Dr. María Valderrama V [Write text] Dr.

Juan Ponce V

NATIONAL UNIVERSITY OF SAN AGUSTIN DE AREQUIPA

FACULTY OF CS. BIOLOGICAL AND AGRICULTURAL
ACADEMIC AND PROFESSIONAL SCHOOL OF BIOLOGY

GENETICS PRACTICE GUIDE

Teachers:
Dr. María Valderrama Valencia
Dr. Juan Elías Ponce Vélez

2011
PRACTICE Nº 1

MECHANISMS OF THE INHERITANCE OF QUALITATIVE

CHARACTERISTICS
IN
Drosophila melanogaster

1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

1 .- INTRODUCTION

The transmission of biological information from parents to progeny has been an

essential factor in the development of organisms; this transmission has required the evolution
of genetic mechanisms that guarantee the fidelity of this process. Due to their fundamental
importance, these mechanisms were established very early in the history of life, so that they are
currently shared by many taxonomic groups. To understand genetic principles, it is then
possible to study very different organisms and reach general conclusions. The selection of a
specific organism to carry out genetic studies depends on the advantages it is present for
carrying out these studies.

The fruit fly Drosophyla melanogaster offers us great advantages for carrying out
various genetic studies. It has been widely used as experimental material since it was used by
WE Castle, in 1906, and laid the foundations for the crosses carried out by TH Morgan and his
collaborators in 1909. Another advantage that this organism offers is a relatively short
generation time, a size small enough to facilitate its handling but large enough for the
observation of a large number of mutant characters, at a high rate of proliferation which results
in easy production of large numbers of progeny for the application of a high level of statistical
rigor in the analysis of the experiments.

Lifecycle. The life cycle of Drosophyla melanogaster includes four phases: Egg, larva, pupa
and adult. The length of the cycle varies with the growing temperature. At 25ºC the cycle lasts
around 10 days, but at 20ºC, it can last around 15 days. Drosophyla cultures should not be
exposed to high temperatures 30ºC. Which results in sterilization or death of the flies, nor at
low temperatures (10ºC) which results in prolonged life cycles (perhaps 57 days), and reduced
viability. The optimal cultivation temperature is 25ºC.

Egg (0.5 mm.) Adult females are capable of laying eggs two days after emerging from
the pupa stage, laying increases per day for a week up to 50 or 75 eggs per day. They
put them on the surface of the foundation. The egg is ovoid, with two small projections
that emerge from one end, these are flattened and serve to keep the egg from sinking
into the culture medium. The eggs can be seen with the naked eye on the surface of the
food. Embryonic development of the egg takes approximately 1 day at 25° C. The larva
emerges from the egg.
Larva (4-5 mm) It is white, segmented and vermiform. It has black mouthparts
(mandibular hooks) in a narrow cephalic region, which penetrate the food, eating
voraciously. It does not have eyes so this animal is completely blind. The larvae also
do not have appendages and must push themselves by eating to move around their
environment. They breathe through tracheas and have a pair of visible spiracles (air
pores) at the anterior and posterior ends of the body. The larval phase in the Drosophila
cycle is one of rapid eating and growing. It consists of three subdivisions called stages.
The first and second stages end in molting, each molting involves a complete removal
of the skin and oral parts of the larva and is the mechanism by which it grows. The
third stage ends in pupation. Immediately before pupation the larva stops feeding,
crawls to a relatively dry surface, and reverses its anterior spiracles. The larval phase
lasts about 4 days at 25° C. It is then the third instar and measures approximately 4.5
mm long.
Pupa (3mm) The pupa is considered the reorganizing phase of the fly cycle, during
which most larval structures are destroyed and adult structures develop from
embryonic tissues called aniagen (or also imaginable discs). These embryonic tissues
have remained latent in the animal since its differentiation in the egg. The animal
pupates inside the last larval skin, which is initially soft and white but gradually

2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

hardens and acquires a darker color. The above changes result in the development of an
individual with the body shape and structures of the adult (imago). The pupal phase
takes about 4 days at 25° Celsius, the adult emerges from the puparium.
Adult (2 mm) The adult is considered the reproductive phase of the cycle. The fly
emerges or hatches from the puparium, forcing its way out through the anterior end of
the puparium. Initially, the adult fly is elongated in shape with unexpanded wings. It's
an hour, the wings expand and the body gradually takes on a more definitive adult
shape. At first the adults are relatively light in color, within the first few hours they
darken and acquire the characteristic color.

The adults of D. melanogaster can mate 6 hours after emerging from the puparium.
Sperm is stored in the spermathecae and ventral receptacles of the female and is
gradually released into the oviduct as eggs passed through the oviduct into the vagina
are produced. The female begins to lay eggs approximately 2 days after emerging; she
can lay up to 50 to 75 eggs per day during the first days. Afterwards egg production
decreases. The average lifespan of adult flies is 37 days at 25° C.

2 . AIM
• Recognize the distinguishable characteristics of Drosophila.
• Study of the life cycle of Droshophila
• List some of the genetic characters of Drosophila.
• Analyze the form of inheritance of these characters through the crossing
procedure

3 MATERIAL AND METHODS

3.1 Examination of flies : In the laboratory you will find jars with normal flies (wild
type). Take a fly (male and female) and place it in a stereoscope and identify that the
skin of the fly is divided into head, thorax and abdomen. Using the attached figures,
identify the following characteristics of the fly's morphology.
HEAD : The head is made up of six fused segments. In it you will find: 1. Antenna,
each consisting of three segments.
2. Awns, each branched, originating near the distal segment of each antenna.
3. Try it, language.
4. O/os compounds, formed from a large number of independent facets (Ommatidia)

5. Ocelli, simple eyes, three in number and located between the compound eyes on the
dorsal surface of the head.
6. Setae, vibrissae, orbitals, ocellars, verticals, posterverticals.

THORAX : The thorax is composed of three fused segments:

1. Prothorax, consisting of a pair of humeri and the first pair of legs (each leg made up
of: coxa, trochanter, femur, tibia and five tarsal joints, in the case of males the
sexual comb, in the next basic joint.
2. Mesotomx, consisting of dorsally located mesonotum and scutellum: laterally
located mesopleura, petropleura, and stemopleura, the wings (note the general
positions of the longitudinal and transverse veins), and the second pair of legs.
3. Meta thorax, consisting of metanotum, hypleura, the alters or rockers (modified
hind wings, which function as balances), and the third pair of legs.
4. Ioraxic spiracles, two in number
5. Setae: dorsoceníral, notopleural, presutural, supraalar, postalar and scutellar.

3
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

ABDOMEN : The abdomen consists of seven or eight visible segments in the female
and five or six in the male.
In it you will find:
1. Tergites, dorsal sclerites (integumental plates) one per segment.
2. Stemites, abdominal sclerites, one per segment.
3. Abdominal spiracles
4. genital region

5. 2 IDENTIFICATION OF THE SEX OF THE ADULT FLY: Male and female

flies can be differentiated by a number of different criteria, some of which have already
been mentioned. Identification of the sex of the adult fly can be done as follows:

Sexual comb . The sexual comb is found only in male flies and consists of a row of
approximately ten straight, black setae at the proximal (upper) tarsal joint of each of
the first pair of legs. This structure can also be identified in the pupal phase.
Abdomen . The female has seven visible segments, with posterior elongation, and
separate dark bands on the dorsal surface to the very end. The male has five visible
segments and has a rounded posterior end, the dark bands of the last segments are
fused.
Genital region . The female has anal plates and ovipositing plates that are light in
color. The male has anal plates and genital arch and penis with dark pigmentation.
After examining the wild type (normal) flies and having found the structures
mentioned above, do the same with the mulant strains that will be provided to you. It is
preferable to examine wild and mullant individuals simultaneously for comparative
purposes.

6. 3 CULTIVATION OF Drosophilsa

CULTIVATION MEDIUM
For the experimental rearing of Drosophila melanogaster , a food medium must be
available that is dense and firm enough to prevent it from falling or spilling into the culture
flasks, especially when transferring the flies, to etherize them. , count and sex them or establish
new crops.

The medium must contain enough sugar to feed the flies and promote the growth of
yeast. Approximately 50 cc of the culture medium should be placed in each culture flask (250 cc
flasks).

Culture media for raising Drosphila melanogaster

Ingredients Banana Polenta Oatmeal Semolina Agar
Water 47.8cc 74.3cc 72.7cc 77.5cc 100cc
Banana 50.0g
Molasses 13.5cc 11.0cc 11.5cc
Sugar 5.0g
Polenta 10.0g 14.0g
Oatmeal 1.6g
Semolina 10.3g
Agar (colapis) 1.5g 1.5g 2.0g
fungus inhibitor 0.7cc 0.7cc 0.7cc 0.7cc 0.7cc

Note: Amount of medium for two 250 cc bottles. For a larger number of jars, increase the
quantities proportionally.

4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

By placing an adequate number (at least 8) of Drosophila flies in mother (new) flasks
from the flasks maintained in the laboratory, the adult female Drosophila begins to lay eggs after
the second day of emerging from the pupa. The eggs are white and ovoid, 0.5 mm long, carrying a
pair of filaments at one end, which prevents them from sinking into the white food, on which the
eggs are always laid. The white, segmented larva emerges a day or two later and begins to bore
into the medium. This larval stage is feeding and growing rapidly. Since the insect's skin (cuticle)
cannot grow and spread, the young larva must shed its skin periodically. Three larval stages are
distinguished, called INSTARS, distinguished from each other by molting. The third instar ends
in pupation; Just before piupation, the larva stops feeding, then crawls out of the environment to a
dry place where it stops moving.
The adult fly is at first relatively light in color, with extended wings; After a few hours, it darkens
and assumes the defined shape of a typical adult

7. 4 STUDY OF SOME GENETIC CHARACTERISTICS THROUGH CROSSINGS: To

carry out the crosses we must ensure that the females with whom the crosses begin are virgins, to
do so we must follow the following steps.

Isolation of virgins Since Drosophila females can store and use sperm from insemination for a
large part of their reproductive life, only virgins should be used for mating. Females of this
species can mate six hours after they have emerged from pupation. Thus, if all the adult flies are
removed from the culture bottle and the bottle is left for six hours, all the females removed the
second time should be virgins. Males of any age can be used in crosses.

CROSSING SCHEDULE
To Drosophila capture and feature recognition.
the...
Of the... To Original crosses using virgin females.
the...
Of the... To Obtaining parental flies (P1), from etherized bottles. Once the flies have
the... been removed, label the jar with your name, the date and a description of the
crossing. Examine the etherized adults using a dissecting microscope. Be
sure that you can determine the phenotype of each fly (sex, eye color, wing
type, etc.) Discard the parents, as the eggs deposited will hatch to form the
F1.
Of the... To
the... F1 has hatched. Carefully etherize them and examine them, using the
dissecting microscope. Record the type of each fly. Prepare two new mating
teams by placing three males and three females, in each of the jars, with
their name, the date and the type of crossing carried out. Start test crosses.
Of the... To All adults are removed from the bottles and these are returned to the
the... incubator.
Of the... To
the... F2 flies have now emerged. You will not need flies again so you can over-
etherize them before counting them. Record the phenotype of each fly.

Before you look at Drosophila mutants, you should become familiar with the
common or wild type of Drosophila .
To carry out the crosses, the following aspects must be taken into account:
1. Carry out crosses between many pairs of parents from pure lines, with
contrasting characteristics.
2. Great offspring in crossbreeding
3. Character selection.

5
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

4. RESULTS
Draw the characters described on the flies observed.
Schematic adult male and female Drosophila melanogaster to highlight sexual
differences.
Outline the cycle of Drosophila melanogaster , use bibliographical consultations and
on separate sheets
Write down the results of the crosses obtained
Tabulate the time when you first observed each of the stages of Drosophila.
Tabulate information about crosses
Progeny Evaluation (F1)
Selection of Parents to carry out the F1 x F1 crossing.
Evaluation of F1 x F1 (F2) Progeny, Detailed information for sex and by character.
Interpret the results of your experiment. Was the hypothesis proposed by you at the
beginning of the experiment fulfilled? What comments or observations do you
have about the proposed experience?

K.- BIBLIOGRAPHY

1 Demerec, M. 1965. Biology of Drosophila. Hafner Publishing Co., New York.

2 Demerec, M. And Kaufmann, B. 1962. Introduction to the genetics and
cytogenetics of Drosophila melanogaster. National Nuclear Energy Commission,
Genetics Program, Mexico.

3 Ramos, Morales, P. 1993. Genetics Laboratory Manual for Drosophyla

melanogaster. Ed. Mac Graw Hill Interamericana de México, SA Mexico.
4 Roberts, D. 1986. Drosophila a practical approach. IRL. Press, Oxford.
5 Stricberger, Monroe. 1988. Genetics. Ed. Omega.SA, Barcelona, Spain.
6 Winchester, A. 1968. Genetics. Laboratory Manual. WM. c. Brown Company
Publishers, USA

6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº2

PROBABILITY AND GENETIC BEHAVIOR

I .- INTRODUCTION

The physicist Helmholz (1821-1894) wrote that "all science is a measurement." This
statement is essentially true if we admit that the method of measurement may differ from one
science to another.

In genetic transmission, much of what is measured refers to the proportions of the

different phenotypes and genotypes. These genetic ratios arise from probabilistic
relationships: the probability of segregation and transmission of genes in gametes and their
probability of combining into zygotes.

Since they are random events, no exact predictions can be made for any particular
event. In the same way when one tosses a coin there is no guarantee that a head will always be
followed by a tail; there is no guarantee that a particular genetic event (such as a particular
genotype) will occur when different types of events are possible. In general terms, the
probability that an event occurs can be defined as the proportion of times in which the event
occurs in a large number of trials. If there are n trials and an event occurs on average m times
in those n trials, the probability of the event can be taken to be m/n.

In a coin that is tossed 100 times a frequency of heads closer to 50% can be expected
than in a coin that is tossed only 10 times. Similarly, among an offspring of 100 individuals
from a cross between parents who are heterozygous for a single pair of genes, a closer
approximation would be expected to be close to 1:2:1 than among a few offspring from that
cross. However, even taking into account a large number of descendants, it would be very rare
to find that such results fit exactly the expected proportion. Some deviation from the expected
proportion is much more likely to occur within any given experiment, and different
proportions will usually be obtained when experiments are repeated. As for any numerical
character observed in a population, these deviations are considered “statistical.” The geneticist
must therefore perform a statistical test to decide whether or not the observed deviations fit
the proposed explanation or hypothesis. The determination of genetic proportions is derived
from two basic laws of probability. The law of independent events ; when the presence or
absence of any of the events does not affect the probability that any of the others occur.
Example: The toss of a coin has two probabilities p = heads (1/2) or q = tails (1/2). The
combined probability of independent events would be a coin flipped twice and two heads
coming up would be pyq = (1/2)x(1/2) = ¼ and the mutually exclusive are those in which the
appearance of any of them prevents the appearance of others. The word “or” is generally
required or implied in the case of combined probability, indicating that a sum of the
probabilities must be made.

The determination of genetic proportions is derived from two basic laws of probability.

II .- AIM

• Clarify the relationship between the laws of probability and the principles of genetic
segregation, combination and recombination.

III .- MATERIAL AND METHODS

3.1 Work in pairs, each tossing a different coin. Each member of the pair must :

TO. Toss a coin 50 times, allowing it to land without interference. Record the number of

7
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

heads and tails in a table. Gather the results of all students present.

• How does this illustrate the law of probability?

• Heads and tails occur the same number of times?

• Would a greater number of throws probably result in a more equal distribution? List
the factors that could interfere with a perfect distribution of heads and tails?

• How is sample size related to probability?

• Explain, using a diagram, how the principles illustrated by the coin toss apply to
Mendelian segregation in a monohybrid cross.

• Results
No. male gamete female gamete Zygote
Launch Faces Seals Faces Seals DC C.S. H.H
1
2
3
4
5
6
7
8
9
10
Total
1
2
3
4
5
6
7
8
9
10
Total

8
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

1
2
3
4
5
6
7
8
9
10
Total
1
2
3
4
5
6
7
8
9
10
Total
1
2
3
4
5
6
7
8
9
10
Total
TOTAL 50
LAUNCHED
TOTAL CLASS

b. In the table:

• Assume that the faces and stamps are Mendelian characters, with the faces
completely dominant over the stamps (genotypes will be CC, CS, SS). What points of
Mendel's laws does this illustrate? As?

• Consider the faces incompletely dominant on the seals. What proportion is obtained?

• Statistical analysis of the above examples can be done using the X2 (Chi square)
method.

• Add the column of the zygote. Theoretically the results should be 1 CC, 2 CS, 1SS, in
a cross between 2 heterozygotes with dominance or 3:1 with dominance.

9
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

3.3. Probability and its relationship with expected family outcomes.

• The probability that one or another of a set of mutually exclusive events will occur
during an event is the sum of their probabilities. Example. Any birth can be a boy or a
girl: Probability of a boy is equal to 1/2 Probability of a girl is equal to 1/2
Probability of boy or girl equals 1/2 + 1/2 equals 1
• The probability that two or more independent but not mutually exclusive events will
occur during a trial is the product of their probabilities. Example, The probability that
two parents heterozygous for eye color will have a child with blue eyes is ¼.
The probability that it is a girl with blue eyes is ¼ x ½ = 1/8
• Multiple births in a family:
General formula (p + q) N , where p= probability of one event, q= probability of
another event. N= number of descendants Example, 2 children (p + q)2 = p2 + 2pq +
q2 2 let children = p2 = ¼
1 be a boy and the other a girl = 2pq = 1/2 *
2 are girls = q2 = ¼
*Note that coefficient 2 refers to the number of ways in which a family of one boy
and one girl can occur.

• The general formula for finding any term in the binomial expansion is:
N! =pSq
Yes ! T
xT !

1
0
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

N= Total number of descendants

S= Number of a type
T= Other type number
Example, in a family of 5, what is the probability that there will be 2 boys and 3 girls?

5! 10 5
2! x -
32 16
3!

3.4. - Proposed problems

1 .- Your cat is pregnant and you estimate that she will give birth to 5 kittens just
like the last time she gave birth. A) What is the probability that she will have 3
male kittens and 2 female cats in that birth? b) What is the probability that all
of them are males? c) What is the probability that all of them are female?

2 .- The following case was presented before the courts of justice: a family yours.
The W family denies this fact, and the court orders the examination of the
blood groups of the babies and parents, with the following results:

X/Y Family W/Z Family

Mother AB TO
Father EITHER EITHER
Baby TO EITHER
Which family is right?

3 .- If you cross a grayish Andalusian rooster (NG) with 10 grayish blue hens (NG)
a) What is the probability that 4 black (NN), 4 grayish blue (NG) and 2 white
(GG) will be born?, b) What is the probability that they are all black?
4 .- In a family of 6 children, what is the probability that there will be a) 2 boys and 4
girls b) all boys c) 3 boys and 3 girls.
5 .- A couple decides to have 4 children. What is the probability that: a) The father's
wish to have four boys is fulfilled? b) Is the mother's wish to have two of each
sex fulfilled? c) Will grandmother's wish of having three boys and a girl come
true? d) If they had a 5th child, what would be the probability that it would be a
boy?
6 .- If brown eyes are considered dominant to blue eyes, what is the probability that
two parents with heterozygous brown eyes will have a) 4 children with brown
eyes b) 3 children with brown eyes and 1 with blue eyes c) 2 children with brown
eyes blue and 2 with brown eyes?
7 .- In the Holstein-Friesian dairy cattle breed, a recessive ―r‖ allele produces red
and white hair; the dominant ―R‖ allele produces black and white hair. If a
carrier bull is crossed with carrier cows. Determine the probability that a) the first
offspring born is red and white; b) the first four descendants are black and white.
What is the expected phenotypic ratio between the progeny resulting from the
backcross of black and white F 1 cows with the carrier bull? If the carrier bull is
crossed with homozygous black and white cows, what phenotypic ratio can be
expected among the progeny resulting from the backcross of the F 1 cows with the
carrier male?

1
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

8 .- A rancher who owns a Holstein herd obtains one "amputated" calf in every 64
calves born in his herd, this variety being the product of a recessive gene. If these
cattle are crossed at random, how many heterozygous individuals would exist in
the population composed of 160 animals?
9 .- In F 2 , a cross between tall-stemmed plants and short-stemmed plants resulted in
a total of 948 individuals, 727 tall-stemmed plants and 221 short-stemmed plants.
Calculate whether this relationship is a deviation from the relationship expected
in monohybrid inheritance with complete dominance (X 2 ).
10 .- Huntington's chorea is a rare, fatal disease that usually appears in middle age
and is due to a dominant allele. A phenotypically normal man in his early 20s
notices that his father has developed Huntington's chorea. a) What is the
probability that he himself will later develop the disease? b) What is the
probability that your child will develop it over time?
11 .- A normal woman has three brothers affected by juvenile cataracts. Your father
and paternal grandmother also suffered from them. What are the prospects that
your future children will be affected?
12 .- If a man and his wife, not related to him, each have an albino brother. What is
the probability a) that your first-born child is albino? b) If albinism occurs if you
have many children c) If you had three children, would all three be albino? d)
That if your first child was albino, the next two would also be albino?
13 .- In humans the free earlobe is dominant (L) to attached lobes (l) and swirl of hair
on the back of the head turning to the right (R) is dominant to swirl where the
hair turns to the left (r). Miluska is L1Rr and so is Edgar. They get married and
hope to have 5 children. Assuming that these two pairs of genes are on non-
homologous chromosomes, answer the following: a) What is the probability that
three children will emerge with the lobe free and swirling to the right? b) What
is the probability that everyone comes out with the lobe free and swirling to the
left? c) What is the probability that two come out with the lobe stuck and
swirling to the right?
14 .- The diploid number of chromosomes in the African zebra, Equus burchelli , is
44. How many telomeres do somatic cells contain during the G1 phase of
interphase? How many telomeres do somatic cells contain during the G2 phase
of interphase? How many telomeres do somatic cells contain during the
metaphase of mitosis? How many telomeres do meiotic cells contain after
completing meiosis I? How many telomeres do zebra meiotic cells contain after
completing meiosis II?
15 .- The house mouse has 40 chromosomes in its sex cells. A) How many
chromosomes does a mouse receive from its father? B) How many autosomes
are present in a mouse gamete? C) How many sex chromosomes are there in the
mouse egg? D) How many autosomes exist in the somatic cells of a female?

VI.- BIBLIOGRAPHY

1. Anderson, P. and Ganetzky, B. 1997.An electronic companion to Genetics

Worbook. Gogito Learningg Media Inc. New York, San Francisco.
2. White, Manuel. 1980. Repair of genetic material. Research and Science
3. Crick, F.M. 1966. The Genetic Code. Sci.Am. 215 (4): 55
Darnell, E.E. 1983. RNA maturation. Research and Science
4. De Robertis, E. and De Robertis, E. M. 1986. Cellular and molecular biology. The

1
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Athenaeum. Buenos Aires, Argentina.

5. Fustinoni, E. 1979. Human Genetics. Volume II. 2nd edition. Alhambra-Madrid
6. Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain
7.Lewis, B. 1977. Genes. Oxford University Press and Cell press. New York. USA
8.Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
9.Stansfield, W. 1992. Theory and Problems of Genetics. Schawm Compendium
Series. 3rd Edition, McGraw Hill. Inc. Colombia
10. Stern, C. 1973. Human Genetics, 3rd edition. Alhambra, Spain
11. Strickberger, M. 1988. Genetics. Omega S Publishing. TO.; Barcelona, Spain.
12. Watson J. 1982. Molecular biology of the Gene. Winchester Educational Fund,
A. 1968. Genetics. Laboratory Manual. WM. c. Brown Company Publishers, USA
Inter-American, Mexico

1
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 3

MENDELIAN INHERITANCE: TYPE OF RELATIONSHIP BETWEEN

GENES

INTRODUCTION
P 2 White (yy) Principle of Uniformity

The crossing of two homozygous pure

lines (P 1 XP 2 ) that differ for a certain
P character originates a uniform first filial
1
generation (F 1 ) formed by individuals
female parental male parental equal and identical in external
appearance (phenotype) to one of the
parents. The phenotype that manifests
Q
2 itself in the F 1 hybrids is the dominant
one and the one that does not manifest
itself is the recessive one. The same
1st Generation Subsidiary F 1 result is obtained when reciprocal
Purple (Aa) crossing is performed (P 2 XP 1 ).
F
1
Reciproca Reciprocal Crossing Phenotype: Purple ( A ) is the dominant
l color (it appears in F 1 ), while White ( a
P 2 White (yy) P 1 Purple (AA) ) is the recessive color (it does not
appear in F ). A>a
1

Q
2 Genotype: the crossing of homozygous
pure lines ( AA x aa ) gives rise to a
heterozygous F 1 ( Aa ).
female parental male parental
P
1

F 1st Generation Subsidiary F 1

1
Purple
P 1 Purple
(Aa) (AA) P 2 White (yy) MENDEL'S FIRST LAW

Principle of Segregation
P The self-fertilization of the hybrids
1 (heterozygous Aa ) of the F 1 obtained
Female parent Male parent between two homozygous pure lines (P
1 XP 2 ) that differ for a certain character
originates a second filial generation (F
Q
2 2 ) in which the recessive character
reappears in a proportion of three
1st Generation Subsidiary F 1
individuals with a dominant phenotype
Purple (Aa)
for each one with a recessive phenotype
F White
Purple Purple Purple
(3:1). The same result is obtained in the
1
F 2 of the reciprocal crossing (P 2 XP 1 ).

Phenotypic Segregation: segregation is

3/4 Purple (dominant) and 1/4 White
(recessive).

1
5
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

AA Ah Ah aa

2nd Generation Subsidiary F 2

Reciproca Reciprocal Crossing Genotypic Segregation: the segregation

l obtained is 1/4 AA , 1/2 Aa and 1/4 aa
P 2 White (yy) P 1 Purple (AA) (1:2:1). 1/4 homozygous dominant, 1/2
heterozygous and 1/4 homozygous
recessive.

Q
2 Principle of Segregation: When a hybrid
(heterozygous Aa ) forms its gametes, the A
and a alleles separate or segregate, so that it
female gamete produces two kinds of gametes in equal
P Segregation principle proportion, 1/2 gametes with allele A and
1
1/2a 1/2A 1/2 of gametes with the allele a . This
Purple A happens both on the male side and on the
1/2aa Purple A to female side.
to
F male fame
Purple to
1 1/2aa White to to
A

Female parent Male parent

MENDEL'S SECOND LAW

Principle of Independent Combination

The self-fertilization of the hybrids

(diheterozygous AaBb ) of the F 1 obtained
between two homozygous pure lines (P 1
XP 2 ) that differ in two certain characters
originates a second filial generation (F 2 ) in
which the phenotypic segregation for both
characters is 9AB:3Ab:3aB:1ab and comes
from the independent combination of what
happens to each character separately. The
same result is obtained in the F 2 of the
reciprocal crossing (P 2 XP 1 ).

(3·A:1a)(3B:1b)=9AB:3Ab:3aB:1ab

Reciprocal Crossing
Segregation Phenotypic: the
segregation is 9/16 AB (Yellow,
Smooth), 3/16 Ab (Vere, Smooth),
3/16 aB (Yellow, Rough and 1/16 ab
(Green, Rough).

1
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V
R
(3·A:1a)(3B:1b)=9AB:3Ab:3aB:1ab
e
Segregation Genotypic:
c the
segregation that is obtained is the
independent combination of each
character (1/4 AA + 1/2 Aa + 1/4 aa )
X (1/4 BB + 1/2 Bb + 1/4 bb ).
p
Principle of Independent
r Combination:

o When a hybrid (diheterozygous AaBb

) forms its gametes, alleles A and a
c combine independently with alleles B
and b so that it produces four kinds of
o gametes in equal proportion: 1/4 AB ,
1/4 Ab , 1 /4 aB and 1/4 ab .

(1/2 A+ 1/2 a )(1/2 B+ 1/2 b )=

=1/4 AB+ 1/4 Ab+ 1/4 aB+ 1/4 a b

2nd Law
TEST CROSSING

1
7
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
Principle of Independent Combination
Mendel performed additional crosses to
test the principle of independent
combination. He carried out backcrosses
of the F 1 by individuals with a recessive
phenotype for both characters (Green,
Rough).He
Crossing by the homozygous recessive
or ( AaBb x aabb ) is called Crossing
Test , since it allows you to test what the
gametes that form the hybrid ( AaBb )
R
are like. This is because the external
appearance (Phenotype) and
e proportion of the
offspring matches the types and
c proportions of gametes produced by the
AaBb hybrid (1/4 AB , 1/4
Ab , 1/4 aB and 1/4 ab ). The same
result is obtained in the offspring
p Reciprocal Crossing of the
reciprocal crossing.
r
Phenotypic Segregation: the
segregation is 1/4 AB (Yellow, Smooth),
o
1/4 Ab (Vere, Smooth), 1/4 aB (Yellow,
Rough and 1/4 ab (Green, Rough).
c
Genotypic Segregation: the segregation
o obtained is 1/4 AaBb , 1/4 Aabb , 1/4
aaBb and 1/4 aabb .

II. GOALS
- By using examples learn to determine the
type of relationship between genes

III. MATERIAL AND METHODS

3.1 Problems solved
1. Below are a series of exercises,
which consist of diagrams and
figures that allow you to apply the knowledge previously expressed.

In pea plants, smooth seeds (S) are dominant over rough seeds (s). In a genetic cross of two plants that are
heterozygous for the trait "seed shape," what fraction of the offspring should have smooth seeds?

Monohybrid
cross
of F1 plants
x

Lisa Lisa

1
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
A phenotypic ratio of 3:1 in the offspring of a cross of two organisms
heterozygous for a single trait is expected when:

TO. the alleles segregate independently during

meiosis.
b. each allele contains two mutations.
c. the alleles are identical.
d. the alleles are incompletely dominant.
AND. only recessive characters are marked.

