Microsatellite Workshop Spring 2000

The following document was developed for a workshop held at the National Zoological Park. The protocol was based upon one developed in our lab; please see Hamilton et al., 1999. Biotechniques 27: 500-507. We use NEB (New England BioLabs, Beverly, MA, USA) for all enzymes, enzyme buffers, and the photodetection kit. The only exception is rATP which we order from Sigma (St. Louis, MO, USA) . Instead of EtBr staining, we use 1x Gel Star stain (FMC BioProducts, Rockland, ME, USA). Our oligos come from Operon (Operon technologies, Almeda, CA, USA). Our magnetic beads are Dynabeads (Dynal, Lake Success, NY, USA). Our plasmids (pBluescript II SK(+))and bacteria come from Stratagene (La Jolla, CA, USA). The cells are Stratagene Epicurian-coli XL1-Blue supercompetent cells. INTRODUCTION Welcome to the Microsatellite Development Workshop at the National Zoological Parks Molecular Genetics Laboratory. As you know this workshop is being sponsored by the University of MarylandSmithsonian Institution Research Training Grant in the Biology of Small Populations from the National Science Foundation. The purpose of this workshop is to train students to locate and clone microsatellite loci via construction and screening of microsatellite-enriched genomic libraries. The protocol we will be following comes from Hamilton et. al (1999) which is included in this notebook. Most of you probably already know what a microsatellite is and what they are used for, but heres a brief summary. A microsatellite is a stretch of DNA with mono-, di-, tri- or tetranucleotide units repeated Examples: AAAAAAAAAAAAAAAAA. GTGTGTGTGTGTGTGTGT.. CATCATCATCATCATCAT.. ACGGACGGACGGACGGA. These specific microsatellites would be referred to as (A)23, (GT)16, (CAT)12, (ACGG)21 and micros in general can also be referred to as simple sequence repeats (SSRs), short-tandem repeats (STRs) or variable number tandem repeats (VNTRs). The actual number of repeats can vary a great deal

-1-

among individuals, but the sequence flanking the microsatellite tends to be conserved. Thus, once a microsatellite is located, and its flanking sequence determined, primers can be designed to amplify the specific locus in multiple individuals. The varying number of repeats can be determined by comparing the size of the amplified fragment. Microsatellites are very useful markers for many reasons including: being hyper-variable due to high mutation rate (10-3), having a more or less random distribution throughout the genome, and being PCR based and thus requiring small amounts of genetic material. Micros are currently being used in many different fields including: behavior studies using relatedness, conservation genetics, population structure analyses, medical studies, and forensics. The hardest part of working with microsatellites is finding them. Our goal is to take you most of the way to developing microsatellite loci. We will at least take you past the stages that require special equipment and supplies. Basically, you will be starting with tissue samples and ending up with hundreds of bacterial colonies that contain fragments of DNA (from your tissue sample) with microsatellites in them. You will need to sequence these fragments and design primers for the microsatellites on your own. To get you started, we have provided information at the end of the workshop protocol for how to proceed after leaving this workshop. This is our first time providing a workshop of this type, so we make no guarantees of what level of success you will have. Please feel free to comment on any ways that we can improve the workshop or the provided documents.

MICROSATELLITE WORKSHOP: OVERVIEW OF CONSTRUCTING A LIBRARY

Step 1: Digesting DNA The first step in constructing a microsatellite library is to use restriction enzymes to cut up genomic DNA into fragments ranging in size from 200 to 1000 base pairs (bp). This size range is highly manageable for sequencing and for inserting into plasmids (which well get to later). Step 2. Ligating Linkers to DNA After cutting up your DNA, the next step is adding a linker to both ends of your DNA fragments. A linker is just a piece of double stranded DNA
-2-

(usually about 20bp) that are designed for tagging your fragments. Since the sequence of your fragments is unknown, by adding a known sequence, you can use PCR to amplify your fragment. Although the addition of linkers is a common step in micro development, the protocol well be using involves linkers designed by members of the Smithsonian Institutess Molecular Genetics Laboratory (Hamilton et al. 1999) which have greatly improved the efficiency of the whole protocol. Below is a description of these linkers which we will refer to as the SNX linkers. SNX forward 5 -CTAAGGCCTTGCTAGCAGAAGC-3 | | | | | | | | | | | | | | | | | | | | | | SNX reverse 3- AAAAGATTCCGGAACGATCGTCTTCGp-5 The poly-A tail polarizes the linker so that only one end can be used as a blunt end for ligation. Step 3. Enriching for microsatellite repeats Once you have linkers attached to your DNA fragments, you want to find those fragments that contain micros. To do this we make our DNA single stranded and add oligos (30 bp repetitive sequence of DNA, for example: CACACACACACACACA.). This oligo will anneal to fragments that have the complementary sequence. Typically, you can enrich for many different repeats. In this workshop we will just be using one (GT). The oligos are 3 labeled with biotin. After exposing your DNA to the biotinylated oligos we capture those fragments that have hybridized to the oligo (i.e. those that have micros) with magnetic beads. The beads are coated in streptavidin which strongly binds with the biotin protein on your oligo. All DNA fragments not attached to a biotinylated oligo are washed away when a magnet is used to attract the beads which are attached to the biotin which is attached to your DNA. After this enrichment step, hopefully all of your remaining DNA contains a microsatellite.

Step 4. Ligation into plasmid

-3-

Now that we have a subset of DNA with micros, we need to insert into a plasmid for later transformation into bacteria. To do this, we use a restriction enzyme to cut the plasmid and ligate our linker-ligated enriched DNA into the circular plasmid. The plasmid we use confers ampicillin resistance to bacteria. Step 5. Transformation into competent E. coli cells. This step involves incorporation of the plasmids into bacterial cells. The cells are plated out on agar treated with ampicillin. Thus, only those bacteria which have been successfully transformed should be able to grow. Step 6. Colony Lifts and Microsatellite detection After growing the bacteria overnight, we use nylon filters to lift the bacterial colonies off the plates and onto the filters. These filters are then treated extensively to bind the plasmid DNA and wash away bacterial debris. Then, we hybridize the filters to biotinylated oligos again. The plasmids that have micros should then be stuck to the biotin again. Streptaividin is then used in a chemiluminescent reaction that allows us to find these positive colonies. The use of chemiluminescence removes the need for radiation detection. Yippee! Step 7. PCR amplification and sequencing of plasmid inserts After detecting which plasmids have micros, we go back and pick the corresponding bacteria off the plates and amplify the plasmid insert. This insert is then sequenced and microsatellite primers can be designed, if the sequence is appropriate.

-4-

LABORATORY EXPLANATIONS DAY 1 Digestion of DNA The restriction enzymes should cut the DNA into a size range from 200 to 1000 base pairs. Nhe I is included in this digestion because it is used later, during ligation of microsatellites into plasmid DNA. If it is not included in this digestion, genomic DNA will be cut rather than ligated during that step. You may not need to use more than 1 restriction enzyme. We recommend starting with just Nhe I and then adding more if the digestion is not sufficient. We frequently use Hae III is because it is a 4 base-cutter (GG-CC) that should cut in most genomes. Like NheI, XmnI is also used during a ligation step. We have not included it in this ligation because it is unlikely to cut most genomic DNA (GAANN-NNTTC). However, it has been shown to cut frequently in mosquito DNA. As a preventative measure, XmnI can also be included in this digestion.

