You are on page 1of 38

TEMA 5:

GENES E INGENIERA
GENTICA
1. ADN: el material de los genes
Empaquetamiento del ADN en un
cromosoma en mitosis
Estructura de la molcula de ADN
(descubierta en 1953 por Watson y Crik)

El ADN es una doble cadena de nucletidos, paralelas


y enrolladas en hlice.
Los nucletidos estn formados por:
Azcar: desoxirribosa
Fsforo (P)
Base nitrogenada:
Adenina (A),
Timina (T),
Guanina (G)
Citosina (C)
La doble cadena estara unida por estas bases, de manera que la A
se une a la T y la C a la G

Por ejemplo:
AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC
TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG
Funciones del ADN
Si el ADN es el material del que estn hechos
los genes, esta molcula debe realizar las
funciones que se le atribuyen a los genes:
Contener la informacin gentica (o hereditaria)
necesaria para realizar todas las funciones del ser
vivo. Pero cmo lleva la informacin una molcula
de ADN?
Controlar la aparicin de los caracteres o la
realizacin de una funcin. Pero cmo se
manifiesta el carcter o se realiza la funcin?
Pasar la informacin de una clula a sus clulas
hijas durante el proceso de divisin celular. Pero
cmo se copia esa informacin que se va a
repartir?
2. El ADN contiene informacin
La informacin vendr dada por el orden de los
nucletidos (de las bases nitrogenadas)
Pero esta informacin tiene que traducirse a
protenas, que hacen un trabajo determinado y darn
un carcter determinado
Cmo y dnde se hace esto?
El ADN no puede salir del ncleo por lo que la informacin
se copia en una molcula de ARNm (mensajero). Est
formada tambin por nucletidos y la informacin est
copiada por complementariedad: A=U, T=A, CG, GC
(est molcula no posee la timina y en su lugar tiene
uracilo)
AAATTATGCGTGCATTGACCTAAACCCAAATTTGACTTAC
TTTAATACGCACGTAACTGGATTTGGGTTTAAACTGAATG
AAAUUAUGCGUGCAUUGACCUAAACCCAAAUUUGACUUAC (RNAm)
El ARNm sale al citoplasma y su informacin se lee y
traduce en los ribosomas (el proceso se llama traduccin)
Traduccin de la informacin a protenas
Pero las protenas estn formadas por unidades
llamadas aminocidos. Cmo se traduce un
lenguaje de nucletidos a uno de Aa?
La secuencia de nucletido es leda en grupos de
tres. Cada 3 nucletidos (triplete) corresponde a
1 Aa y esa correspondencia se llama cdigo
gentico.
Los ribosomas van identificando los tripletes y
van uniendo los Aa hasta formar las protenas
Cdigo gentico

Tercera letra
AUG CGU GCA UUG ACC UAA ACC CAA AUU CUU UGA AC (RNAm)
Metionina- Arginina- Alanina- -Treonina- - Treonina- Glicina- Isoleucina-- Stop (protena)
Sntesis de protenas
3. La informacin contenida en el ADN se copia
Se abre la doble cadena y delante de cada una de ellas
se colocan los nucletidos complementarios.
4. Cambios en la informacin gentica:
mutaciones
Las mutaciones son errores en la copia del ADN,
producidos:
Al azar
Inducidos por agentes mutagnicos:
Factores fsicos: rayos X
Sustancias qumicas: como sustancias que hay en el tabaco
Las mutaciones pueden afectar:
A 1 gen (gnicas): es un error al copiar el ADN. Es la
causa de que aparezcan alelos diferentes para 1 gen
(aumentan la diversidad)
A 1 cromosoma (cromosmicas): es un error al
repartirse los cromosomas en la mitosis o meiosis (ms
importante porque forma clulas reproductoras)
Una mutacin puede resultar:
Favorable: facilita la supervivencia y deja ms
descendencia.
Neutra: ni beneficia ni perjudica la descendencia (pero
permanece en la poblacin)
Desfavorable: los individuos que la tienen presentan
problemas para sobrevivir
Si el medio cambia, lo que es desfavorable puede
llegar a ser favorable (o viceversa). Por ej la anemia
falciforme en lugares donde hay malaria (y ver diapositiva siguiente)
Adems de las mutaciones hay otra forma de
aumentar la diversidad Cul?
Ejemplo de variacin del medio
Resumiendo: la diversidad se produce por

REPRODUCCIN

Intercambio de Errores en la
informacin copia o reparto

Reproduccin sexual Mutaciones

Variabilidad en la descendencia
5. La ingeniera gentica
Conjunto de tcnicas que permiten quitar, poner o
modificar genes al ADN de un organismo con el fin de
cambiar su informacin. Los genes incorporados
pueden ser de la misma especie o de otra diferente.

