Lab 1

Running Python
There are several ways to run Python code: 1. from the interpreter:
>>> dna ='atgc' >>> dna atgc

2. from a file: If a file mydna.py contains:

#! /local/bin/python dna ='atgc' print dna

it can be executed from the command line:

localhost~$ python mydna.py atgc

or using the #! notation:

localhost~$./mydna.py atgc

It is also possible to execute files during an interactive interpreter session:

caroline:~> python Python 2.5.2 (#1, May 27 2008, 13:20:02) [GCC 4.2.3 (Debian prerelease)] on linux2 Type "help", "copyright", "credits" or "license" for more information. >>> execfile("mydna") atgc

or to load a file from the command line before entering Python in interactive mode (-i):
localhost~$ python -i mydna.py atgc >>>

this is very convenient when your Python file contains definitions (functions, classes,...) that you want to test interactively. 3. from other programs embedding the Python interpreter:
#include <Python.h> int main(int argc, char** argv) { Py_Initialize(); PyRun_SimpleString("dna = atgagag + tagagga"); PyRun_SimpleString("print Dna is:, dna"); return 0;
}

Exercise 1.1 Write a program to ask the user for a sequence then print its length. Example output:
Enter a sequence: ATTAC

It is 5 bases long. Exercise 1.2 Modify the program so it also prints the number of A, T, C, and G characters in the sequence Example output: Enter a sequence: ATTAC It is 5 bases long adenine: 2 thymine: 2 cytosine: 1 guanine: 0 Exercise 1.3 Modify the program to allow both lower-case and upper-case characters in the sequence Example output: Enter a sequence: ATTgtc It is 6 bases long adenine: 1 thymine: 3 cytosine: 1 guanine: 1

Exercise 1.4: Modify the program to print the number of unknown characters in the sequence Example output: Enter a sequence: ATTU*gtc It is 7 bases long adenine: 1 thymine: 3 cytosine: 1 guanine: 1 unknown: 2

Exercise 1.5: GC content Calculate the GC percent of dna. (Insert an arbitrary DNA sequence at the interpreter, for example : >>> dna=gcatgacgttattacgactctgtcacgccgcggtgcgactgaggcgtggcgtcg

Exercise 1.6: DNA complement Find the DNA complement. Use the replace or maketrans and translate function to accomplish the task. For the information of some of the function, you can type >>> help(replace) For accessing the method, you need to import the string module >>> from string import *
Help on function replace in module string:replace(s, old, new, maxsplit=-1) replace (str, old, new[, maxsplit]) -> string Return a copy of string str with all occurrences of substring old replaced by new. If the optional argument maxsplit is given, only the first maxsplit occurrences are replaced.