LABORATORY EXPLANATIONS DAY 2 Running an agarose gel You should see a smear of DNA in your gel lane, ranging from 2001000 base pairs. These are the sizes of DNA that are potentially large enough to contain a microsatellite and flanking region, but small enough to insert into a plasmid.

Understanding ligation of genomic DNA to SNX linkers The genomic DNA that you have cut with restriction enzymes must be ligated to linkers, pieces of DNA with known sequence. The linker can then be used as a primer to amplify your genomic DNA. There are two kinds of

-5-

ligation: blunt end and sticky end. Sticky end ligation requires an exact match of DNA overhang. Sticky Ends NNNNGATC NNNNC TNNNN TAGANNNN

Sticky Ends Ligated NNNNGATCTNNN NNNNCTAGANNN This method of ligation is specific, and by using only one restriction enzyme and a linker designed to complement that overhang, ligation can be very efficient. The problem with this method, however, is that by cutting with only one restriction enzyme, genomic DNA will not be cut small enough, 200-1000 bp. Common practice is to run this genomic DNA onto a gel and cut out the DNA from the desired size range. However, this range is NOT a random sample of the genome and will not provide random genomic markers (Hamilton and Fleischer 1999). If DNA is digested with multiple restriction enzymes, as we have done, most of the genome is represented in the 200-1000 base pair range. However, each restriction enzyme leaves a different overhang, making a sticky-end ligation impossible. These sticky ends can be chewed off with Mung Bean Exonuclease. Nhe I cut site NNNNNGCTAGCNNNNN NNNNNCGATCGNNNNN DNA fragments cut with NheI NNNNNG CTAGCNNNNN NNNNNCGATC GNNNNN DNA fragments chewed with Mung-bean exonuclease NNNNNG CNNNNN NNNNNC GNNNNN Blunt ends ligated NNNNNGCNNNNN NNNNNCGNNNNN
-6-

After chewing genomic DNA with mung bean exonuclease, all fragments are blunt-ended. We then dephosphorylate the genomic fragments. DNA has a phosphate group at the 5' end and an OH at the 3 end of each strand. Ligation of two strands involves the formation of a phosphodiester bond between the phosphate and hydroxyl groups. The linker we use has a 5 phospate on one strand. Thus, our linker can ligate to either 3 end of our DNA fragment. However, because weve dephosphorylated the 5 end of the fragment, our DNA fragments cannot ligate to themselves. Another problem with blunt-end ligation is that the linker can ligate to itself. The SNX linker is designed so that an XmnI cut site is created when linkers ligate to themselves. By including the XmnI in the ligation, linkers that self-ligate are cut apart. SNX Linkers 5' CTA AGG CCT TGC TAG CAG AAG C 5' pGCT TCT GCT AGC AAG GCC TTA GAA AA

SNX: SNX rev:

5'

Double stranded SNX Linker CTAAGGCC TTGCT AGCAGAAGC 3' AAAAGATTCCGG AACGA TCGT CTTCGp

The A tail on one end of the linker polarizes it, so that only one end can serve as a blunt end for the ligation. If two linkers ligate to themselves, they create an XmnI cut site (bold below). By including XmnI in the ligation reaction, dimers will be cut apart. SNX Linkers Ligated to form Dimer 5'
CTAAGGCCTTGCTAGCAGAAGC---GCTTCTGCTAGCAAGGCCTTAGAAAA 3' AAAAGATTCCGGAACGATCGTCTTCG---CGAAGACGATCGTTCCGGAATC

The double stranded SNX linker that you ligate to your genomic fragments has already been prepared for you. However, it is easy to make.

-7-

In a tube, mix equal amounts of 10M forward and reverse linker. Let sit for a few minutes so that the linkers hybridize. Store at 4o C.

LABORATORY EXPLANATIONS DAY 3 Amplifying linker-ligated samples The linker sequence can now be used as a primer to amplify your genomic DNA, assuming that the linker has attached to both ends of your genomic fragments. For this reaction, we use single stranded linker. Agarose gel A successful amplification indicates that ligation was successful. Since a range of fragment sizes should be amplified, the product will appear as a smear. If the PCR reaction did not work, you will not be able to visualize any DNA in the agarose gel. The amplified products should be about 40 bp larger than the non-ligated genomic DNA, although you may not be able to see that difference on the gel. Hybridization to biotinylated oligos Oligos are 30 base-pair fragments of microsatellite repeats, for instance, (GT)15. These fragments will hybridize to any complementary sites (ie: microsatellites) on your DNA. The oligos are 5 labeled with biotin so that in the next step we can capture only the DNA that has hybridized to oligos (ie: only the microsatellites) and remove the rest of the DNA. To hybridize your DNA to the oligo it is first denatured by heating to 950 for 15 min.

LABORATORY EXPLANATIONS DAY 4 Enrichment

-8-

Enrichment refers to the process of weeding out the non-microsatellite containing DNA, so that you are left with an "enriched" sample of DNA that contains a high proportion of microsatellites. Right now, you have linkerligated DNA that has been allowed to hybridize to biotinylated oligos. Any DNA fragment that does not contain the repeat for which you enriched, is not labeled with biotin. You will expose your sample to magnetic beads that have been coated in streptavidin, which strongly attracts biotin. When the sample is placed near a magnet, the magnetic beads are attracted to the magnet. Attracted to these magnetic beads is the biotinylated oligo, and hybridized to the oligo is your repeat-containing DNA. By washing the bead-biotin-DNA complex multiple times, you remove the DNA that has not hybridized to an oligo. You are then left with primarily repeat-containing DNA. To retrieve our DNA, we heat the sample to 95o and denature the DNA. This heating breaks the bond between the biotinylated oligo and your sample. Our released DNA is quickly removed before it rebinds to the oligos. Amplification of repeat-enriched DNA To increase the quantity of repeat-containing DNA, a PCR reaction is set up, again using the SNX linker as primer. A successful reaction is indicated by a smear of DNA. Digestion of amplified, enriched DNA The next step in this procedure is to ligate your enriched DNA directly into a plasmid. This ligation is a sticky-end ligation (see explanation on page 2), so your DNA must be cut to have the proper overhang. The SNX linker is designed with an NheI cut site, which complements an XbaI cut site in the vector. By digesting your DNA with NheI, both ends of each fragment will be sticky, and ready to ligate into vector. Since NheI was included in the original digest of genomic DNA, it will not further cut genomic DNA. The NheI will only cut the linkers. Linker-ligated DNA
5 CTAAGGCCTTGCTAGCAGAAGC-NNNNN(GT)12 NNNNNGCTTCTGCTAGCAAGGCCTTAGAAAA 3 AAAAGATTCCGGAACGATCGTCTTCG-NNNNN(CA) 12NNNNCGAAGACGATCGTTCCGGAATC

