Biosintesis Protein

MK. Biokimia Universitas Udayana

I Nengah Wirajana
Email: nwirajana@gmail.com

Pendahuluan
Anda telah mengetahui bagaimana DNA direplikasi dan bagaimana DNA ditranskripsi menjadi RNA. Kita sekarang akan mempelajari mekanisme sintesis protein, suatu proses yang disebut translasi karena empat-hurup alfabet asam nukleat (GACT) ditranslit menjadi dua puluh hurup alfabet protein (20 asam amino). Translasi terjadi dalam ribosom.

1/1/2014

Pendahuluan

Protein Assembly. The ribosome, shown at the right, is a factory for the manufacture of polypeptides. Amino acids are carried into the ribosome, one at a time, connected to transfer RNA molecules (blue). Each amino acid is joined to the growing polypeptide chain, which detaches from the ribosome only once it is completed. This assembly line approach allows even very long polypeptide chains to be assembled rapidly and with impressive accuracy. [(Left) Doug Martin/Photo Researchers.] Sumber :
1/1/2014 3

Kodon

1/1/2014

Kodon = triplet pengkode asam amino Woble fenomena pembentukan pasangan basa komplementer antara kodon dalam mRNA dengan antikodonnya dalam tRNA pada posisi ketiga dalam triplet biasanya tidak terlalu terbatas seperti halnya pada dua posisi pertama.

1/1/2014

1/1/2014

Codon Reading Frame

AUG is always the start codon so all polypeptides begin with Methionine when they are synthesized Having a consistent start codon is necessary so that the reading frame is always the same.
1/1/2014 7

1. Translasi Urutan Nukleotida Menjadi Urutan asam Amino

Dasar sintesis protein sama pada semua mahluk hidup (all kingdoms of life), menunjukkan fakta bahwa sistem sintesis protein muncul paling awal dalam evolusi. Protein disintesis dalam arah dari amino-ke-karboksil, dengan penambahan secara berurutan asam amino pada ujung karboksil dari rantai peptida yang sedang tumbuh (lihat Gambar berikut).

1/1/2014

1. Translasi Urutan Nukleotida Menjadi Urutan asam Amino

Pertumbuhan rantai polipeptida. Protein disintesis dengan penambahan berurutan asam amino pada terminal/ujung karboksil.
1/1/2014 9

1.1. The Synthesis of Long Proteins Requires a Low Error Frequency

The process of transcription is analogous to copying, word for word, a page from a book. There is no change of alphabet or vocabulary; so the likelihood of a change in meaning is small. Translating the base sequence of an mRNA molecule into a sequence of amino acids is similar to translating the page of a book into another language. Translation is a complex process, entailing many steps and dozens of molecules. The potential for error exists at each step.

1/1/2014

10

1.2. Transfer RNA Molecules Have a Common Design

The fidelity of protein synthesis requires the accurate recognition of three-base codons on messenger RNA. Recall that the genetic code relates each amino acid to a three-letter codon. An amino acid cannot itself recognize a codon. Consequently, an amino acid is attached to a specific tRNA molecule that can recognize the codon by Watson-Crick base pairing. Transfer RNA serves as the adapter molecule that binds to a specific codon and brings with it an amino acid for incorporation into the polypeptide chain.

1/1/2014 11

1.3. The Activated Amino Acid and the Anticodon of tRNA Are at Opposite Ends of the L-Shaped Molecule

The most important properties of the tRNA structure are:

1. The molecule is L-shaped (Figure 29.5). 2. There are two apparently continuous segments of double helix. These segments are like A-form DNA, as expected for an RNA helix . The base-pairing predicted from the sequence analysis is correct. The helix containing the 5 and 3 ends stacks on top of the helix that ends in the TyC loop to form one arm of the L; the remaining two helices stack to form the other (Figure 29.6). 3. Most of the bases in the nonhelical regions participate in hydrogenbonding interactions, even if the interactions are not like those in Watson-Crick base pairs. 4. The CCA terminus containing the amino acid attachment site extends from one end of the L. This single-stranded region can change conformation during amino acid activation and protein synthesis. 5. The anticodon loop is at the other end of the L, making accessible the three bases that make up the anticodon.