Si los organismos modificados genticamente son


eucariotas, se dice que son transgnico.

Si los organismos modificados son procariotas


(bacterias) se les suele denominar organismos
genticamente modificados (OGM)
4. Los Proyectos Genoma
Genoma es el conjunto de genes que posee un organismo.
El proyecto genoma pretende secuenciar el ADN de una
especie e identificar los genes.
El Proyecto Genoma Humano (PGH) comenz en 1990 y se
complet en abril de 2003, pero se contina con l porque, se
conoce la secuencia de nucletidos pero se pretende interpretar
la informacin hasta conocer la posicin de los genes y su
funcin.
Caractersticas del genoma humano:
Contiene unos 3200 millones de pares de bases
Solo el 2% pertenece a genes con informacin para fabricar
protenas (proteoma: conjunto de protenas codificadas por un
genoma). Contiene unos 25.000 genes pero se desconoce la funcin
de casi la mitad de ellos
Es casi igual para todos los seres humanos. Solo nos diferencia el
0,1%
Casi la mitad de las protenas humanas son muy semejantes a las de
otros seres vivos.
As, adems de la genmica se ha iniciado una etapa protemica o
Proyecto Proteoma.
5Cmo se modifica el ADN de un organismo?
APLICACIONES DE LA
INGENIERA GENTICA
Obtencin de protenas de inters mdico, comercial,
etc (insulina, hormona del crecimiento, factores de coagulacin)
Obtencin de vacunas recombinantes (aternativa al uso de
organismos patgenos inactivos)
Diagnstico de enfermedades de origen gentico
Tratamiento de enfermedades de origen gnico:
Terapia gnica
..
Terapia gnica
Estrategias Teraputicas: enviar una informacin a
un grupo de clulas del organismo puede hacerse de
dos formas distintas
Inyectando directamente el vector en el paciente (estrategia
in vivo-dentro del cuerpo)
Inyectando el gen en clulas sanas del paciente que se han
extrado antes mediante una biopsia (estrategia ex vivo-
fuera del cuerpo).
Qu tipo de clulas pueden emplearse en la
terapia gnica? Se pueden emplear dos tipos :
Clulas del propio paciente: estas clulas se modifican en el
laboratorio, antes de re-inyectarlas.
Clulas Madre: Clulas con gran capacidad de multiplicarse y
que pueden generar cualquier tipo de clula de un organismo
adulto. Estas clulas pueden extraerse del propio paciente o
proceder de cultivos mantenidos en el laboratorio.
Vector: Se usa el plsmido de la bacteria Agrobacterium
Plantas transgnicas tumefaciens, que es patgena de plantas. Produce tumores

Agrobacterium
ncleo
Plsmido Ti
inductor de tumores cromosoma
contiene oncogenes
Transgnesis= introduccin de (genes onc)
ADN extrao en un genoma, de
modo que se mantenga estable de
forma hereditaria y afecte a
todas las clulas en los organismos cromosoma
multicelulares.
clula
Ingeniero vegetal
gentico
natural tras
sutitucin de tumores
genes onc por Proliferacin de
genes de hormonas
inters crecimiento. Se
forman tumores en
las zonas de la
lesin
Resistencia a herbicidas, insectos y enfermedades microbianas
El maz transgnico de Novartis es resistente al herbicida Basta y tambin es
resistente al gusano barrenador europeo (contiene el Gen de resistencia a la
toxina Bt de Bacillus thuringiensis) produce su propio insecticida