Linker-ligated DNA cut with NheI

5 3 CTAGCAGAAGC-NNNNN(GT)12 NNNN-GCTTCTG GTCTTCG-NNNNN(CA) 12NNNN-CGAAGACGATC

-9-

LABORATORY EXPLANATIONS DAY 5 Ligation of vector and insert Your DNA must be ligated into a plasmid so that it can be cloned. We are using a Pbluescript plasmid that has already been digested with XbaI, so that it has a complementary cut site to your DNA. Like the first ligation (which ligated your DNA to SNX-linkers) this ligation also contains a restriction enzyme. The NheI will cut apart any fragments of your DNA that ligate to one another. NheI does not cut in the Pbluescript. Although the sticky ends that both XbaI and NheI produce are complementary, the cut sites are different, so the NheI will not cut genomic DNA that has ligated to the plasmid. Although both enzymes leave a CTAG overhang, NheI recognizes GCTAGC and XbaI recognizes TCTAGA. XbaI cut site NNNTCTAGANNN NNNAGATCTNNN NNNCGATCGNNN Fragments left by XbaI cut cut NNNT CTAGANNN CTAGCNNN NNNAGATC TNNN GNNN NheI cut site NNNGCTAGCNNN

Fragments left by NheI NNNG NNNCGATC

Ligation of XbaI cut to NheI cut (note that the NheI site is destroyed) NNNTCTAGCNNN NNNAGATCGNNN

-10-

LABORATORY EXPLANATIONS DAY 6 Transformation of E. coli Today you will be inserting your plasmid DNA into E. coli cells. Once inside the bacteria a plasmid can autonomously replicate itself 100s to 1000s of times with each replication of the bacteria. The cells we use for this are supercompetent. A competent cell is one that is able to take up exogenous DNA (and thus be transformed). The supercompetent cells are expensive, but increase the efficiency of transformation substantially. There are different ways to transform. We are using the heat-shock app roach. After inducing the bacteria to take up the plasmids, we allow them to grow for about an hour and then spread them on agar plates. The agar plates contain ampicillin. The plasmid we used contains a gene which confers antibiotic resistance to the E. coli. Therefore, only those cells which have been successfully transformed will be able to grow on our plates. All of the cells that grow will have plasmids, but some will have plasmids that did not successfully ligate to our DNA fragments. We use blue/white colony selection to tell these apart. The plasmid we use has a gene called the Lacz gene which codes for - galactosidase with an addition of an amino acid at the amino terminal. E coli has a gene that codes for galactosidase with a carboxy-terminal. Both forms of the protein are inactive, however when placed together they complement one another and become active. This active protein breaks down lactose or its analog X-gal (5-bromo-4-chloro-indolyl-,D galactoside) to 5-bromo-4 chloro-indigo which is bright blue. Plamids with inserts (our genomic DNA) do not form the proper proper protein because the reading frame is disrupted. Thus, no complementation occurs between the plasmid and bacterial proteins. When our bacteria are grown in the presence of X-gal and IPTG (which induces the lacz gene) some colonies will turn blue and others remain white. The white colonies should contain plasmids with inserts.

LABORATORY EXPLANATIONS DAY8 Colony Lifts The overall goal of today is to move your bacterial colonies from the agar plates to nitrocellulose filters. After the cells are transferred to the filters the cells are lysed and the DNA is fixed to the filter through a series

-11-

of washes. The purpose of the proteinase K is to eat away remaining bacterial debris. Hybridization Once the filters are thoroughly cleaned, we need to hybridize our DNA fragments to biotinylated oligos again. The biotin will be used later for detection of microsatellites.

LABORATORY EXPLANATIONS DAY 9 Filter Washing After overnight hybridization we once again wash the filters thoroughly. Basically we just need to make sure that all pieces of DNA excluding our fragments with micros and bound oligos are gone. Any extra background makes it difficult to use the chemiluminescent detection. Positive clone detection To detect which colonies contained DNA with microsatellites we use the NEB phototope star detection kit. This kit utilizes the binding affinity of biotin and streptavidin. The basic overview is that streptavidin is bound to the biotinylated oligo. Next biotinylated alkaline phosphatase is bound the streptavidin. Next a solution called CDP-star reacts with the bound alkaline phosphatase and emits light which is captured on x-ray film. Amplification of insert DNA Once you have the x-ray film you can line it up with your original plates and determine which colonies had plasmids with micros. The insert DNA can be amplified using the primers T3 and T7 which anneal outside the insert on the plasmid DNA. Remember you destroyed the SNX linkers with NheI so they can no longer be used as primers. It is a good idea to pick a blue colony and amplify with T3 T7 as a negative control. When run out on an agarose gel, this negative will show you the size of the T3 T7 section without an insert. You want to sequence only those fragments that are at least 200 bp larger than the negative.

-12-

-13-

LABORATORY TECHNIQUES DAY 1 1) Isolation of DNA from tissue, blood, hair or feathers. All waste generated goes into biohazard bags. Use filter tips. Follow protocol in Qiagen Dneasy tissue kit TM (Qiagen, Valencia, CA, USA) kit appropriate for your tissue type. Elute in 200 L of elution buffer. 2) Overnight digestion of isolated DNA In a 0.5 mL centrifuge tube (small) add the following (use FILTER TIPS!): NEB buffer #2 (10X) 10 L DNA 83 L Nhe I 2 L nd 2 enzyme (*optional) 2 L rd 3 enzyme (optional) 2 L sterile water up to total vol of 100 l Pipet up and down to mix all the ingredients. Place in 370 incubator overnight. *See laboratory explanations for day 1.

-14-

LABORATORY TECHNIQUES DAY 2 Turn on heat blocks to 650 and 300! Make sure small blocks are in place. 1) Running an agarose gel Run out 5 l of your digest on a 2% agaraose gel. If the size range is adequate (200-1000bp) proceed to step 2. If not, add an additional enzyme and check again after digestion. 2) Heat kill the restriction enzymes. Make sure heat block is at 650. Place your DNA digest in the block and set timer for 10 minutes. 3) Chew off sticky ends with Mung Bean exonuclease. To your digest, add: 1 L mung bean exonuclease. Leave at 300 for 30 minutes. 4). Qiaquick mung-beaned sample. (QIAquickTM PCR purification columns, Qiagen, Valencia, CA,USA) Be careful with stock solutions of buffers. Use filter tips! a) Add 5 volumes (455 L) of buffer PB to your sample and pipet up and down to mix. b) Pipet this sample into a Qiaquick column (sitting in a 2 mL collection tube). Make sure your name is on the column. Centrifuge at full speed for 1 minute. c) Throw away the liquid in the collection tube and place the column back in the tube. Your DNA is in the filter of the column. d) To wash DNA, add 750 L of buffer PE to column and centrifuge 1 minute. e) Throw away the liquid and centrifuge again for 1 minute to ensure that all the liquid has come through the column.

