Genetic code quiz

• 1. Given the list of amino acids, determine the

sequence of bases in the codon of the mRNA that
codes for these amino acids. Use the table for the
Genetic Code.
• 1. Arginine
• 2. Threonine
• 3. Aspartic acid
• 4. Glutamic acid
• 5. Asparagine
1. The following is the base sequence
on one strand of a DNA molecule:
A A T G C C A G T G G T, write its
complementary strand.
Write the complementary strand of
the following if transcribed into the
mRNA.
2. A G C A G G C A G A U C
3. U U A C G G U C A C C A
• 4. A portion of an RNA molecule has the
sequence AUGCUGAAUUGCGUAGGA
GGGCAA.
• What amino acid sequence does this
code for?
• Translate each of the following
codons into its corresponding
amino acid from DNA to mRNA
• ATGCCCCTTAAAGAGTTTACATATTG
CTGGAGGCGTTAACCCCGGA
•