2. In Mendel's "Experiment 1," true pea plants with smooth seeds were crossed with true pea plants
with rough seeds. (smooth seeds are the dominant characteristic). Mendel collected the seeds
from this cross, planted them and obtained the F1-generation of plants, allowed them to self-
pollinate to form a second generation, and analyzed the seeds of the resulting F2 generation. The
results he obtained; and the ones you would predict in this experiment are:
A. 1/2 of the F1 and 3/4 of the seeds of the F2 generation were smooth.
B. 1/2 of the F1 and 1/4 of the seeds of the F2 generation were rough.
C. All seeds of the F1 and F2 generation were smooth.
D. 3/4 of the F1 and 9/16 of the seeds of the F2 generation were smooth.
E. All seeds of the F1 generation and ¾ of the F2 generation were smooth.

3. A genetic cross between two hybrid pea plants -F1 for smooth seeds What percentage of plants
with smooth seeds will it produce in the F2 generation? (smooth is dominant over rough).
TO. 100% b. 75% c. 50% d. 25% AND. 0%

4. A genetic cross between two F1-hybrid pea plants with yellow seeds will produce what
percentage of plants with green seeds in the F2 generation? Yellow seed is dominant over green
seed.
TO. 0% b. 25% c. 50% d. 75% AND. 100%

5. When real, tall-stemmed pea plants; are crossed with true short-stemmed pea plants: All plants
of ____________________________________________, and 3/4 of the _________
They will have tall stems. Therefore tall stem is dominant.
TO. F1, F2. b. G1, G2. c. parents, F2. d. F2, parents. AND. P1,
P2
A Cross of
To identify the genotype of yellow-seeded pea plants as Homozygous Dominant (YY) or
Heterozygous (Yy) Test , you could do a X?
test cross with genotype plants_______________.
A stranger
YYoYy

TO. and b. AND c. yy d. YY AND. yy

In Mendel's experiments, if the gene for tall plants (T) were incompletely dominant over the gene
for short plants (t), what would be the result of crossing two Tt plants?
A. 1/4 will be high; 1/2 intermediate height; 1/4 low
B. 1/2 will be high; 1/4 intermediate height; 1/4 low.

1
9
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
c. 1/4 will be high; 1/4 intermediate height; 1/2 down.
d. All descendants will be tall.
AND. All descendants will be intermediate.

What are the possible blood groups of a descendant of a cross between individuals who are type
AB and type O? (Hint: blood type O is recessive)
TO. AB or O b.A, B, or OR C.A or B D. A, B, AB, or O AND. A, B, or AB
The crossing of a
variety (P 1 ) of corn
with purple and
smooth seeds with P
another variety (P 2 ) 1

with yellow and F 2 cob: 302 seeds

wrinkled seeds caused Please indicate:
a uniform yellow and Q
2 character.
smooth F 1 . The F 1
self-fertilized and The number of loci that control coloration and
produced ears like shape of the seeds.
those in the F
1 Observed and expected segregation.
photograph on the
Checking with a X 2
left.
— ruGFR---------- 35
The crossing of a • e24“ i W 1 4 jl jfc Ij
variety (P 1 ) of corn
with purple seeds with
i t2ejee
another variety (P 2 ) P
with yellow seeds 1

caused a uniform Part of Cob No. 1 of F 2 : 167 seeds

purple F 1 . The
Self-fertilization of
the F 1 plants gave F 2
ears like those in the
photograph of the
left.

F
1 Part of the Cob No. 2 of the F 2 : 187 seeds
Please indicate:
The Dominant and Recessive character.
The number of loci that control seed coloration.
Observed and expected segregation.
Checking with a
v2

The crossing of a variety (P 1 )

of corn with purple seeds
with another variety (P 2 )
with yellow seeds caused a P
uniform purple F 1 . F 1 was 1

backcrossed to the yellow

parent (P 2 ) and gave
Q Part of an F 2 Cob: 159 seeds
2

2
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
ears like the ones in the Please indicate:
photograph on the left. The Dominant and Recessive character.
The number of loci that control seed coloration.The
observed and expected segregation. Checking with a x 2
F
1

A genetic cross, of red flower dragons procreated by inbreeding; with white-flowered snapdragons bred by
inbreeding; resulted in F1 hybrid offspring that all had pink flowers. When the F1 plants were self-
pollinated, the resulting F2 generation of plants had a phenotypic ratio of 1 red: 2 pink: 1 white. The most
logical explanation is:
A. Pink flower color is epistatic to red flower color.
B. Pink flowers are the result of mixing the red and white genotypes.
C. Flower color is due to two or more complementary genes.
D. Heterozygous plants have a different phenotype than the parents procreated by inbreeding due
to the incomplete dominance of the dominant allele.
E. Flower color inheritance in snapdragons does not behave like a Mendelian character.

Human blood type is determined by co-dominant alleles. There are three different alleles, known as I A , I B ,
and i. Alleles I A and I B are co-dominant and allele i is recessive.
The possible human phenotypes for blood groups are type A, type B, type AB, and type O. Type A and B
individuals can be homozygous (I A I A or I B I B , respectively), or heterozygous (I A io I B i, respectively). A
woman with blood type A and a man with blood type B could potentially have an offspring with: Which of
the following blood types?
TO. type A b. type B c. type AB d. type O AND. all the above

Manx cats are heterozygous for a dominant mutation that results in tailless cats (or very short tails), long
hind legs, and a very distinctive gait. Mating two Manx cats produces two Manx kittens for every normal
long-tailed kitten, instead of three to one as would be predicted in Mendelian genetics. Therefore the
mutation that causes the Manx cat phenotype is probably an allele. .
TO.pleiotropic b.co-dominant C.epistatic d. lethal
sex

The crossing of a variety (P 1 ) of corn with purple seeds with another variety
(P 2 ) with yellow seeds caused a uniform purple F 1 . The F 1 self-fertilized
and produced ears like those in the photograph on the left.
linked to

P
1

Q Part of an F 2 Cob: 110 seeds

2
Purple, yellow and white seeds are observed
Please indicate:

F The Dominant and Recessive character. The

1 number of loci that control seed coloration.
Observed and expected segregation. Checking with

2
1
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
The crossing of a variety (P 1 )
of corn with purple and smooth
seeds with another variety (P 2 )
with yellow and wrinkled seeds P
caused a uniform yellow and 1

smooth F 1 . F 1 was backcrossed

to the parental P 2 (yellow and
wrinkled seeds) producing ears Q
2
like those in the photograph on Backcross Cob: 113 seeds
the left. indicate
F The Dominant and Recessive character. The number
1
of loci that control seed color and shape.Observed and
Proposed problems expected segregation . Checking with a

From the following problems, prepare 5 exercises with figures according to the character and place
the possible answers in multiple choice form.
1. The red color of tomato pulp depends on the presence of a dominant R factor over its r allele,
which gives yellow color. Dwarfism is due to a recessive gene d. There is a variety with yellow
flesh and normal size and another dwarf and red flesh, both pure varieties. Could a variety with
red pulp and normal size be obtained? And one with yellow and dwarf flesh? Which one would
be obtained first?
2. A man with normal pigmentation and woolly hair marries a woman with normal pigmentation
and normal hair. Their first child is an albino with normal hair. a) What other phenotypes can
they expect in their children? b) What will be the theoretical proportions to expect from all the
phenotypes?
3. Mendel discovered that the yellow color of pea seeds is dominant over the green color. In the
following experiments, plants with known phenotypes, but with unknown genotypes, gave rise
to the following offspring: a) Yellow x Green = 82 Yellow + 78 Green; b) Yellow x Yellow =
118 Yellow + 39 Green; c) Green x Green = 50 Greens; d) Yellow x Green = 74 Yellow; e)
Yellow x Yellow = 90 Yellow. Based on the proportion of offspring, indicate the most probable
genotypes of each parent.
4. A man with normal pigmentation and woolly hair marries a woman with normal pigmentation
and normal hair. Their first child is an albino with normal hair. a) What other phenotypes can
they expect in their children? b) What will be the theoretical proportions to expect from all the
phenotypes?
5. A dominant K gene in mice produces a curly tail; the recessive genotype at this locus, kk, has a
normal tail. The homozygous condition of another AA locus produces a gray color called
agouti; the A and A heterozygous condition produces a yellow color; the homozygous genotype
A and A and is lethal.
a) If yellow mice heterozygous for curly tail are crossed with each other, what phenotypic
proportions are expected among their offspring?
b) What proportion of the offspring is expected to be genotype A and Akk?
c) If all yellow offspring were allowed to mate at random, what would be the genotypic and
phenotypic frequencies among their adult progeny?
6. Antirrhinum can have pink, white or red flowers. The table details the results of a series of
crosses between various plants and the results obtained:

Crosses Offspring
Red x pink 126 red and 131 pink
White x pink 88 white and 92 pink
Red x white 155 roses
Pink x pink 43 white, 39 red and 83 pink

2
2
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
What genetic mechanism can be deduced from these results?
7. In the rabbit, the black color (wild type) is due to the dominant b + gene and the brown color to
the recessive b allele, the normal short hair of the common rabbit is due to the I + gene and the
long hair called angora to the recessive gene Yo . The wild rabbit has white fat, but there are
breeds that have yellow fat. The white fat y + gene dominates the yellow fat y. If a female
parent was homozygous for white fat and the male parent was homozygous for yellow fat.
What is the probability of getting a specimen in F 2 that is black, has long hair and whose fat is
yellow? Calculate the probable relative frequencies of all possible phenotypic combinations.
8. The red color of tomato pulp depends on the presence of a dominant R factor over its r allele,
which gives yellow color. Dwarfism is due to a recessive gene d. There is a variety with yellow
flesh and normal size and another dwarf and red flesh, both pure varieties.
b) Could a variety with red pulp and normal size be obtained?
c) And one with yellow and dwarf flesh?
d) Which one would be obtained first?
9. In zucchini, the genes for spherical fruits are dominant over those for elongated fruits. The
crossing of two different varieties of spherical fruit gave the following F 2 : 89 disc, 62
spherical, 11 elongated. Check with a chi-square, whether these data fit the reasonable
modified proportion of dihybrid; Explain the form of inheritance, the genotype and phenotype
of F and the genotypes of F 2 .
10. A plant with a tall stem, a yellow legume and a round seed is crossed with another dwarf, green
and round plant, giving rise to 3/8 tall, green and round plants, 3/8 dwarf, green and round, 1/8
tall. , green and rugosa and 1/8 dwarf, green and rugosa. Give the genotypes of the parents.
11. In ducks, there is a multiple allelic series that determines the type of down. The M I factor
produces dark color on the head and tail; the M dark color on the back and light in the ventral
region and finally the m factor causes uniform dark color. In another allelic series, factor C
allows the formation of pigments and its recessive allele determines the white color. How many
genotypes, in relation to these factors, will exist in the white Pekingese breed?
12. It is known that coat color in mice is determined by several genes. The presence of a yellow
band of pigment near the tip of the hair is called the "agouti" pattern and is produced by the
dominant A allele. The recessive condition of this locus (aa) does not have this subapical band
and is known as non-agouti. The dominant allele of another B locus produces black color and
the recessive bb genotype produces brown. The homozygous cc genotype restricts pigment
production to the extremities of the body in a pattern called Himalaya, while the dominant C
allele allows pigment to be distributed over the entire body. When crossing pure brown, agouti
and Himalayan mice with pure black, non-agouti, non-Himalayan mice, a) what are the
expected phenotypic proportions in F 1 and F 2 ? b)What percentage of the fully colored, black
and agouti F 2 is expected to be of genotype AaBBCc? c) What percentage of all F 2 Himalayan
mice could show brown pigment? d)What percentage of all agoutis in F 2 could be expected to
exhibit black pigment?
13. In the cat, the characters spotted ( S ) or non-spotted ( s ), short hair ( L ) or long hair ( l ) and
undiluted ( D ) or diluted ( d ) color are due to three independent genes. The cross is made
between two cats of genotypes llSsdd and LlSsDd.
a) What is the probability of obtaining a cat of genotype llssdd ?
b) What is the probability of obtaining a short-haired, mottled and undiluted phenotype cat?
12. The vestigial wings in Drosophila are determined by the recessive vg allele, and the normal
ones by the dominant vg+ allele. The ebony body color is determined by the recessive allele e
and the normal color (tan) by the dominant allele e+. When a fly with normal body color and
normal wings is crossed with another fly, they produce a progeny of 160 flies: 43 normal body
and normal wings; 35 normal body and vestigial wings; 40 ebony body and normal wings; 42
ebony body and vestigial wings. a) What is the genotype of the normal father?; b) What is the
genotype and phenotype of the other parent?; c) What are the genotypes of the offspring?
13. Petrakis and collaborators investigated the inheritance of the types of wax produced in the ear
(cerumen) among American Indians and observed that an individual could have one of two

2
3
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V
types of wax, dry or sticky, which were inherited in the way indicated by the following data:

Parental combination Number of matings Offspring

Clingy Dry
Sticky x sticky 10 32 6
Sticky x dry 8 20 9
Dry x dry 12 0 42

Based on these data, explain whether the inheritance of dry earwax is dominant, recessive,
partially dominant, co-dominant or some other type.
14. In Drosophila , crossings of flies with "Dichaetae" wings (D) always produce offspring 2/3
"Dichaetae" + 1/3 normal wings. When crossing "Dichaetae" with normal wings you always
get 1/2 Dichaetae + 1/2 normal wings. Explain the results.
15. Suppose that there are three genes in the horse that affect color and that produce the following
effects: WW is lethal, Ww prevents the appearance of color (whites) and ww allows the
appearance of the same; BB and Bb black color and bb brown; OO and Oo are solid color and
oo has white spots on the background color. A white stallion and a white mare are crossed,
both heterozygous for the three genes. What is the expected frequency of possible phenotypes
in viable offspring? What phenotypic frequencies would be expected if the stallion were
WwBboo?

3.4 Proposed task

Conduct a survey in your family in order to obtain the necessary data that will be placed in the
following table to determine the presence or absence of the following characters:

Relative Widow's Peak

tongue curl Free ear pinna

1. Demonstration of hereditary mechanisms in humans

2. Prepare a pedigree and place the genotype or phenotype of each individual

IV BIBLIOGRAPHY

1. Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
2. Stansfield, W. 1992. Theory and Problems of Genetics. Schawm Compendium Series. 3rd
Edition, McGraw Hill. Inc. Colombia
3. Stern, C. 1973. Human Genetics, 3rd edition. Alhambra, Spain
4. Strickberger, M. 1988. Genetics. Omega S Publishing. TO. ; Barcelona, Spain.
5. Watson J. 1982. Molecular biology of the Gene. Winchester Educational Fund, A.
1968. Genetics. Laboratory Manual. WM. c. Brown Company Publishers, USA Inter-
American, Mexico

2
4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE N°4

INTERALLELIC RELATIONSHIP

INTRODUCTION

Gene interaction can be defined as the mutual influence between alleles from the same locus or
alleles from different loci.
On some occasions, the trait we are analyzing may be controlled by a single locus. The seven
characters analyzed by Mendel in his crosses behaved as if controlled, each of them, by a single
locus. The interactions between alleles at the same locus are Dominance (3:1 segregation in F 2 ),
Intermediate Inheritance (1:2:1 segregation in F 2 ), New Character (1:2:1 segregation in F 2 ) and
Codominance (1:2:1 segregation in F 2 ). The two alleles of each of the seven loci that control seven
characters analyzed by Mendel show Dominance relationships (A>a).
EPISTASIES: Epistasies occur when the character studied is governed by more than one locus.
The simplest situation that we can imagine would be that of a character controlled by two loci, each
locus with a pair of alleles: A,a and B,b. In this case, in addition to influences between alleles of the
same locus (influence of A on a, and influence of B on b), influences occur between alleles of
different loci (influence of alleles A on alleles B and vice versa). .
There are many morphological characters that are governed by more than one locus, the flower
coloration character in many plant species is controlled by at least two different loci. The coat
coloration character in many animal species is determined by three different loci, even in some
cases up to four different loci influence. Therefore, epistasis or interactions between alleles of
different loci that influence the same trait can be quite complex.
However, to better understand epistasis, we will assume that the analyzed trait is controlled by only
two loci: A,a and B,b. The segregation of two independent loci in the offspring of the crossing of
two diheterozygotes (AaBb x AaBb) is 9AB:3Ab:3aB:1ab, but as a consequence of the interactions
between the alleles, this segregation can be modified.

TYPES OF EPISTASIES
Epistasis is classified based on the interactions that take place between the alleles of the
two loci as follows:

Interaction type Genotypes

AB- A-bb aaB- Aabb
Without modification of
segregation 9 3 3 1
9:3:3:1 (Classical epistasis)
Simple Dominant Epistasis 12 3 1
Simple Recessive Epistasis 9 3 4
Duplicated gene epistasis with
9 6 1
cumulative effect
Double Dominant Epistasis 15 1
Double Recessive Epistasis 9 7
Epistasis Double Dominant- 13 3 ____________

2
5
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

11. GOALS

• Recognize the different types of epistatic interactions.

III MATERIAL AND METHOD

Through the following examples, recognize the different types of interactions.

WITHOUT MODIFICATION OF SEGREGATION 9:3:3:1

For example, the crest shape character of chickens, or the plant color character in cabbage (
Brassica olearcea ).

Non-epistatic gene interaction

No gene inhibits or suppresses the action of another. The interaction can make new
phenotypes appear (1) Without modification of the
Mendelian proportions
Example: chicken crest (A/a, B/b, A>a, B>b)
A: rosette; B: pea; a: nut; b: sawn;
A_B: Walnut A-bb: Rosette aaB- Pea aabb: Sawn
AaBb x AaBb
9 (walnut) 3 (rosette) 3 (pea) 1 (simple)

SINGLE DOMINANT 12:3:1

The dominant allele of one of the two loci (for example
allele A ) suppresses the action of alleles B and b of the
other locus. In the case of practical corn cobs, the
dominant allele of locus A produces Purple color in the aleurone that prevents seeing the
color of the endosperm, only when the plants are aa (colorless aleurone) is it possible to
observe the color of the endosperm, which is controlled by a locus whose dominant allele B
gives rise to yellow pigment and the recessive b blocks the synthesis of said pigment.

2
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

DOMINANT SIMPLE EPISTASIA

Precursor I
Aleur
Final Product Color of the
(Colorless) (Purple)

Precursor Final Product

one
F 2 cob with segregation 12 (White) (Yellow) Color of! Yo
Purple :3 Yellow : 1 White SEGREGATION 9 AB 3 Ab
3
I _1

Two independent loci (A,a and B,b) control

SEGREGATION 12 Purple 3 Yellow ab
1 White |

the color of the aleurone and the locus B,b the

color of the endosperm. If the aleurone is
colorless or transparent (genotype aa) the
color of the endosperm can be seen. The
enzymes produced by the a and b alleles are
incapable of transforming the corresponding
compounds

SIMPLE RECESSIVE
9:3:4
The recessive allele of one of the two loci (for example the a allele) suppresses the
the B and
action of b alleles of the other locus. For example, the inheritance of coat color in
Labrador breed dogs. There are black, brown and gold Labrador retrievers. He
Allele B produces black color, allele B produces brown. The A allele allows the
appearance
of color and the a allele prevents the appearance
P 1 Black P 2
Gold

AABB aabb
1st Generation
Subsidiary F 1

Black (AaBb) Black (AaBb)

Black Brown Gold Gold Two independent loci (A,a and B,b) control coat color.
The allele prevents the production of the Intermediate
and, therefore, the expression of the B and b alleles
9 A- B- 3 A- bb 3 aa B- 1 aa bb that form Black and Brown pigment, respectively.
F2: 9 black: 3 Brown: 4 gold

This same situation can also be observed for the fur color of mice: there are agouti
(gray), black and albino mice. In the crossing Agouti (AABB) by Albino (aabb) all
the descendants are Agouti (AaBb). Crossing heterozygous Agouti mice (AaBb x
AaBb) produces offspring consisting of 9 Agouti: 3 Black and 4 Albino . In the
following photograph, instead of an albino mouse, you can see a yellow mouse.

2
7
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Different genes determine hair color

□ .4 gene = determines pigment distribution -B gene = determines pigment color
- A= agouti;black with yellow bands - B = black pigment
- a = non-agouti; homogeneous or solid pigment - b = brown pigment ____________

- A r = yellow; lethal recessive - B/- ; A/- = agouti EEA

- a' = “black and tan'; yellow belly, dark elsewhere - B/- ; a/a =
solid black •
-_-b/b; A/- = cinnamon________________E====

DOUBLE DOMINANT 15:1 (DUPLICATED GENES)

Allele A alone or allele B alone can produce the final product. For example, allele A
produces one type of chlorophyll (green) and allele B produces another type of
chlorophyll (also green).

Two independent loci (A,a and B,b) control plant color. Allele A produces chlorophyll by a
different route than allele B, which also produces chlorophyll. Therefore, the color green
appears with either of the two dominant alleles, only A, only B, or both A and B. The
enzymes produced by the a and b alleles are incapable of transforming the corresponding
compounds. So aabb plants lack chlorophyll and are albino.

DOUBLE RECESSIVE 9:7 (COMPLEMENTARY GENES)

For a certain character to manifest, the simultaneous presence is necessary
of both dominant alleles, A and B. For example, the color of the flower
pea.

Two independent loci (A,a and B,b) control flower

color. The enzymes produced by the A and B alleles
are needed simultaneously to form the Purple Pigment.
The enzymes produced by Alleles a and b are
incapable of transforming the corresponding
compounds.
In the case of corn cobs with 9:7 segregation, both dominant alleles are needed at the same
time to produce the red pigment.

2
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

DOUBLE DOMINANT-RECESIVE 13:3

The dominant allele of one locus (for example A ) and the recessive allele of the other locus
(for example b ) respectively suppress the action of the other alleles. For example, one locus
( A,a ) that inhibits pigmentation and another locus ( B,b ) that controls pigment production.
DOMINANT-R DOUBLE

Y
h Product
EPISTASIA
F
Precursor B Intermediary & -
(Yellow) ——• (Yellow) rb

F 2 cob with segregation 13

Yellow :3 Purple
SEGREGATION 9 AB 3 aB 1 ab

SEGREGATION
to

1 3 Yellow
3 Ab
oTwo
e la aleu rona.
loci (A,a and B,b) control the color l allele a The
of allele A produces purple pigment, locus B, aleurone
and yellow. The dominant allele B of elo b pe b is a
the pigmentation inhibitor, al limit
pigmentation.

F 2 cob with segregation 9 DOUBLE RECESIVE

Red :7 White
Precursor A Intermediary B Final product
□ (White) -.
to
(White) -
b
SEGREGATION 3 Ab 3 aB 1 ab
9AB
SEGREGATION 9 Red 7 White
EPISTASIA
Two independent loci (A,a and B,b) control the
color of the aleurone. The enzymes produced by
alleles A and B are simultaneously needed to form
the red pigment. The enzymes produced by the a
and b alleles are incapable of transforming the
corresponding compounds.

The red color in the endosperm of wheat is Duplicated genes with RRBB multiplicative
determined by the RB- genotype, the white effect x rrbb
color by the double recessive genotype
(rrbb); the genotypes R-bb and rrB- F1 RbBb
produce
brown endosperm. A pure red variety is F2 9/16 RB- red
crossed with pure white varieties. What do 3/16 R-bb, rrB- brown
you expect in F1 and F2? What type of 1/16 rrbb White
Epistasis is it?
IV PROPOSED PROBLEMS

1. In corn, genes A and C interact to produce pigmented aleurone in the grain. Any
combination of one of the dominant in a homozygous or heterozygous state with the
recessive of the other, as well as the doubly recessive, produces colorless aleurones. We
cross two plants that produce colorless aleurone grains and obtain an F 1 where all the

2
9
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

plants produce colored aleurones. Then we cross the F 1 with each other and obtain an F
2 in which out of every sixteen plants nine produce grain with pigmented aleurone and
seven produce grain with colorless aleurone. a) What type of genetic action regulates
these proportions? b) Regarding pigmentation or non-pigmentation of the aleurones of
the corn grain, what types of plants will produce the following crosses: Ccaa x ccAA;
CcAa x CcAa; ccAa x Ccaa; CcAa x ccaa; CCAa x CcAA?
2. In humans, deaf-mutes from birth are the result of a double recessive epistatic action.
Can two deaf-mutes have normal children?
3. In zucchini, the genes for spherical fruits are dominant over those for elongated fruits.
The crossing of two different varieties of spherical fruit gave the following F2: 89 disc,
62 spherical, 11 elongated. Check with a chi-square, whether these data fit the
reasonable modified proportion of dihybrid; Explain the form of inheritance, the
genotype and phenotype of F and the genotypes of F 2 .
4. It is known that coat color in mice is determined by several genes. The presence of a
yellow band of pigment near the tip of the hair is called the "agouti" pattern and is
produced by the dominant A allele. The recessive condition of this locus (aa) does not
have this subapical band and is known as non-agouti. The dominant allele of another B
locus produces black color and the recessive bb genotype produces brown. The
homozygous cc genotype restricts pigment production to the extremities of the body in
a pattern called Himalaya, while the dominant C allele allows pigment to be distributed
over the entire body. When crossing pure brown, agouti and Himalayan mice with pure
black, non-agouti, non-Himalayan mice, a) what are the expected phenotypic
proportions in F 1 and F 2 ? b) What percentage of the fully colored, black and agouti F
2 is expected to be of genotype AaBBCc? c) What percentage of all F 2 Himalayan mice
could show brown pigment? d) What percentage of all agoutis in F 2 could be expected
to exhibit black pigment?
5. The red color of the wheat endosperm is determined by the RB- genotype, the white
color by the double recessive rrbb genotype; the R-bb and rrB- genotypes produce
brown endosperm. A homozygous red variety is crossed with a white variety. a) What
phenotypic results are expected in F 1 and F 2 ?; b) If F 2 is artificially crossed at
random (normally wheat self-fertilizes), what genotypic and phenotypic proportions are
expected in the offspring?
6. A gene inhibitor of pigment production in onion bulbs ( Allium cepa L. ) exhibits
dominant epistasis over another locus. The iiR- genotype produces red bulbs and the
iirr genotype produces yellow bulbs. a) A pure white strain is crossed with a pure red
strain and produces a totally white F 1 and an F 2 with 12/16 white, 3/16 red and 1/16
yellow. What were the genotypes of the parents?; b) If yellow onions are crossed with a
pure white strain of a genotype different from the parental genotype in part (a), what
phenotypic proportions are expected in F 1 and F 2 ?; c) Among the white F 2 progeny
from part (a), suppose that 32 of genotype IiRR were found, how many progeny are
expected in each of the three phenotypic classes of F 2 ?
7. By crossing two types of oats, with black and white seeds respectively, F 1 presented
plants with black seeds, while F 2 produced 418 plants with black seeds, 106 with gray
seeds and 36 with white seeds. Explain the inheritance of oat seed color.
8. In the Spanish Cocker, skin color is determined by two pairs of genes that segregate
independently. The presence of a dominant gene A and one B determine the black
color; aa with a dominant B allele produces liver-colored skin, bb with a dominant A
allele is red, and aabb is lemon-colored. A black cocker is crossed with a lemon-colored
cocker and they produce a lemon-colored litter. If this same black cocker is crossed

3
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

with another of the same genotype, what type of offspring would be expected?
9. A variety of peppers with brown fruit was crossed with a variety with yellow fruit. The
plants resulting from F 1 had all red fruits. With this information alone give two
possible explanations for the inheritance of fruit color in peppers. What additional
information would be needed to decide between them?
10. When the red fruit F 1 plants gave rise to F 2 , a set of: 182 red fruit plants, 59 brown
fruit plants, 81 yellow fruit plants was obtained. What will be, according to these data,
the genetic base? of the inheritance of fruit color in peppers? Test your hypothesis
using the X 2 test.
11. The white color in the pumpkin fruit is determined by a dominant gene (W) and the
colored fruit by its recessive allele (w). The yellow fruit is determined by a hypostatic
gene (G) of the previous one that segregates independently of it and the green fruit by
its recessive allele (g). When dihybrid plants are crossed, do the offspring obtained
follow the proportions of a dominant epistasis? What phenotypic proportions will be
expected in the offspring of the following crosses? Wwgg x WwGG; b) WwGg x
green; c) Wwgg x wwGg ; d) WwGg x Wwgg; e) If two pumpkin plants are crossed
and the offspring obtained are 1/2 yellow and 1/2 green. Determine the phenotypes and
genotypes of the parental plants.
12. If a double heterozygote, through self-fertilization, gives rise to 9:7 offspring, what
offspring will be obtained if said heterozygote is used in a test cross? If this time it is a
double heterozygote that, through self-fertilization, produces 9:3:4 offspring, what
offspring will it produce when used in a test cross?

IV BIBLIOGRAPHY
1. Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
2. Stansfield, W. 1992. Theory and Problems of Genetics. Schawm Compendium Series. 3rd
Edition, McGraw Hill. Inc. Colombia
3. Stern, C. 1973. Human Genetics, 3rd edition. Alhambra, Spain
4. Strickberger, M. 1988. Genetics. Omega S Publishing. TO. ; Barcelona.
5. Watson J. 1982. Molecular biology of the Gene. Winchester Educational Fund, A. 1968.
Genetics. Laboratory Manual. WM. c. Brown Company Publishers, USA Inter-American,
Mexico
PRACTICE Nº 5

INHERITANCE OF SEX: DETERMINATION, LINKED, LIMITED AND

INFLUENCED

I .- INTRODUCTION

We are too accustomed to thinking about sex in terms of the males and females of our own or
domestic species. What is more, not all organisms have only two sexes; some of the lower forms of
plant and animal life, for example, may have several sexes. For example, in a variety of ciliate
protozoan Paramecium bursaria there are eight sexes or “mating types,” all morphologically
identical. Each of them is physiologically incapable of conjugating with its own type, but can
exchange genetic material with any of the other seven types within the same variety.

The important thing about sex is that in one of the sexes of many organisms there is a pair of
different "sex" chromosomes , of inheritance is peculiar. In addition, it will also be seen that sex can
influence the expression of some genes.