-15-

f) Place the column in a clean 1.5 mL tube clearly labelled with your name and sample. Add 30 L of buffer EB to the CENTER of the column and centrifuge for 1 minute. g) After you have checked to make sure that there is liquid in the bottom of your tube, throw away the column. 5) Dephosphorylate your sample. DNA sample NEB buffer #2 Sterile water CIP 30 L 4 L

5 L 1 L

Mix with pipet. Incubate at 370 for 2 hours. Heat inactivate at 75o for 10 minutes. 6) Qiaquick dephosphorylated sample from above. Follow directions from above. 7) Ligation of insert to linkers. In a PCR tube (very small), mix: Double stranded linker (dsSNX) NEB Buffer #2 100X BSA DNA from above rATP (10 mM) Xmn I Ligase (high concentration) 11.7 L 3 L 0.3 L 10 L 3.0 L 1.0 L 1.0 L

Put in PCR machine cycling at 160 for 30 minutes and 370 for 10 minutes. After 10 hours of cycling, heat kill the enzyme for 20 minutes at 650 and keep reaction at 4 degrees until you are ready for it. Our PCR machine PTC 100 02 is already programmed for this ligation (MWLIG). You will use this machine for all PCR needs this week.

-16-

LABORATORY TECHNIQUES DAY 3 Warm hybridization buffer to 370 and set heat blocks to 650 and 950 1) Amplify linker-ligated samples. This recipe only produces enough amplified linker-ligated DNA to enrich for a single oligo. If you are using mulitple oligos, increase the number (from 5) to include the extra tubes. You still only need the 3 controls from below, but do more of the Tube #2s. In a small microfuge tube add the following (from x5 recipe column) Sterile water 33.7 L ------------x 5 = 168.5 L 10x Thermopol buffer 5.0 L 25 L dNTPs 5.0 L 25 L SNX linker (single strand) 4.0 L 20 L Vent exopolymerase 0.3 L 1.5 L Into 4 PCR tubes, pipet 48 l of this master mix. Add the following to your tubes: Tube #1 2 L of sterile water Tube #2 2 L of ligated DNA Tube #3 2 L of original digested DNA Tube #4 2 L of double-stranded SNX linker Label your tubes carefully!! Place tubes in PCR machine with the following profile (on our machine this is profile MWAMP) Step 1: 960 5 min 40 cycles of: Step 2: 960 46 sec Step 3: 620 1.0 min Step 4: 720 1.0 min

2) Run 2% gel of PCR products and include digested genomic DNA as a control (3l)
-17-

3) Hybidization to biotinylated oligos For each enrichment, mix the following in a small microfuge tube: Linker-ligated amplified genomic DNA 40 L Biotinylated repeat oligo (1M) 2 L Hybridization solution 58 L Wrap tops of tubes with parafilm to prevent evaporation Heat to 950 for 15 min. to denature genomic DNA and then place at 650 overnight

LABORATORY TECHNIQUES DAY 4 Set a heat block (with large block in place) on a shaker to 430 Set two more heat blocks (not shaking) to 600 and 950 1) Prepare magnetic beads For each enrichment: Pipet 20 L of beads into a large microcentrifuge tube Add 100 L of binding and washing buffer and mix by vortexing Place tube into magnet and wait one minute before pipeting off the B&W buffer (be carfeful not to remove any beads) Rinse beads with B&W buffer 3 more times as above. After removing B&W buffer for the 4th and final time add 150L of hybridization buffer.

2) Hybridization to magnetic beads Add the 100 L of hybridized DNA from yesterday to the beads and hyb. buffer. Agitate 3 hours at 430 in the shaking heat block Vortex the tubes every 30 min.

-18-

After removing samples from heat block place 1mL of 1x SSC 0.1% SDS at 450, 1 mL at 600, and 1 tube of T.E at 950 (these solutions have been pre-aliquoted for you) 4) Wash beads a) Place tubes in magnet and wait for 1 min for beads to stick to side of tube, pipet off hybridization solution. b) Add 200 L of 2x SSC 0.1% SDS to each tube, leave at room temp (RT) for 5 min. and then place in magnet, wait and remove wash solution c) Repeat step b. d) Add 200 L of 450 1x SSC 0.1% SDS to each tube, leave at 450 for 5 min. and then place in magnet, wait and remove wash solution e) Repeat step d. f) Add 200 L of 600 1x SSC 0.1% SDS to each tube, leave at 600 for 5 min. and then place in magnet, wait and remove wash solution g) Repeat step f. h) Elute genomic DNA bound to oligo by adding 60 L of T.E (preheated to 950) and heat samples to 950 for 10 minutes. Working quickly, place sample in magnet and pipet T.E to a new tube (THIS IS YOUR DNA DO NOT THROW IT OUT!!!) i) Add 60 L of T.E to your dry beads and store tubes at 200 C as a back up. 5) Amplify repeat-enriched DNA Label enough PCR tubes to have one for every enrichment plus a negative control. To each tube add the following:

-19-

Sterile water 10x Thermopol buffer dNTPs SNX forward linker Vent exopolymerase

25.7 L 5.0 L 5.0 L 4.0 l 0.3 L

To tube #1 add 10 l of sterile water and to the remaining tubes add 10L of post-hyb eluted DNA

Run the following PCR profile (called MWAMP2): 960 for 5 minutes followed by 40 cycles of : 960 for 45 sec 620 for 1 min 720 for 2 min

6) Run a 5 L aliquot of PCR reactions on a 2% gel 7) Digestion of enriched DNA to leave sticky ends for cloning Directly to your PCR products, add: NheI 100X BSA 1 L 0.46 L

Incubate at 370 overnight.

LABORATORY TECHNIQUES DAY 5 1) Qiaquick digested DNA. See protocol from above. 2) Digestion and Dephosphorylation of vector DNA.

-20-

We have already completed this step for you, but here are the instructions incase you try it again. We use Pbluescript SK+. Digest 3 g of Pbluescript DNA with Xba 1. Leave for several hours at 37 .
o

Remove 5 phosphates from the vector by adding 1 L of CIP. Incubate for several hours at 37o. Heat inactivate at 75o for 10 minutes. Qiaquick the DNA and elute in 30 L. The resulting vector should be at a concentration of about 100 ng/L. Run a gel to verify digestion. 3) Ligation of vector and insert. Construct a ligation reaction using the Xba 1 cloning site. Set up a PCR tube for each enrichment and in each tube combine: L Digested DNA, qiaquicked DNA from step 1 above. NEB Buffer #2 rATP (10 mM. aka ribose ATP) 100X BSA Xba I digested Pbluescript Nhe 1 Ligase (regular concentration) 2 L 0.2 L 1 L 12.8 2 L 1 L 1 L

Incubate overnight in a PCR machine programmed for cycles of 30 minutes at 16o and 10 minutes at 37o. Heat kill for 20 minutes at 65o. Program MWLIG 4) Making LB ampicillin plates Follow the recipe in the solutions section at the end of this document We will need 3 liters for the workshop. After autoclaving and cooling we will add ampicillin.

