MUTACIONES

DEL DNA:
DEFICIENCIA DE
COLAGENO
Dayana Enriquez Michael alzate
• Molecula de ADN
3´TGGCCAATAGGGACTTCGCGAATATTAGCCATACTAGGAACCGCCATTTGAGGAACTATGGGCAGTCCCGATTTAGCGA 5´

Este Gen en especifico codifica la proteína colágeno.

Esta es la proteína constituyente de los tejidos conjuntivos en humanos y animales, como la piel los tendones y los
huesos, es la proteína mas abundante del organismo se caracteriza principalmente por su notable resistencia, una fibra
de 1 mm de diámetro puede soportar una carga de 10 a 40 Kg.

El colágeno esta constituido por un conjunto de tres cadenas polipeptídicas ( 1000 aminoácidos por cadena)
agrupadas en una estructura helicoidal. La glicina constituye la tercera parte de cada cadena (maso menos 333
glicinas por cadena polipeptídica) hecho único entre todas las proteínas del organismo.
• Molecula de ADN
3´TAGGGACTTCGCGAAATCTAGCCATACTAGGAACCGCCATTTGAGGAACTATGGGCAGTCCCGATTTAGCGA 5´

3´AUCCCUGAAGCGCUUUAGAUCGGUAUGAUCCUUGGCGGUAAACUCCUUGAUACCCGUCAGGGCUAA -- AUCGCU5´

Ile Pro Glu Ala Leu Stop Ile Gly Met Ile Leu Gly Gly Lys Leu Leu Asp Thr Arg Gln Gly Stop
• Table of contents

01 03
Objectives Results analysis
You can describe the topic of You can describe the topic of
the section here the section here

02 04
Methodology Conclusions
You can describe the topic of You can describe the topic of
the section here the section here
 Introduction •
You can give here a brief description
of the topic you want to talk about.
For example, you can say that it’s the
smallest planet in the entire Solar
System
 01
• Objectives •
You can enter a subtitle here if you
need it
• Background

Problem Hypothesis
Mercury is the closest planet to Jupiter is the biggest planet of
the Sun them all

Sampling Data
Venus is the second planet from Saturn is a gas giant and has
the Sun several rings

Experimentation Report
Neptune is the farthest planet Despite being red, Mars is a
from the Sun cold place
• Goals

A B
Genetics Human body
Mercury is the closest planet
Jupiter is a gas giant and the
to the Sun and the smallest
biggest in the Solar System
one
• Methods

Instruction Development Experiments

Mercury is the closest
Despite being red, Mars is Jupiter is a gas giant and
planet to the Sun and the
actually a very cold place the biggest planet
smallest
• Research and publications

“Venus is the second planet “Jupiter is the biggest planet of

from the Sun” them all”

by Mel Martinez by Sergio Doe

“Despite being red, Mars is a “Saturn is a gas giant and has

cold place” several rings”

by Camilla Beck by Robert Pat

• Research resources

● You can list your reference websites or publications here.

● You can list your reference websites or publications here.
● You can list your reference websites or publications here.
● You can list your reference websites or publications here.
● You can list your reference websites or publications here.
● You can list your reference websites or publications here.
• Factors to consider

A
Chromosomes
Despite being red, Mars is actually a
cold place

B
Gene
Jupiter is the biggest planet in the
Solar System

C
Cell
Mercury is the closest planet to the
Sun and the smallest
• A picture is
worth a
thousands words
•
• Using a picture is a
good idea
Images reveal large amounts of data,
so remember: use an image instead of
a long text. Your audience will
appreciate that
Awesome •
words •
“This is a quote, words full of
wisdom that someone
important said and can make
the reader get inspired.”

• Someone Famous
• Clinical trial

30% 60% 90%

Phase 1 Phase 2 Phase 3

Mars is actually a very Mercury is the smallest Venus is the second planet
cold place planet from the Sun
• Trial timeline

02 04
Preclinical Conclusion
01 Mars is a very cold
place
03 Neptune is the
farthest planet
Research Tests
Mercury is the Jupiter is the biggest
smallest planet planet
• Trial process

01 03
Studies Efficacy
Mercury is the Jupiter is the biggest
smallest planet planet

02 04
Safety Results
Mars is a very cold Neptune is far away
place from us
• Phase 1

Effects Results
Venus is the second planet
from the Sun
80% Jupiter is a gas giant and the
biggest planet
DNA study
success rate
20%
Headache
Mercury is the
smallest planet

150 40%

Nausea days of research

Mars is a very cold 60%
planet
• About the sample

60%
Women
Jupiter is the biggest
planet

40%
Men
Neptune is far away
from us
• Tendency

25% 25%
Adenine Thymine
Jupiter is the biggest Earth is where we
planet all live on

25% 25%
Guanine Cytosine
Follow the link in the graph to modify its data
Neptune is far away Ceres is in the and then paste the new one here.
from us asteroid belt For more info, click here
• Results

Experiment A Experiment B
Outcome Outcome

Sample Test 1 Test 2 Sample Test 1 Test 2

Group 1 315 285 Group 1 185 474

Group 2 210 390 Group 2 210 444

Group 3 240 560 Group 3 365 396

• Results analysis

About DNA Adenine

Venus is the second planet from the Jupiter is the biggest
planet
Sun
Thymine
Adenine Thymine Mars is a very cold
planet