Sex determination

3
1
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

• Phenotypic determination . In many species, the genetic makeup does not completely determine the type
of sex, and it is the environmental conditions that make this determination. Many higher plants that
produce hermaphrodite flowers can masculinize or feminize their flowers when treated with some
phytohormone. In some marine worms of the class Polychaetes , young individuals are all male and
adults are all female. Furthermore, when several females grow together in a closed environment, the
youngest ones end up becoming males, under the influence of an ectohormone produced by the mature
eggs. In species of frogs and toads, males are hermaphrodites in their juvenile phase and adult females
can become hermaphrodites and even males. In Rana temporaria , genetically female larvae that develop
at 28:C give rise to males and genetically male larvae, and genetically male larvae that develop at less
than 10:C, give rise to females.
• Genetic determination. In some species, sexual determination is produced by a gene with several alleles.
This is the case of the devil's pickle , in which there are three alleles for sexuality:
o aD is the dominant allele and determines masculinity
or a+ is the intermediate allele and determines monoecious plants (plants with male flowers
and female flowers)
or ad is the recessive allele and determines femininity
• Chromosome determination. The most common case of sexual determination is that in which the genes
that determine sexuality are gathered on certain chromosomes called sex chromosomes . In all the cells
of an individual, except in the gametes, there are two series of chromosomes, which form pairs of
homologues , that is, their chromosome endowment, which we represent by 2n .
• Karyotypic determination. In social Hymenoptera (bees, wasps.) sex is determined by chromosomal
endowment: diploid individuals are female and haploid individuals are males .

SEX-LINKED INHERITANCE

In the human species, the X and Y chromosomes present morphological differences (Y is smaller
than X) and have different gene content. They are composed of a homologous segment where genes
that regulate the same characters are located and another differential segment , in the latter there are
both the genes exclusive to the The characters whose genes are located in the differential segment of
the X chromosome, such as color blindness, hemophilia, ichthyosis, are linked to sex .

• Example: Color blindness . It consists of the inability to distinguish certain colors,

especially red and green. It is a trait regulated by a recessive gene located on the differential segment of
the X chromosome . The possible genotypes and phenotypes are:

WOMEN MAN
X D X D : normal vision X D Y: normal vision
X D X d : normal/carrier X d Y : color blind
X d X d :colorblind

• Example Hemophilia It is characterized by the inability to clot blood, due to the mutation of one of the
protein factors. As with color blindness, it is a recessive character , and it mainly affects men since
possible Xh Xh hemophilic women are not born, since this homozygous recessive combination is lethal in
the embryonic state. The possible genotypes and phenotypes are:

WOMEN MAN
H H H
X X : normal X Y : normal
H h
X X : normal/carrier XhY:
hemophiliac
X h X h :hemophilic (not
born)
INHERITANCE INFLUENCED BY SEX
Some genes located on autosomes, or in homologous areas of sex chromosomes, are expressed differently
depending on whether they are present in males or females. Generally this different behavior is due to the

3
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

action of male sex hormones. As an example of these characters, we can cite baldness in men, a lock of
white hair , and the length of the index finger. If we call the normal hair gene "A" and the baldness gene
"a." The "a" gene is dominant in men and recessive in women. According to this we will have the following
genotypes and phenotypes for hair.
Genotype Men Women
AA Normal Normal
Ah Bald Normal
Ah Bald Bald spot
Inheritance limited to sex
Some autonomic genes may be expressed in only one of the sexes, either due to differences in the internal
hormonal environment or due to anatomical differences. For example, milk's expression is limited to female
mammals.
Genotype Males Females

HH chicken plumage chicken plumage

HH chicken plumage chicken plumage
HH rooster plumage chicken plumage
II .- GOALS

• Solve problems about sex determination, binding, limited and influenced by sex.
III .- MATERIAL AND METHODS

1 .- If a woman has three sons, one hemophiliac and two color blind, what is the most
likely genetic constitution of said woman?

2 .- In the domestic rooster, a gene that affects the speed of plumage development is linked
to sex: the K allele for slow development is dominant over the k that produces rapid
development speed. The allele that produces "rosette crest" dominates over the allele
that determines normal crest and is controlled by an autosomal gene. A KKRR rooster
is crossed with a rapidly developing hen with a normal crest. Give the genotypes and
phenotypes in F 1 and F 2 to each sex. A slowly developing male with a rosette crest is
crossed with a slowly developing female with a normal crest. All males of the offspring
are slow to develop. Half have a rosette crest and the other half have a normal crest. Of
the females of the offspring, 1/4 have slow development and a rosette crest, 1/4 have
rapid development and a rosette crest, 1/4 have slow development and a normal crest,
and 1/4 have rapid development and a normal crest. Determine the genotype of the
parents.

3 .- Nystagmus is a disease that causes double vision due to involuntary oscillation of the
eyes. This disease is controlled by a sex-linked recessive allele. A man and a woman,
both with normal vision, have four offspring, all of whom marry normal individuals.
The first male child has Nystagmus, but has a normal daughter; The second is normal
and has a normal daughter and a normal son; The first daughter is normal and has 8
children who are all normal; The second daughter has two normal daughters and two
sons, one normal and one affected. a) Indicate the genotype of all family members; b) If
the original parents had had another offspring, what is the probability that it would be a
normal male, an affected male, and an affected daughter?; c) If the original mother was
affected and the father was normal? Could any offspring present the sex-linked
recessive character?

3
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

4 .- The pattern of baldness in humans is the result of the expression of an autosomal

factor ( B ) dominant in males and recessive in females. Its allele ( b ), not bald,
behaves as dominant only in females. What will be the result of the following matings?:
a) A normal man and a normal woman heterozygous for the pair of alleles; b) A normal
man and a bald woman; c) A bald man whose father was not bald and a normal
homozygous woman; d) We consider the alleles for baldness together with the sex-
linked alleles that affect color vision ( P , p ). The P allele is required for normal vision
and p is recessive and responsible for color blindness. Give the results of a cross
between a non-bald, color-blind man and a non-bald, normal-sighted woman whose
father was color-blind and whose mother was bald.

5 .- In men the presence of a fissure in the iris is regulated by a recessive gene linked to
sex. From a marriage between two normal people, a daughter with the aforementioned
character was born. The husband files for divorce alleging the wife's infidelity. Explain
the mode of inheritance of character and the conditions under which the husband's
lawyer can use the birth of the affected daughter as evidence of infidelity.

6 .- In the Ayshire breed of dairy cattle, the mahogany and white color depends on a CM
gene that is dominant in males and recessive in females. Its allele for red and white
(CR) acts as dominant in females and recessive in males. a) if a red and white male is
crossed with a mahogany and white female, what genotypic and phenotypic proportions
are expected in the F and F2?; b) if a mahogany and white cow has a red and white calf,
what is its sex?; c) What genotype is not possible in the male parent of the calf at point
b?

9 .- In canaries, the green variety with black eyes depends on a dominant factor linked to
sex and the cinnamon variety with red eyes is the product of a recessive allele. A tan
male is crossed with a green female, what will the F1 look like? Which one is the F2?

10 .- The lower part of the chicks of birds of paradise, of genotype S-, have dark stripes,
while the recessive genotype ss, causes in both sexes that the lower part of the body is
yellowish white without stripes. However, in adult plumage this characteristic behaves
as a character limited by sex. Males develop the typical plumage of birds of paradise,
regardless of their genotype. Females of the S- genotype show the normal plumage of
birds of paradise, but the recessive ss have a buff color. creamy. A male without dark
stripes at birth is crossed with three females, each of which lays 16 eggs. Among the
progeny of 48 chicks, there are 32 unstriped and 16 striped. When they reach maturity
there are 16 buff-creamy in color and 32 with the normal plumage of birds of paradise.
What are the most likely genotypes of the three parent females?

11 .- Consider simultaneously two traits influenced by sex: pattern baldness and a

shortened index finger, both dominant in men and recessive in women. A heterozygous
bald man with a long index finger marries a heterozygous bald woman with a long
index finger, determine the expected phenotypes of their children.

12 .- In a species of moth in which the female's sex chromosomes are XO and the male's
chromosomes are XX. a) How would the occasional transmission of a sex-linked
recessive gene from mother to daughter be explained? b) How would we explain the
appearance of this type of mother-daughter transmission in all crosses of a given strain?

3
4
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

13 .- Achromatopsia or color blindness is due to a recessive gene linked to sex, and

hemophilic jaundice is due to a dominant gene linked to sex. If a color-blind man (di)
marries a normal woman who suffers from hemophilic jaundice (DDII). a) What will be
the phenotype and genotype of the sons and daughters of this marriage and in what
proportions? b) If a DdIi woman marries a Ddi man, what will be the phenotypes of the
sons and daughters of this marriage and in what proportions?

14 .- In dogs, a recessive factor associated with sex produces a hemophilic condition,

similar to that in humans, but the female never exhibits this disease because recessive
homozygosity has a lethal effect. If two normal animals intersect and are born

3
5
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

15 a hemophilic male puppy. What are the genotypes of the parents? If the two animals
interbreed again, what would be the probability that a non-hemophilic male puppy
would be born?

16 .- Consider the following 3 pedrigrís, referring to the same character in humans

3
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

a) Of the following possibilities, which could you exclude?: dominance,

recessivity, autosomy, sex-linkage. b) What individual have you based on to reject
each of them? c) according to your hypothesis, decide which genotype is expected
in individuals II-1, II-6 and II-9, using the symbols A and a .

17 .- A virgin female Drosophila with very short thoracic setae is crossed with a male
who has normal (long) setae. In F 1, 1/3 females with short setae, 1/3 females with
long setae, and 1/3 males with long setae are obtained. Crossing F 1 females with
long setae with their brothers gives only offspring of individuals with long setae.
A cross of the short setae females with their brothers gives: 1/3 long setae females,
1/3 short setae females and 1/3 long setae males. Give a genetic explanation for
these results.

18 . A sex-linked recessive gene determines hemophilia. From the information

obtained in the following pedigree, answer the following questions:

Hemophilic man Normal man Normal Woman

If II 2 marries a normal man. a) What is the probability that her first child will be
a hemophiliac child? Suppose your first child is a hemophiliac, b) What is the
probability that your second child is a hemophilic child? If I1's mother was a
carrier, c) What was the phenotype of I1's father?

19 .- Indicates the genotype of a bald man whose father was not bald, that of his wife
who is not bald, but whose mother was, and that of his future children.

20 .- What genotypic proportion can be expected in a marriage between a color-blind

man and a carrier woman? What proportion of color blind people can be expected
in the family if you have eight children?

21 .- In the domestic rooster, a gene that affects the speed of plumage development
is linked to sex: the K allele for slow development is dominant over the k that
produces rapid development speed. The allele that produces "rosette crest" dominates
over the allele that determines normal crest and is controlled by an autosomal gene. A
KKRR rooster is crossed with a rapidly developing hen with a normal crest. Give the
genotypes and phenotypes in F 1 and F 2 to each sex. A slowly developing male with a
rosette crest is crossed with a slowly developing female with a normal crest. All
males of the offspring are slow to develop. Half have a rosette crest and the other half
have a normal crest. Of the females of the offspring, 1/4 have slow development and
a rosette crest, 1/4 have rapid development and a rosette crest, 1/4 have slow
development and a normal crest, and 1/4 have rapid development and a normal crest.
Determine the genotype of the parents.

3
7
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

VI.- BIBLIOGRAPHY

1 Anderson, P. and Ganetzky, B. 1997.An electronic companion to Genetics

Worbook. Gogito Learningg Media Inc. New York, San Francisco.
2 Fustinoni, E. 1979. Human Genetics. Volume II. 2nd edition Alhambra-Madrid
3 Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain
4 Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
5 Klug, W. and Cummings, M. 1994. Concepts of Genetics. Fourth Edition. Merrill
Publishing Company, United States of America.
6 Stansfield, W. 1992. Theory and Problems of Genetics. Schawm Compendium
Series. 3rd Edition, McGraw Hill. Inc. Colombia
7 Stern, C. 1973. Human Genetics, 3rd edition. Alhambra, Spain
8 Strickberger, M. 1988. Genetics. Omega S Publishing. TO. ; Barcelona, Spain.
9 Ramses, A. 2006. University Manual of General Genetics Practices. National
Assembly of Rectors. Lime. Peru.

3
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 6

POLYGENES AND HEREDABILITY

I .- INTRODUCTION

There are two types of inheritance that in principle seem to disagree with Mendelism:
quantitative inheritance and extranuclear inheritance. Quantitative inheritance does not give
Mendelian proportions. Instead, it generally gives a continuous distribution of trait variation.
The work of Johannsen, Nilsson-EhIe and East showed that a phenotype can be
determined by more than one gene. Indeed, if several pairs of genes with additive effects
determine the phenotype, and if the environment affects genotypic expression, then a normal
distribution of variation appears. But it is important to note that segregation and independent
distribution are still operating, even if Mendelian proportions are not obtained.
In the analysis of quantitative inheritance models we generally deal with an unknown
number of polygenes with additive effects, which can be modified by the environment. To
analyze such characters, we describe them statistically. To determine our sample, we can
calculate the mean, median, and mode. But these location points tell us nothing about the
variations between the individuals in the sample. To find this variation, we calculate the
variance and standard deviation. Finally, we have examined the procedure commonly used to
determine what part of the observed variation is the result of genetic differences, environmental
differences or genotype-environment interactions. Heritability expresses the degree to which a
particular phenotype is genetically determined and changeable by selection.
Polygenic inheritance cannot be analyzed using pedigrees or studying
chromosomes (unless a specific chromosomal aberration is studied). A polygenic trait
is the phenotype resulting from the action of two or more genes. These have some
common characteristics:
1. Traits are quantified by measuring ,
2. Traits are controlled by 2 or more genes resulting in an additive effect ,
3. Traits are controlled by the effect of multiple alleles ,
4. The phenotypes of polygenic and multifactorial traits vary in expression due to the
effect of environmental factors .
There are numerous examples of this type of inheritance, for example height, weight,
intelligence, skin color, etc.

II .- GOALS

- The student will be able to explain how polygenes behave and how heritability is
calculated by solving problems about the cases stated.
Analysis of polygenic inheritance in fingerprints

III MATERIAL AND METHODS

3.1 Suggested exercises

Clausen and Hisey carried out crosses between two Californian races of Pontella glandulosa .
One was a coastal population whose growth was active throughout the year and the other was
an alpine population inactive during the winter months. Measurements of the degree of growth
activity during the winter of F 1 and F 2 were taken from such crosses as follows:

Variety and Degree of growth during winter

type of Fully active Quite active Intermediate Quite a few Total
crossing inactive inactivity

4
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

P 1 (coastal) +
P 2 (alpine) +
F 1 (P 1 x P 2 ) +
F 2 (F 1 xF 2 ) 43 139 601 178 14
to. What types of genetic effects are involved in determining winter activity?
b. How many pairs of genes would you suggest are segregating to give the character?

SOLUTION
a. Taking into consideration the results of F 1 and F 2 , do the multiple factors involved
have an additive effect (is the growth activity of F 1 average compared to the parental
strains?
b. Based on the number of pairs of genes that segregate, the relative proportion of
individuals exactly the same as the original parents decreases. In the cultivation there
were 975 plants and 43 coastal type plants were recovered, and 14 of the alpine type,
that is, approximately 1/36 and 1/61 respectively; It can be concluded that probably 3
to 4 pairs of genes are involved in the degree of plant growth (4 x 4 x 4 = 64).
Answers
a. Additive effect
b. 3 to 4 pairs of genes

Assuming that genes A and B with their respective recessive a and b influence the height of a
replication in an additive manner. The AABB homozygous has a height of 100 cm and the aabb
homozygous has a height of 60 cm. a) What is the height of the hybrids? b) After a
conventional cross, part of the F2 has a height of 80 cm.

Data
Genes with additive effect AABB = 100 cm aabb = 60 cm
Solution AABB (100 cm) – aabb (60 cm) = 40 cm
Dihybrids AaBb 60 + 10 + = 80 cm, four additive characters for height we have:
40 / 4 = 10 cm per gen.
Taking as a basis the height of 60 cm (aabb) and for each gene with an additive character 10
cm; the dihybrid has a height of 60 cm + 10 cm + 10 cm = 80 cm (AaBb)

1/4BB 1/16 AABB 100cm

1/2 Bb 1/8 AABb 90cm
1/4 bb 1/16 AAbb 80cm
1/4BB 1/8 AaBB 90cm
1/2 Bb 1/2 AaBb 80cm
1/2 bb 1/2 Aabb 70cm
1/4BB 1/16 aaBB 80cm
1/2 Bb 1/8 aaBb 70cm
1/4 bb 1/16 aabb 60cm

1/4 AA

1/2 Aa

1/16 + ¼ + /16 = 3/8 = 37.5 %

1/2 aa
Answers :
a. The height of dihybrids is 80 cm.
b. 37.5% of the F 2 have a height of 80 cm

3.2 Fingerprint analysis

In 1890, Francis Galton suggested that fingerprints would be a good form of
identification for humans. In recent years, in fact, both

4
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Drawings of fingerprints (of the hands and feet) and of the prints of the palms of the hands and feet
have been of great interest to numerous specialized studies. An example of its usefulness is the
study of the newborn's footprint for the early diagnosis of chromosomal abnormalities.
The inheritance of fingerprints, like other polygenic inheritance characters, is also influenced
by environmental factors although, due to the precocity and rapidity of their development, the
phenotype will not change after birth. Fingerprints can be detected from the 6th week of fetal
development, reaching their greatest development around week 12-13. Later they will return until
they acquire the final morphology that will no longer be altered during the remaining prenatal and
postnatal development.

ARCHES TIES SPIRALS

Fingerprint classification

The patterns of the footprint drawings can be classified into three main groups: arcs, loops
and spirals. The arch is the simplest and least common pattern. In the traces where loops appear,
the lines appear in three directions, meeting at an intermediate point (the triradius ) with angles of
about 120 degrees. A triangle is formed in the center of the meeting point. The loops may be called
radial or ulnar , depending on which way they are inclined; For example, a little finger will have a
radial loop if its triradius opens towards the thumb of the same hand. An ulnar loop will be one that
opens from the thumb towards the little finger of the same hand. The spiral pattern presents two
triradios (forming two triangles). The frequencies of three estrus patterns in the population are 5.0%
for the arch, 5.4% for the radial loop, 63.5% for the ulnar loop, and 26.1% for the spiral.

Study of fingerprints: counting the lines

The objective of this study will be to study the total ridge count or TRC . Holt in 1968
determined that for men the average is 145 and for women it is 126.
Lines are to be counted from the triradius to the center of the footprint (see the white line in
the footprint images above), i.e. footprints that feature the arc pattern have a count of zero (there is
no triradius) . In spirals the count must be carried out from each triradius to the center of the trace.
Once all the lines of all the fingerprints per person have been counted, they will be added to obtain
the TRC. How CRT supports the polygenic inheritance model will be examined below.
Characteristics of some common syndromes:

Trisomy 21: fingers with usually ulnar loops, radial loops on fingers 4 and 5.

4
2
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Trisomy 18: poorly developed lines, high frequency of arches (average of 7-8 with at least one
arch). In thumbs without arches, with radial loops, low TRC counts.
Turner syndrome (45,X): high CRT count without increased coils.

Relationship between the mean CRT and the number of X and Y chromosomes

45, X 165 47, XYY 10

46, XY 145 48, XXYY 88
46, XX 126 48, XYYY 83
47, XXY 114 49, XXXXX 17

Individual data collection

(paste the adhesive tape with the footprints in each box here)

right thumb (I) right index (II) right heart (III) right ring finger right little finger
(VI) (V)

left thumb (L) left index (II) left heart (III) left ring finger left little finger (V)
(IV)

right hand
thumb Index heart Cancel pinky

pattern
obtained:
—— —— —— —— ——
partial
count:
- - - - -

count
total =
--
right hand

4
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

left hand
thumb -----Yo. heart Cancel pinky
-----
pattern Index
obtained:

partial - - - - -
count:
- - - - -

count
total = left
--
hand

Total count two hands: CRT=

3.3. - PROPOSED PROBLEMS

1- - In a given plant species the weight of the seeds is controlled by three independent loci, so that
each of the uppercase alleles contributes 15 mg to the weight of the seed, while each of the
lowercase alleles contributes 10 mg. a) Give the weight of the F 1 seeds from a cross between
two homozygous lines AABBCC (90 mg) and aabbcc (60 mg). b) How many different
(different) phenotypes and genotypes would you expect to obtain in the self-fertilization of the F
1 plants? c) What proportion of the F 2 seeds will have the same weight as the homozygous
parental lines? d) What proportion of the seeds with a genotype homozygous for the three loci of
this F 1 will have the same weight as the seeds of F 1 ?
2- Two homozygous inbred lines that differ in four loci that control a certain quantitative trait are
crossed to obtain the F 1 and the corresponding F 2 . What proportion of the F 2 will have the
same external appearance for the analyzed metric character as the inbred lines.
3- A farmer has four varieties of wheat (autogamous species) that differ in the red or white color of
their seeds. Variety A is white and the other three (B, C and D) are red. By crossing different
varieties, the following results have been obtained:
F1 F2
Cross varieties Color seeds No. seeds No. seeds
red white
AxB All red 324 108
AxC All red 330 22
AxD All red 315 5

a) How many loci appear to control seed color in these wheat varieties?

b) Indicate the most probable genotypes of the four wheat varieties used in the crosses.
c) This farmer has observed that variety D has a more intense red color than variety C and this,
in turn, is more intense than variety B. Likewise, in the F 2 of the indicated crosses different
intensities in the red color of the seeds have been observed. Propose an explanation for the
difference in intensity in the red color of the seeds and indicate what segregation you would
expect to obtain in each of the indicated crosses taking into account the variation in intensity
mentioned above. Assume that environmental influence is minimal and that there are no

4
4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

dominance or epistatic interactions.

4 Wheat variety A needs an average of 30 days for seed maturation, while variety B only needs 15
days. Both varieties were crossed to obtain F 1 , which was self-fertilized and produced 6,200,000
plants in F2. Ninety-five of the 6,200,000 F 2 plants were those that needed the shortest
maturation time and did so in 15 days on average. a) How many loci seem to be involved in the
determination of this trait in wheat?
5 - Two rabbits most appreciated for sale as pets are those with longer ears. In an initial population
of rabbits (G o ), the 25% with the longest ears were selected to reproduce and form the generated
filial (G 1 ). The following table shows the distribution of rabbits with different ear lengths in the
two indicated generations.
Ear length in (cm)
5 6 7 8 9 10 11 12 13 14 15 Total
Go 8 36 48 85 138 120 67 54 16 8 580
G1 12 44 48 60 108 64 40 20 8 404
a) Calculate the heritability of the trait "ear length" in this population of rabbits.
b) Will the heritability of the trait increase or decrease in subsequent generations of selection?
c) What will happen to genetic variance during successive generations of selection?

6- Emerson and East studied the inheritance of corn cob length. In one of their experiments they obtained
the results shown in the following table:
Cob length (cm)
Crosses 5 6 7 8 9 10 11 12 13 14 15 16 1718 19 2021
(1) P 1 x P 2 4 21 24 8
(2) P2 x P2 3 11 12 15 2615 10 7 1
(3) P1 x P2 1 12 12 14 17 9 4
(4) F 1 x F 1 1 10 19 26 47 73 68 68 39 25 159 1
of (3)
a) Make an estimate of the number of genes involved.

7 - The following table data the variance of two phenotypic characters in the run, length between
the wings and length of the beak.
Wingspan Peak Length
VP 271.4 VP 627.8
GO 71.2 GO 107.3
GOES 102 GOES 342.9
VGE 98.9 VGE 177.6

4
5
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Calculate the heritability of each trait and say why one of these traits is more susceptible to
selection pressure than the other.
8 .- According to Davenport, skin color in humans is controlled by two independent loci. If this
theory were correct, what type of color and what proportions will appear among the offspring of
the following marriages: a) Mulatto of the 1st generation x black b) White x white segregant c)
light mulatto x black d) light mulatto x dark mulatto; e) Assign all possible genotypes to
marriages whose members have the following phenotypes: White x light mulatto; light mulatto x
light mulatto; mulatto x mulatto f) What phenotypes, and in what proportions, can be expected
among the offspring of the marriages listed in section e).
10 .- Below are the quantitative measurements taken in 10 individuals: 8, 12, 10, 14, 11, 13, 12, 9,
9, 7. Calculate: (a) The mean, (b) The standard deviation, (c) The standard error of the mean,
(d) The 95% confidence interval within which the true mean of this character can be found.
11 .- Three inbred strains (A, B, and C) of a plant species were measured in centimeters, obtaining
the following means and variances:
Strain Half Variance
TO 70 49
b 193 841
c 315 3969
(a) Calculate the coefficients of variation, (b) Indicate the types of genes that can be thought to
cause the size differences in these strains.
12 .- Measurements of a given trait were taken in 10 individuals of each of the strains (A and B) of
a species in the same environment, obtaining the following results:
strain A 10, 12, 8, 14, 12,9,7,7, 13,6
strain B 13, 9, 14, 12, 10, 13, 15, 11, 14, 12
Are there significant differences in this trait between the two strains?
13 .- Two strains of mice (A and B) were developed in the same environmental conditions and were
fed the same amount of food. For each strain, 20 adult mice of the same age and sex were
weighed, and the results in grams are given below:
Strain average body weight Variance
TO 16 16
b 28 25
Are there significant differences in body weight between the two strains?
14 .- As an example of regression, Galton published the following results regarding the average
seed size of a group of 100 offspring of seven different classes of sweet pea parents. (Values
correspond to the diameter of the seed and are given in hundredths of an inch.)
Parental size
Size 15 16 17 18 19 20 21
middle of the 15,3 16,0 15,6 16,3 16,0 17,3 17,5
progeny

4
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

(a) Using progeny size as the dependent variable Y, calculate the regression
coefficient of Y on X. (b) How big would progeny be expected to be from a size
12 parent?
15 .- A cross was made between two strains of plants that differed in size, with
respective quantitative values of 20 and 14 centimeters. The F] of this crossing
is 18 centimeters. Calculate the degree of dominance.
16 .- The means and variances of the flowering date in two parental varieties of
wheat and in the progeny of their subsequent crosses were studied by Allard,
finding the following results:
Half Variance
P 1 (Ramona, early flowering) 12,99 11,036
P 2 (Baart, late flowering) 27,61 10,320
F 1 (P 1 XP 2 ) 18,45 5,237
F 2 (F 1 XF 1 ) 21,20 40,350
B 1 (F 1 x P 1 ) 15,63 17,352
B2 ( F1 x P2 ) 23,88 34,288
17. -The length of the leg and neck were measured in a species of mammal, observing
the following variances
Lenght of Length of
paw neck
Phenotypic variance 310,2 730,4
Environmental variance 103,4 365,4
Additive genetic variance 103,4 182,6
Variance of the 103,4 182,6
dominance
Explain which of the two characters would be modified more quickly by
selection.
18 .- Heritability for various traits in livestock estimated from data on the degree of
resemblance between identical twins is normally much higher than heritability
estimates using similarities between parents and offspring. What factors do you
think may contribute to these differences?
19 .- Assume a quantitative character, measured in mm. Two pure lines intersect.
AABBCCDDEE (80mm) and aabbccdd (40mm). We want to know: a) The
phenotypic value of an individual that has 7 maximum contribution alleles. b)
The frequency of F 2 individuals with a phenotypic value equal to 76.
20 .- Around 1903, Johannsen, a Danish botanist, measured the weight of the seeds
in the Princesa del frijo variety. The beans are self-fertilizing and therefore this
variety is pure. The weight in cg of a small but representative sample is listed
below: 19, 31, 18, 24, 27, 28, 25, 30, 29, 22, 29, 26, 23, 20, 24, 21, 25, 29 . a)
Calculate the mean and standard deviation of the weight of the fixtures in this
sample. b) Calculate the environmental variance. c) Estimate the heritability of
the fixol weight in this variety. d) If the average weight of the beans selected to
be parents of this population is 30 cg, calculate the average weight of the beans
in the next generation.