-21-

LABORATORY TECHNIQUES DAY 6 Turn on extra-large heat block to 42 o. Put SOC in 37o incubator. 1) Transform E-coli compentent cells. This protocol is a half reaction compared to what Stratagene suggests. Some have had equal success with quarter reactions. This recipe is for a single enirchment/transformation. Adjust accordingly. a) Thaw supercompetent cells on ice. b) Place a 15 mL Falcon 2059 polypropylenetube on ice. LABELLED! c) Gently mix cells by swirling. d) Aliquot 50 L of cells into your pre-chilled tube. e) Add 0.85 L mercaptoethanol to the bacteria. f) Incubate the cells on ice for 10 minutes, swirling gently every 2 minutes. g) Add 2 L of ligation mix (from yesterday) to cells and swirl gently. h) Incubate on ice for 30 minutes. i) Heat pulse the tubes at 42o for 45 seconds exactly. j) Incubate tubes on ice for 2 minutes. k) Add 0.45 mL of pre-heated SOC medium and incubate tubes at 37o for 1 hour with shaking at 225-250 rpm. 2) Plate preparation. While cells are incubating, spread IPTG (200 mg/mL) and X-Gal (20 mg/mL) onto 5 plates using the following recipe. For each transformation make the folowing master mix: Per plate master SOC 100 L x6= 600 L IPTG 4 L 24 L X-Gal 40 L 240 L Spread 144 L of master mix on each plate with a sterile spreader. 3) Density check plates.

-22-

For each transformation mix spread out the following quantities: 10 L on one plate 15 L on one plate 20 L on one plate 30 L on one plate 50 L on one plate Number plates and label with amount of transformation added. Include your name or initials. ***Store your remaining transformations in a refrigerator for plating tomorrow. Leave at room temperature for 10 minutes to allow liquid to adhere to agar. Then turn upside-down and place in 37o incubator for 16-18 hours. LABORATORY TECHNIQUES DAY 7

1) Examine plate densities. The ideal density has many colonies, but all of them should be far enough away from each other that you could easily pick them without touching neighboring colonies. This is extremely important. You will be much happier with lots of low density plates than a few high density plates. 2) Prepare as many plates (following yesterdays protocol) as you can easily manage for each transformation. Spread out the density that you think works best. This density could be different for each transformation.

LABORATORY TECHNIQUES DAY 8 Set both hybrization ovens to 55o. Before beginning todays protocol, check your plates. If colonies have grown, put plates in refrigerator, which will enhance blue color. If colonies are not large, leave in incubator for a few more hours.

-23-

Colony lifts: This protocol modified from Sambrook et al. 1989. 1) Prepare solution trays. a) Cut 4 pieces of Whatman 3 MM paper to fit neatly onto the bottom of 4 glass trays. b) Saturate each of the pieces with one of the following solutions: 10% SDS Denaturing solution (0.5 Normal NaOH, 1.5 Molar NaCl) Neutralizing solution (1.5 M NaCl, 0.5 M TrisCl PH 7.4) 2X SSC c) Pour off extra liquid. Paper should NOT be swimming!! 2) Prepare filters. We use Osmonics Magna Lift nylon 0.45 Micron 85mm filters. These filters come packed with a piece of paper b/t each filter. You must remove these before wrapping filters in foil and autoclaving. We also add a piece of whatman paper b/t each filter. Label as many autoclaved filters as you have plates. Using a pencil, label neatly along the edge. Include your initials and plate number. Add 3 hatch marks (dark) at irregular intervals along the edge.

3) Colony Lifts. a) Gently place filter precisely onto plates. Label the plates with a marker where the hatch marks are. DO NOT FORGET THIS STEP!! b) Using forceps, carefully lift filter off of the plates. Do not drag across plates while lifting. Place, colony side up, in the SDS tray. Make sure that liquid does not float over top of filter, but seeps up from the bottom. Move from tray to tray with forceps, according the following times.

-24-

c) SDS 3 minutes d) Denaturing 5 minutes e) Neutralizing 5 minutes f) 2X SSC 5 minutes g) Place on dry 3MM paper for at least 30 minutes. h) Cross link filters for 2 automatic cycles (about 2 minutes). Leave filter on 3MM paper. ****Return plates to incubator for 2-4 hours to regrow colonies. Then place in refrigerator.

4) Proteinase-K hybridization. a) Place filters in hybridization tubes (5-6 per tube). b) Add 5 mL of Prot-K buffer and 25 L of Prot-K (10 mg/mL) to each tube. c) Incubate in rotating oven at 55o for 1 hour.

5) Prehybridization. a) dump out Prot-K solution. b) add 25 mL of hybridization solution. c) pre-hyb at 65o for 4 hours. 6) Hybridization a) dump out prehyb solution b) pour 10 mL of fresh hybridization solution into a 15 mL tube. c) add 2 L of biotinylated oligo (1 M) to solution. Use the oligo that you used for enrichment. Pour into hybridization tube. d) incubate overnight at 65o.

-25-

LABORATORY TECHNIQUES DAY 9 1) Filter Washing Some of the following washes must take place at high temperatures. The easiest way to do this is to leave the filters in hyb tubes, but large tupperwares on shakers also work. Test the temp. with a thermometer and cover to retain heat. Wash filters for 15 min. in each of the following solutions: a. 2X SSC, 0.1%SDS at room temp b. 2X SSC, 0.1%SDS at 450 c. 1X SSC, 0.1%SDS at 650 d. 1X SSC, 0.1%SDS at 650 2) Positive clone detection. The following protocol is from the NEB Phototope Star Detection Kit. a) Blocking step To a tupperware container, add 0.1 mL of blocking solution per cm2 of filter membrane. Incubate at 5 min at room temperature with moderate shaking. b) Streptavidin incubation Determine the necessary volume of diluted solution based on using 0.05 mL of diluted streptavidin per cm2 of filter. Dilute the stock solution with blocking solution to a final concentration of 1ug streptavidin per mL. (1:1000 dilution) Incubate for 5 min at room temp with moderate shaking. c) Wash Solution 1 Use 0.25 mL of wash solution 1 per cm2 of membrane. Wash for 5min at room temperature with moderate shaking. Repeat 3 MORE times. d) Biotinylated Alkaline Phosphatase (BAP) Incubation
-26-

Determine the necessary volume of diluted phosphatase using 0.05mL of diluted phosphatase per cm2 of membrane. Prepare this by diluting the stock solution 1:1000 with blocking solution for a final concentration of 0.5 g per mL. Incubate for 5 min at room temp with moderate shaking. e) Blocking Solution Wash Use 0.5 mL of blocking solution per cm2 of membrane. Wash 1x for 5 min at room temperature with moderate shaking. f) Turn on the developer

g) Wash Solution 2. Use 0.25 mL of 1X wash solution 2 per cm2 of membrane. Wash for 5min at room temperature with moderate shaking. Repeat 3 MORE times. h) Detecting the DNA i. dilute the 25x CDP-star assay buffer with sterile water to a 1x concentration. ii. Determine the amount of diluted CDP-star needed. Use 0.025 mL of diluted CDP-star per cm2 of membrane. The diluted reagent is prepared by diluting the 25mM CDP-star stock with 1x CDP-star assay buffer diluent from the previous step. iii. Add the diluted CDP-star reagent from above to the tupperware with your filters. Incubate at room temperature for 5 min with moderate shaking.