1/1/2014

12

1.3. The Activated Amino Acid and the Anticodon of tRNA Are at Opposite Ends of the L-Shaped Molecule

Figure 29.4. General Structure of tRNA Molecules. Comparison of the base sequences of many tRNAs reveals a number of conserved features. 29.5. L-Shaped tRNA Structure. A skeletal model of yeast phenylalanyl-tRNA reveals the L-shaped structure. The CCA region is at the end of one arm, and the anticodon loop is at the end of the other. Figure 29.6. Helix Stacking in tRNA. The four helices of the secondary structure of tRNA (see Figure 29.4) stack to form an L-shaped structure.
1/1/2014 13

2. Aminoacyl-Transfer RNA Synthetases Read the Genetic Code

The linkage of an amino acid to a tRNA is crucial for two reasons.

First, the attachment of a given amino acid to a particular tRNA establishes the genetic code. When an amino acid has been linked to a tRNA, it will be incorporated into a growing polypeptide chain at a position dictated by the anticodon of the tRNA. Second, the formation of a peptide bond between free amino acids is not thermodynamically favorable. The amino acid must first be activated for protein synthesis to proceed. The activated intermediates in protein synthesis are amino acid esters, in which the carboxyl group of an amino acid is linked to either the 2 - or the 3 -hydroxyl group of the ribose unit at the 3 end of tRNA. An amino acid ester of tRNA is called an aminoacyl-tRNA or sometimes a charged tRNA. 1/1/2014 14

2.1. Amino Acids Are First Activated by Adenylation

The activation reaction is catalyzed by specific aminoacyl-tRNA synthetases, which are also called activating enzymes. The first step is the formation of an aminoacyl adenylate from an amino acid and ATP. This activated species is a mixed anhydride in which the carboxyl group of the amino acid is linked to the phosphoryl group of AMP; hence, it is also known as aminoacyl-AMP.

1/1/2014

15

The next step is the transfer of the aminoacyl group of aminoacyl-AMP to a particular tRNA molecule to form aminoacyl-tRNA.

The sum of these activation and transfer steps is

1/1/2014 16

1/1/2014

17

1/1/2014

18

1/1/2014

19

1/1/2014

20

1/1/2014

21

1/1/2014

22

Post Translation
Protein structure is determined by amino acid sequence and modifications Modifications include

The attachment of certain sugars, lipids, or phosphate groups Joining different subunits of the protein to create the quaternary structure

1/1/2014

23

Point Mutations The change of a single nucleotide in the DNAs template strand

1/1/2014

24

Two Types of Mutation Substitutions

Replacing one or more base with others

Insertions or Deletions
Adding or removing one or more base

1/1/2014

25

Gambaran umum proses ekspresi gen

(dari transkripsi sampai translasi)

1/1/2014

26

Latihan soal
Urutan satu untai tunggal dari 53basa nukleotida DNA open reading frame (ORF) adalah sebagai berikut: 5- ATGGGCAA ATTGCGCTTGGGGCCGCCGATGGTATTGC CCAAATTTGCCCCGATGGTACCGGGGTAC TTTTGGCCGCTCTAA-3 Tentukan urutan asam amino hasil translasi! 2. Jelaskan apa saja yang terlibat dalam proses biosintesis protein !
1.

Terima kasih, selamat belajar!!!

1/1/2014

28

21

Metabolisme Karbohidrat, Siklus Sitrat dan Fosforilasi Oksidatif.

Asam Selasa,27Nop2012

8.30- 10.10

Pak Wira

22

SGD 2 Klp(Pembentukan Transport lipida)

Keton

bodi

, Rabu, 28 Nop2012

8.30- 10.10

Bu Ratna + Klp15 dan Klp 16 Pak Wira Pak Wira , Klp 17 dan Klp 18

23 22.

Lanjutan Metabolisme Karbohidrat

Selasa, 4 Des2012

8.30- 10.10 11.00-11.50

SGD 2 Klp(Pengaturan Metabolisme Rabu, 5 Des2012 Karbohidrat Secara Hormonal, Gangguan Klinis Metabolisme Karbohidrat)

23. 24.

Struktur Asam Nukleat

Selasa, 11 Des2012

8.30- 10.10 11.00-11.50

Pak Wira Pak Wira, Klp 19 dan Klp 20

SGD 2 Klp + SGD 2 Klp(Struktur tRNA) dan Rabu, 12 Des2012 Struktur &fungsi Ribosom),

25. 26.

Replikasi DNA dan Biosintesa Protein

Selasa, 18 Des 2012

8.30- 10.10 11.00-11.50

Pak Wira Pak Wira dan Klp 21

Lanjutan + SGD 1 Klp(Antibiotik Penghambat Rabu, 19 Des 2012 Replikasi/Translasi)

27

Resume

Rabu, 26 Des 2012

1/1/2014

11.00- 11.50

Pak Wira
29