4
7
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

IV BIBLIOGRAPHY
1. Jimenez C. 1999. 360 Genetics problems. Synthesis Editorial. Madrid Spain.
2. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium
Series. Third edition. McGraw Hill. Inc Colombia.
3. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.
4. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.
5. Visors E. 1998. Issues and solved problems in Genetics. University of Granada.
Spain

4
8
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE N°7

EFFECT OF ENVIRONMENTAL FACTORS AND THE INTERNAL

ENVIRONMENT ON THE
GENETIC EXPRESSION

I .- INTRODUCTION

They are those that give rise to phenotypic changes that seem directly correlated with
observable variations in the external environment of the organism. There are many factors of
the external environment whose effects on the phenotype can be discussed, only some of
them are presented here. TEMPERATURE : It is expected that the intimate correlation
observed between the speed of chemical reactions and temperature in various solutions is also
present in living organisms. According to Goldschmidt, the basic effect on the development
of most genes lies in the control of the speed of a specific reaction. Since many genes act in
this sense, it can be assumed that an alteration in temperature has a widespread effect on
development. LIGHT: also provides kinetic energy and in practically all plants constitutes an
essential source for the growth and development necessary for the complete expression of the
genotype. In fact, many plants grown in the dark, even if they survive for a short period, will
not produce chlorophyll and will appear albino even though they have genes for color.
NUTRITION: Although living organisms synthesize a variety of necessary compounds, all
require, to one extent or another, environmental material introduced in the form of food,
which serves diverse functions, including the supply of energy to carry out necessary
processes and materials that must be incorporated into structures. However, genetically
different organisms even of the same species generally differ in the type and amount of
nutrients they require. This can easily be seen when organisms, due to mutations, are unable
to synthesize specific compounds that must then be added to their diet in the form of extra
nutrients.
As an example, one can cite the nutritional mutants of Neurosporas originally discovered by
Beadle and Tatum. Normally Neurospora can grow in a simple medium containing
inorganic salts, sugar and biotin (vitamin B). Through a special technique for identifying
nutritional mutants, Beadle and Tatum found numerous varieties whose diet had to be
supplied with specific chemical compounds. Currently, the types of nutritional supplements
that different strains of Neursopora require for their growth range from ammonia through
most of the amino acids that make up proteins to compounds such as adenine and uracil.
Depending on the genotype, simple modifications in Diet can lead to important consequences
for an organism. In rabbits, for example, the appearance of yellow fat depends on two factors:
the presence of a homozygous recessive genotype and xanthophylls in the diet. Additional
examples of the gene-diet relationship are found in the appearance of yellow legs and yolks in
the chicken. MATERNAL RELATIONSHIPS: When direct bodily relationships between
parent and offspring extend beyond fertilization, as in mammals, additional interactions may
occur between the fetus and the mother's internal environment. The action of the environment
on the genotype is not limited to external events, but can also include less obvious internal
changes. Internal environmental effects are those that give rise to phenotypic changes that
seem to be primarily correlated with modifications inside the organism. Among them we can
mention: AGE: in each age interval phenotypic variations occur that allow the expression of
other genotypic characters. The effect of genes that influence feather color in chickens and
hair color in mammals, for example, depends on the appearance of these structures during
development. In man some of the effects of age have been documented with great care and
accuracy. In any case, the genes responsible for the effect considered are present from
fertilization; It is just the phenotypic expression that depends on the

5
0
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

age of the organism. SEX: in general, the phenotypes that accompany sexual differences are
evident in many physical characteristics associated with the reproductive functions and with
the specialized behavior of each sex. To some extent, such differences arise from genes
present in one sex and absent in the other. However, numerous phenotypic differences occur
between the sexes that are due to genes that are present in both sexes. For example, these
genes are responsible for the appearance of horns in one sex of certain species of sheep and
their absence in the other, or the genes that influence the amount of milk produced by cows.
SUBSTRATES: the type of reactions that take place in an organism depends to a high degree
on the materials that are present inside. In many cases these are synthesized by metabolic
actions of the organism and often their presence or absence can be traced back to genetic
control. Phenylketonuria, accumulation of phenylalanine due to the inactivation of its liver-
specific enzyme, phenylalanine hydroxylase, which prevents the conversion of phenylalanine
to tyrosine, causing a variety of symptoms including early idiocy. In many cases, knowledge
of the substrates involved has allowed successful treatment of the disease, since patients
placed on a diet low in phenylalanine show some improvement in symptoms. The sugar level,
which is normally controlled by the pancreatic hormone insulin, is not properly regulated in
patients with diabetes mellitus. High blood sugar and excretion of sugar in the urine are
among the symptoms that over time can lead to a change in the body's metabolism, from the
use of sugars as a source of energy to the excessive use of acids. fatty. The treatment of
diabetics includes both a restriction in the ingestion of sugars and carbohydrates and, when
necessary, the administration of insulin. There is a double aspect in this environmental
relationship. On the one hand, genes constitute this environment and on the other hand they
also depend on its presence for their own activity and effect. Therefore, talking about gene
activity without specifying or at least implying a certain environment has little real value.
Examples of the environment in the expression are found in different species, for example in
man:
One of the most important environmental causes of malocclusion is long-term habits
that can alter the normal function and balance of teeth and jaws. Pressure habits
interfere with the normal growth and function of orofacial muscles. Among these we
can mention:

• Digital suction, among which the most common is thumb sucking, holding it
in a vertical position. (Fig. 1)
• Lip sucking, which occurs in malocclusions that are accompanied by a large
incisor overjet. (Fig.2)
• Oral breathing, which may appear as a consequence of the reduction in the air
passage of the nose or nasopharynx due to mechanical or allergic
circumstances. (Fig. 3)

Fig.2: Lip sucking habit

Fig.1: Digital sucking habit.

5
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

The problem appears when it is prolonged over time. The appearance of a

malocclusion due to a habit depends on the number of hours (duration and frequency)
in which the habit acts, rather than its intensity. Other environmental factors that
influence the etiology of malocclusion include premature tooth loss, dental caries,
trauma, and tumor and cystic pathologies. 5

Fig.3: Patient Oral Respirator.

Environmental factors most affect anteroposterior dimensions, that is, depth
measurements, such as maxillary length, mandibular length, overjet, and molar
relationship, which are measures of the anteroposterior link of the mandible with the
maxilla.

II .- AIM

1 At the end of the practice, the student will explain the effects of the external
environment on the expression of genes.
2 At the end of the practice, the student will explain the action of the individual's
internal environment on the expression of genes.

III . MATERIAL AND METHODS

3.1 Model Exercises

1. In mice, the hair-loss (hl) gene is related to the absence of hair growth, and is
considered deleterious. However, homozygous hairless females (hl/hl) mated with
normal heterozygous males (hl/hl+).
males Hl hl+
females
hl 30 hl/hl 15 hl/hl+
hl 30 hl/hl 15 hl/hl+
Answer: The equivalent proportions that would be expected between normal and
hairless offspring are not produced. It is known that normal heterozygous embryos
from these mothers suffer calcium losses and die normally as they grow. When the
mother is normal, however, there is no loss of calcium and there is no

5
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

There is no change in the expected proportions in the offspring. There is an effect of

maternal relationships.
2. 126 pairs of identical twins and 38 pairs of fraternal twins were analyzed for the
character of blood pressure and the following results were obtained:
Twins
Identical Fraternal Totals
Discordant Concordant 82 44 126
Discordant 16 22 38
Totals 98 66 164
Answer:
It is known that the results are dependent (contingent) on the conditions in which
they were observed. We can ask ourselves if the observed results are independent
of the conditions of the experiment. Using contingency chi-square. To prove
dependence or independence. The hypothesis will be H1: it is the environment that
influences this character Ho= it is genetics that influences the character.
The concordance for identical twins will be 82/98=0.84 = 84% (genetics)
The agreement for fraternal twins will be 44/66 = 0.67 = 67% (environmental) By
doing an independence test we can obtain:
2 _( I (82 x 22 ) - (16 x 24) I J - 1/2(164)) 2
5. -5
(82 + 44)(82 + 16)(16 + 22)(44 + 22) .
The null hypothesis is accepted and the alternative hypothesis rejected, therefore in
our example the character has a significant genetic component.
Third way of checking:
Identical Fraternal
Concordant 84 % 67 %
Discordant
Discordant 16 % 23 %
Totals 100 % 100 %
Twins
3.2 Suggested exercises
1. Genetic:
The 84 +23 = 107 following
g of glucose, taken at intervals over a period of 4 hours, taking
into account one pair of identical twins (A) and the other of non-identical ( B). What
inferences can you make about the environment and gene expression?
Environmental = 16 +67
= 83

5
3
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Twins Both affected One affected

Identical 115 11
Fraternal 42 51
mental retardation in
twins:

2. The following table provides the data collected by several researchers regarding the
Explain the relative proportions in which
heredity and the environment participate.
3. A wild Drosophyla, treated with a mutagenic agent, crosses with a fly
Cy/Pm (Cy and Pm are lethal in homozygosity), the F1 Cy flies were maintained at the permissive
temperature of 25°C, the F2 eggs were incubated at 29°C and produced the following results:
Phenotypes
Cy/Pm P.m Explain the results obtained.
T|° 25 372 125
29 300

4. Meir, Myers, and Huebner estimated the frequency of leukemia in mice that differed only by the
presence of one gene; one type was hairless, hr/hr, and the other had hair but was heterozygous for the
hr/hr + gene. Both mice carry murine leukemia virus. The results of their observations are given in the
following table:
Genotype Age T-probe
8 to 10 months 18 months
hr/hr 141 243 337
hr/hr + 4 56 279
a) It could be said that the incidence of leukemia is independent of age and genotype. b) In a
heterozygous cross, what proportion of offspring could be expected to be leukemic at 8
to 10 months, based on these data? (hr + /hr + = not leukemia).
5. Phocomegaly (one or more limbs reduced to an appendage) is a genetic disease; In 1960, it was
discovered that thalidomide, a medication consumed as a tranquilizer, produced phocomegaly in
children whose mothers consumed it. Between 1960 and 1962, in both Great Britain and West
Germany, 57,837 were born, whose stories show us the following available data:
1960 1961 1962
January July August October Total
Total births 19052 1991 13326 5542 57837
Malformations such as 28 60 40 2 130
Phocomegaly

5
4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

History
Having taken thalidomine 13 46 33 2 94

No testing 0 5 1 0 6
No history available 15 9 6 0 30
In view of the results, what can be concluded, regarding environmental influence?
6. In a study on blood pressure, it was found that 62 pairs of identical twins agreed for this character
while 98 pairs agreed, while 80 pairs of fraternal twins presented concordant pressure readings and
210 differed in terms of the character. a) What are the relative influences of environment and
heredity on this trait? b) How would you explain the difference in concordance of monozygotic
twins with respect to this trait)
7. Vesel and Page recorded the time it took to halve a given dose of the drug antipyrine in the blood of 9
pairs of identical twins and 9 pairs of fraternal twins. If we interpret their results as representative of
a similar or different response in each of the pairs of twins (similar response = difference of an hour

Identical twins
Differential
Similar answer
response
9 couples 0 couples

fraternal twins
Differential
Similar answer
response
1 couple 8 couples
or less, different response = more than an hour) then the results can be written:
8. Von Verschuer analyzed concordance and discordance in twins affected by various pathological
conditions, finding the following results:
G.I. GF
clubfoot 40 125 134 4466
Measles 189 199 146 167
Diabetes M. 63 75 70 189
Based on these data, compare the degree of environmental and genetic influence of these 3
pathological conditions.
9. Phenylketonurics (aa homozygotes) who have developed normally thanks to a diet low in
phenylalanine, when they marry they normally have normal heterozygous children (Aa), since their
wives are normally normal homozygotes (AA). However, it has recently been discovered that in some
phenylketonuric women undergoing treatment (aa), when they marry normal homozygous individuals
(AA) they can result in all their children being mentally deficient. How would you explain this effect.
10. Analyze the following data and draw, whenever possible, pertinent conclusions regarding the
respective roles of heredity and environment: a) In a given city, symptoms of lead poisoning occur
that are almost 100% concordant in all pairs of identical twins; In another city, only 80% of identical
twin pairs are concordant. b) The frequency of concordance in the case of measles is practically the
same in identical and non-identical twin pairs. c) Concordance for a disease was discovered in 31 of
33 pairs of identical twins and in one of 16 pairs of non-identical twins.
11. If a congenital human character is concordant in 60% of non-identical twins:
a) What conclusions regarding the environmental inheritance problem can be deduced from this fact.
b) What happens if said character were concordant in 93% of identical twins?
12. The following bar histogram considers the average percentage deviation of four traits in pairs of
identical and non-identical twins. Mention what genotype-environment effect occurs in each of the
mentioned traits. The numbers next to the bars indicate the number of pairs considered.

5
5
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

3.3 Proposed task

Analysis of the role of the environment in expression through practical experience
Plants carry out photosynthesis using a protein known as chlorophyll. The information
necessary to produce chlorophyll is found in the DNA of plant cells, that is, there is a gene for
chlorophyll. In addition, it is the molecule responsible for the green color of the leaves. We
know, at the same time, that a plant requires light, water and soil with sufficient nutrients to be
able to develop normally.

Aim:
Demonstrate the existence of different phenotypes from a common genotype, based on the
differential effect of the environment
METHOD
• Choose a plant that has many leaves, preferably thin leaves (like those of the cardinal). Then
select two leaves that are similar in shape and size. Give them a mark that will not damage
the leaf, for example, a tag hanging from where it attaches to the stem. We will call one "a"
and the other "b".
• Cover sheet "a" with two black gloss papers, one on each side of the sheet. Secure them with
some clips. Leave sheet "b" as is.
• Make sure the plant has a sufficient supply of sun and water for the next two days.
• On the third day, remove the paper covers from sheet "a". Cut leaves "a" and "b". Compare
the color, shape, texture of both leaves. Do you notice any difference between them?
• Prepare a beaker with 100 ml of ethyl alcohol. Immerse the leaf "a" in the alcohol and heat
the glass in a bain-marie (placed inside a second glass of water) for 15 minutes. Repeat the
procedure with sheet "b", but in another glass with the same amount of alcohol.
• Label the glasses according to the name of the leaves: "a" and "b".
• Do you now notice any difference between the color of the liquid in the two glasses?

Ethyl alcohol has the ability to remove chlorophyll from the leaves, leaving them without
green pigment. Based on this and your results, answer the following questions:
a) On which of the two leaves was the more intense green alcohol?
b) Could it be said that leaf "a" lost its ability to produce chlorophyll?
c) Do you think that if the leaf had not been cut it would have been possible to recover the
"lost" chlorophyll after a few days without paper covers? Because?
d) In this experiment, was the factor that generated variability internal (from the plant) or

5
6
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

external (from the environment)?

e) Can you tell what factor is missing to explain the phenotype of an organism?

IV.- BIBLIOGRAPHY

1. Brauer, O. 1988. Applied Plant Genetics. Edit Limusa SA 9th reprint Mexico 518 pp.
2. Curtis, H., Barnes N., Schnek, A., Flores, G. 2001. Biology. Edit Panamericana. Ed. 6th, 1st
reimp. 2001. Spain. 1496 pp.
3. Gardner E., Simmons, M., Snustad, D. 1998. Principles of genetics. Edit LIMUSA WILEY.
Ed. 4th. Mexico. 649 pp.
4. Lasley, J. 1970. Genetics of Livestock Improvement. Edit UTEHA. Mexico. 378 pp.
Mendoza, C. 1986.
5. Genetics Dictionary. National Experimental University of Táchira. San Cristobal, Venezuela.
165 pp. Strickberger, M. 1978. Genetics. Translated of the ed. English by Montserrat, A and
L. Paricio. 2ed. Edit Omega SA E

5
7
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE N° 8

MATERNAL EFFECT AND EXTRACHROMOSOMIC INHERITANCE

I. INTRODUCTION

Extrachromosomal inheritance can be divided into two main types: one based on the
transmission of surface configurations and the other based on the transmission of
nucleic acids in extrachromosomal particles. The first form of transmission appears to
be unaffected by either chromosomal or extrachromosomal genes, and therefore
appears to be an extreme deviation. However, it exists in Paramecium Tetralhymena,
and other unicellular organisms.

Extrachromosomal inheritance, based on the transmission of nucleic acids, has so

far provided the main area of research, and in general two types can be distinguished:
(1) cases in which the cellular particles that are inherited are necessary for normal
functioning of cells, such as that of mitochondrial and chloroplastic organelles: and (2)
cases in which inherited extrachromosomal particles are not normally necessary for
cellular function, such as kappa, sigma, and sex ratio endosymbionts. Some of the
differences between the two forms lie in their mode of inheritance: not only are
particles such as kappa, sigma, and those of the sex ratio organisms self-perpetuating,
but they are also infective to some extent since it is through this property as they can be
introduced into their hosts. (This infectivity has also been found as a property in certain
virus-like particles called episomes or plasmids, which are located in various cells and
are occasionally capable of integrating themselves into the host's chromosomes.) In
addition, some endosymbionts (for example, (for example, zoochloral algae in
Paramecium, aerobic bacteria in the amoeba Pelomyxa) may be necessary for the
normal growth of their host organisms. It has therefore been seriously debated whether
or not these particles should be considered as parasites and symbionts, or as
extrachromosomal organelles. In fact, it is possible that some of these particles may
start out as parasites and symbionts, and eventually become incorporated into the
normal functioning of the cell as organelles.

MATERNAL EFFECT
Presence of cytoplasmic factors that exist for a period of time independent of the
nucleus and that produce phenotypic effects by themselves. These factors are not self-
perpetuating and disappear unless they are replaced by the appropriate effect of a
nuclear gene. Ex. Kynurenine = brown eyes and brown larvae (M), m = red eyes and
larvae without pigments
♂ Mn x ♀ nn ♀ Mn x ♂ nn
F1 ½mm ½ nn F1 ½ Mn ½ nn
Larva Pigmented Larva Pigmented Pigmented
Not pigmented
Adult Brown Red Adult Browns Red

5
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

EXTRACHROMOSOMIC HERENIC (cytoplasmic)

It is extrachromosomal material. They are capable of self-perpetuation and transmission
independently. (Extranuclear, extrachromosomal genetic factors, plasmagenes,
plasmons, plasmids, cytogenes).
Chloroplasts/ Mitochondria First we can see extranuclear inheritance

in microorganisms: Resistance (Chlamydomonas)

5
9
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Infectious transmission inheritance

Criteria to define extrachromosomal inheritance

II. AIM

Differentiate the various forms of extrachromosomal inheritance.

III. MATERIAL AND METHODS

3.1 Model exercises

1. Corn is a hermaphrodite plant that produces pollen and egg cells in the same
individual. However, Rhoades obtained a strain of corn that was almost completely
sterile with respect to the male sex, giving rise to very little or no pollen. Retrograde
crosses between said sterile lines for the male sex with fertile lines for that sex did
not restore fertility. When the little pollen produced by the sterile line for the male
sex was used to fertilize plants fertile for that sex, all the offspring were fertile for
that sex. How would you explain these results? Furthermore, a restore gene located
on the chromosomes whose dominant allele suppresses the effect of the male sterility
factor described without modifying said factor. b) if a plant homozygous for said
restore RR allele is crossed with a sterile plant for the male sex, what would be the
genetic and phenotypic constitution of the F1 in relation to sterility? C) If the F1
plants are fertilized with pollen from plants that do not have the restore allele, what
results would you expect? d) If the f1 plants self-fertilized, what results would you

6
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

expect?
Answer
a) Sterility or fertility for the male sex follows a maternal extrachromosomal
inheritance pattern in this species, so that the offspring will be for this character the
same as the individual who provides the egg. Surely, sterility for the male sex is due
to a cytoplasmic factor that is inherited through the female route. b) The plant sterile
for the male sex (sm) must be homozygous recessive (rr) since if it were RR or Rr it
would be sterile. This individual logically provides the lobe with the nuclear allele r
and the cytoplasm carrying the sterility factor. The crossing would be:
Q: RR*RR
fertile sm sterile sm

pollen oulo. . ■
R r(cytoplasmic factor
। of sterility -fee-]

F1: Rr[fce]
F1 individuals carry the cytoplasmic sterility factor for the male sex, but its effect is
canceled by the nuclear combination Rr, therefore they are fertile for the male sex.
c) The F1 individual will provide the egg that will carry the sterility factor for the
male sex. As for the individual that provides the pollen, even if it is rr, it can be
perfectly fertile for the male sex if its female parent was not a carrier of the
cytoplasmic sterility factor. The crossing will be:
Rr x egg rr pollen
Yo (fee) |

1/2Rr(+fce)....... fertile sm
1/2 rr (+fce)...... sterile sm
d)
Rr (+ Fee) X Rr (+ Fee)
Yo
1/4 RR (+fce)—> Fertile sm
1/2 Rr [+fce]-) Fertile sm
1/4 rr (+ fec) —-> sterile sm

2. A yeast strain with a mitochondrial mutation of resistance to an antibiotic is crossed

with a wild strain. What will the resulting spores be like for said character?

6
1
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

The mutant strain will contain in its

cytoplasm mitochondria resistant to the
antibiotic that, when mixed in the zygote
with the normal mitochondria of the wild
strains, will give them and the resulting
vegetative cells and spores (to whose
cytoplasm the two types of mitochondria
will pass mixed) the resistance capacity.
All of this is schematized on the left
side.

3.2 Proposed problems

1- - How do you differentiate a sex-linked trait from a trait inherited through the
cytoplasm?
2- Reciprocal crosses between two types of donkey grass, Oenothera hookeri and O.
muricata, produce different effects on the plastids as demonstrated by Renner.
♀ hookeri x♂muricata→ yellow plastids
♀ muricata x ♂ hookeri → green plastids
Since the chromosome constitution is the same in both cases, explain the
differences.
3- . In plants from the previous cross ♀ muricata x ♂hookeri, Renner found some
sectors of yellow tissue that were not produced by mutation. These yellow sectors
gave rise to flowers, and could therefore be cultivated so that their cytoplasm was
combined with a hookeri nucleus. When this nuclear-cytoplasmic combination was
obtained, the plastids were green. How would the origin of the yellow sectors in the
♂muricata x ♀ hookeri cross be explained?
4 .- If a plant's yellow color (in contrast to normal green) can be produced either by an
autosomal recessive gene or by a cytoplasmic factor, what results would be
expected for each type of inheritance in the following cases?: (a ) In reciprocal
crosses between pure yellow and green strains. (b) In backcrosses between the
products of each of these reciprocal crosses with the parental strains. (c) When the
products of each reciprocal cross are self-pollinated. (d) When there is cross-
pollination between the products of the two reciprocal crosses.
5 .- In crosses in which Lychnis species were used, Winge found variegation,
apparently due to the presence of the Y chromosome. Other chromosomes also
affected variegation, and a series of autosomal inhibitors of variegation were found.
In one case, Winge crossed a variegated female with a green male and obtained
offspring of which approximately 1/4 of the females were variegated, 3/4 of the
females were not, nor were the males. How would these results be explained?

6 .- In another case, using Lychnis, Winge crossed a green female plant with a green
male plant and obtained 2458 plants in the offspring which consisted of 1216
females and 1242 males. Of the females, 127 were variegated, while none of the
males were variegated. Limiting ourselves to independently segregating nuclear
genes, how could these results be explained?

6
2
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

7 .-. A streptomycin-resistant strain of Chlamydomonas, carrying resistance factors

located in both the nucleus and cytoplasm, was crossed with a streptomycin-
susceptible strain. (a) What results would be expected if the resistant strain was the
plus (+) parent and the sensitive strain was the minus (-) parent? (b) What if
reciprocal crossing were done?
8 .- To demonstrate that cytoplasmic genes can "segregate" one from another in cases
in which both mt + and mt - parents contribute their cytoplasm to the formation of
zygotes, Sager and Ramanis used two types of cytoplasmic mutants in
Chlamydomonas: streptomycin sensitive (ss), in which growth does not occur in the
presence of streptomycin, and streptomycin dependent (sd), in which growth cannot
occur in the absence of streptomycin. Their crosses were of the following types: (1)
sd rnt + X .ss mt - ; (2) ss mt + x sd mt - - . Each cross was plated on agar with
streptomycin and on agar without streptomycin. Explain in which cross and on what
medium one would expect to isolate zoospores that were heterozygous for the two
cytoplasmic genes.
9 .- As already discussed in this chapter, Sonnehorn demonstrated that a cross between
the killer strain of Paramecium (number 51) and the sensitive strain (number 32)
produced an F 1 that were killer (Kk + kappa) and sensitive (Kk ) depending on the
degree of cytoplasmic exchange. What results would be expected in: (a) a cross
between two F 1 assassins? (b) A cross between an F 1 assassin and a sensitive F 1 ?
(e) Autogamous reproduction of sensitive F1 strains? (d) A cross between a sentient
KK (produced in (c)) and an F1 killer?
10 .- Humphrey has discovered a gene, o, in the axolotl that does not differ from the
wild type in heterozygosity but produces marked effects in homozygosity. Males
are either/or sterile and females are/or produce abnormal embryos regardless of
which male they are crossed with. Homozygous o/o females, however, give rise to
normal offspring when a normal +/+ ovary is transplanted into their abdomen.
Explain the effect responsible for these results.
11 .- Neurospora crassa is a haploid filamentous fungus. A mutant strain called pony
has been found for this fungus, which has slower growth than the wild strain. The
wild strain has three classes of cytochrome abyc, while in the poky mutant
cytochrome aob is absent and they have an excess of cytochrome c. When crosses
are carried out between both strains so that one of the parents provides most of the
cytochrome to the offspring, the following results are obtained:
♀ poky ♂wild→ All pony
♀ wild ♂ poky→ All wild
Propose an explanation for these results.
12 .-Sonneborn showed that the crossing between the Killer strain of Paremecium
(Nº51 and the sensitive strain (Nº42) gave an F1 formed by killer individuals (Kk
+kappa) and sensitive individuals (Kk). What results would you expect? a) from a
cross between two F1 Killers b) from a cross between an F1 killer and a sensitive
F1? From the autogamous reproduction of the sensitive F1?

IV BIBLIOGRAPHY
1. Jimenez C. 1999. 360 Genetics problems. Synthesis Editorial. Madrid Spain.
2. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium
Series. Third edition. McGraw Hill. Inc Colombia.
3. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.

6
3
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

4. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.

5. Visors E. 1998. Issues and solved problems in Genetics. University of Granada.
Spain

6
4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 9

LINKAGE AND GENETIC MAPPING.

INTRODUCTION

Linkage occurs when two or more genes are found on the same chromosome. They
can be on one of the autosomes or on the sex chromosome. These genes tend to stay together
during the formation of said gametes. In the progeny of a dihybrid cross, significant deviations
from a 1:1:1:1 ratio should be considered evidence of linkage. However, linked genes do not
always stay together, because non-sister (homologous) chromatids can exchange segments of
variable length during meiotic prophase.
Homologous chromosomes pair with each other called synopsis and the points of
genetic exchange, called chiasmata, produce recombinant gametes through crossing over .
The proportion of gametes that are products of crossing over is known as the recombinant
frequency (r). There is a relationship between the frequency of recombination of linked
genes and their linear distance on the chromosome

Scheme of crossing over produced between 3 loci.

Evaluating the order and distance between genes on a chromosome allows us to construct a
“linkage map.”
In order to make a linkage map you need to have two criteria:
- have recombination frequency (r)
- and to determine the order you need at least 3 loci
In order to obtain the order and distance between the genes we do not use the three-point cross
technique.

II.- OBJECTIVES
- The student will be able to explain how linkage maps are created by solving problems
about the cases stated.

III MATERIAL AND METHODS

3.1 Problems Solved

1. An ABC/ABC individual is crossed with another of the abc/abc type and the

6
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

ABC/abc trihybrid is obtained, to which a test cross will be carried out, obtaining the
following progeny:

36% ABC/abc 9% Abc/abc 4% ABc/abc 1% AbC/abc

36% abc/abc 9% aBC/abc 4% abC/abc 1% aBc/abc

72% 18% 8% 2%
Parental type Simple Simple Double
recombinants in A recombinants in B recombinants.
To find the AB distance, youand B count all the single
must and Cand double crosses that occur in
that region 18%+2%=20% or 20 map units between loci A and B. To find the BC
distance, all crossovers (single and double) that occur in that region must be counted
8%+ 2%= 10% or 10 map units between loci B and C. Therefore, the AC distance is
30 map units when double crossovers are detected in a three-point linkage experiment,
and 26 map units when double crossovers are not detected.

3.2. PROPOSED PROBLEMS

1 If AABB and aabb are crossed and F 1 is used in a test cross, what percentage of the
offspring will be aabb if the two genes are a) on different chromosomes? b)
completely linked? c) separated by 10 map units?
2 In a certain plant species, the color of the flowers depends on the interaction of two
loci A,a and B,b . Both loci are linked, crossing over between them in 28% of
meiosis. The A allele regulates the production of a chromogenic substance or color
precursor, while its recessive a prevents the formation of the precursor, producing
albinism. Gene product B can act on this precursor, transforming it into violet
pigment, or gene product b, which transforms it into pink pigment. When products
B and b act simultaneously on the precursor (in the heterozygote), the flowers are
lilac in color. An AaBb plant was obtained by crossing the homozygous AAbb and
aaBB . We want to know what phenotypic segregation is expected to be obtained
when crossing it with a double recessive plant.
3 Suppose a dihybrid Drosophila female in the repulsion phase for the a/+ , b/+ genes
and a dihybrid male of the same species in the mating phase. Knowing that these
loci are located at 20 um, indicates the expected frequency of individuals with a
genotype identical to that of the male parent.
4 In Tribolium there are three characters determined by the following recessive
alleles: elongated eyes ( l ), red eyes ( r ) and short bristles ( c ). The F 1 of
homozygous parents is used for test crossing, obtaining the following offspring:
401 with elongated eyes, 378 with red eyes and short bristles, 157 with short
bristles 143 with red and elongated eyes, 52 with red eyes, 19 with eyes
red and elongated and short bristles, 58 with elongated eyes and short bristles and
12 wild type a) What were the parental genotypes? b) Determine the genetic map.
5 The symbols n, v and l represent the recessive alleles of three linked loci of a given
eukaryotic species. When a trihybrid is subjected to a test cross, the following
phenotypes are obtained: 46 wild, 150 l ; 226v ; 552n ; 38 n, v , l ; 134 n, v ; 258 n,
l ; 612 v , l . a) What is the correct order of these genes?
6 A strain homozygous for the recessive alleles of three autosomal genes, d, e and f,
is crossed with a strain homozygous for the dominant alleles, D, E and F. If the F 1
females are subjected to a test cross, the following results are observed: DEF 48,
dEf 5, def 42, deF 6, DeF 5, dEF 46, DEf 4, Def 44. a) Which of these genes are

6
7
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

linked? b)What is the distance between them?