-27-

3) Exposure to X-ray film (we use Kodak BioMax film) a) Tear off a piece of Saran Wrap that is twice as large as an x-ray cassette. In the x-ray cassette, tape down half of the Saran wrap, leaving half free to later fold over the taped down half. Place your filters on the Saran wrap in an irregular pattern, clone side up. Then fold the other half of the Saran wrap over your filters, smoothing away bubbles. Fold the edges over so that excess Star reagent does not drip out, and tape shut. Make sure that the entire ensemble can not move around within the cassette. b) Move to the darkroom. Make sure you carry a timer with you set for 1 minute. Turn out the lights and make sure there is no light leaking in from the doorway. Working quickly, place one piece of film carefully in the cassette, close the cassette and turn on the timer. ONCE THE FILM HAS BEEN PLACED IN THE CASSETTE, IT CAN NOT BE MOVED, EVEN 1 CM! After 1 minute, open the casssette and carefully remove the film without dragging it along the filters. Place in the developer. You can turn the lights back on after the developer has beeped. Depending on how this film looks, you may want to increase exposure to 2 minutes or decrease to 45 seconds. c) Before removing the filters and Saran wrap from the cassette, write the filter label on the film with a marker and align the 3 marks on your plate with the corresponding marks on the film. These marks can be removed with ethanol.

-28-

LABORATORY TECHNIQUES DAY 10 Remove plates from refrigerator and leave upside down. Turn on small heat block to 100o. 1) Into small centrifuge tubes, aliquot 200 L T.E. 2) Identifying positive colonies: Place the film on a light box and line up the marks on the film with the marks on your plate. You should be able to identify the individual colonies on the plate and their corresponding dots on the film. With a yellow tip, lightly touch a dark colony. Place the tip in the T.E. and shake around to dislodge bacteria. Discard tip in biohazard container. Be sure to pick one blue colony. 3) Colony boils to release plasmids. After you have picked colonies (including 1 blue), put tubes at 100o for 10 minutes. Make sure you save these boils (at 200 C) for later use as positve controls. 4) Amplification of insert DNA. Run a PCR reaction for subsets of your picked colonies. The recipe for a single reaction is given here: x1 Colony boil 2 L Thermopol buffer 5 L DNTP 5 L T3 primer 4 L T7 primer 4 L Water 27.7 L Vent 0.3 L Run the program called MWT3T7 960 for 5 minutes followed by 30 cycles of : 960 for 45 sec 510 for 1 min

-29-

720 for 2 min 5) Run a 2% agarose gel to check for amplification and successful insertion of microsatellite in plasmid. The blue colony should be smaller than the white colonies. 6) Amplification of these inserts is the extent of this workshop. You will want to pick more colonies (at least 200) and check for insertion of microsatellites. You will then need to sequence these inserts to check for microsatellites and to design primers. We recommend only sequencing inserts > 400 bp. We have included protocols for these steps, and will be happy to help with troubleshooting.

-30-

POST-WORKSHOP TECHNIQUES Sequencing of positive clones and primer design. 1. Clean up PCR reactions of amplified clones. Using a Qiaquick kit, clean reactions. Elute in 30 L of buffer EB. 2. Sequence in one direction. Use T3 or T7 as a primer. You can do this step yourself, or send the sample to a sequencing facility. 3. Examine and edit sequence. If there is a microsatellite in your sequence (we suggest at least 10 repeats), you will want to remove the plasmid sequence to determine how much flanking DNA is available for primer design. Search for the sequence from the SNX linker CTAGCAGAAGC. Remove everything before and including this sequence. Sequencing is not always perfect. If you can not find this sequence, look for a segment of DNA that likely matches this. You can also search for portions of the plasmid DNA sequence, which we have provided in this packet. 4. Sequence in other direction. If you have at least 50 base pairs of DNA flanking your microsatellite after editing out SNX linker and plasmid sequence your microsatellite in the other direction. Use T3 or T7 as a primer, whichever you didnt use before. Follow directions above for editing. Again, you will want at least 50 base pairs of flank on each side. 5. Primer Design. Align the edited sequences. We suggest using the Sequencher program. Re-edit to correct any ambiguous base pairs. Here are some general rules we go by in our lab for primer design. Try to place the primer at least 20 base pairs away from either end of the microsatellite because this region may not be well conserved. Primers should be about 20 base pairs in length. We recommend that the entire fragment be greater than 100 bp and less than 400 bp. Attempt to design primers with a GC clamp (at least 2 or 3 Gs or Cs at the 3 end). Try not to design a primer with repetitive sequence or self annealing potential. You also do not want the primers to anneal to each other.

-31-

 The 2 primers should have similar Tms (melting temperatures). We have had luck with primers that differed by up to 6o. You can try a wider spread, but the closer the better.

Self annealing and primer annealing can be tested in the primer design program Amplify (free download: www.wisc.edu/genetics/CATG/amplify/#download If you insert your target sequence and potential primer sequences, this program will also give you Tm for each primer and give you the strength of the primers in the PCR reaction. The website www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi will design primers for you if you insert your target sequence. You can then input these primers into Amplify to test for self annealing and strength of PCR. Optimizing PCR and running Microsatellite Gels 1. Optimization with your positive clone. Once you have ordered primers, the first thing you need to do is make sure the primers work on your clones, since this is the sequence it was designed from. Dilute some of the colony boils 1:10,000 with T.E and run a PCR reaction. We recommend trying 5o less than the Tm, 1 L of the diluted boil, 1.5 mM Mg. When this product is run on an agarose gel, you should see a strong band at the appropriate size. 2. Optimization of DNA samples on agarose gels. After you have successfully amplified your clone, you can start optimizing these primers for use with other DNA samples. Dont be surprised if you have to alter conditions many times in order to get amplification. If you do not get amplification, here are some things to try: Increase Mg concentration (usually by 0.5 or 1 mM) Decrease annealing temperature (however, sometimes raising the temperature also works). Adding BSA (usually 1 L of a 10mg/mL stock in a 25 L reaction) Increase the number of cycles (however, the lowest number possible is best for analysis. Usually between 25 and 30.)