Problemas:La toxina Bt en las plantas transgnicas tiene propiedades


sustancialmente diferentes a la toxina Bt en su forma natural.
La toxina puede ser transmitida a travs de la cadena alimenticia, un
efecto que nunca ha sido observado en la toxina Bt en su forma natural.
Larvas de especies de insectos predadores benficos (larvas verdes de
crisopa) murieron cuando fueron alimentadas con el gusano barrenador
europeo
Mejora de la calidad de los productos agrcolas
ARROZ con enzima lactoferrina de leche humana, que puede ser
utilizada para mejorar las frmulas de leche infantil. Los nios la
necesitan para usar eficientemente el hierro y pelear contra las
infecciones (Pearson, H. Nature, 26 april 2002).
Gold rice de Monsanto con beta caroteno de genes de narciso,
pigmentos que se transforman en pro-vitamina A al ser ingeridos
Sntesis de productos de inters comercial
Anticuerpos animales, interfern, e incluso elementos de un polister
destinado a la fabricacin de plsticos biodegradables
Clonacin de animales con
funcin reproductora
(TRANSFERENCIA NUCLEAR DE CLULAS EMBRIONARIAS)
Ingeniera Gentica:
NUEVOS ALIMENTOS
Salmn transgnico por
hormona de crecimiento. (ISB, 2001, oct; Netlink, 2000).

Producido por AF Protein Inc. Cuenta con el promotor de la


protena de anticongelamiento de otra especie de pez. Crece
de 4 a 6 veces ms rpido que un salmn no transgnico.
Tiene un 20% en mejoramiento de la eficiencia de conversin
del alimento.
VACAS LECHERAS con incremento de
protenas. En Nueva Zelanda se clonaron
vacas con vulos mejorados genticamente,
para mejorar la produccin del queso y crema,
aumentando dos veces la kappa casena,
crucial para hacer la cuajada y de 20% ms de
beta caseina, que mejora la accin del cuajo
(Hoag, H. Nature, 27 enero 2003).
Clonan terneros en EE UU para producir anticuerpos
humanos

efe- Washington - agosto 2002

Terneros clonados y manipulados genticamente (fbrica de anticuerpos humanos)

genes para anticuerpos clulas drmicas clonacin


humanos recombinantes

Objetivo: Tratamiento de enfermedades inmunolgicas

Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por


bacterias y virus, como hepatitis, ntrax (utilizada como arma biolgica)
Clonan cerdos destinados a trasplantar sus rganos a
humanos

La empresa escocesa PPL Therapeutics logra


retirar de los cerditos el gen que provoca el
rechazo en transplantes a humanos "alfa 1,3
galactosil transferasa"

Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)

Paso importante en favor del xenotrasplante (transferencia de clulas u


rganos de una especie a otra)

Ayudar a superar la escasez de rganos humanos para hacer trasplantes de


todo tipo
Declaracin Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997),
adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una
continuacin en las investigaciones y la salvaguarda de los derechos humanos)

Frente a los mltiples beneficios de la ingeniera gentica pueden surgir


algunos problemas:

Problemas sanitarios nuevos microorganismos patgenos, efectos secundarios


de nuevos frmacos de diseo, etc...
Problemas ecolgicos desaparicin de especies con consecuencias desconocidas,
nuevos contaminaciones, etc...
Problemas sociales y polticos
Pueden crear diferencias an ms grandes entre pases ricos y pobres (en el campo de la
produccin industrial, agrcola y ganadera),
El sondeo gnico en personas puede llevar a consecuencias nefastas en la contratacin laboral, por
ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de
seguros, discriminacin..).
Problemas ticos y morales
16 de Febrero de 2001
Celera Genomics

Proyecto genoma humano


La secuencia del genoma es un atajo valioso: ayuda a los
cientficos a encontrar los genes ms fcil y rpidamente
y sienta las bases para averiguar la funcin de los genes
identificados

Beneficios mdicos tras el conocimiento de la


estructura de cada gen humano

1. Diagnstico en individuos con riesgo de ser


portadores del gen de alguna enfermedad

2. Marco de trabajo para el desarrollo de


nuevas terapias, adems de nuevas
estrategias para la terapia gnica

15 de Febrero de 2001
Consorcio pblico internacional
DUDAS
SI FUERA POSIBLE, A USTED LE GUSTARA
HACERSE UN TEST GENTICO QUE LE
DIJERA LAS ENFERMEDADES QUE SUFRIRA
EN SU VIDA?
Reemplazar genes
defectuosos para
sanar no es
controversia,
pero...introducir
genes en gente
saludable para ser
ms inteligente o
transformarla en
atleta, ser tico?
PERO:CUNTO PODEMOS
AVANZAR?
ETICA
Algunas aplicaciones
parecen claramente
no ticas (armas
biolgicas).
...y muchas preguntas
no tiene una
respuesta clara.
PERO, al menos
Un pblico
informado es la
mejor proteccin
contra
aplicaciones no
ticas o abusos
del conocimiento
biolgico.