7 The eyes of some Drosophila mutants have a rough texture due to the normal facet
structure. Three of the mutant alleles that produce approximately the same
phenotype are sex-linked recessives ( rst ), ( rg ), ( rux ). The distances from the
end of the X chromosome of the loci occupied by these genes are 2, 11 and 15
mapping units respectively. a) From wild-type, test-crossed females of genotype rst
+ rux / + rg + , predict the number of wild-type and wrinkle-eyed flies expected
among a progeny of 15,000. Assume no interference. b)Approximately how many
wrinkle-eyed progeny flies are expected per wild-type individual? c) If the females
in part a) were triheterozygous in the mating phase, what would be the approximate
proportion of wild-type progeny: rough eyes?
8 Let A and B be two loci located 40 um on a eukaryotic chromosome and a C gene
equidistant from both. a) If the interference is 40, what is the number of double
recombinants that should be expected among 1,000 offspring from the test cross of
a trihybrid? b) What if the interference was 100? c) What if it were null?
9 Antennapedia ( Antp ) is a dominant mutation of the third chromosome of
Drosophila melanogaster that transforms the antennae into legs; Stubble ( Sb ) is a
dominant mutation that produces short setae; and rosy ( ry ) is a recessive eye color
mutation. Antp ++/+ SB females are crossed with + ry +/+ ry + males, observing
the progeny classes indicated below. Determine the order, crossover frequencies
and distance on the map between these mutant genes. Calculate the coincidence
coefficient and interference value from the data: Antennapedia = 1.140, Stubble,
rosy = 1.078, wild type = 55, Antennapedia, Stubble = 70, Rosy = 110, Stubble = 2,
Antp, Stubble, rosy = 43
10 Suppose three hypothetical human loci A/a , M/m and G/g , located in this order
on an autosomal chromosome at distances of 20 um. ( AM ) and 10 um ( MG ),
with an interference of 60. All three present a Mendelian system of complete
dominance, represented as usual by capital letters. The traits determined by each of
the six alleles are: A : Artistic, M : Moral, G : Generous, a : Negative of art, m :
Immoral, g : Not at all detached.
11 In tomato, fruit shape depends on the loci P,p ( P =smooth > p =rough) and R,r (
R =round > r =elongated). The F 1 of a cross between homozygous smooth and
elongated by rough and round was backcrossed by the double recessive, obtaining
the following results: Smooth and round = 45, Smooth and elongated = 86, Rough
and round = 91, Rough and elongated = 39 . a) Demonstrate the existence of linkage
between these two loci. b) Determine the probability of crossing over, the
recombination fraction and the genetic distance. c) If we analyzed 3,000 pollen
mother cells, in how many would we expect to observe at least one chiasm among
the loci considered?
12 In a certain plant species, a diheterozygous AB/ab plant was self-fertilized,
obtaining the following phenotypic segregation in the offspring: AB = 512, Ab =
38 , aB = 24 and ab = 170. Indicate whether both loci are linked and if so, find out
the genetic distance.
13 A crossing of a trihetrezygous plant ( AaBbCc ) with another homozygous
recessive plant (aabbcc) was carried out, obtaining the following offspring: ABC =
95, abc = 101, ABc = 25, abC = 21, Abc = 1, aBC = 3, AbC = 384 , aBc = 370.
Answer the following questions: a) Observed and expected individual segregation
of each locus. b) Combined observed and expected segregation in case of
independence for each pair of loci: A, a with B,b ; A,a with C,c and B,b with C,c .
c) Expected segregation of the three loci in case of independence. d) Do these three

6
8
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

loci behave as linked? If yes, e) Determine the central locus. f) Calculate the values
of the recombination fraction and the genetic distances between the central locus
and each of the extreme loci, and between the two extreme loci. g) Calculate the
coincidence and interference coefficient. h) Determine the genotype of the parents
of the triheterozygous plant used in the crossing.
14 In corn there are three pairs of genes linked on the same chromosome. Namely, for
plant color, yellow ( y ) is recessive to green ( Y ); for endosperm shape, shrunken
( sh ) is recessive vs. full ( Sh ); for seed color, colorless ( c ) is recessive vs.
colored ( C ). A backcross was performed with the triple recessive homozygote,
and sh c / and sh c , from three different plants, I, II, and III, all of them
heterozygous for these three genic loci, although not necessarily all in the same
way (i.e. , y sh c / Y Sh C , Y Sh c / y sh C , etc.) The resulting progeny had the
following phenotypic frequencies:
Number of offspring produced by Heterozygous
plants
Offspring phenotype Yo II III
and sh c 95 368 22
Y Sh C 100 387 23
and Sh C 3 21 390
and sh c 2 24 365
and sh C 20 4 96
And Sh c 25 1 99
and Sh c 375 98 0
And sh C 380 97 5
1000 1000 1000
a) Using the progeny of any of the heterozygous plants, propose an order of
these genes and the distinct recombination between the genes.
b) Based on aa), calculate the coincidence coefficient. C) For the plant
analyzed in a) and b) describe the changes in frequencies that would be
expected in the progeny if interference increased. d) Give the exact
genotypes of each of the two homologous chromosomes that carry these
genes in heterozygous I, II and III plants.
15 i the loci A, a ; B, b and C, c are located on the same chromosome. The distance
between locus B, b and A , a is 10 morgon, between locus B, b and locus C c is
20 morgon and between loci A, a and C, c is 25 morgon. Determine the central
locus, the coincidence coefficient and the interference, indicating whether the
latter is positive or negative.
16 tadler crossed a maize strain homozygous for the recessive genes colorless ( c ),
shrunken ( sh ), and waxy ( wx ) with a strain homozygous for the dominant
alleles of these genes ( C Sh Wx ). He then backcrossed the F 1 plants with the
homozygous recessive strain, obtaining the following offspring: C Sh Wx =
17,959, C Sh wx = 4,455, c sh wx = 17,699, c sh Wx = 4,654, C sh wx = 509 , C
sh Wx = 20, c Sh Wx = 524, c Sh wx = 12. a) Draw the linkage map for these
three genes, b) Calculate the degrees of coincidence and interference for the
double recombinants.

IV.- BIBLIOGRAPHY

1. Jimenez C. 1999. 360 Genetics problems. Synthesis Editorial. Madrid Spain.

6
9
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

2. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium

Series. Third edition. McGraw Hill. Inc Colombia.
3. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.
4. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.
5. Visors E. 1998. Issues and solved problems in Genetics. University of Granada.
Spain.

7
0
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 10

MUTATION: CHROMOSOMIC, SPECIFIC, LOCATION

CHROMOSOMES AND MAP CONSTRUCTION
CYTOGENETICS, GENE MUTATIONS.

INTRODUCTION
The alteration of the DNA sequence, through the process of mutation, is the
primary origin of all genetic variation. Allelic variants that arise by mutation and are
transmitted from generation to generation make evolution possible. The mutations
that occur in the germ lines are the important ones because they can be transmitted to
offspring; although there are some somatic mutations that can be inherited when
reproductive structures arise from somatic meristems.
During replication and at other times DNA is frequently damaged by physical
and chemical events, but most damage is repaired by enzymes. However, some of
such alterations escape enzymatic repair, becoming gene mutations. Two important
conclusions are that (1) the mutation process is not an adaptation but the consequence
of an error (unrepaired DNA damage) and (2) mutations affect only pre-existing
traits.
Mutation is a random (stochastic) process in the sense that the occurrence of a
particular mutation is not determined by the presence or absence of the organism
suffering from it in an environment where the mutation could be advantageous; That
is, when the mutation causes an amino acid substitution in a protein, it does so
without considering whether the change is advantageous for the protein. It is also
random because while we can predict the probability of a particular mutation
occurring, we cannot predict which of a large number of gene copies will undergo the
mutation. That mutation is a stochastic process does not mean that all sites in the
DNA are altered with equal frequency or that the environment does not affect
mutational rates; In fact, we know that exposure to various types of radiation, certain
chemicals or even malnutrition increase mutation rates.
Mutations can consist of the alteration of a nucleotide in the DNA sequence,
in which case they are called point mutations , or in the loss or reorganization of
large DNA fragments, in which case they are called karyotype alterations or
chromosomal aberrations.
Chromosomes occasionally undergo spontaneous breaks, or can be
induced to break at high frequency by ionizing radiation. The broken ends of
these chromosomes behave as if they were “sticky” and can come together in
non-homologous combinations (translocations). A reciprocal translocation
includes the exchange of segments between two non-homologous
chromosomes. During meiosis, an individual that is structurally heterozygous
for a reciprocal translocation (with two chromosomes of normal structure and
two that are attached to non-homologous fragments, must have a cross-shaped
configuration to achieve pairing or synapsis of all homologous segments). . A
structural heterozygote may or may not be genetically heterozygous at one or
more loci. The only way in which functional gametes can be formed from a
heterozygous translocation is by alternate disjunction of the chromosomes.
Chromosomes also undergo inversion processes, deletions, duplications. All of
them can be summarized in structural anomalies which can be studied at the

7
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

level of meiosis and in this way decipher the alteration suffered as well as the
segments of the chromosomes involved.

II.- OBJECTIVE

1 . Demonstrate through exercises the identification of chromosomal and point

mutations and their location.
2 . Construction of cytogenetic maps.
3 .- Solve gene mutation problems

111 .- MATERIAL AND METHODS

3.1 Problems solved

1. An individual is a structural heterozygote for a deletion, such that one

chromosome has the full arrangement 1234c56789 and the deleted
chromosome has the arrangement 1234c59 (c indicates the centromere). A)
What meiotic conformation would be observed in pachythema in this
individual? B) Could recombination be detected for the deleted loci? C)Can
you reverse a deletion?
Resolution
a) In the meiotic pachythema of this structural heterozygote for the
deletion that has a chromosome with all the information and the
homologous chromosome with the deletion, a loop would be observed
that would cover the region that includes the 678 genes, since these
would have nothing to pair with during the meiosis.
Hete rod goto structural

12 3 4^ ^5 6 7 8 9 Normal chromosome

। 3 ~ Chromosome with deletion

7
•);-eu
12 34 51/19
on
12 34 5 9
EITHER
Paquitema
b) It is not possible to detect recombination in this structural heterozygote
for the deleted genes (678), since they have nothing to recombine with.

c) Deletions do not revert, since it is very difficult for an addition to occur

in exactly the same position, of the same size and with exactly the same
sequence. Therefore, the deletions do not revert to the normal sequence.
2. If 54 mutations are detected among 723 offspring of males that received
2,500 roentgens and 78 mutations are detected among 649 offspring of
males that received 4,000 roentgens, how many mutants would be expected
to appear among 1,000 offspring of males that received 6,000 roentgens?
Answer

7
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

78/649 = 12.02% mutations at 4000 roentgens

54/723 = 7.47% mutations at 2500 roentgens
The difference = 12.02 -7.47 = 4.55% (0.0455) mutations for 1500 roentgens
Among a progeny of 1000 individuals at 6000 roentgens it is expected:
1000(6000)/(1500)(0.0455) = 182 mutants

3.2 Proposed problems

1. An individual is heterozygous for a chromosome duplication, the normal

chromosome has the arrangement 1234c56789 and the homologous
chromosome has the duplication 1234c56786789. a) What meiotic
configuration would be observed in the pachythema of this individual? B)
Can recombination be found for duplicate loci? C)Can you reverse a
duplication?
2. If there is an individual who is structurally heterozygous for a pericentric
inversion in which one chromosome has the normal arrangement
1234c5678 and its counterpart has the inverted arrangement 15c432678.
Make a diagram of the first meiotic anaphase, when a double
complementary crossing over occurs, the first in the region between 4 and
the centromere and the second in the area between the centromere and 5.
3. In a structural heterozygote for a paracentric inversion in which one
chromosome has the normal arrangement c12345678 and its counterpart
has the inverted c12654378, a double diagonal crossover occurs, the first in
the region between 1 and 2 and the second in the area between 4 and 5.
Make a diagram of the first and second meiotic anaphases.
4. A structural heterozygote is available for a paracentric inversion in which
one chromosome has the normal arrangement 12c345678 and the
homologous chromosome has the inverted arrangement 12c3765489.
During meiosis, in pachythema, in one of the meiocytes there is crossing
over in the region between 4 and 5 while in another meiocyte there is
crossing over in the area between 6 and 7. Which of the two cases will be
greater? size of the acentric fragment that occurs in meiotic anaphase I?
5. A rye plant homozygous for a reciprocal translocation between
chromosomes 1R and 2R is crossed with another plant with the normal
chromosome arrangement. What chromosome configuration will be
observed in the meiocytes of the hybrid between both plants during
metaphase-I?
6. A rye plant homozygous for a reciprocal translocation between
chromosomes 3R and 4R is crossed by another homozygous for a
reciprocal translocation between chromosomes 4R and 6R. What
chromosome configuration will be observed in the meiocytes of the hybrid
between both plants during metaphase-I? ?
7. A barley plant homozygous for a reciprocal translocation between
chromosomes 1H and 2H is crossed by another homozygous for a
reciprocal translocation between chromosomes 3H and 4H. What
chromosome configuration will be observed in the meiocytes of the hybrid

7
4
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

between both plants during metaphase-I ?

8. There are four varieties of barley (V1,V2,V3,V4) that are structurally
homozygous. V1 has the normal chromosome arrangement, V2 has a
reciprocal translocation between chromosomes 1 and 2, and V3 has a
reciprocal translocation between chromosomes 2 and 3 and V4 has a
reciprocal translocation between chromosomes 2 and 4. Another variety
V5, structurally homozygous for another different reciprocal translocation,
is crossed by the previous ones, giving the following results when
observing the meiosis of the corresponding hybrids.
Crossing Metaphase I configuration of the hybrid
V1 x V5 An association of 4 chromosomes (1 IV )
V2 x V5 An association of 6 chromosomes (1 VI )
V3 x V5 Two associations of 4 chromosomes (2 IV )
V4 x V5 An association of 6 chromosomes (1 VI )
What are the chromosomes involved in the translocation of the V5 variety?
9. A homozygous recessive aa rye plant that has the normal chromosome
arrangement is crossed with another homozygous AA and homozygous in
turn for a reciprocal translocation between chromosomes 3R and 6R. The
F1 of this cross was of phenotype A and semi-sterile. When an F1 plant is
crossed with another homozygous recessive aa plant with a normal
chromosomal constitution, the following offspring is obtained.
Phenotype Phenotype No. of plants
TO Semi-sterile 382
to Semi-sterile 73
TO Fertile 93
to Fertile 364
a) How far is the A,a locus from the translocation point? b) What
configuration is observed in metaphase-I of semi-sterile and fertile
plants?
10. In a dioecious autotetraploid plant species there are two duplex individuals
(AAaa), one of each sex. The female sex is achiasmatic and the male sex
presents chromatid segregation. When these two duplex individuals are
crossed with each other, 2,000 offspring are obtained.
A) How many will be recessive phenotype? B) How many will be
tetraplexes (AAAA)?
11. An autotreplix individual (AAAa) is crossed by another nulliplex
autotetraploid individual (aaaa), obtaining 1000 offspring. A) Indicate the
phenotypic and genotypic segregation in case of chromosomal segregation
(the locus would be next to the centromere) b) Indicate the genotypic and
phenotypic segregation in case of chromatid segregation.
12 -A compound The error is most common in DNA replication that includes X. a)
What types of mutations would it be expected to cause? b) What type will be the
most common?
13 -If the mutation rate in a certain gene is directly proportional to the radiation dose
and the mutation rate of Drosophila has been observed to increase from 3% at
1000 roentgens to 6% at 2000 roentgens, what percentage of mutations are wait

7
5
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

for 3500 roentgens?

14 Assume that the induced mutation rate is directly proportional to the radiation
dose. Suppose further that 372 individuals out of a total of 6000 suffer a mutation
at 2000 roentgens, and that 610 out of 5000 individuals suffer a mutation at 4000
roentgens. Estimate the spontaneous mutation rate.
15 -The DNA sequence that encodes the alpha-globin chain of hemoglobin has the
following nucleotide sequence:
(5').GCT . CT. CGA. GGC. CBT. AGC. TTA. ACG. GTA. TTT. GGA .(3')
which goes from 730-720, |Indicate: a)By deletion of T no. 717, what chain
would be formed? b)By transversion of A nº726 to C, what chain would be
formed?
16. If we assume that there are 100,000 pairs of genes in man and an average
mutation rate per gene and generation of 10 -5 , estimate the number of mutants per
generation. If there are 4 x10 9 men on earth, estimate the number of mutations that
arise per generation at each locus in the human species.
17. Red blood cells synthesize a large amount of hemoglobin from a stable mRNA
whose final 3' end sequence is 5'-AAGUAUCACUAAGC-3'. The carboxyterminal
dipeptide of hemoglobin is NH 2 -Tyr-His-COOH. Mutant hemoglobins with a
longer than normal polypeptide chain are known. One of these mutants ends with
the sequence NH 2 -Tyr-His-Leu-Ser-COOH. What type of mutation characterizes
this mutant?
18. The T4 lysozyme contains the sequence: NH 2… Trp-Val-Thr-Gly-Ser-Trp-
Met…COOH What changes at the molecular level have caused the mutant and the
revertant, respectively?

IV BIBLIOGRAPHY

1 Anderson, P. and Ganetzky, B. 1997.An electronic companion to Genetics

Worbook. Gogito Learningg Media Inc. New York, San Francisco.
2 White, Manuel. 1980. Repair of genetic material. Research and Science
3 Crick, F.M. 1966. The Genetic Code. Sci.Am. 215 (4) : 55
Darnell, E.E. 1983. RNA maturation. Research and Science
4 De Robertis, E. and De Robertis, E. M. 1986. Cellular and molecular biology. The
Athenaeum. Buenos Aires, Argentina.
5 Jiménez C. 1999. 360 Genetics Problems. Synthesis editorial. Spain

6 Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain

7 Lewis, B. 1977. Genes. Oxford University Press and Cell press. New York. USA
8 Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
9 Klug, W. and Cummings, M. 1994. Concepts of Genetics. Fourth Edition. Merrill
Publishing Company, United States of America.
10 Stansfield, W. 1992. Theory and Problems of Genetics. Schawm Compendium
Series. 3rd Edition, McGraw Hill. Inc. Colombia
11 Stern, C. 1973. Human Genetics, 3rd edition. Alhambra, Spain
12 Strickberger, M. 1988. Genetics. Omega S Publishing. TO; Barcelona, Spain.
13 E 1998 visors. Issues and solved problems of genetics. Ed. University of Granada.
Spain.

7
6
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE N° 11

APPLICATION OF CYTOGENETICS TECHNIQUES AND PREPARATION

OF
IDIOGRAMS IN ANIMALS

I. INTRODUCTION

Cytogenetics is the study of chromosomes and related diseases caused by

abnormal number and/or structure of chromosomes. Chromosomes are complex
structures located in the nucleus of cells, composed of DNA, histones and other
proteins, RNA and polysaccharides. They are basically the "packages" that contain the
DNA. Chromosomes cannot normally be seen with an optical microscope, but during
cell division they condense enough to be easily analyzed. To collect cells with their
chromosomes in this condensed state, they are exposed to a mitosis inhibitor, which
blocks the formation of the mitotic spindle and stops cell division at the metaphase
stage. Different tissues can be used to obtain chromosome preparations; for example,
peripheral blood, bone marrow, amniotic fluid and products of conception, this in the
case of the animal species including man; However, in plants the preferred tissues are
those that are constantly dividing, such as meristems. Although specific techniques
differ depending on the tissue used, the basic method for obtaining chromosome
preparations in animals is: a) Sample collection and initial preparation. b) Cell culture.
c) Addition of a mitosis inhibitor to stop cells in metaphase. d) Collection of cells. This
step is very important to obtain high quality preparations. It involves exposing the cells
to a hypotonic solution, followed by a series of fixative solutions. This causes the cells
to expand, so that the chromosomes extend and can be examined individually and e)
Staining of chromosome preparations to detect possible numerical and structural
changes.
Chromosome Morphology
Under the microscope, chromosomes look like thin, elongated structures. They
have a short and a long arm separated by a narrowing or primary constriction, called
the centromere . The short arm is designated p and the long arm q . The centromere is
the attachment point of the mitotic spindle and is an integral part of the chromosome. It
is essential for normal chromosome movement and segregation during cell division.
Human metaphase chromosomes have three basic shapes and can be classified
according to the length of the short and long arms, as well as the position of the
centromere. Metacentric chromosomes have short and long arms of approximately the
same length, with the centromere at the midpoint. Submetacentric chromosomes have
short and long arms of unequal lengths, with the centromere closest to one of the ends.
Acrocentric chromosomes have the centromere very close to one end, with a very small
short arm. They often have secondary constrictions on the short arms, connecting very
small pieces of DNA, called stems and satellites, to the centromere. The stems contain
genes that encode ribosomal RNA.
The idiogram is basically a "chromosomal map" showing the relationship
between the short and long arms, the centromere ( cen ) and, in the case of acrocentric
chromosomes, the stalks ( st , from stalk ) and satellites ( sa ). Specific banding patterns
are also illustrated. Each band is numbered to aid in describing rearrangements.

Chromosome Analysis
Virtually all routine cytogenetic analyzes are performed on chromosome

7
7
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

preparations that have been treated and stained to produce a chromosome-specific

banding pattern. This allows the detection of subtle changes in chromosome structure.
The most common staining treatment is called G banding. Other staining techniques are
available that help identify specific abnormalities. Once stained metaphase
chromosome preparations have been obtained, they can be examined microscopically.
Typically, 15 to 20 cells are observed and counted, with complete analysis of at least 5
of them. During a complete analysis, each chromosome is critically compared band by
band with its counterpart . It is necessary to examine so many cells to be able to detect
mosaicism , with clinical significance. After microscopic analysis, images of the
metaphase cells that have the best quality are taken, either by photography or by
computerized image digitization. Each chromosome can then be arranged in pairs
according to its size and banding pattern, forming a karyotype . Karyotyping allows the
cytogeneticist to examine each chromosome in even more detail for structural changes.
A written description of the karyotype is then made, defining the chromosome analysis.

Fig. Idiogram of human chromosomes

II. GOALS

• Understand how chromosomes are described and how cytogenetic studies are
prepared and interpreted.
• Learn the principles to create an idiogram

7
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

III. MATERIAL AND METHODS

3.1 OBTAINING ANIMAL CHROMOSOMES

1. Obtaining the sample. Take a small animal, put it in a glass bell and place cotton
wool soaked in ether or chloroform on it, until the animal is anesthetized.
2. Immediately take a scalpel and make incisions in order to obtain the long bone of
the leg (front or back), as quickly as possible.
3. Clean bones from remains of muscle and connective tissue
4. Crush the bone with scissors in a test tube containing the hypotonic solution
(0.0075M KCl). If it is a warm-blooded animal, this should be at 37°C and if it is a
cold-blooded animal, it should be at room temperature. For a period of 20 minutes
to 1 hour:
5. After this time, centrifuge at 1000 rpm for 10 min., Eliminate the supernatant and
add Carnoy fixative (3 ethanol: 1 ac, glacial acetic) to the pelex, leaving for at least
15 min. After time, centrifuge at 1000 rpm for 10 min. Repeat this last step 2 times,
at the end of which a few drops of sample will be taken in a Pasteur pipette and
dripped (2-3) onto a previously frozen slide, avoiding overlapping of the drops.
6. Dry the sheets with hot air. Color the slide with 2% Giemsa for 10 min. Take it out,
rinse it with running water, dry it and observe it under a microscope.
7. They observe under a microscope with lower magnification, locating the
metaphases.
8. Once the metaphase is located, change the objective to the immersion objective.
9. Count chromosomes seen

3.2 PREPARATION OF AN IDIOGRAM

1. Take the photos of the metaphases provided by the professor, cut the chromosomes
and proceed to assemble the karyotypes belonging to human beings, using the
samples provided.
2. Then measure the total length of each chromosome pair, and measure the length of
the p arm, in order to develop a centromeric index of each chromosome pair.
3. Take these measurements and place them proportionally to the centromeric index
on a graph paper, taking into account the total length and distance of each arm.
4. Then present the corresponding ideogram on graph paper.

3.3. PROPOSED PROBLEMS

1. If a woman contracts measles during the first trimester of pregnancy, even when the
mother does not suffer serious disorders, abnormalities such as heart and liver
defects, deafness, cataracts and color blindness often occur in the child, evident at
birth in affected children. . Can a pattern of inheritance be attributed to these
phenotypic results?
2. A patient is found with Turner syndrome and color blindness. Both his mother and
father have normal vision. How can this be explained?; Can we know if the origin
of the alteration occurs in the father or the mother? If the color blindness gene is
very close to the centromere, could we know if the error occurs in the first or
second meiotic division? Repeat the questions this time using a colorblind patient
with Klinefelter syndrome.
3. Individuals have been found to be color blind in one eye but not the other. What

7
9
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

does this suggest to us if: a) these individuals are only, or fundamentally, women?
b) are they only, or fundamentally, men? (Assume this is an X-linked recessive
trait).
4. Men and women with Down syndrome are capable of interbreeding, although this is
rare. What chromosomal constitution is expected in the zygotes of such crosses,
and what will these zygotes become?
5. - Suggest how each of the following examples of sexual mosaics can originate: a)
XX/X0 b) XX/XXYY c) X0/XXX d) X0/XX/XXX
6. What would be the correct representation of the karyotype of three people: a girl
with trisomy of pair 21 (Down syndrome), another with monosomy that affects the
sex chromosomes and female phenotypes (Turner syndrome) and others
completely normal and male? ?
7. Below are some cases of people who presented alterations in the number of
chromosomes. Case 1: in 1973 it was discovered that a girl had 45 chromosomes
and lacked a chromosome -22. The girl died at 15 days old. Case 2: A baby with a
karyotype (47, XY +13) died a few weeks after birth. Case 3: A child has cells
with 47 chromosomes. Each cell has 3 chromosomes -18. Case 4: A person has
only one X chromosome and no Y chromosomes. Name the types of chromosomal
abnormalities described?
8. A woman goes to the doctor's office because she has had spontaneous abortions on
repeated occasions. When carrying out different tests on the woman and her
husband, it is discovered that the latter has a karyotype of 47, XYY. Researchers
proposed several hypotheses to try to explain the appearance of the abnormal
karyotype in man. What is the origin of this anomaly?
9. A woman who is pregnant for the first time loses her pregnancy due to a
spontaneous miscarriage. It was decided to study the karyotype of the product due
to genetic reasons, finding that it was a case of triploidy and each cell had 2 X
chromosomes and a Y chromosome. How could the formation of this triploid
embryo be explained?
10. A 56-year-old person suffers from a certain type of cancer. By performing
laboratory tests, a geneticist finds that some of the cancer cells had 92
chromosomes each. What type of abnormality does these types of cells have?
11. The following table shows the type of chromosomal alterations found among 1026
cases of spontaneous abortions:

Trisomy Triploidy Tetraploidy Others Abnormal Total

45, X
total
Number 101 43 41 13 24 222 1026
Anomaly 45.5 19 18.5 6 11 100
percentage
Percentage of 9.8 4.2 4.2 1.2 2.3 21.1
total
What information could you obtain with this data?

IV BIBLIOGRAPHY

1. Demerec, M. And Kaufmann, B. 1962. Introduction to the genetics and cytogenetics

of Drosophila melanogaster. National Nuclear Energy Commission, Genetics
Program, Mexico.

8
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

2. Fustinoni, E. 1979. Human Genetics. Volume II. 2nd edition Alhambra-Madrid

3. Gardner E., Simmons, M., Snustad, D. 1998. Principles of genetics. Edit LIMUSA
WILEY. Ed. 4th. Mexico. 649 pp.
4. Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain
5. Jimenez C. 1999. 360 Genetics Problems. Synthesis editorial. Spain
6. Mueller R and Young I. 2001. Medical Genetics. Marban. Spain.
7. Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
8. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium
Series. Third edition. McGraw Hill. Inc Colombia.
9. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.
10. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.
11. Valderrama M. 1994. Cytogenetics manual. NAILS. Arequipa.
12. E 1998 visors. Issues and solved problems of genetics. Ed. University of Granada.
Spain.

8
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 12

APPLICATION OF CYTOGENETICS TECHNIQUES IN VEGETABLES

I. INTRODUCTION

Chromosomes are the object of study of a series of researchers. Chromosomal

investigations provide important information both for monitoring the evolutionary
path of the species of a genus and for practical breeding work and allow a wider
spectrum of wild and cultivated species to be involved in hybridizations with the aim
of facilitating the introgestion of the desired genes.
Plant cytogenetics is widely applied in genetic monitoring. The intense use of
pesticides, fertilizers, growth regulators and other substances makes it necessary to
evaluate their genetic consequences. These substances make it necessary to evaluate
their genetic consequences. These substances, in addition to their positive effect on
the production and/or resistance of plants to pests and diseases, can have negative
effects on the chromosomal apparatus of the plant cell, leading to the loss of its
genetic stability and utilitarian qualities. Therefore, methods for evaluating the
influence of chemical substances on the structure of chromosomes are essential in
tests for determining the mutagenic capacity of substances circulating in the
biosphere.
Unlike animal tissue in plant cells, it is necessary to take into account the
following steps a) Obtaining the sample b) Removal of the cell wall c) Fixation and
staining of the sample.

II. GOALS

• Learn the technique of obtaining chromosomes in vegetables.

• Test the effect of a chemical mutagen on the karyotype of plants

III. MATERIAL AND METHODS

3.1 OBTAINING CHROMOSOMES IN VEGETABLES.

1. Place the onion bulbs in small glasses filled with tap water until new roots
emerge.
2. Cut the ends of the roots to approximately 2 mm.
3. Place them on a watch moon
4. Add 2ml of HCl.
5. Flame three consecutive times, avoiding boiling the sample.
6. Remove the HCl and add the dye, avoiding boiling the sample.
7. Flame until the sample turns a dark red color, avoiding boiling.
8. Place one of the ends of the onion on a slide with a few drops
of new dye.
9. Cover the coverslip slide.
10. Perform the Squach technique.
11. Observe the preparation at higher magnification and with an immersion lens.

8
4
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

3.2 PRODUCTION OF CHROMOSOMIC ABERRATIONS

1. Place onion bulbs in small glasses filled with tap water until new roots emerge.
2. Place the rootlets in a small glass containing a solution of colchicine or caffeine
(1%), and let it remain for at least three hours. After this time, follow all the
necessary steps to obtain the chromosomes, carried out in the previous section.

