavi, F. Navab-Moghadam, et al., Comparison of gut microbiota in
adult patients with type 2 diabetes and healthy individuals, Microb. Pathog. 111
(2017) 362–369.
[35] A. Muñoz-Garach, C. Diaz-Perdigones, F.J. Tinahones, Gut microbiota and type 2
diabetes mellitus, Endocrinol. Nutr. 63 (2016) 560–568.
[36] K.K. Li, P.J. Tian, S.D. Wang, et al., Targeting gut microbiota: lactobacillus alle-
viated type 2 diabetes via inhibiting LPS secretion and activating GPR43 pathway,
J. Funct. Foods 38 (2017) 561–570.
[37] K.M. Maslowski, A.T. Vieira, A. Ng, et al., Regulation of inflammatory responses by
gut microbiota and chemoattractant receptor GPR43, Nature 461 (2009)
1282–1286.
[38] M. Rastelli, C. Knauf, P.D. Cani, Gut Microbes and Health: A Focus on the
Mechanisms Linking Microbes, Obesity, and Related Disorders, Obesity Silver
Spring (Silver Spring) 26 (2018) 792–800.
[39] J. Miyamoto, K. Watanabe, S. Taira, et al., Barley beta-glucan improves metabolic
condition via short-chain fatty acids produced by gut microbial fermentation in
high fat diet fed mice, PLoS One 13 (2018) e0196579.
[40] Q. Zhang, X. Xiao, M. Li, et al., Vildagliptin increases butyrate-producing bacteria in
the gut of diabetic rats, PLoS One 12 (2017) e0184735.
[41] W. Miao, X. Wu, K. Wang, et al., Sodium butyrate protes reassembly of tight
junctions in Caco-2 monolayers InvolvingInhibition of MLCK/MLC2 pathway and
phosphorylation of PKCβ2, Int. J. Mol. Sci. 17 (2016).
[42] B. Shen, J. Hu, H. Song, et al., Antibiotics exacerbated colitis by affecting the mi-
crobiota, Treg cells and SCFAs in IL10-deficient mice, Biomed. Pharmacother. 114
(2019) 108849.
[43] S. Seo, J.S. Shin, W.S. Lee, et al., Anti-colitis effect of Lactobacillus sakei K040706
via suppression of inflammatory responses in the dextran sulfate sodium-induced
colitis mice model, J. Funct. Foods 29 (2017) 256–268.
[44] J. Xu, R. Liang, W. Zhang, et al., Faecalibacterium prausnitzii-derived microbial
anti-inflammatory molecule regulates intestinal integrity in diabetes mellitus mice
via modulating tight junction protein expression, J. Diabetes (2019).
[45] W. Wang, L. Chen, R. Zhou, et al., Increased proportions of Bifidobacterium and the
Lactobacillus group and loss of butyrate-producing bacteria in inflammatory bowel
disease, J. Clin. Microbiol. 52 (2014) 398–406.
[46] B.S. Samuel, A. Shaito, T. Motoike, et al., Effects of the gut microbiota on host
adiposity are modulated by the short-chain fatty-acid binding G protein-coupled
receptor, Gpr41, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 16767–16772.
[47] I. Kimura, A. Ichimura, R. Ohue-kitano, et al., Free fatty acid receptors in health and
disease, Physiol. Rev. 100 (2020) 171–210.
[48] J. Miyamoto, R. Ohue-Kitano, H. Mukouyama, et al., Ketone body receptor GPR43
regulates lipid metabolism under ketogenic conditions, Proc. Natl. Acad. Sci. U. S.
A. 116 (2019) 23813–23821.
[49] R. Aoki, K. Kamikado, W. Suda, et al., A proliferative probiotic Bifidobacterium
strain in the gut ameliorates progression of metabolic disorders via microbiota
modulation and acetate elevation, Sci. Rep. 7 (2017) 43522.
[50] Y. Liang, S. Liang, Y. Zhang, et al., Oral administration of compound probiotics
ameliorates HFD-Induced gut microbe dysbiosis and chronic metabolic inflamma-
tion via the g protein-coupled receptor 43 in non-alcoholic fatty liver disease rats,
probiotics antimicrob, Proteins 11 (2019) 175–185.
[51] F. Rohden, C.S. Costa, T.O. Hammes, et al., Obesity associated with type 2 diabetes
mellitus is linked to decreased PC1/3 mRNA expression in the Jejunum, Obes. Surg.
24 (2014) 2075–2081.
[52] Y.X. Liu, M.M. Si, W. Lu, et al., Effects and molecular mechanisms of the anti-
diabetic fraction of Acorus calamus L. On GLP-1 expression and secretion in vivo
and in vitro, J. Ethnopharmacol. 166 (2015) 168–175.
[53] S.S. Lu, Y.L. Yu, H.J. Zhu, et al., Berberine promotes glucagon-like peptide-1 (7–36)
Y. Wang, et al.
amide secretion in streptozotocin-induced diabetic rats, J. Endocrinol. 200 (2009)
159–165.
[54] K. Morimoto, M. Watanabe, T. Sugizaki, et al., Intestinal bile acid composition
modulates prohormone convertase 1/3 (PC1/3) expression and consequent GLP-1
production in male mice, Endocrinology 157 (2016) 1071–1081.
[55] W. You, K. Wang, C. Yu, et al., Baicalin prevents tumor necrosis factor-alpha-in-
duced apoptosis and dysfunction of pancreatic beta-cell line Min6 via upregulation
of miR-205, J. Cell. Biochem. 119 (2018) 8547–8554.
[56] V. Kondylis, S. Kumari, K. Vlantis, et al., The interplay of IKK, NF-kappaB and
RIPK1 signaling in the regulation of cell death, tissue homeostasis and inflamma-
tion, Immunol. Rev. 227 (2017) 113–127.
[57] T.L. Jetton, J. Lausier, K. LaRock, et al., Mechanisms of compensatory beta-cell
growth in insulin-resistant rats: roles of Akt kinase, Diabetes 54 (2005) 2294–2304.
[58] Q. Cheng, W. Dong, L. Qian, et al., Visfatin inhibits apoptosis of pancreatic beta-cell
line, MIN6, via the mitogen-activated protein kinase/phosphoinositide 3-kinase
pathway, J. Mol. Endocrinol. 47 (2011) 13–21.
11
Biomedicine & Pharmacotherapy 125 (2020) 109914
[59] C.H.F. Hansen, D.S. Larsen, H.O. Petersson, et al., Targeting gut microbiota and
barrier function with prebiotics to alleviate autoimmune manifestations in NOD
mice, Diabetologia 62 (2019) 1689–1700.
[60] J. Dolpady, C. Sorini, C. Di Pietro, et al., Oral probiotic VSL#3 prevents auto-
immune diabetes by modulating microbiota and promoting indoleamine 2,3-
Dioxygenase-Enriched tolerogenic intestinal environment, J. Diabetes Res. 2016
(2016) 7569431.
[61] T.J. O’Malley, G.E. Fava, Y. Zhang, et al., Progressive change of intra-islet GLP-1
production during diabetes development, Diabetes Metab. Res. Rev. 30 (2014)
661–668.
[62] M.E. Sanders, D.J. Mernstein, G. Reid, et al., Probiotics and prebiotics in intestinal
health and disease: from biology to the clinic, Nat. Rev. Gastroenterol. Hepatol. 16
(2019) 605–616.
[63] D. Kothari, S. Patel, S.K. Kim, Probiotic supplements might not be universally-ef-
fective and safe: a review, Biomed. Pharmacother. 111 (2019) 537–547.