-32-

3. Making your PCR reaction flourescently labelled Once you know your primers are working you need to complete optimization on acrylamide by making your DNA fluorescent. There are two ways to do this: fluorescent primers, or fluorescent dNTPs. Whichever method you choose to use, there are 3 colors that are generally used: blue, green and yellow. The chemical names of the colors vary depending on the machine and type of chemistry you are using. You can run all three colors (ie: three loci) in one lane of a gel. Make sure the loci are not the same size. The ideal approach is to optimize your primers using fluorescent dNTPs in order to verify that it is a variable locus, and then to order a fluorescent primer. Only one of the primers in the pair should be fluorescent, the other one is regular. Flourescent primers are expensive, but yield much cleaner results on the acrylamide gels. If you are using fluorescent dNTPs, you need to clean the PCR product before running an acrylamide gel (we use Sephadex. See instructions at end of section). With fluorescent dNTPs, you must set up separate PCR reactions for each color in the gel. You can, however, clean three samples together (for example, the blue, green and yellow for lane one can be sephadexed into one tube). If you are using a fluorescent primer, you do not have to clean the product, but it will probably need to be diluted. Also, with fluorescent primers you can multiplex, or amplify multiple loci in one PCR reaction. Multiplexing is a huge time saver if your loci have identical PCR profiles. Always include your clone as a positive control in all of your microsatellite gels. If it amplifies, you know that the PCR reaction worked, and if its size varies by a base pair between gels, you can use it to calibrate gels.

4. Optimizing for Scoring Gels. This is the hardest part! Dont get too discouraged The appearance of bands in an agarose gel is not necessarily representative of how the locus will look on an acrylamide gel. Unfortunately a beautiful band on agarose may not correspond to a scorable locus. In the ideal world, every allele would yield one peak. Thus, a homozygote would have one peak and a heterozygote would have two. Weve seen this type of locus, but only for human forensics studies. More often you get serious problems with stutter. Stutter refers to multiple peaks
-33-

per allele. Basically, for the same reason microsatellites have a high mutation rate, you also see different size fragments come out a PCR reaction due to problems with slippage. So for a fragment that is 150 you may easily get a peak at 148, 150, and 152. Worse yet a heterozygote for 150 and 154 could give you peaks at 148, 150, 152, 154 and 156. The 152 peak may look strongest because it is showing up from both fragments, but yet is a PCR artifact. So, expect stutter, but with practice you can get rid of all or enough to read through the stutter. Another common problem is the addition of an A by Taq polymerase. Taq tends to add an A to the end of PCR fragments which would give you a peak one base pair larger than the actual allele. One way to tell stutter from extra-A is that stutter bands should differ by the size of the repeat (ie. Multiples of 2 for dinucleotides, multiples of 3 for trinucleotides, etc) whereas an extra-A just adds one bp. Some things to try for getting rid of stutter and extra-As. Increase stringency of your PCR by decreasing Mg, or increasing temperature Decrease the number of PCR cycles. After slippage, the mutant stand will keep increasing in concentration with every cycle. Add a 30 minute extension at 72o after your final cycle. This extra time allows all fragments of DNA to complete extension. Use a flourescent primer instead of flourescent dNTPs. This reduces the visible stutter to just one of the two strands. For some loci, you may never get rid of all the stutter, but you may be able to clearly see patterns and define peaks. For example, a homozygote may always show 3 peaks. As long as you are consistent in your scoring (eg. always scoring the rightmost peak) this amount of stutter should not be a problem. Normally, the smallest peak is the tallest (because it is amplified more times than larger ones). So, if you have one tall peak, and a shorter peak that is smaller than it, the shorter peak is probably an artifact. That said, there can sometimes be very large artifacts that amplify strongly, so common sense and knowing what size range youre looking at is important. Weve included some pictures of various types of allele patterns and stutter problems.

Cleaning PCR reactions with Sephadex

-34-

The easiest and most cost efficient way to clean the DNA successfully is by using Sephadex columns. In our lab we re-use the columns. The Sephadex mix is 2g of Sephadex and 32 ml of water, after it is autoclaved it should be kept at 40. The general procedure is: place the column in the collection tube add 750 l of Sephadex for 1 PCR rxn, 800 L for 2 rxns, or 850 L for 3 rxns. Suck out excess water from bottom with a small rubber bulb (for pastuer pipets). Spin at 3000 rpm for 2 min Move the column to a 1.5 mL eppendorf tube and add appropriate reaction(s). Spin at 3000 rpm for 2 min. Drying down and preparing cleaned PCR reactions After Sephadexing your reactions they need to be dried down. We usually dry down 6L per PCR reaction. However, you can adjust this depending upon the strength of the signal you see on the acrylamide gel. We dry down the samples in a Speed-Vac for 10-20 min. Before loading the samples they are reconstituted with a formamide loading dye which must contain the size standard for your machines chemistry. With our chemistry we use 2 L of a master mix which contains 40L of the Rox size standard with 360 L of dye. After adding the dye (with ladder) the samples are denatured for 2 min at 900, placed in an ice block and immediately loaded. Because most of you will be using different automated sequencers we are not going to give detailed protocols for running gels. However, heres some general advise: Load your odd samples first, let them run for 2-5 min while you are denaturing the evens. This makes it easier to track your lanes after the run. It is a good idea to have two bands of the size standard smaller and larger than your fragment length. Therefore, make sure you run the gel long

-35-

enough, but you dont have to run it until all of the size standard comes through. Different labs store their formamide dyes differently. Typically it is aliquoted into small tubes. Once opening a new tube we recommend only using it for one week. Weve had problems with incomplete denaturation with older dyes. Some companies will tell you to make fresh gel stock the day of the run. This is not necessary. Gel stock can definitely last 2 weeks. However, as soon as your running buffer (10x TBE) has any precipitate, throw it out!

Microsatellite Data Analysis Computer Programs Microsatellite gel and DNA sequence analysis: Genescan and Genotyper (ABI) Sequencher (aligning insert sequences): Behavior/relatedness calculation programs: Kinship: Relatedness: Cervus: http://helios.bto.ed.ac.uk/evolgen/cervus/cervus.html Arlequin

Population genetic analysis programs: Biosys: Swofford Genepop: http://wbiomed.curtin.edu.au/genepop/ AMOVA: http://anthropologie.unige.ch/ftp/comp/win/amova/README
-36-

LAMARC: Likelihood analysis with metropolis algorithm using random coalescence (coalesce, fluctuate, migrate, recombine): http://evolution.genetics.washington.edu/lamarc.html RSTCALC: http://helios.bto.ed.ac.uk/evolgen/rst/rst.html Microsats.mac: Population genetic simulation programs: Easypop: http://www.unil.ch/izea/softwares/easypop.html

List of linkage analysis software: http://linkage.rockefeller.edu/soft/list.html

-37-

REFERENCES THAT MAY BE USEFUL There are a tremendous number of references out there dealing with the evolution and application of microsatellites. Weve included copies of some papers that we think are either really good case studies or really helpful. In addition weve included the table of contents of a new book that is all inclusive. It pretty much covers every angle you may be interested in and has extensive references. We have also listed some references below of papers we have discussed in our lab. This is not meant to be anything near a complete list, but more of a place to start. Bruford, M.W. and R. K. Wayne. 1993. Microsatellites and their application to population genetic studies. Current Opinion in Genetics and Development 3:?? Coltman, D. W., W. Don Bowen, and J. M. Wright. 1998. Birth weight and neonatal survival of harbour seal pups are positively correlated with genetic variation measured by microsatellites. Proc. R. Soc. Lond. B 265:803809. Goldstein, D.B., A. R. Linares, L.L. Cavalli-Sforza, and M. W. Feldman. 1995. An Evaluation of Genetic Distances for Use with Microsatellite Loci. Genetics 139:463-471. Hedrick, P. W. 1999. Perspective: Highly variable loci and their interpretation in evolution and conservation. Evolution 53:313-318. Orti, G., D. E. Pearse, and J. C. Avise. 1997. Phylogenetic assessment of length variation at a microsatellite locus. Proc. Natl. Acad. Sci. USA 94:10745-10749. Paetkau, D. and C. Strobeck. 1994. Microsatellite analysis of genetic variation in black bear populations. Molecular Ecology 3:489-495.