3.3 PROPOSED PROBLEMS

1. Each species has a characteristic number of chromosomes. For example, corn (Zea
mays) has 10 pairs of chromosomes, a tomato plant has 12 pairs of chromosomes.
By studying the karyotype of a corn plant with 30 chromosomes in its cells. A
tomato plant has 48 chromosomes and a corn plant has 18 chromosomes. What
type of anomaly do we find in this species?
2. When a plant of chromosome type AA pollinates a plant of type AA , what
chromosome type of embryo and esdosperm is expected in the resulting seeds?
3. In corn (Zea mays), it has a diploid number of 20. How many chromosomes would
be expected in a) a meiotic product (microspores or megaspores), b) the cell
resulting from the first nuclear division (karyokinesis) of a megaspore, c) a polar
nucleus, d) a sperm nucleus, e) the microspore mother cell, f) a leaf cell, g) a
mature embryo sac (after degradation of non-functional nuclei), h) an egg nucleus ,
i) an endosperm cell, j) an embryo cell, k) a pericarp cell and, l) an aleurone cell?
4. The diploid number of onion is 16. How many chromosomes are expected as a
product of the second karyokinesis of meiosis in the embryo sac?
5. The American cotton species Gossypium hirsutum has 26 pairs of chromosomes.
The Asian cotton species G. arboreum has 13 pairs of chromosomes, the same as
the American species G. thurberin . When hirsotum individuals are crossed with
others from arboreum , triploids are obtained in whose meiosis 13 pairs of
chromosomes and another 13 isolates are observed. The triploids obtained by
crossing hirsotum and thurberin present a similar situation, that is, 13 pairs and 13
univalents in their meiosis. When crossing thurberin and arboreum, F1 individuals
are sterile since the pairing of chromosomes during meiosis is irregular. What does
what has been said suggest to you regarding the phylogenetic origin of American
cotton G. hirsotum ?
6. A species A (n=5) was crossed with another B (n=7). In the hybrid, only a few
pollen grains were produced, which were used to fertilize ovules of B. As a result
of this fertilization, some plants with 24 chromosomes were produced. These
plants were phenotypically different from the parental ones and fertile. What steps
may have led to such results?
7. An organism has 2n=12 chromosomes. How many chromosomes will: a) a
monosomic b) n trisomic c) a tetrasomic d) a double trisomic e) a nullisomic f) a
monoploid g) a triploid h) an autotetraploid

IV BIBLIOGRAPHY

1. Demerec, M. And Kaufmann, B. 1962. Introduction to the genetics and

cytogenetics of Drosophila melanogaster. National Nuclear Energy Commission,
Genetics Program, Mexico.
2. Fustinoni, E. 1979. Human Genetics. Volume II. 2nd edition Alhambra-Madrid

8
5
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

3. Gardner E., Simmons, M., Snustad, D. 1998. Principles of genetics. Edit Limusa
Wiley. Ed. 4th. Mexico. 649 pp.
4. Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain
5. Jimenez C. 1999. 360 Genetics Problems. Synthesis editorial. Spain
6. Mueller R and Young I. 2001. Medical Genetics. Marban. Spain.
7. Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.
8. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium
Series. Third edition. McGraw Hill. Inc Colombia.
9. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.
10. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.
11. Valderrama M. 1994. Cytogenetics manual. UNSA. Arequipa.
12. E 1998 visors. Issues and solved problems of genetics. Ed. University of Granada.
Spain.

8
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 13

MOLECULAR MARKERS: ISOENZYMES

INTRODUCTION
Isoenzymes are different molecular forms of the same enzyme that present or show
specificity for the same substrate. Ex. The different molecular forms of alcohol
dehydrogenase (ADH) differ in net electrical charge, molecular weight or both
simultaneously, but all of them dehydrogenate the alcohol (substrate) converting it into
aldehyde. The main characteristic of isoenzymes is that they must have the same substrate
specificity.

1 23 4 5 67 8
ADH in 8 rye plants

The technique usually used to study isoenzymes is electrophoresis, which allows molecules to
be separated by their different charge, size or both under the action of an electric field.
Alterations in the net electrical charge occur by replacing one amino acid with another of
different polarity, for example, changing an acidic amino acid for another basic or neutral
one.
Some authors believe that only those molecular forms that are present in the same
organ or tissue, that have a similar genetic origin and very similar catalytic activities, should
be considered as isoenzymes . Peroxidases, esterases and phosphatases have different
molecular forms in the same organ or tissue, but they have a broad substrate specificity, so
they can transform different compounds. Furthermore, they can have different origins and are
therefore not considered true isoenzymes .
The active quaternary structure of the isoenzymes can be fundamentally of three
types:
1. Monomers: isoenzymes that have a single polypeptide chain as the active quaternary
structure.
2. Dimers: isoenzymes whose active quaternary structure consists of the union of two
polypeptides.
3. Tetramers: The active quaternary structure of these isoenzymes consists of four
polypeptides.
Dimeric and tetrameric isoenzymes can be made up of the same or different subunits or
polypeptides.
a) Homodimers: isoenzyme formed by two identical polypeptides.
b) Homotetramer: isoenzyme made up of four equal polypeptide chains.
c) Homopolymers: isoenzymes formed by multiple identical polypeptide chains.
d) Heterodimer: isoenzyme made up of two different polypeptides.
e) Heterotetramer: tetramer constituted by the union of four different polypeptides, the
four of which may be different, three different aa, or two different types of aa.
To date, no isoenzymes whose active quaternary structure consists of three polypeptide
chains (trimers) have been described.
A term that is used quite frequently is Isoenzymatic Pattern or Zymogram , a set of
bands belonging to the same enzymatic system that are observed in the same individual. It
should be noted that I have used the word band instead of isoenzyme to indicate that a band
that is observed in a gel, after carrying out an electrophoresis, can be a single isoenzyme or
the superposition of several different isoenzymes with the same migration. electrophoretics.
Another term used very frequently is Allozymes or Allelozymes , used to refer to the
different molecular forms of the same enzyme produced by different alleles of the same locus.
Naturally, the term isoenzyme is broader, since it includes both the different molecular forms
of the same enzyme produced by alleles of the same locus, as well as those produced by

8
8
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

alleles of different loci.

Subcellular Location
Different isoenzymes show different subcellular localization, so that some are found
in the cytoplasm, others in the mitochondria, some in chloroplasts, others in glyoxysomes, in
peroxisomes, etc.
In plants there are malic dehydrogenase (MDH) isoenzymes found in the cytoplasm
(cytosolic) and MDH isoenzymes located in the mitochondria. The cytosolic and
mitochondrial forms are encoded by nuclear genes. A simple way to find out the cytosolic or
mitochondrial localization of MDH isoenzymes in plants is to compare the isoenzyme
patterns ( zymograms ) of pollen and leaves. In pollen, mitochondrial isoenzymes are not
observed, but cytosolic isoenzymes are observed, while both are observed in leaves.
It is convenient to note that for isoenzymes with a dimeric or tetrameric quaternary
structure, heterodimers or heterotetramers are never observed between polypeptide subunits
with different subcellular locations. For example, heterodimers are not produced between the
polypeptide chains of cytosolic and mitochondrial localization.
Therefore, in addition to mentioning the tissue or organ in which the isoenzymes are
detected, it is also necessary to take into account their subcellular location.
In general, works published with isoenzymes tend to use this term in the broadest
possible way, including the most doubtful cases such as peroxidases, esterases and
phosphatases.

Variability: With isoenzymes it is possible to study at least three types of genetic variability:
1. Tissue variability: different tissues or organs of the same individual show different
molecular forms or different relative amounts of the same isoenzymes .
2. Ontogenic variability: the same tissue or organ at different times of development shows
different molecular forms or different relative quantities of the same isoenzymes .
3. Population variability: different individuals in the same tissue or organ and in the same
stage of development present different isoenzymes .
Naturally, when you want to study one type of variability it is necessary to establish the other
two sources of variation.

Tissue Variability
There are many isoenzymes that have high tissue specificity, so that different tissues
or organs show different molecular forms or different relative amounts of the same
isoenzymes . For this reason, some isoenzymes are only synthesized in a certain tissue or
organ, being specific to that tissue. In other cases, the same isoenzyme is produced in two
different tissues but in very different relative quantities.
A good example of tissue specificity is hexaploid wheat seed peroxidases. When the
peroxidases of different parts of the dry wheat seed are studied, such as the embryo together
with the scutellum (E+S), the endosperm (Ed) and the covers (C), it is observed that the
endosperm and the covers present the same molecular forms, however, the embryo together
with the scutellum (E+S) has three different isoenzymes than those of the covers (C) and the
Endosperm (Ed). The complete seed (with all its parts) shows

8
9
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

the sum of the isoenzymes of the different parts, although the E+S isoenzymes

gma
appear fainter, since the E+S represents a small part of the seed.

Ge Ed CE*S
Lactic acid dehydrogenase (LDH) isoenzymes are one of the typical examples of
tissue variability in animal species. For example, in mice it is possible to observe five
different isoenzymes in organs such as kidney, heart, liver and skeletal muscle. These
isoenzymes are called LDH1, LDH2, LDH3, LDH4 and LDH5 from highest to lowest
electrophoretic migration. However, the relative amounts of these five molecular forms are
different in each organ or tissue. The most abundant in the liver is LDH5, while in the kidney
there is a greater amount of LDH1.

LACTATEDEHYDROGEIIase
Tissue Variability in Mouse
LD • c
LDH2
• • g
LD @ @ @
LD (
LD g
@
either •
• = d

Ontogenic Variability
Kidney Heart Muscle Liver
•
The same tissue or organ at different times in development may present
different isoenzymes or different relative amounts of the same isoenzymes.
Again, Lactic dehydrogenase (LDH) isoenzymes are an example of variability
during development in animal species. In mouse kidneys it is possible to observe five
LDH isoenzymes that, from highest to lowest electrophoretic migration, are called
LDH1, LDH2, LDH3, LDH4 and LDH5. However, 5 days before birth the most
abundant isoenzyme in the kidney is LDH5, while in the adult individual the most
abundant isoenzymes are LDH1 and LDH2. In this case these are differences in the
relative amounts of the same isoenzymes .
LACTATEDEHYDROGEIIase
Ontogenic Variability in Mouse Kidney~|
LDH1 or —3m • ••
LDH2 or ( of * ••
LDH3 @ * •* * @ @
@d (
| -5 -1 '+1 +3 +1? +?1 Adult]
LDH4 ®• @
LDH5 • or D or ei
Birth
Also in which There are
the same isoenzymes examples of
have different coleoptile in the first hours of wheat seed sample fabric in
moments of germination change dramatically. different
the Both Tissue Variability and Ontogenic development. By
example, the Peroxidases
Variability are a consequence of differential regulation, so that in all organisms different
tissues have different batteries of genes being expressed and, in the same tissue at different
times of development, different groups of genes are expressed.
It is common to talk about Constitutive enzyme systems and Variable enzyme
systems. Constitutive systems are those that are expressed constantly throughout development

9
0
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

and in all tissues, while Variable systems are those whose expression changes throughout
development and from one tissue to another.
Population Variability: Different individuals in the same tissue or organ and in the same
stage of development present different isoenzymes . Therefore, the different individuals that
make up the populations of different plant or animal species can present different molecular
forms of the same enzyme. Logically, when it comes to studying population variability, it is
necessary to establish the other possible sources of variability, so that the analyzes must be
carried out in the same organ and in the same stage of development in all individuals of the
studied population.
Naturally, studies of population variability are closely linked to knowledge of the
genetic control of isoenzymes . That is, it is necessary to find out the number of loci that
control or code for the isoenzymes analyzed and the dominance or co-dominance
relationships existing between the alleles of the loci involved.

Genetic Control of Isoenzymes: Knowing the genetic control of isoenzymes consists of

finding out the number of loci that code for the analyzed enzyme system, the number of
alleles of each locus and the relationships of dominance or co-dominance that exist between
the different alleles that give rise to the isoenzymes studied. Likewise, to discover the genetic
control of the analyzed isoenzymes , it is important to know their quaternary structure, that is,
the number of polypeptide chains of the active enzyme. As we have already indicated
previously, there are fundamentally three possible types of active quaternary structures:
monomer (one polypeptide), dimer (two polypeptides) and tetramer (four polypeptides).
Naturally, the most correct way to find out the active quaternary structure of an
enzyme is to carry out biochemical experiments on dissociation and reassociation of subunits
"in vitro". However, it is also possible to deduce the monomeric , dimeric or tetrameric
behavior of the isoenzymes by classical genetic analysis. Therefore, following the same
Mendel methodology, the quaternary structure of an isoenzyme can be determined, as well as
its genetic control. In addition to the method used by Mendel, it is also possible to use other
options to find out the quaternary structure and genetic control of isoenzymes , for example,
studying the isoenzymatic patterns of the different individuals of a population, analyzing the
zymograms of the different tissues of a same individual and also study the isoenzymatic
patterns of individuals with different chromosomal constitutions.

Summary of the method used by Mendel (crosses in which a locus segregates).

Obtaining the first filial generation (F 1 with genotype Aa ) between two homozygous
pure lines (P 1 with genotype AA and P 2 with genotype aa ). Self-fertilization or crossing of
two F 1 individuals to achieve the second filial generation (F 2 ).
By observing the external appearance (phenotype) of the F 1 individuals ( Aa ) it is
possible to deduce the dominance or co-dominance relationships of the alleles ( A and a ) that
control the studied character. If the phenotype ( isoenzymatic pattern ) of the F 1 is uniform
and equal to that of one of the parents (P 1 or P 2 ) it is a case of dominance, if the allele A
dominates over a ( A>a ) the F 1 looks the same as the parent P 1 . The seven characters
studied by Mendel in pea showed complete dominance (Mendel's First Law or Principle of
Uniformity).
If in the F 1 individuals the two alleles A and a are expressed at the same time, it is
said that there is co-dominance ( A=a ) and their phenotype ( isoenzymatic pattern ) is
different from that of the two parents (P 1 and P 2 ).

In the second filial generation (F 2 ) individuals of three different genotypes are

observed in the following proportions: 1/4 AA , 1/2 Aa and 1/4 aa . When there is complete
dominance ( A>a) in the F 2, two different phenotypes are observed with the following
proportions: 3/4 A and 1/4 a . In this case it is not possible to distinguish the dominant
homozygotes ( AA ) from the heterozygotes ( Aa ) since both show the same external
appearance (Mendel's Second Law or Principle of Segregation).

9
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

However, if there is a codominance relationship between alleles A and a ( A=a ), in F 2 we

will find three different phenotypes ( isoenzymatic patterns ) with the following proportions:
1/4 AA , 1/2 Aa and 1/ 4 aa . In the latter case, each genotype corresponds to a different
external appearance. The results obtained in F 2 allow us to deduce in both cases (complete
dominance A>a or co-dominance A=a ) that the trait studied (enzymatic system) is
controlled by a single locus with two alleles (A ya).

Hypothesis used for the analysis of isoenzymatic patterns.

In all cases of genetic control that we are going to study we will assume:
1. That the analysis is carried out in a diploid tissue (with two sets of chromosomes).
2. That all the loci studied are found on autosomes.
3. That as a consequence of what was said above, all genes are found in two doses.
4. That the two alleles of the same locus are equally active, so that in a heterozygous
individual ( Aa ) in which there is a dose of allele A that produces polypeptide chain a
and another dose of allele a that encodes chain P , there is an equal amount of both
polypeptide chains (1/2 a : 1/2 P )
5. That the different monomers, dimers or tetramers ( as the case may be) are equally active
and show the same substrate specificity.
6. That in the case of dimers and tetramers , the polypeptide chains associate randomly to
form active dimers or active tetramers , as the case may be.
To better understand how it is possible to deduce the quaternary structure and the genetic
control of isoenzymes using Mendel's methodology, the different cases of quaternary
structure will be presented, starting with the simplest situation of genetic control , a locus
with two alleles. , and monomeric quaternary structure.

1 .- A locus with two alleles with complete dominance ( A>a ) and monomeric
quaternary structure.
Suppose that the active allele A carries information for polypeptide a and that allele a is
a null. A null allele may be an amorphous allele that would carry information for a non-
functional polypeptide, or it could be a deletion or loss of the gene or allele that encodes the
corresponding polypeptide. A null allele could also be a gene that carries information for a
polypeptide that cannot be detected by the "in vitro" staining that is carried out to stain the
enzyme, but that does have a physiological function "in vivo". In short, a null allele is one
that cannot be detected by the staining system used "in vitro". In this situation, the AA
homozygous individuals (P 1 ) produce a polypeptide chain and present a single isoenzyme
( a monomer ) . The aa homozygotes (P 2 ) lack an active polypeptide and do not present
any isoenzyme, and the Aa heterozygotes (F 1 ) also They synthesize the a monomer and
therefore have an isoenzyme identical to that of AA homozygotes. Aa heterozygotes (F 1 )
have the same isoenzyme pattern as dominant AA homozygotes. The crossing of two
heterozygotes ( Aa x Aa ) produces an F 2 with two classes of individuals, those that have a
single isoenzyme ( monomeric ) and those that lack an isoenzyme in proportions 3/4 and
1/4, respectively. This segregation of F 2 coincides with that expected for a locus with two
alleles and complete dominance.

9
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Although the most common thing is that there is co-dominance between the alleles that
code for isoenzymes , however, there are examples of complete dominance, such as
Peroxidases, Alkaline Phosphatases and Esterases. These isoenzymes also have a
monomeric structure in many plant species.
2 .- A locus with two co-dominant alleles ( A=a ) and monomeric structure.
In this case, both alleles ( A and a ) give rise to active polypeptides, the A allele carries
information for the a polypeptide chain and the a allele for the P. Homozygous AA
individuals (P 1 ) present a single active monomer ( a ) and homozygous aa (P 2 ) show
another active monomer ( P ) with different electrophoretic migration. The crossing of both
homozygotes produces a heterozygous F 1 ( Aa ) that simultaneously has the two
isoenzymes ( a and P monomers) observed separately in the parents. Therefore, in F 1
individuals the two alleles are expressed simultaneously, with co-dominance existing.

MOHOMER

| A locus with two active alleles |

a• •1•m
p•d1d1•
Pi Da F1 fz Fa Fa
AA aa Ah AA Ah aa

Crossing two heterozygotes ( Aa x Aa ) produces an F 2 with three individual classes,

1/4 AA with a single isoenzyme ( a monomer), 1/2 Aa with two isoenzymes ( a and P
monomers) and 1/4 aa with another isoenzyme of lower migration ( P monomer ). In this
case, the two homozygotes have different external appearances than the heterozygotes. The
segregation obtained in F 2 corresponds to that of a locus with two co-dominant alleles.
3 .- A locus with two co-dominant alleles ( A=a ) and a dimeric quaternary structure.
The A allele carries information for the a polypeptide and the a allele for the P
polypeptide chain. We will assume that two polypeptide chains associate randomly to form
active dimers . AA homozygotes (parental P 1 ) have only the a chain and form aa dimers ;
they have a rapidly migrating isoenzyme . Homozygotes aa (parental P 2 ) have only chain
P and produce dimers
PP , have an isoenzyme of
slow migration. We have assumed that the dimers _ a a y
PP show different
electrophoretic migration. The crossing of both parents gives rise to a heterozygous F 1
(Aa) that simultaneously has a chain and P chain, therefore, the random association of
both polypeptides will produce three classes of dimers : aa , Pa and
PP . If we assume that a and P
are produced in equal quantities ( a : P ratio 1:1), the heterodimer ( Pa + aP ) is twice as
likely as the homodimers , aa or the
PP .
DIMER
A locus with two active alleles

Pi Pa f I Fa Fa
AA aa Aa AA Aa aa

9
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Segregation F2 1/4 1/2 1/4

Consequently, the F 1 individuals present three different isoenzymes ( dimers ) , two of
them have the same migration as those shown by the parents separately (the homodimers )
and the other shows an intermediate migration between the two, corresponding to the
heterodimer. . The relative intensities of the three isoenzymes present in the heterozygotes
are 1:2:1 from highest to lowest electrophoretic migration, respectively.

Dimer Polypeptide Alleles

heterozygous Ah
Random association of polypeptides for
form active dimers

The A and a alleles are being expressed simultaneously in the heterozygotes ( Aa ),

therefore, there is co-dominance. If we compare the isoenzymatic patterns of F 1 individuals
when the quaternary structure is monomeric and dimeric , we will reach the conclusion that
in the first case ( monomers ) , the F 1 heterozygotes ( Aa ) do not show new migration
bands. intermediate between those of the parents, while in the second ( dimers ) , a new
migration band intermediate between those of the parents is observed.
The crossing of two heterozygotes ( Aa x Aa ) produces an F 2 with three individual
classes, 1/4 AA with a single isoenzyme ( aa dimer), 1/2 Aa with three isoenzymes (
dimers , aa , Pa and
PP ) and 1/4 aa with another isoenzyme of lower migration ( dimer
PP ).
Homozygotes ( AA and aa ) have different external appearances than heterozygotes ( Aa ).
The segregation observed in F 2 corresponds to that of a locus with two co-dominant
alleles.
4 .- A locus with two co-dominant alleles ( A=a ) and tetrameric quaternary structure.
The A allele carries information for the a polypeptide and the a allele for the P
polypeptide chain. We will assume that four polypeptide chains associate randomly to form
active tetramers . AA homozygotes (parental P 1 ) have only the a chain and form aaa
tetramers; they have a rapidly migrating isoenzyme . Homozygotes aa (parental P 2 ) have
only chain
P and produce PPPP tetramers , they have a slow
migrating isoenzyme . We have assumed that the aaaa and PPPP tetramers show different
electrophoretic migration.

9
4
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

TETRAMER

A locus with two active alleles

2011 1
X9 20
Total count two hands: 44
gma 90
LACTATEDEHYDROGEIIase 90
a• •1•m p • d 1 d 1 • 93
PP . 93
88 and 99
yP and 99
PROCEDURES 132
Greenhouse 132

The crossing of both parents creates a heterozygous F1 (Aa) that simultaneously has a
chain and P chain, therefore, the random association of both polypeptides will produce
five classes of tetramers : aaaa , aaaP , aa, PaPP and PPPP . If we assume that a and
P are produced in equal quantities ( a
: P ratio 1:1), aaP and
PaPP heterotetramers are four times more likely than aaaa or PPPP homotetramers since
there are four possible heterotetramers of the aaaP type ( aaaP + aaaP + aPaa +
aPaa ) and another four of the PaPP type ( PaPP + PaPP + PPPa + PPPa ).
Similarly, the heterotetramer that has two a chains and two P chains ( aaPP ) is six times
more probable than the homotetramers since there are six possible heterotetramers with two
chains of type a and two of type P ( aaPP + aa + aa + aa + aa + PPaa ).
Consequently, the F1 individuals present five different isoenzymes (tetramers ) , two of
them have the same migration as those shown by the parents separately (the homotetramers
) and the other three show an intermediate migration between the two, corresponding to the
heterotetramers . The relative intensities of the five isoenzymes present in the
heterozygotes are 1:4:6:4:1 from highest to lowest electrophoretic migration, respectively.

9
5
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Heterozygous Aa
Random association of polypeptides for
form active tetramers
The A alleles
and they are
expressing simultaneously in the heterozygotes ( Aa ), therefore, there is co-dominance. If we
compare the isoenzymatic patterns of the F 1 individuals when the quaternary structure is monomeric
, dimeric and tetrameric , we will reach the conclusion that in the first case ( monomers ) , the
heterozygotes ( Aa ) of the F 1 do not show bands new ones of intermediate migration between those
of the parents, in the second ( dimers ) , a
new band of migration intermediate between those of the parents, and in the third case (the tetramers
) the heterozygotes show three new bands of migration intermediate between those of the parents.
The crossing of two heterozygotes ( Aa x Aa ) produces an F 2 with three individual classes,
1/4 AA with a single isoenzyme ( aaaa tetramer), 1/2 Aa with five isoenzymes ( tetramers , aaaa ,
aaap , aa, Papp and ) and 1/4 aa with another isoenzyme of lower migration ( tetramers .
PPPP ). Homozygotes ( AA and aa ) have different external appearances than heterozygotes (
Aa ). The segregation observed in F 2 corresponds to that of a locus with two co-dominant alleles.
So far, we have considered that the isoenzymes analyzed fit simple genetic control
situations. In all cases, we have assumed the existence of a single locus. From now on, we are going
to complicate our study a little and take into account that the isoenzymes analyzed can be controlled
by two independent loci, that is, by two loci located on different chromosomes or on the same
chromosome but very far away. In any case, we will assume that both loci ( A,a and B,b ) combine
independently according to Mendel's Third Law.

Summary of the method used by Mendel (crosses in which two loci segregate).

Obtaining the first filial generation (F 1 with genotype AaBb ) between two homozygous
pure lines (P 1 with genotype AABB and P 2 with genotype aabb ). Self-fertilization or crossing of
two F 1 individuals to achieve the second filial generation (F 2 ).
By observing the external appearance (phenotype) of the F 1 ( AaBb ) individuals it is
possible to deduce the dominance or co-dominance relationships of the alleles A and a and the
alleles B and b that control the characters studied. If the phenotype ( isoenzymatic pattern ) of F 1 is
uniform and equal to that of one of the parents (P 1 or P 2 ), it is a case of dominance, if allele A
dominates over a ( A>a ) and B on the b ( B>b ) the F 1 has the same appearance as the parent P 1
(Mendel's First Law or Principle of Uniformity).
If alleles A and a and alleles B and b are expressed at the same time in F 1 individuals, it is
said that there is co-dominance at both loci ( A=a, B=b ) and their phenotype ( isoenzymatic pattern
) is different from that of the two parents (P 1 and P 2 ).
In the second filial generation (F 2 ), individuals of nine different genotypes are observed in
the following proportions: 1/16 AABB + 2/16 AABb + 1/16 Aabb + 2/16 AaBB + 4/16 AaBb +
2/16 Aabb + 1/16 aaBB + 2/16 aaBb + 1/16 aabb . These proportions are obtained from the
independent combination of what happens to each locus separately (1/4 AA + 1/2 Aa + 1/4 aa ) X
(1/4 BB + 1/2 Bb + 1/4 bb ). When there is complete dominance in both loci ( A>a, B>b) in F 2,
four different phenotypes are observed with the following proportions: 9/16 AB , 3/16 Ab , 3/16 aB
and 1/16 ab . In this case it is not possible to distinguish dominant homozygotes from heterozygotes
at each locus. This phenotypic segregation also comes from the independent combination of what
happens to each locus separately, (3/4 A + 1/4 a )X (3/4 B + 1/4 b ). (Mendel's Third Law or
Principle of Independent Combination).
However, if there is a codominance relationship between alleles A and a ( A=a ), and
between alleles B and b as well ( B=b ), in F 2 we will find nine different phenotypes (isoenzymatic
patterns), as many as different genotypes and with the same proportions: 1/16 AABB + 2/16 AABb
+ 1/16 Aabb + 2/16 AaBB + 4/16 AaBb + 2/16 Aabb + 1/16 aaBB + 2/16 aaBb + 1/ 16 aabb . In

9
6
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

the latter case, each genotype corresponds to a different external appearance.

5 .- Two independent loci with two alleles with complete dominance at each locus ( A>a ) (
B>b ) and monomeric quaternary structure.
We will assume that allele A carries information for polypeptide a while allele a is a null
that does not carry information for any polypeptide chain. Likewise, we will accept that allele B
carries information for the P polypeptide while allele b is a null allele that does not code for any
polypeptide chain. The migration of the a polypeptide is faster than that of the P polypeptide, so
that AAbb homozygotes show an isoenzyme or monomer corresponding to the a polypeptide.
However, aaBB homozygotes present a lower migration isoenzyme corresponding to the P
monomer . The crossing of homozygous AAbb with aaBB gives rise to a heterozygous F 1 ( AaBb )
that simultaneously presents the monomers a and P. That is, the F 1 individuals show at the same
time the a and P monomers observed separately in the homozygous parents, therefore, it is complete
dominance at both loci ( A > a and B > b ).

Two independent loci

P, P, F, F2 F, F, F2
AA aa Aa TO- TO- aa aa
bb BB Bb B- bb b bb

F2 9/16 3/16 3/16 1/16

segregatio
The crossing of two diheterozygotes AaBb x AaBb gives rise to an F 2 formed by four
classes of descendants. Individuals are observed with two isoenzymes or monomers (monomer a
and monomer P ) with the same appearance as the individuals of F 1 ( AaBb ), these individuals
have at least one allele A and another B , their genotype being, therefore, AB- . Also, in this F 2
individuals are obtained that only possess the a monomer and have at least one A allele ( A-bb
genotype) and individuals that only possess one isoenzyme ( the P monomer ) having at least one B
allele ( aaB genotype). - ). Finally, in this F 2 , individuals are also obtained that do not present any
isoenzyme or monomer ; these individuals are homozygous for the two null alleles ( aabb ). If we
take into account that the loci A,a and B,b are independent, that is, they are found on different
chromosomes or on the same chromosome but very far from each other, the proportions with which
these four types of descendants are observed in the F 2 is the following: 9/16 AB- , 3/16 A-bb , 3/16
aaB- and 1/16 aabb . The segregation corresponding to Mendel's 3rd law or Principle of
Independent Combination 9 AB : 3 Ab : 3 aB : 1 ab is fulfilled.
It is important to note that the isoenzymatic patterns observed in this case are identical to
those described for the case of a locus with two co-dominant alleles ( A = a ) and a monomeric
quaternary structure. The only difference is that when it comes to two loci ( A,a and B,b ) with
complete dominance ( A > a and B > b ), in F 2 individuals appear that simultaneously lack the two
isoenzymes or monomers , a And p . Therefore, to decide whether it is a locus with two co-
dominant alleles and a monomeric quaternary structure or whether it is two loci with complete
dominance and also a monomeric structure, it is necessary to observe in the F 2 individuals that
simultaneously lack both monomers , that is, that is, individuals without isoenzymes . When the loci
analyzed are independent, it is relatively easy to find in the F 2 individuals without the two
monomers , since the expected proportion is 1/16. However, if both loci are located on the same
chromosome and very close (they are closely linked), the probability of obtaining in F 2 individuals
that lack both isoenzymes or monomers is very low. So for a genetic distance of 10 Morgan
(recombination fraction r=0.1) and a total of 200 descendants (N=200), only 1/4 p 2 N will lack both
monomers , that is, not even an individual of type aabb is expected, since 1/4 x (0.1) 2 x 200 = 0.5. In

9
7
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

such a situation (when we do not observe aabb individuals), we would interpret the isoenzymes
studied to be monomers controlled by a single locus with two active and co-dominant alleles.
6 .- Two independent loci with two co-dominant alleles each locus ( A=a and B=>b ) and
monomeric quaternary structure.
In this case, the A and a alleles give rise to active polypeptides, the A allele carries
information for the a polypeptide chain and the a allele for the
P. Alleles B and b carry
information for the active polypeptides 8y
and, respectively. We will assume, to facilitate
understanding, that all monomers p show different migration, and that monomers _a and P show
greater electrophoretic migration than monomers 8y
AND .
AABB homozygotes have the a and8 isoenzymes or monomers , while aabb homozygotes have the
P and monomers.
AND . The crossing of both homozygotes ( AABB x aabb ) gives
rise to a diheterozygous F 1 that simultaneously presents the four isoenzymes or monomers ( a , P ,
8y
AND). Therefore, in both loci the alleles are co-dominant ( A=a and B=b ),
since in the heterozygote both alleles are expressed simultaneously. One of the characteristics of co-
dominance is that each genotype corresponds to a different phenotype or external appearance, so that
homozygotes are different from heterozygotes.