Guanine Cytosine Guanine

Earth is where we all
Thymine Adenine live on

Cytosine
Cytosine Guanine Ceres is in the
asteroid belt
 3.bi
The human genome contains 3 billion
base pairs of DNA
 99.9%
All human beings are 99.9 percent
identical

600
DNA can stretch from Earth to the
Sun 600 times

46
DNA pairs are arranged on 46
chromosomes
• Conclusions

01 02
Signs Symptoms
Despite being red, Mars is Jupiter is a gas giant and
actually a cold place the biggest planet
• Our team

Ellen Doe Daniel Jam Jess Smith

You can talk a bit about You can talk a bit about You can talk a bit about
this person this person this person
• Our website

You can replace the images on the screens with your own work. Just right-
click on them and select “Replace image”
Thanks!
Do you have any questions?
youremail@freepik.com
+91 620 421 838
yourcompany.com

CREDITS: This presentation template was created by Slidesgo

, including icons by Flaticon, and infographics & images by
Freepik

Please keep this slide for attribution

• Alternative resources
Here’s an assortment of alternative resources whose style fits that
of this template

● Researcher conversing laboratory

● Doctor looking blood sample
• Resources
Did you like the resources? Get them for free at our other
websites.

Vectors Photos
● Scientists holding DNA mole ● Researchers laboratory with safety glasses
cules I ● Researcher holding glassware
● Scientists holding DNA mole ● Scientists working in laboratory
cules II ● Smiley woman with microscope
● Science concept with microsc ● Smiley male researcher laboratory using m
ope icroscope
● Characters holding dna mole ● Woman holding glasses
cules
• Try the effect on your photos

If you want to apply the same filter as the pictures already

included in the template, follow these instructions.

In Google Slides:
● Insert the picture into the slide
● Go to Format options > Recolor
● Choose the “Light 1” option
● Copy and paste the image exactly in the same place
● Apply some transparency to it
 Instructions for use
In order to use this template, you must credit Slidesgo by keeping the Thanks slide.

You are allowed to:

- Modify this template.
- Use it for both personal and commercial projects.

You are not allowed to:

- Sublicense, sell or rent any of Slidesgo Content (or a modified version of Slidesgo Content).
- Distribute Slidesgo Content unless it has been expressly authorized by Slidesgo.
- Include Slidesgo Content in an online or offline database or file.
- Offer Slidesgo templates (or modified versions of Slidesgo templates) for download.
- Acquire the copyright of Slidesgo Content.

For more information about editing slides, please read our FAQs or visit Slidesgo School:
https://slidesgo.com/faqs and https://slidesgo.com/slidesgo-school
 Instructions for use (premium users)
As a Premium user, you can use this template without attributing Slidesgo or keeping the "Thanks" slide.

You are allowed to:

● Modify this template.
● Use it for both personal and commercial purposes.
● Hide or delete the “Thanks” slide and the mention to Slidesgo in the credits.
● Share this template in an editable format with people who are not part of your team.

You are not allowed to:

● Sublicense, sell or rent this Slidesgo Template (or a modified version of this Slidesgo Template).
● Distribute this Slidesgo Template (or a modified version of this Slidesgo Template) or include it in a database or in
any other product or service that offers downloadable images, icons or presentations that may be subject to
distribution or resale.
● Use any of the elements that are part of this Slidesgo Template in an isolated and separated way from this
Template.
● Register any of the elements that are part of this template as a trademark or logo, or register it as a work in an
intellectual property registry or similar.

For more information about editing slides, please read our FAQs or visit Slidesgo School:
https://slidesgo.com/faqs and https://slidesgo.com/slidesgo-school
 Fonts & colors used

This presentation has been made using the following fonts:

Spartan
(https://fonts.google.com/specimen/Spartan)

#334860 #f9f9f9 #261e23 #f75f4f #ed8962

#efb94b #d39c2c #c2d7d0 #aa437e #c65490

 Storyset

Create your Story with our illustrated concepts. Choose the style you like the most, edit its colors, pick
the background and layers you want to show and bring them to life with the animator panel! It will boost
your presentation. Check out How it Works.

Pana Amico Bro Rafiki Cuate

 Use our editable graphic resources...

You can easily resize these resources without losing quality. To change the color, just ungroup the resource
and click on the object you want to change. Then, click on the paint bucket and select the color you want.
Group the resource again when you’re done. You can also look for more infographics on Slidesgo.
 JANUARY FEBRUARY MARCH APRIL MAY JUNE

PHASE 1

Task 1

Task 2

PHASE 2

Task 1

Task 2

JANUARY FEBRUARY MARCH APRIL

PHASE
1

Task 1

Task 2
 ...and our sets of editable icons

You can resize these icons without losing quality.

You can change the stroke and fill color; just select the icon and click on the paint bucket/pen.
In Google Slides, you can also use Flaticon’s extension, allowing you to customize and add even more icons.
Educational Icons Medical Icons
Business Icons Teamwork Icons
Help & Support Icons Avatar Icons
Creative Process Icons Performing Arts Icons
Nature Icons
SEO & Marketing Icons