-38-

Schwartz, M.K., D. A. Tallmon, and G. Luikart. 1998. Review of DNAbased census and effective population size estimators. Animal Conservation 1:293299. Slatkin, M. 1995. A Measure of Population Subdivision Based on Microsatellite Allele Frequencies. Genetics 139:457-462. Wattier, R., C. R. Engel, P. Saumitou-Laprade, and M. Valero. 1998. Short allele dominance as a source of heterozygote deficiency at microsatellite loci: experimental evidence at the dinucleotide locus Gv1CT in Gracilaria gracilis (Rhodophyta). Molecular Ecology 7:1569-1573.

SOLUTIONS 10X TBE 108 g of Tris base 55 g of Boric acid 9.3 g of Na2EDTA Bring to total volume of 1 L and filter it.

20X SSC 3M NaCl, 0.3 M NaCitrate For 1 Liter: 175.5 g NaCl 88.0 g NaCitrate (294.1 g/Mole) Bring to total volume of 1 L with dH2O. Autoclave. 20% SDS
-39-

Dissolve 200 g SDS and dilute to 1 Liter in dH2O. Note: SDS can not be autoclaved; it will bubble over. Hybridization buffer for enrichment 6X SSC, 0.1% SDS For 1 Liter: 300 mL 20X SSC 5 mL 20% SDS Bring to total volume of 1 Liter with dH2O. 1 M Tris Dissolve 121.1 g Trizma Base in 700 mL dH2O. Adjust pH to 7.5 with HCl. Adjust volume to 1 L with dH2O. You will also need 1M Tris adjusted to pH 8.0. Autoclave.

0.5 M EDTA (aka: NaEDTA) For 500 mL:Dissolve about 7 g. NaOH pellets in 300 mL dH2O. Add 93.1 g Na2EDTA (372.24g/M). Continue adding NaOH pellets (wait for each pellet to dissolve before adding more) until pH=8. The EDTA will slowly dissolve once the pH has reached 8. Bring volume close to 500 mL, adjust pH to 8 if necessary with 10 M NaOH. Fill to 500 mL. Autoclave. 5 M NaCl For 1 Liter: Dissolve 292.2 g NaCl (58.44 g/M) and dilute to 1 Liter in dH2O. Autoclave. Binding and Washing Buffer 10 mM Tris, [pH 7.5] 1.0 mM EDTA, 1 M NaCl For 1 Liter: 10 mL 1M Tris 2 mL 0.5 M EDTA 200 mL 5 M NaCl Bring to total volume 1 Liter with dH2O. Autoclave. T.E (Pronounced: Tee-dot-eee. NOT Tee-eee)
-40-

10 mM Tris-HCl [pH 8.0], 0.1 mM EDTA [pH 8.0] For 1 Liter: 10 mL 1M Tris, pH 8.0 200 L 0.5 M EDTA Bring to total volume of 1 Liter with dH2O. Aliquot into 50 mL tubes. Autoclave. 2X SSC, 0.1 % SDS For 1 Liter: 100 mL 20X SSC 5 mL 20% SDS Bring to total volume of 1 Liter with dH2O. 1X SSC, 0.1% SDS For 1 Liter: 50 mL 20X SSC 5 mL 20% SDS Bring to total volume of 1 Liter with dH2O. SOC For 1 Liter: 20 g Bacto-tryptone 5 g Bacto-yeast extract 0.5 g NaCl Add to 950 mL dH2O. After solutes have dissolved, add: 10 mL 250mM KCl (Dissolve 1.86 g KCl in 100 mL dH2O) Adjust pH to 7.0. Bring to total volume of 1 Liter. Autoclave, along with 4 250 mL bottles. After autoclaved and cooled to less than 60oC, add 20 mL of 1 M glucose (dissolve 18 g glucose in 90 mL dH2O. After the sugar has dissolved, adjust the volume to 100 mL. Then sterilize by filtration through a 0.22 micron filter).

LB broth with agarose for plates. Ampicillin added. For 1 Liter: 10 g Bacto-tryptone 5 g Bacto yeast extract
-41-

10 g NaCl 15 g agarose Bring to 1 Liter with dH2O. Autoclave. Allow to cool below 50oC. Add 75 mg Ampicillin. Pour into plates. X-gal (20 mg/mL). Make in a hood! For 10 mL: 200 mg X-gal Bring to 1 mL with Dimethyl Formamide. Aliquot into 1.5 mL tubes. Freeze. IPTG (200 mg/mL) For 10 mL: 2g IPTG Bring to 10 mL with dH2O. Sterilize by filtration using a 0.22 micron filter. Aliquot and freeze.

Prot-K Buffer For 250 mL:2.5 mL 1 M Tris [pH 7.5] 2.5 mL 0.5 M EDTA 6.25 mL 20% SDS Bring to 250 mL with dH2O. Hybridization Solution 0.25 M Na2HPO4 [pH 7.2], 7% SDS, 1 mM NaEDTA [pH 8), 1% BSA fraction 5. For 1 Liter: 250 mL 1 M Na2HPO4 ( 141.96 g/Mole) 350 mL 20% SDS 2 mL 0.5 M EDTA 10 g. BSA Fraction 5 Bring to 1 Liter with dH2O. Denaturing Solution 0.5 N NaOH, 1.5 M NaCl For 1 Liter: 20 g NaOH (40 g/Mole)
-42-

300 mL 5M NaCl Bring to 1 Liter with dH2O. Neutralizing Solution 1.5 M NaCl, 0.5 M Tris [pH 7.5] For 1 Liter: 300 mL 5M NaCl 500 mL Tris Bring to 1 Liter with dH2O. Blocking Solution 5% SDS, 17 mM Na2HPO4, 8 mM NaH2PO4, 125 mM NaCl For 1 Liter: 7.3 g NaCl 2.41 g Na2HPO4 dibasic 0.96 g NaH2PO4 monobasic 250 mL 20% SDS Bring to 1 Liter with dH2O. Wash Solution I Dilute blocking solution 1:10 with dH2O. Wash Solution II 10X 100 mM Tris, 100 mM NaCl, 10 mM MgCl 2 For 1 Liter: 100 mL 1M Tris 20 mL 5 M NaCl 10 mL 1 M MgCl 2 Bring to 1 Liter with dH2O.

-43-

-44-