MONOMER
Two loci with two active alleles each locus
Two independent loci

1 •1 ®2 ®1 •1 @1
« ®1
T 1 @11 01 •2 @ 1 •1
••
•

Q, P2 F, F2 F2 F, F2 F2 F, F2 F2
AA aa aa AA AA AA Ah Ah Ah aa aa aa
B.B. bb bb B.B. Bb bb B.B. Bb bb B.B. Bb bb
F2 segregation 1/16 2/16 1/16 2/16 4/16 2/16 1/16 2/16 1/16

The crossing of two diheterozygotes ( AaBb x AaBb ) gives rise to an F 2 made up of nine
different classes of individuals, as many as there are different genotypes. The nine different
genotypes of this F 2 are obtained by independently combining what happens to each locus
separately, so that at the locus A,a three classes of individuals are observed in the proportions 1/4
AA + 1/ 2 Aa + 1/4 aa ; At the B,b locus, three classes of individuals are also obtained in the
proportions 1/4 BB + 1/2 Bb + 1/4 bb . The independent combination of both loci (1/4 AA + 1/2 Aa
+ 1/4 aa ) X (1/4 BB + 1/2 Bb + 1/4 bb ) results in the following segregation in the F 2 : 1/16 AABB
+ 2/16 AABb + 1/16 Aabb + 2/16 AaBB + 4/16 AaBb + 2/16 Aabb + 1/16 aaBB + 2/16 aaBb +
1/16 aabb . In this F 2 , as can be seen, there are nine different phenotypes corresponding to the nine
genotypes mentioned above. Furthermore, F 2 individuals show two, three or four monomers .
Homozygotes for both loci present two isoenzymes : a y8 ( AABB ), a and
Y ( AAbb ), P y8 ( aaBB ) or P y
And ( aabb ). Diheterozygotes have four
isoenzymes or monomers , like F 1 individuals: a , P , 8y
AND . Homozygotes for a

9
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

locus and heterozygotes for the other locus present three monomers : AABb ( a , 8y
Y), aaBb ( P , 8y
Y ), AaBB ( a , P and 8 ) and Aabb ( a , P and Y ).
The segregation obtained in F 2 corresponds to that expected when the loci analyzed are
independent, that is, when they are located on different chromosomes or on the same chromosome
but very far away. In the event that they behave as closely linked (they are on the same chromosome
and very close together) the relative proportions of the different individuals are different from those
obtained in independence.
7 .- Two independent loci with two co-dominant alleles each locus ( A=a and B=>b ) and
dimeric quaternary structure.
We will assume that the codominant alleles A and a carry information for the polypeptides
a and P , while the codominant alleles B and b encode for the polypeptides 8y.
AND . Likewise, we will imagine that the four possible homodimers ( aa ,
PP ,
88 and
YY) present different migration on the gels, the aa homodimers and
PP greater
migration than homodimers 88 and
YY. We will also assume that both loci A,a and B,b code for
isoenzymes with the same subcellular location, therefore, heterodimers may appear between the
polypeptides encoded by alleles of different loci, that is, a or ya or SP or yP heterodimers . In such a
situation, AABB homozygotes show the aa , Sa and 88 dimers ; and aabb homozygotes have the
dimers
PP ,
yP and
yy . The
crossing of both homozygotes ( AABB x aabb ) gives rise to a diheterozygous F 1 that presents nine
different bands, the same ones observed in the parents separately and three new ones of intermediate
migration.

Each of the F 1 bands corresponds to a different dimer , except for the central band which is due to the
superposition of two heterodimers with the same migration ( SP+ya ).
Because there is co-dominance between the alleles of loci A,a and B,b and heterodimers are produced between
the polypeptide chains encoded by alleles of different loci, in diheterozygotes 10 different dimers are produced
that, from greatest to least migration, give rise to nine bands aa, ,Pa PP, ,Sa ( SP+ya ) , ,ya SS, yS y

9
9
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

yy . The relative intensities of these nine bands are

obtained by remembering that heterodimers have twice the probability of homodimers and that the central
band is the superposition of two heterodimers , therefore, the relative intensities of the nine bands AX, a , , 5a
( +ya ) , a 55, and and
YY are 1:2:1:2:4:2:1:2:1, respectively.
The crossing of two diheterozygotes ( AaBb x AaBb ) creates an F 2 made up of nine types of
offspring. The nine different genotypes of this F 2 are obtained by independently combining what happens to
each locus separately, so that at the locus A,a three classes of individuals are observed in the proportions 1/4
AA + 1/ 2 Aa + 1/4 aa ; At the B,b locus, three classes of individuals are also obtained in the proportions 1/4
BB + 1/2 Bb + 1/4 bb . The independent combination of both loci (1/4 AA + 1/2 Aa + 1/4 aa ) X (1/4 BB + 1/2
Bb + 1/4 bb ) results in the following segregation in the F 2 : 1/16 AABB + 2/16 AABb + 1/16 Aabb + 2/16
AaBB + 4/16 AaBb + 2/16 Aabb + 1/16 aaBB + 2/16 aaBb + 1/16 aabb . Homozygotes for both loci show
three dimers AABB ( aa , 5a and 55 ), aabb ( PP ,
YP and
YY ), AAbb ( aa, Ya and
YY ) and aaBB ( PP, 5P
and 55 ). Diheterozygotes ( AaBb ) show the same isoenzyme pattern as F 1 individuals, nine isoenzymes .
Homozygotes for one locus and heterozygotes for the other have six dimers with the relative intensities
indicated in each case: 1 aa :2 Pa :1
PP :4 5a :4 5P :4 55 in individuals AaBB , 1 aa
:2 Pa :1
PP :4 Now :4
YP :4
YY for the Aabb , 4 aa :4 5a :4 Now :1 55 :2 Y5 :1
YY in AABb and 4 PP :4
5P :4 YP :1 55 :2 Y5 :1 YY in the aaBb individuals.
The segregation obtained in F 2 corresponds to that expected in case of independence, that is, when
the loci are located on different chromosomes or on the same chromosome but very far away. In the case of
close linkage (located on the same chromosome and very close together), the relative proportions of the
different individuals are different from those obtained independently.
Assuming that the loci analyzed encode isoenzymes with different subcellular locations , for
example, locus A,a for isoenzymes located in the mitochondria and locus B,b for isoenzymes located in the
cytoplasm, the isoenzymatic patterns would be simpler. , since heterodimers would not be observed between
the alleles corresponding to polypeptides with different subcellular localization . Homozygotes for both loci
would only show two homodimers and diheterozygotes ( AaBb ) would only have six dimers or distinct bands
instead of the nine bands and 10 dimers described in the previous case. Homozygotes at one locus and
heterozygotes at the other would present four isoenzymes instead of the six observed in the previous example.
8 .- Allelic series and crosses between individuals heterozygous for different alleles of the same locus.
Until now, we have considered that in each of the loci analyzed there were only two alternatives or
alleles. However, when isoenzymatic analyzes are carried out in populations, it is common to find that at a
locus there are more than two alleles or alternative forms. An allelic series occurs whenever there are more
than two alleles at the same locus. The typical example of an allelic series is the ABO blood group system in
the human species.
The total number of different genotypes that can be found in a population for a locus at which there
are n alleles is:
CR = Combinations with repetition
CR = n(n+1)

The total number of different homozygous genotypes is n (as many as there are different
alleles), and the number of heterozygous genotypes is:
(n-1)/2; C = Combinations
C=n
If we imagine a locus with four co-dominant alleles (A 1 , A 2 , A 3 and A 4 ), we will have a total of
10 different genotypes, of which four are homozygous (A 1 A 1 , A 2 A 2 , A 3 A 3 and A 4 A 4 ) and
six are heterozygous (A 1 A 2 , A 1 A 3 , A 1 A 4 , A 2 A 3 , A 2 A 4 , and A 3 A 4 ). The number of
different phenotypes is the same as the number of genotypes since there is co-dominance.
Until now, to find out the genetic control of the isoenzymes studied, we have always
assumed that F 2 was obtained by crossing two identical heterozygotes ( Aa x Aa ). However, when

1
0
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

there are more than two alleles at the locus analyzed, in many cases crosses can be carried out
between individuals heterozygous for different alleles. For example, A 1 A 2 x A 1 A 3 or A 1 A 2 x A
3A4.
To better understand what happens in this type of crossing, we are going to assume in all
cases that it is a locus in which there are four different and co-dominant alleles (A 1 , A 2 , A 3 and A
4 ) that code for four polypeptide chains with different electrophoretic migration ( a , P ,8y
and, respectively). Likewise, to begin we will assume
that the active quaternary structure of our enzyme is monomeric .
In the offspring of a cross between individuals heterozygous for different alleles (A 1 A 2 x
A 3 A 4 ) we will find four classes of descendants in equal proportion. This result is reached by
thinking that one of the parental heterozygotes (A 1 A 2 ) produces two kinds of gametes in equal
proportion, 1/2 A 1 + 1/2 A 2 ; and the other heterozygote also produces two other types of gametes
in the same quantity 1/2 A 3 +1/2 A 4 .
2011..................................................................................................................................1
X9.......................................................................................................................................20
Total count two hands:............................................................................................44
gma.........................................................................................................................................90
LACTATEDEHYDROGEIIase.......................................................................................................90
a• •1•m p • d 1 d 1 •....................................................................................................93
PP .............................................................................................................................93
88 and..........................................................................................................................99
yP and........................................................................................................................99
PROCEDURES...................................................................................................132
Greenhouse.........................................................................................................132

AA AA A,Az A,
| Segregation! 154 134 134 194
Therefore, the offspring is obtained by independently combining the gametes produced by
each parent (1/2 A 1 + 1/2 A 2 ) X (1/2 A 3 +1/2 A 4 ) = 1/4 A 1 A 3 + 1/4 A 1 A 4 + 1/4 A 2 A 3 + 1/4
A 2 A 4 . As can be seen, despite being the segregation of a single locus, four classes of descendants
appear, and in addition they are all heterozygous with two bands and with an isoenzymatic pattern
different from that of their parents.
It is also possible to perform crosses between heterozygotes that have a common allele (for
example A 1 ), the others being different (A 1 A 2 XA 1 A 3 ). The offspring obtained are also made
up of four classes of individuals in equal proportion, (1/2 A 1 + 1/2 A 2 ) x (1/2 At 1 +1/2 A
3) = 1/4 A 1 A 1 + 1/4 TO 1 TO 3 + 1/4 TO 2 TO 1 + 1/4 A 2 A 3 ), although
between
There are homozygotes.

1
0
1
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

If the isoenzymes we are analyzing have a dimeric or tetrameric quaternary structure, and
we continue assuming that they are controlled by a single locus with four alleles that code for
polypeptide chains with different electrophoretic migrations, the results would be similar to the
previous ones, simply changing the isoenzymatic pattern presented. by the descendants.
In the offspring of a cross between individuals heterozygous for different alleles (A 1 A 2 x
A 3 A 4 ) that code for polypeptide chains ( a , P ,8y
And) that give rise
to dimeric isoenzymes , we will find four classes of descendants in equal proportion, (1/2 A 1 + 1/2
A 2 ) X (1/2 A 3 +1/2 A 4 ) = 1/4 A 1 A 3 + 1/4 A 1 A 4 + 1/4 A 2 A 3 + 1/4 A 2 A 4 . These descendants
are all heterozygous and show three bands (two homodimers at the ends and one heterodimer
migrating intermediately between both homodimers ) .

1
0
2
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

DC @Yo @Yo I heard

cP •2
PP,c5 ( 1 • 2 c 1 @1
ay.pS _ •202
85,py (1(1 @1•2
ST •2
T.T. @1 (1 g
AAzXAzA4 Aaz AA+ AzAz A-A4
Segregation] 114 134 [1/4] 1/4
In the offspring of a cross between individuals heterozygous for different alleles (A 1 A 2 x
A 3 A 4 ) that code for polypeptide chains ( a , P ,8y
And ) that give rise to tetrameric isoenzymes , we will find four classes of descendants in equal
proportion, (1/2 At 1 + 1/2 A2) x (1/2 At 3 +1/2 A 4 ) = 1/4 A 1 A 3 +
1/4 A 1 A 4 + 1/4 A 2 A 3 + 1/4
A 2 A 4 . These descendants are all heterozygous and show five bands (two homotetramers at the
ends and three heterotetramers with intermediate migration between both homotetramers ) .

TETRAMER

FF,a5
PPP,fall
pppp,am5s
PPp5

PHH,aNNAT.PRy
P835 NN35,PP» S55y.0m 8m.0m

II
GOALS
Apply knowledge of Mendel's laws in the interpretation of isoenzymatic molecular
markers.

III MATERIAL AND METHODS 3.1 Proposed problems

1
0
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

1 ADH
To find out the possible quaternary structure of the alcohol dehydrogenase
(ADH) isoenzymes in rye, two homozygous plants (P 1 x P 2 ) have been
crossed. with ADH isoenzymes of different migration
electrophoretics. The F 1 plants were uniform and showed the isoenzymatic
pattern on the right.
Indicate the dominance or co-dominance relationships between
the ADH alleles. State the quaternary structure. P 1 F 1Q 2

1
0
4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

2 CAT
To find out the possible quaternary structure of the catalase (CAT) isoenzymes
in rye, two homozygous plants (P1 x P2) that had CAT isoenzymes of different
electrophoretic migration were crossed. The F1 plants were uniform and showed
the isoenzymatic pattern on the right.
Indicate the dominance or co-dominance relationships between the alleles
P1 F1 P2
of
CAT. State the quaternary structure.

3 ADH PGM
To find out the dominance or co-dominance relationships between the alleles of
the four loci that code for four different isoenzymes, Alcohol dehydrogenase
(ADH), Phosphoglucose mutase (PGM), Catalase (CAT) and Peroxidase (PER)
in rye, two homozygous plants (P1 x P2) that had different isoenzymes. The F1
plants were uniform and showed the isoenzyme patterns indicated on the right.
Indicate the dominance or co-dominance relationships between the alleles
of
ADH, PGM, CAT AND PER. P1 F1 P2 P1 F1 P2
State the quaternary structure.
CAT PER

P1 F1 P2 P1 F1 P2

4. ACO 50 Plants of the F 2

The crossing of two plants
homozygous
(P 1 x P 2 ) for Aconitase
(ACO) has resulted in a
uniform F 1 . The self-
fertilization of F 1 has
' e---eeee-. •• . •• ee
caused a compound F 2by 2• •••• •••••« eeesse •
50 11 I 4 1 67 1 ♦ 14 11 1» 13 M 1s 14 17 11 1» 20 21 21 21 24 2s
floors. Find out: Gel No. 1: 25 first plants of the F2
The interactions
between alleles, the
number of loci and 1 •• -eee-e •••••«••••«• •
the quaternary 2 • • • • • ••• ••••• •••• • •

structure for 1 2 3 4 1 67 4 4 14 11 12 11 14 14 14 17 14 14 24 21 22 « MY
TGel Nº 2: 25 last plants of the F2
aconitase.
segregation . Checking
using c 2 .
CAT
5.
The crossing of two plants
homozygous (P1 x P2) for * «4 "="555=
Catalase (CAT) gave rise to a * * that ■* »* * *
uniform F1. Self-fertilization r • - sems== ==mess= m
of F1 gave rise to F2 made up P 1 F 1 Q 2 11 14 1 41 h 7 #nuHHHTIB2E 211 a
of 25 plants. Find out: Gel Nº1: 25 F 2 plants

1
0
5
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

The number of loci,

interactions between
alleles and quaternary
structure.
Observed and expected
segregation .
Checking using c 2 .

6 ADH
The crossing of 2• ---- ---e= ******* •
two plants 12 1 4 s • 7 a I 11 11 U 11 14 ti 1« 17 II It 19 >1 11
13 24 zs
homozygous (P 1 x Gel Nº1: Plants from 1 to 25
P 2 ) for Alcohol
dehydrogenase go ****** * • • • • * * * • • •*
(ADH) has 2***•• •ee e • ee • •••• ••
resulted in a ij 3 4 5 ay ■ 9 10 1112 13 1415 1617 18 19202122 2324 25
uniform F 1 . The P 1 F 1 Q 2 Gel Nº2: Plants from 26 to 50
self-fertilization of
the F 1 ha
originated a
F 2 composed
for 50 plants. Find
out:
The number
of loci,
interactions
between alleles
and quaternary
structure.
Observed and
expected
segregation .
Checking
using c 2 .

7 PGD 50 F2 Plants
The crossing of two
floors
homozygous (P 1 x Debetmebetmebemmebetmebee vaD-1

Q2) for 6- GEL-

Phosphogluconate
dehydrogenase (PGD) • 222 222222 2 22 22*00-2 1 2 J 4 5 • 7 s 9 101112 1314
has resulted in a
uniform F 1 . The self- 151617 18192021 22 2324 25
fertilization of F 1 has Gel No. 1: 25 first plants of the F 2
caused a F 2
composed :.: De®-
by 50 floors. GEL-2
Find out:
He no. of loci, 2-00-2
interactions between
alleles and structure 1 234567 8 9 1112 1314151Í 17 11 192021 22
quaternary. Observed 232425
Gel No. 2: 25 last plants of the F 2
and expected
segregation .

1
0
6
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

1
0
7
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Checking using c
2
.

PER 100 F2 Plants

8
The crossing of two ' e-
2 = = • •• =m==
-and
•••“
-
“
..
•••
• • GEL
= 1
plants homozygous (P1
x P2) for Peroxidase 12 3 4 s 67 s 9 1011 12 12141510 17 18120 2122 23 2425
Gel No. 1: Plants 1 to 25
(PER) gave rise to a 1 •••- • e- e................................................... -ee - GEL
P1P2 . . ........ -*2
uniform F1. Self-
F1
fertilization of F1 gave 1 2 to 4 • 67 to •11121111 171120 21 22 23 24 2s
rise to F2 made up of Gel No. 2: Plants from 26 to 50
100 plants. Find out: ’
2
...
* •= • •••®* “•
-and •
--==== *
•- • - GEL
• 3
The number of loci,
the 13 3 4 • «3 • 1 UHU 13 M 11 II 17 II HN 21 n 23 M M
Gel No. 3: Plants from 27 to 75
interactions between 1 • • •••>•« -e- - •••••• •GEL
alleles and the 2 •• * • b •eee and • • to • to • * 4

quaternary structure 1 2 2 4 S «7 ■ 9 13 11 12 12 14 15 16 17 13 1» 20
of isoenzymes. 21 22 23 24 25
The segregation Gel No. 4: Plants from 76 to 100
and
expected.
Checking using c 2 .

9 ACO ’ _ _ • • - e-. KOI

The self-fertilization of
a F1 GEL 1

heterozygous for ' ememmee B mmemmme *

Aconitase (ACO), ।g •• -• • SDs • ••• •••«
- AC0-2

originating of 13 3 • 3 67 3 1 M 11 11 U W HM n II H n 11
the n 22 MM
P1F1P2 Gel No. 1: Plants from 1 to 25
crossing of two
1 ----.eee _e • e-. ACO-
homozygous plants (P Zmwnwbi • • • • • • 9== • •
1 XP 2 ) gave 100
GEL-2
decendents.
Find out: re e- • • • • ••• • Ac0-, 3
--e-- • •
••••• • • • • •
== ==9
The number of
loci, the 13 3 4 s 11 3 1 M II H 12 M 11 HP 11 11 W 11 HDHH
Gel No. 2: Plants from 26 to 50
interactions *e eme amsee • - e eea •••• MO-1
3•• *•*•• • • and • • •
between alleles,
GE 13
the
'•*•••••*•• •*• ACO-
quaternary 3 ••••• ••••• ••••••• •••
structure of 18 3 4 s 33 ■ su1uuw1*w/uwnn*zs
isoenzymes of Gel No. 3: Plants from 27 to 75
Aconitase, and * eegememe eee •• emsee ACO-1
8• ®s®=e= •e= • ® • ®esm ••
Yeah OEL-4
exists either No • ""=599""== • Accommodate
linkage. «•••• ••••«••• •• ••• •

The segregation 18 3 4 S 43 3 IHHQaNIINPUnHlinnMn

observed Gel No. 4: Plants from 76 to 100

and

1
0
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 14

RECOMBINANT DNA, RESTRICTION MAPS, MAPS

MOLECULAR
INTRODUCTION

Restriction endonucleases are enzymes that recognize specific DNA nucleotide

sequences, and break the DNA double helix at or near these specific locations. The use of them
has allowed us to use them in order to create restriction maps of many lower organisms. This
discovery opened the doors to knowledge of the genome and to being able to manipulate DNA in
such a way that we can introduce genes in specific sequences where we know where. They cut
these enzymes. We currently have many examples of restriction enzyme maps in various
organisms, the best known is that of E.coli, in which it has been possible to introduce genes of
interest to man, such as the insulin gene of this form. We fused this new gene with the genome of
the target individual using a technique called recombinant DNA.

II .- GOALS

Understand the mechanism of recombination

Build restriction maps and molecular maps.

III .-MATERIALS AND METHODS

3.1 PROBLEMS SOLVED

1- Seven mutations affect three different cistrons. When complementation tests are
performed, the results indicated in the following table are obtained in which the + sign
indicates complementation and the - sign means absence of complementation:
TO b c d AN F g
TO - + - + D + + +
b - + - + - +
c - + + + +
d - + - +
AN - + -
D
F - +
g -
Find out which mutations affect the same cistron.
Answer
Two mutations complement when they affect a different functional unit or different
cistron and two mutations do not complement if they affect the same cistron (gene) or
function unit.

1
0
7
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Therefore, mutations A and C affect the same cistron, which we will call cistron 1 ,
since they do not complement. Mutations B , D and F also affect the same functional
unit. But, the cistron that contains mutations B , D and F is different from cistron 1
that has mutations A and C , since mutants B , D , and F complement mutants A and
C , this information indicating that the mutations A and C affect a different cistron
than that affected by mutations B , D and F. Therefore, we are going to call cistron 2
the one that contains the mutations B , D and F. Finally, mutants E and G do not
complement and affect a different cistron, cistron 3 . We know that they affect
another cistron because E and G complement A and C , and they also complement B ,

1
0
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

D , and F. There are therefore three cistrons, cistron 1 with mutations A and C ,
cistron 2 with mutations B , D and F ; and cistron 3 with mutations E and G. The
following diagram summarizes the results obtained

The order of the mutations within each cistron, and of the different cistrons among
themselves, cannot be determined with the data provided in the complementation
table.

2.- It is known that 6 different mutations affect three different cistrons in the following
way:

Suppose you perform complementation or cis-trans tests between pairs of mutants.

Write the results you would expect to obtain in a table, using a + sign when
complementation exists and a - sign in the absence of complementation.
Answer
Suppose you perform complementation or cis-trans tests between pairs of mutants.
Write the results you would expect to obtain in a table, using a + sign when
complementation exists and a - sign in the absence of complementation.

Two mutations complement when they affect a different functional unit or different
cistron and two mutations do not complement if they affect the same cistron (gene) or
functional unit.

1
0
9
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Mutations C and D cannot complement, they affect the same cistron, but they do
complement the others ( A , F , B and E ). Mutations A and F do not complement
each other since they affect the same cistron, but they complement all the others (
C , D , B and E ) since they are in a different gene. Finally, B and E will not
complement each other because they are in the same cistron and they will
complement with the mutations A , C , D and E. The results are indicated in the
following table:

TO b c d AND F

1
1
0
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

TO - + + + + -

1
1
1
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

+ = indicates complementation - = absence of complementation

4. Suppose that we have 7 mutant strains of phage T4 that each have a different deletion
that affects the rII region according to the following scheme:

In addition, it has 5 other mutant strains ( A, B, C, D and E ) that when used to

simultaneously infect the mutant strains carrying different deletions, the following
results are obtained:

1 2 3 4 5 6 7
TO R - R + R R +
b - - R + R - +
c R + + - + + -
d - R - - R R R
AN - R R + R R +
D
R = recombination, + = complementation, - = absence of complementation and
recombination .

In what region or regions of the map are mutations A, B, C, D and E located?

Answer

1
1
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

The criteria that we have to follow to solve this problem are the following:
a) If two mutants complement (+) it means that they affect a different cistron and do
not overlap.
b) If two mutants recombine (R) it means that they do not overlap, but that they
affect the same cistron, since if they affected a different gene they would
complement.
c) When two mutants neither complement nor recombine (-) we must interpret that
they affect the same functional unit (cistron) and that they also overlap.
Following these criteria we can place the mutants ( A, B, C, D and E ) on the map
they have provided us.
Deletion 1 encompasses both cistrons and cannot complement either mutation.
Mutant A does not recombine or complement with 2 , therefore, it is in the same
cistron as 2 ( cistron A ) and overlaps with this deletion. It recombines with 1 , with
3 , with 5 and with 6 and, consequently, does not overlap with these deletions,
discarding regions A and B ( 5 ), D and E ( 6 ), F and G ( 3 ) and H ( 1 ). Mutant A
must necessarily affect the C region (overlap with 2 ) and recombine with the other
deletions of the A cistron .
Mutant B does not recombine or complement with 2 and 6 , therefore, it is in cistron
A (the same as deletions 2 and 6 ) and overlaps with 2 , 6 and 1 . It recombines with
3 and 5 , does not overlap with these deletions and cannot be in regions A and B (
5 ), and F and G ( 3 ). It cannot only be in regions C or E or H since in these cases it
would recombine with 2 , 6 or both, respectively. Therefore, it is necessarily in zone
D , overlapping with 2 , 6 and 1 . It could cover C , D and E or C and D or D and E.
Mutant C neither recombines nor complements 4 and 7 , therefore, it is in cistron B
and overlaps with 4 and 7 . It recombines with 1 and cannot be in regions I and J for
this reason. Nor can it be only in the K or M zones since in these cases it would
recombine with 7 or 4 , respectively. Consequently, it affects at least the region L ,
and can encompass K , L and M or K and L or L and M.
Mutation D neither recombines nor complements with 1 , 3 and 4 , therefore
overlapping with these three deletions. A affects both cistrons, 3 is in cistron A and
4 is in cistron B. Therefore, mutation D is a deletion since it overlaps with two other
deletions that are far from each other. We will determine the limits of the D deletion
by looking at what other mutations it recombines with. It recombines and therefore
does not overlap with 2 , 5 , 6 and 7 ; According to these data it is not in regions A ,
B , C and D ( 2 ); it is not in D and E ( 6 ) or L and M ( 7 ). The deletion

1
1
3
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

D could cover a maximum of region F to K inclusive, although it could also cover a

minimum of G to J inclusive. The map indicates the different regions that the D
deletion can cover.
Mutant E complements with 4 and 8 , it is not in cistron B , it has to affect cistron
A. It overlaps with 1 , while it recombines with 2 , 5 , 6 and 3 and cannot affect
regions A to G, both inclusive. Therefore, mutation E is in the H region.
The following diagram summarizes the results obtained

5 If DNA from a strain a + b + c + is used as transforming DNA with a recipient strain a - b

-
c -, the following types of transformed colonies are obtained:

Transformed colony classes No. of

colonies
to b c
+ + + 215

- - + 22

+ - + 56

- + + 37

+ + - 11

- + - 22
+ - - 21
a) What is the central locus? b) Find out the distance in transformation units between
these three loci.

RESULTS
We are going to try to solve the problem theoretically and then we will do the
necessary calculations. Let's think about a situation in which we had 3 loci x, y, z;
Likewise we have a donor strain x+y+z+ and a recipient x-

1
1
4
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

yz-We know that for transformation to occur the number of crossovers must be
even, and in our case we could have 2 or 4 crossovers in different places:
Yo II III IV
x+ y+ z+

x- and- z-
Crossovers resulting Frequency
I and II strain
x+yz- a1
I and III x+y+z- a2
I and IV x+y+z+ a3
II and III x-y+z- a4
II and IV x-y+z+ to 5
III and IV xy-z+ a6
I II III and IV x+y-z+ a7
Total No. N

To see the central locus we have to think that the most difficult process to occur
and therefore the least probable is the occurrence of 4 crossings, therefore this
must be the least frequent. In this process the only locus that does not change with
respect to the recipient strain is precisely the central one, in our assumption the y,
and in our problem the central locus will be the "c".
To calculate the genetic distance in transformation units between the different loci
we must simply consider the loci two by two and apply the formula of simple
transformed times total transformed.
a1+a4+a5+a7 21 + 22 + 37 + 56
d ( x , y ) =----------------------=----------------------= 0.37
a1+a2+a3+a4+a5+a7 21 + 11 + 215 + 22 + 37 + 56

Note that class a6 is not included because it is not transformed for loci x,y.
a1+a2+a5+a7 21 + 11 + 37 + 22
d ( x. z ) =-------------------=---------------------= 0.25
a1+a2+a3+a5+a6+a7 21 + 11 + 215 + 37 + 22 + 56
a2+a4+a6+a7 11 + 22 + 22 + 56
= 0.31
a 2 + a 3 + aa 4 + a 5 + a 6 + a 11 + 215 + 22 + 37 + 22 + 56
7 to four different antibiotics (A, B, C and D) and
6. There is a strain of bacteria sensitive
another resistant to the same 4 products. An experiment is carried out to transform the
sensitive strain with DNA from the resistant strain, sowing equal volumes of the set of
transformed bacteria in culture media containing different combinations of these
products. The results obtained are indicated in the following table:

No. of No. of
Drugs Drugs
colonies colonies
AB 22 ABC 14
A.C. 325 ABD 22
A.D. 473 ACD 317
B.C. 25 BCD 19

1
1
5
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

B.D. 23
CD 396
Three of the genes that confer resistance are so close that they go together in the
same segment of transforming DNA, behaving as linked in a transformation
experiment. Which of the genes is not linked to the other three? Which locus is the
central one of the three that are linked?

ANSWER

In bacteria, and more specifically in transformation experiments, two loci are said to be
linked if they are found in the same transforming segment. The statement itself tells us
that in this case we have 3 linked loci and one independent. The table that gives us the
problem gives us data on when only two drugs are added to the medium, therefore, in
that medium only bacteria that are resistant to those two products will grow
simultaneously, or what is the same, only those strains will grow. that they are double
transforms for those drugs. Based on this we are going to solve the problem, and in an
act of heroism we are not going to do any numbers, we are only going to reason.
We have said that only double transformed bacteria grow in these media.
Undoubtedly, if the loci are in the same transforming segment, two crossings will be
enough to obtain a double transformed strain, but if the loci that produce resistance are
in different segments (they are independent) we will need two transformation processes
each with two crossovers to integrate each of the two segments. Therefore, the
independent locus will be the one that appears least frequently in the double
transformed strains. Observing the data we see that locus B transforms the low
frequency drastically, therefore locus B must be the independent one.
Well, we already know the independent locus, let's now think about how to find
out which is the central one. In the previous problem we saw that when there are 3 loci
in the same segment, the least likely is the process of 4 crossings and that when that
occurs the central locus does not change in the recipient strain. Following the same
reasoning in our problem we observed that the least frequency of double transforms is
for AC, therefore that will be the least frequent process and the locus that has not
changed is D, therefore we can affirm that locus D is the central one.

7. In a generalized transduction experiment, the donor strain had the trpC + pyrF - trpA -
genotype and the recipient strain had the trpC - pyrF + trpA + genotype. The vector used
was phage T2 and all the transducting colonies were selected. trpC + . The following
types of colonies were obtained
transductants:

Genotype of transducting No. of

colonies colonies
trpC + pyrF – trpA – 273

1
1
6
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

trpC + pyrF + trpA - 278

+ – +
trpC pyrF trpA 3
+ + +
trpC pyrF trpA 45

Indicate the central locus and calculate the cotransduction frequencies between C
and F and between C and A.

ANSWER

In transduction experiments, a marker is generally selected to be sure that at least

one of the genes being worked on has been transported by the phage from the donor
bacteria to the recipient. In this way, all the descendant bacteria of the transduction
experiment must have varied for the selected marker (trpC+, in our case). Otherwise
the basic reasoning for solving these problems is almost the same as in transformation
experiments. To find out what the central locus is, let us remember that the least
probable event is that of 4 crossings, and that in this process the central locus remains
unchanged in the recipient strain. If we look at the table we see that the least frequent
class is trpC+ pyrF- trpA+, as our recipient strain was trpC- pyrF+ trpA+, the only
locus that remains unchanged is trpA, therefore that will be the central one.
In transduction, the genetic distance between two markers is measured by the
frequency of cotransduction, that is, it is measured by the number of times they are
transmitted together compared to the total number of colonies. Therefore in our case

FrequencyC, F = 278 +5
273 + 278 +3+ 45

the calculations will be carried out as follows:

= 0.81

273 +3
FrequencyC, F = = 0.69
273 + 278 +3+ 45
8. A piece of DNA with a unique sequence of 12 kb has been isolated in barley, one of its
5' ends has been labeled with P 32 , two samples have been taken and a partial
digestion of one sample has been carried out with the restriction endonuclease EcoRI
and from the other sample with HindIII . The fragments resulting from each partial
digestion have been separated in an agarose gel, obtaining the following results. Draw
a map of the restriction sites of this 12 Kb molecule.

ANSWER

When we perform a partial digestion with a certain restriction endonuclease, the

reaction is carried out under conditions such that the enzyme cuts at one in every 50
recognition sites. In this way, simply by chance, if we have a DNA molecule with 50
cutting sites, each time the endonuclease will cut at a different point. Once our DNA

1
1
7
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

has been marked at the 5' end with P 32 , we carry out a partial digestion with an
endonuclease, in this way DNA fragments of different lengths are generated that have
in

1
1
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

one end the endonuclease cutting sequence. These fragments can be separated by
agarose gel electrophoresis by their sizes, so that small segments migrate more
quickly than large ones. These DNA fragments are transferred to a membrane using a
Southern (transfer under denaturing conditions) and subsequently an autoradiography
is performed, placing a photographic film on the membrane. In those areas where
there is radioactivity, the B particles of P 32 affect the film and impress it. When the
film is developed, a band is observed in that position.
In this simple way, it is possible to directly read the cut-off points on the
autoradiographs:
Therefore, the restriction map of our 12 Kb fragment would be the following:
HindIII - EcoRI- HindIII- HindIII- EcoRI- HindIII-EcoRI-HindIII-HindIII-
EcoRI

3.2 PROPOSED PROBLEMS

1. Draw a diagram of the archilamide gel that would be obtained when sequencing a
template DNA segment with the following sequence using the Sanger dideoxy
method: 5'CGGATATCCCTAAGGACCTT3'
2. When mutant strains of a bacteriophage are crossed, the following recombination
frequencies in percentages are obtained:
TO b c d
TO 0 12 3 8
b 0 9 4
c 0 5
d 0
Draw a map that indicates the location of each of the mutations.
3. Three independent autotrophs for Neurospora methionine have been studied to
determine which related compound can substitute its

1
1
9
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

4. methionine requirement. In the table below, + indicates growth in minimal medium

with the indicated compound added and – indicates no growth.

Mutant Methionine homoserine Homocysteine Cystathionine

1 + - + -
2 + - - -
3 + - + +

5. Given the following nucleotide sequence of a DNA segment that is translated into a
five-amino acid polypeptide and using the genetic code:
3'TACAATGGCCCTTTTATC5'
5'ATGTTACCGGGAAAATAG3'
a) Deduce the sequence of ribonucleotides in the messenger RNA b) Write the amino
acid sequence of the polypeptide produced. c) Indicate the coding helix and the
stabilizing helix in the DNA. d) Name the anticodons of the transfer RNAs (t-
RNA) involved in the synthesis of this polypeptide, taking into account the
hypothesis of the “flexibility of the third base of the anticodon.” ‖.

6. State what will happen if the following DNA fragment is incubated with the Klenow
fragment of DNA polymerase in the presence of:
a) dGTP; b) dGTP plus dTTP, and c) dGTP plus dTTP plus [ a - 32
P]dATP.d)AGCTTGCTACTATGTGGATGTTACCT 5'
TCGAACGATGATACACCTACAA …… 3' ...
7. After denaturation and sedimentation in CsCl, two bands are obtained: X and Y. Only
X is sensitive to the action of exonuclease VII. Digestion of Y with DNase I under
very mild conditions gives rise to an exonuclease VII-sensitive product.
8. S1 nuclease treatment. After electrophoresis, two bands appear.
9. Design the process to follow to reduce the size of the plasmid by deletion from the
indicated targets, from the DNA in 1) clockwise direction, 2) counterclockwise
direction and 3) both directions.

10. Design a procedure to isolate radioactively labeled DNA that hybridizes to the map
gene mRNA and does not hybridize to the ghsO mRNA.

BIBLIOGRAPHY 1 White, Ma. 1980. Repair of genetic material. Research and Science
2 Crick, F.M. 1966. The Genetic Code. Sci.Am. 215 (4) : 55
3 Darnell, E.E. 1983. RNA maturation. Research and Science
4 De Robertis, E. and De Robertis, E. M. 1986. Cellular and molecular biology. The
Athenaeum. Buenos Aires, Argentina.
5 Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain
6 Jimenez C. 1999. 360 Genetics Problems. Synthesis editorial. Spain
7 Lewis, B. 1977. Genes. Oxford University Press and Cell press. New York. USA
8 Nuñez Murillo, R. 1991. Genetics. Concepts and Problems solved. Arius, Peru.

1
2
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

9 Perera J, Tormo A and Garcia J. 2002. Genetic engineering. Vol II. DNA preparation,
analysis, manipulation and cloning. Synthesis Editorial. Spain.
10 Stansfield, W. 1992. Theory and Problems of Genetics. Schawm Compendium Series.
3rd
Edition, McGraw Hill. Inc. Colombia
11 Stern, C. 1973. Human Genetics, 3rd edition. Alhambra, Spain
12 Strickberger, M. 1988. Genetics. Omega S Publishing. TO; Barcelona, Spain.
14 Visors E 1998. Issues and solved problems of genetics. Ed. University of Granada.
Spain.

1
2
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 15

LIGATION AND RECOMBINATION IN MICROORGANISMS .

I .- INTRODUCTION

The preparation of the maps in microorganisms is done based on the analysis of linkage
and recombination and is similar to that of diploids: comparing the frequency of the parental
types vs. recombinant types in fungi is the way to carry out the detection of linkage and to be
able to prepare the genetic maps.
In this case we say parental type or parental ditypes (DP) = they maintain the paternal
combinations, non-parental ditypes (DNP) = in which each chromosome has the opportunity
to move to one of the poles independently and tetratypes (T) = that indicate recombination.
In bacteria, however, the (1) Conjugation mapping must be taken into account: The
interrupted mating technique is used. 8 min for the transfer to start. It crosses a prototrophic
strain with an autotrophic one. After time intervals, they take a sample and shake it to
separate the strains that are in conjugation. (2) Recombination mapping : To detect the
linkage order between genes that are separated by distances of less than three time units. A
marker must be used.
In bacteriophages, phenotypic differences are more easily recognized by different effects
on bacterial host cells than by differences in the appearance of the virus itself. To study
recombination in viruses, two methods can be followed:
Bald: A culture of bacteria without phages, they have a cloudy appearance (translucent
although not transparent), when these are infected, the entire culture becomes clear as a result
of the lysis of all the cells. Each isolated phage functions as an infection center producing a
“bald” or circle of small bald lysed bacteria whose outer perimeter has a diffuse, cloudy halo
appearance. If phages from previous lysis are sown on a new culture, these bacteria become
superinfected, producing a certain turbidity in the plaque due to the inhibition and delay of
the usual lytic pattern (slow lysis r + or wild phage). But plaques can be found caused by
phages that can superinfect bacteria without inhibition or delay in lysis, recognized by the
plaques that are larger than the previous ones and do not present cloudy halos but rather well
marked ones (lysis phage fast or mutants r)

II .- GOALS
- The student will be able to explain how linkage maps are created by solving problems
about the cases stated.

III .- PROPOSED PROBLEMS

1 .Establish the gene-centromere distance for each of the following Neurospora

characteristics for which segregation was observed in the first and second division.

2 In Neurosppora crassa, crossing the mutant strain with a wild one gave rise to asci
of 6 types:

1) + + to to + + to to 13
2) + + + + to to to to 81
3) to TO to to + + + + 83
4) + + to to to to + + 15

1
2
1
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

5) to to + + to to + + 14
6) to to + + + + to to 11

Calculate the distance from gene a to the centromere.

3 After crossing a wild strain and a mutant strain for the color of the Sordaria spores,
the following results were obtained in the tetrad count: Segregation 4:4 (186),
2:2:2:2 (119), 2:4:2 (95). Calculate the distance of this gene from the centromere.
4 .The distance to the centromere of a certain gene for the color of Jordanian
ascospores is 20 um When crossing a wild strain and a mutant we count 500 asci.
How many should we expect of type 2:4:2 assuming that we find 110 of type
2:2:2:2?
5 In which fungus that forms disordered tetrads, a strain auxotrophic for two
substances a and b is crossed with a wild strain, obtaining the following result:
ab a+ Ab
Type of Ab a+ a+
ascus ++ +b +b
++ +b ++
Frequency 301 42 389

6 .When four mutant strains of a bacteriophage are crossed, the

following recombination frequencies in percentages:
TO b c d
TO 0 12 3 8
b 0 9 4
c 0 5
d 0
Draw a map that indicates the location of each of the mutations.

7 . A three-factor cross was performed between two strains of a virus. The results are
the following :
Offspring No. of bald
genotypes spots
+++ 1200
abc 1100
a++ 280
+bc 300
ab + 180
+ +c 160
a+c 85
+b+ 75
Determine: a) the linkage order of these three genes; b) the linkage distance
between ab, bc and ac; c) the coincidence coefficient; d) interference. In certain

8. In certain transformation experiments to map two genes of Bacillus subtillus , ay,

the following results are obtained:

Experiment donor DNA receptor DNA Transfer Class No. colonies

TO a +b+ a- -b + - a b 130
- + a b
96

1
2
2
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

a+b+ 247
+ - - -
b a b a b a+b- 232
-b+ -b+
a a
341
+b+
a
7
a) According to the definition of linkage in the transformation analysis, are the two
genes linked? b) If they are linked, what
distance awaits you?
9. DNA was obtained from a normal bacterial line, using it to transform a mutant line
incapable of synthesizing the amino acids alanine (ala), proline (pro) and arginine
(arg). The number of colonies of the different transformed classes was the
following:
wing + pro + arg + wing - pro + arg +
8400 + pro - arg -
wing 420 - pro + arg -
wing
wing + pro - arg + wing - pro - arg +
2100 pro arg
wing + + -
840
1400map
Determine the genetic
10. The distance between genes a and b is 0.4 transformation units. The
transformation of bacteria a - b - with DNA from bacteria a + b + originates 5000
transformed colonies. How many of these 5000 colonies will be a + b + .
11. The transformation of ab- bacteria with DNA from an a+b+ strain has given rise
to 13,00 a + b + colonies, 1700 a - b + colonies and 7000 a + b + colonies. What is the
distance in transformation units between the genes? ayb?
12. Two separate transformation experiments have been carried out on a recipient
bacterial strain ab- with DNA from an a + b + strain on the one hand, and on the
other with DNA from two strains, one a + b - and the other a - b + . The results
obtained are indicated in the following table:
donor DNA receptor DNA Transfer Class. No. colonies
a+b+ a-b- a+b- 150
- +
a b
180
+ +
a b
320
a +b- a- -b + -
a b 350
- + - +
a b a b 290
a+b+ 10
a) Why is the number of colonies a + b + greater in the first experiment?
transformation? b) What is the distance in transformation units between
genes a and b?
13. If DNA from a + b + c + donor strain is used to transform a strain
recipient a - b - c - the following types of transformed colonies are obtained:
Tran colony class sformed Number of
to b c colonies
+ + + 2100
- - + 210
+ - + 550
- + + 350
+ + - 102
- + - 217
+ - - 208
a) What is the central locus? b) Find out the distance in transformation units between
these 3 loci
14. There is a strain sensitive to four different colonies (A, B, C and D) and others
resistant to the 4 drugs. A transformation experiment is carried out

1
2
3
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

sensitive strain with DNA from the resistant strain, sowing volumes
equal to the set of bacteria transformed into culture media containing
different combinations of drugs. The results obtained are indicated in the
following tables:
Drug No. colonies Drug No. colonies
AB 23 ABC 15
A.C. 320 ABD 21
A.D. 471 ACD 315
B.C. 26 BCD 18
B.D. 24
CD 393
Three of the genes that confer resistance are so close that they go together in the
same segment of transforming DNA, behaving as if linked in a
transformation experiment. a) Which of the genes is not linked to the others
three? b) Which locus is the central one of the three that are linked?
15. There are four strains of E. coli (1,2,3 and 4) of genotype a + b - and four other
strains (5,6,7 and 8) of genotype a - b + . Two genotypes are mixed in all
possible combinations and after an incubation period it is plated to determine the

following results:

frequency of the a + b + recombinants. You get the

1 2 3 4 M = many recombinants
5
EIT M M EIT L = few recombinants O =
HE
6
EIT M M EIT HE no recombinants
lHE EIT EIT M
7 HE
8EIT lHE lHE EIT
Taking these results into account,HE
assign a sexHE
(Hfr, F + or F - ) to each strain
16. Establish the gene-centromere distance for each of the following Neurospora
characters, in which segregation was observed in the first and second division.
Number of Asci
Character Segregation in the Segregation in the
1st division 2nd division
331 51
a) Type of mating (A vs. to)
b) Pale color of the conidia vs. 73 36
orange
c) Fluffy growth vs. normal 42 67

17. Below are the results of the ordered tetrad analysis of a cross between a strain of
Neurospora that carries the albino gene (al) and that was also unable to synthesize
inositol (inos) and a wild-type strain (++). :
1 2 3 4 5 6 7
at least at + at + at + at least at + at +
at least at + at least at + + + + inos + inos
+ + inos + + + + + at least at + + +

1
2
4
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

++ inos + + inos At least + + + inos at least

4 3 23 36 15 16 22
a) Determine if these two genes are linked and, if so, the linkage distance between
them. b) Which genes have the greatest gene-centromere distance?
18. A cross between a Neurospora strain carrying the colonial temperature-sensitive
(cot) mutant gene, which was otherwise wild-type, and a snowflake (sn) strain,
which was otherwise wild-type, generated several regular tetrads that presented
segregation in the first division and in the second in the following way. Determine if
these genes are linked and their respective gene-centromere distances.
sn cot sn + sn cot sn cot + + sn +
sn cot Sn + sn + sn + + cot sn cot
++ + cot + cot + + sn cot + +
++ + cot + + + cot Sn + + cot
25 16 11 12 8 8
19. A Neurospora strain requiring adenine (ad) and tryptophan (tryp) was crossed
with a wild-type strain (+ +), producing the following tetrads:
1 2 3 4 5 6 7
ad tryp ad + ad tryp ad tryp ad tryp ad + ad tryp
ad tryp ad + Ad + +tryp + + +tryp + +
+ + +tryp +tryp ad + ad tryp ad + +tryp
+ + +tryp + + + + + + +tryp ad +
49 7 31 2 8 1 2
Determine if these two genes are linked and, if so, draw a linkage map that
includes the centromere.
20. DNA was extracted from a wild-type bacterium and used to transform a mutant
strain, unable to identify the amino acids alanine (ala), proline (pro) and arginine
(arg). The number of colonies produced for the different transforming classes are
indicated below:

wing + pro + arg + wing + pro - arg - wing + pro - arg + wing + pro + arg -
7200 200 500 800
wing - pro + arg + wing - pro + arg - wing - pro - arg + Total 10000
100 400 800
a) What are the linkage distances between these genes? b) What is the order of
linkage?
21. If a strain of bacteria used as a donor for transformation is wild type for the a+,
b+, and c+ genes, and the recipient strain carries the a-, b-, and c- mutations, what
transformant classes would you expect to occur? less frequently: a) if a and b
were linked but c was not linked? b) if a and c were linked but b was not linked?;
c) if the three genes are linked in the order acb? d) if they were linked with the
cab order?
22. Crosses were carried out between several autotrophic strains of E. colo that were
either resistant (V r ) or sensitive (V S ) to phage T1. They then selected wild-type
prototrophs and determined their resistance or sensitivity to T1. A set of results is
as follows:
Number of Prototrophs (B
+
Crossing M+T+P+)
Vr VS

- - + + r + + -
B M T P V xB M T 49 8
B-M-T+P+VSxB+M+T- 5 19
P - V to
Check if the gene for resistance r
the virus segregates independently of the others.

1
2
5
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

23. Among the trpB mutations that affect tryptophan biosynthesis in E. coli are B1,
B2 and B3. Linkage relationships between these gene loci were tested by
measuring the frequency of prototrophs arising between two trpB - mutant
recipient strains, when translated with P1 phages carrying preceding DNA from
several trpB - donor strains, as shown in the table below, The frequency of trp +
protozoa ranged from 0 to 5.5 percent. Based on these transduction frequencies,
what is the order of the three mutations B1, B2 and B3?
Receive ptoras trp -
strains
B1 +
B2 + B3 - B1 + B2 + B3 -
- + +
Strains B1 B2 B3 (a) 0 (b) 1.7
+ - +
givers B1 B2 B3 (c) 3.3 (d) 5.5
- + + -
Trp B1 B2 B3 (e) 1.8 (f) 0
24. Six delation mutants were tested in cistron A of the rII region of the
phage T4 in all pair combinations for type combinants

25. Five consumption mutants were tested in cistron B of the rII region of phage T4 in
all pairing combinations for wild-type recombinants. In the following table,
+=recombination, 0 = no recombination. Construct a topological map for these
deletions:
1 2 3 4 5
1 0 + + 0 0
2 0 + 0 +
3 0 + 0
4 0 0
5 0

BIBLIOGRAPHY

1. Jimenez C. 1999. 360 Genetics problems. Synthesis Editorial. Madrid Spain.

2. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium
Series. Third edition. McGraw Hill. Inc Colombia.
3. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.
4. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.
5. Visors E. 1998. Issues and solved problems in Genetics. University of
Granada. Spain.

1
2
6
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

PRACTICE Nº 16

TISSUE CULTURE AS A TOOL FOR

CONDUCT GENETIC STUDIES ON PLANTS
1 .- INTRODUCTION

All cells in multicellular organisms are derived from a zygote that has the genetic
information necessary to divide, differentiate and organize into the tissues and organs that will
make up the complete organism. This ability of cells to regenerate a multicellular individual is
called cellular totipotency. Each cell when separated from a multicellular organism is capable of
leading an independent life when placed in an appropriate environment (in vitro culture).

When organs, tissues or cells are cultured under appropriate conditions it is possible to
induce the formation of organized structures and organs de novo. This process, called
morphogenesis, can lead to the regeneration of whole plants in in vitro cultures. If the formation
of plants involves the initial formation of shoots or adventitious buds and their subsequent
rooting, the process of morphogenesis is said to be organogenetic. When regeneration is
achieved through the production of structures similar to sexual embryos, then the pathway is
called embryogenetic. However, it is also possible that when cultivating plant cells, tissues or
organs, differentiated cells or organized structures are not obtained, that is, an amorphous tissue
may form without defined differentiation or specialization, which is known as callus.

Through existing techniques it is possible to multiply any plant species asexually in

such a way that the same genotype is maintained in the material derived from the original plant.
This method of vegetative propagation is called mycopropagation or clonal propagation and
allows obtaining genetically identical copies called clones.

The isolation of these cells and the successful establishment of the cell culture depends
on numerous factors such as: the source of the explant, the components of the medium
including nutritional factors and hormonal factors and environmental conditions.

In vitro cultures can be used to generate genetic variability in such a way that plants
that are genetically different from the parent plant material can be obtained. Because in vitro
cultures can be maintained under controlled conditions, this makes them an excellent model
system for physiological and genetic studies of plants.

2 .- GOALS

• Use the in vitro culture technique to manage, manipulate and clone plant tissues and organs.
• Develop criteria to prepare and modify media for plant tissue culture and study its response
to environmental change (media modification).

3 .- MATERIAL AND METHODS

To establish cultures in vitro, the following steps are required:
a) Isolate some part of the plant (often tissues or organs)
b) Eliminate all contaminating microorganisms from plant material.
c) Place the plant material in an appropriate growing medium.

1
2
8
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

d) Incubate under controlled environmental conditions

PREPARATION OF CULTURE MEDIUM

Preparation of Stock Solutions of Base Medium Murashige & Skoog, 1962

Stock A weigh
KNO 3 Potassium nitrate 38g/L
CaCl 2 .2H 2 O Calcium chloride dihydrate 8.8g/L
KH 2 PO 4 Monobasic Potassium Phosphate 3.40g/L
NH 4 NO 3 Ammonium nitrate 33g/L
Stock A1 10ml
Stock A2 10ml
Make up to 100 ml distilled water

Stock B (10x) weigh

MnSO 4 . H2O Hydrated Manganese Sulfate 0.338g
MgSO 4 .7H 2 Magnesium sulfate heptahydrate 7.4g
O
Make up to 100 ml distilled water

Stock C (10x) Weigh

KI Potassium Iodide 166mg
H 3 BO 3 Boric acid 1240 mg
ZnSO 4 .7H 2 O Zinc sulfate heptahydrate 1720mg
Na 2 MoO 4 .2H 2 O Sodium Molybdate. 2 waters 50mg
CuSO 4 .5H 2 O Copper sulfate 5 waters 5mg
CoCl 2 .6H 2 O Cobalt Chloride Hexahydrate 5mg
Make up to 100 ml with distilled water

STOCK D Weigh
FeSO 4 .7H2O Iron sulfate heptahydrate 278mg
Na 2 EDTA.2H 2 Sodium Edta. Dihydrate 374mg
O
Dissolve the salts well in 80 ml of distilled water. Pour into a 100 ml test tube.
Dispense into vials, 10 ml per vial. Store refrigerated and in the dark.

Vitamin Stock

Chemical Quantity for 100 ml

1
2
9
Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Inositol 10000 mg

1
3
0
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Nicotinic acid 50mg

Pyridoxine-HCl 50mg
Thiamine-HCl 10mg
Wisteria 200 mg
Dissolve well in 80 ml of distilled water. Pour into a 100 ml test tube.
Dispense into bottles, 20 ml per bottle. Store frozen

MSA-BASE
Chemical Amount
gibberellic acid 0.025g
Glycine HCl 0.5g
Nicotinic acid 0.125g
Pyroxidine HCl 0.125g
Thiamine HCl 0.025g
Myo-Inositol 25g
Water 250ml
Dispense into 2 ml vials, use 1 ml per liter

BASE STORE
Chemical Amount
Glycine HCl 0.5g
Nicotinic acid 0.125g
Pyroxidine HCl 0.125g
Thiamine HCl 0.025g
Myo-Inositol 25g
Water 250ml
Dispense into 2 ml vials, use 1 ml per liter

Stock Solution Liquid medium 1 lt Solid medium 1 lt

TO 5ml 5ml
b 5ml 5ml
c 0.5 0.5
d 1ml 1ml
Vitamins 1ml 1ml
Sucrose 30g 30g
Agar
Adjust the pH to 5.7. Sterilize by autoclave

** Sugar, vitamins, regulators and other components must be previously added

according to the medium to be prepared.

Propagation medium

Murashige & Skoog base medium A+B+C+D

MSA-base 1ml
Sugar (2.5%) 25g
Agar 7g

1
3
1
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

Water 1000ml
pH 5.5

IN VITRO CULTURE PROCEDURES

In vitro introduction process

PROCEDURES
Greenhouse

(Mother plant selection)

Preparation of culture media

Cutting stems (internodes)
Washing surfaces with running water and detergent

70% alcohol x 1 minute

Sodium hypochlorite 0.5% of 2.5% x 30 minutes stirring

(2.6ml/500ml water)
3 washes with sterile water
Sodium hypochlorite 0.5% 2.5% x 30 minutes
and 2-3 drops of tween in stirring
(1.3ml/500ml water)
Dissection (Size of 1cm 2 )
Sowing in the growing media
Procedure for sowing in culture media: in the transfer room
1. Wash your hands with soap up to your elbows. Put on the mouth apron and mask
2. Disinfect the surface of the laminar flow chamber with 70% alcohol.
3. Sterilize the forceps and scalpel blades. Let cool.
4. Place a petri dish (or sterile paper), metal plates, etc. in the center of the chamber.
5. Place the explants that have been washed and disinfected on the paper.
6. Extract the plants with tweezers one by one.
7. Separate the internodes with a distance of approximately one cm (follow your
teacher's steps)
8. Place the explant with tweezers and plant it in a tube that has the medium.
9. Flame edges of the tube and close with the lid or aluminum foil, and seal it with
plastigraf tape.
10. Label taking into account the date and the code of the assigned plant.
11. Place it in the growing room.
Periodic evaluation to determine if there is contamination.

1
3
2
 Dr. María Valderrama V [Write text] Dr. Juan Ponce V

4 .- ADDITIONAL ACTIVITIES

e) Perform the calculations to replace chemically pure quality (chemical)

elements with commercial ones. For example, if you want to prepare MS
culture medium, or B5.
f) Schematic, a conventional micropropagation system; a clonal propagation
system from cells.
g) What do you think are due to the differences in the requirements of different
growing media? These differences are very important in the application of
plant tissue culture.
h) What differences exist at the genetic level between C3 and C4 plants? What
implications would they have in in vitro cultivation?

5 .- BIBLIOGRAPHY

1. George, E. And Sherrington, P. 1984. Plant Propagation by tissue culture.

Handbook and Directory of Commercial Laboratories. Exegetics Limited. Stern
Press, Great Britain.
2. Iquira, E. 1997. In vitro culture of plant tissues. Theoretical-Practical Manual.
UNSA, Arequipa.
3. Evans, D.; Sharp, W. and Ammirato, P. 1986. Handbook of Plant Cell Culture.
Volume 4. Techniques and Applications. Macmillan Publishing Company, New
York.
4. George, E. And Sherrington, P. 1984. Plant Propagation by tissue culture.
Handbook and Directory of Commercial Laboratories. Exegetics Limited. Stern
Press, Great Britain. Interamerican, Mexico
5. Iquira, E. 1997. In vitro culture of plant tissues. Theoretical-Practical Manual.
UNSA, Arequipa.
6. Jenkins, J. b. 1982. Genetics. Revert. Barcelona, Spain
7. Jimenez C. 1999. 360 Genetics Problems. Synthesis editorial. Spain
8. Lasley, J. 1970. Genetics of Livestock Improvement. Edit UTEHA. Mexico. 378
pp. Mendoza, C. 1986.
9. Lewis, B. 1977. Genes. Oxford University Press and Cell press. New York.
USA
10. Perera J, Tormo A and Garcia J. 2002. Genetic engineering. Vol II. DNA
preparation, analysis, manipulation and cloning. Synthesis Editorial. Spain.
11. Stansfield W. 1992. Theory and problems of Genetics. Schawn Compendium
Series. Third edition. McGraw Hill. Inc Colombia.
12. Stern C. 1973. Human genetics. Third edition. Alambra, Spain.
13. Strickberger W. 1988. Genetics. Editorial Omega SA Barcelona, Spain.
14. E 1998 visors. Issues and solved problems of genetics. Ed. University of
Granada. Spain.
15. Watson J. 1982. biology molecular of the Gene. Educational
background
Inter-American, Mexico.

16. Winchester, A. 1968. Genetics. Laboratory Manual. WM. c. Brown Company

Publishers, USA Inter-American, Mexico.

1
3
3