Universidade do Algarve

Departamento de Cincias Biomdicas e Medicina

Mestrado Integrado em Medicina
Mdulo de Escolha do Estudante

Characterization of FOXO3a-mediated gene

expression following NPV-BEZ235 exposure

Laboratrio Wolfgang Link

Tutor: Richard Hill
Realizado por: Teresa Martins (a39062)

N de Palavras: XXXX

Characterization of FOXO3a-mediated gene expression following NPV-BEZ235 exposure

Abstract ______________________________________________________________________
Blablablabla
Introduction __________________________________________________________________
Cancer is the uncontrolled growth of cells
in the body. Among the many types of
cancers that can rise in an organism,
melanoma, originated in anomalous
melanocytes, is considered one of the most
deadly forms of skin cancer and one of the
most aggressive and treatment-resistant
human cancers (Fellner e 1131.full).
According
to
the
World
Health
Organization,
melanoma
kills
approximately 53,000 pacients per year,
worldwide (Fellner).
Of all cancers,
melanoma is considered straightforward to
diagnose due to the presence of the melanin
pigment, that can be directly observed.
Radiation therapy, surgical resection and
systemic therapy (interferon, dacarbazine or
others), are some of the techniques used in
the treatment of melanoma. Yet, since it is a
disease that spreads quickly to surrounding
tissues (due to its high mitotic rate) and its
highly metastatic, standard treatments dont
supply a high survival rate. (nihms129601)
Aside from surgical resection, investigators
still lack to find a therapeutic modality that
can enhance the likelihood of curative
outcome.
Over the last few years research has yielded
important
breakthroughs
in
our
understanding of melanoma particularly
regarding the molecular basis of the
disease, the deregulated cellular processes
essential for continued cell growth within
this cancer, the metastatic process and
mechanisms of melanoma resistance to
chemotherapeutics.
(nihms-233789).
However to date the only two co-adjuvant
treatments approved by the United States of
America Food and Drug Administration are

high-dose Interleukin-2 and dacabarzin.

NPV-BEZ235
(BEZ)
is
an
imidazoquinoline
that
targets
the
phosphatedylinositol 3 kinase (PI3K) and
the mammalian target of rapamycin
(mTOR), that has demonstrated significant
potential antineoplastic properties and is
currently being tested I various active
clinical
trials.
(http://www.cancer.gov/drugdictionary?
cdrid=589292) PI3Ks (the cellular targets
of BEZ) are lipid kinases that play a central
role in the regulation of the cell cycle,
apoptosis,
DNA repair,
senescence
(terminal cell cycle arrest), angiogenesis,
cellular metabolism, and motility. (17568722-6-88). The deregulation that leads to
diminished cell death and increased growth
and proliferation is driven by the
accumulation of genetic and epigenetic
alterations within the cancer. The activation
of PI3Ks has a noticeable relation with
tumor growth, since it promotes an increase
in cellular mass, cell cycle entry,
counteracts apoptosis, modulates and
controls cytoskeletal rearrangements and
enhances cell migration and metastasis.
(601.full) PI3K activation leads to the
production of phosphatidylinositol 3,4,5triphosphate,
that
activates
Phosphoinositide-dependent
kinase-1
(PDK1) and Protein Kinase B (Akt). The
Akt kinase promotes cell survival by
phosphorylating, and thereby inactivating,
pro-apoptotic factors, such as the FOXO
transcription factor family. (4455.full) The
FOXO proteins (including FOXO3a) play
an important role in longevity and tumor
suppression by regulating a wide range of

genes involved in stress resistance,

metabolism, cell cycle arrest and apoptosis.
(onc200821a). Previous studies have shown
that BEZ treatment of malignant melanoma
cells induces FOXO3a-dependent gene
expression following the inhibition of
PI3K. Functional studies suggest that the
tumor suppressive role of was due to their
inactivation, caused by constitutively active
PI3K/AKT or RAS/ mitogen-activated
protein kinase (MAPK)/ERK signaling.
Activation of these pathways can directly
result in phosphorylation of FOXOs and
their subsequent cytoplasmic sequestration
and/or degradation via the ubiquitinproteasome pathway.
When FOXO is activated by
inhibition of the PI3K/AKT pathway,
FOXOs can promote a wide range of effects
including cell cycle
arrest, cell differentiation, autophagy and
apoptosis via various mechanisms. (00085472.CAN-12-3767.full)
Tribbles-2 (TRIB2), a kinase-like protein,
has a role in cell division, that is suggested
in up-regulated gene expression in a subset
of acute myeloid leukaemias. Members of
tribbles family have been reported to
interact and modulate the activity of signal
transduction pathways, including the
PI3K/Akt and the MAPK systems.
(dxn116)
When TRIB2 is highly expressed in
metastatic melanoma cells and has been

implicated in the resistance of various

cancers to a range of chemotherapeutics.
including inhibitors of PI3K that are under
clinical trials. (laura e lab)
While it is highly tempting to
therapeutically inhibit PI3K/Akt (that is
constitutively active in many cancers)
driving the accumulation of nuclear FOXO,
a recent, important study revealed that in
the presence of high nuclear -catenin, that
the activation of FOXO3a by PI3K or Akt
inhibitors induced metastasis rather than
mediating a pro-apoptotic anti-tumor
response as would have been predicted.
(1457-14905-3-PB)
Based on all this known information, my
research goal was to understand if the
repression following Trib2 overexpression
was due to an inability of FOXO3a to bind
target gene promoters.
To this aim, several genes were analyzed,
such as Bcl-2 interacting mediator of cell
death (BIM), Cyclin-dependent kinase
inhibitor 1B (p27), whose major function is
to stop or slow down the cell division cycle,
murine doble minute 2 (MDM2), a negative
regulator of tumor suppressor gene p53,
BCL2-associated X protein (BAX), that
promotes
apoptosis,
cyclin-dependent
kinase inhibitor 1 (distal p21), that
promotes growth arrest and is able to
mediate cellular senescence, and Fas ligand
(FasL).

Methods______________________________________________________________________
Tissue Culture
Cell lines
The cell lines used for this research
experiment were G631 Human Melanoma
Cell Line and the U2OS Human Bone
Osteosarcoma Epithelial Cell Line. The
cells were cultivated in 15 cm plates with
Serum DMEM 10% with Pen/Strep.

Each cell line was previously transfected

with a plasmid containing the TRIB2 and
treated with BEZ as described on table 1.
G631
- Empty
- Trib 2 shRNA
U2OS
- Empty

Bez Treatment
Non Treated
Bez Treatment
Non Treated
Bez Treatment

- Trib 2 shRNA

Non Treated
Bez Treatment
Non Treated

Table 1 Cells line and applied treatments and

transfections.

Imunnoblotting / Western Blotting

This technique provides information about
the presence, relative molecular weight,
and/or quantity of an antigen by combining
protein separation via gel electrophoresis
with specific recognition of antigens by
antibodies.
List of used antibodies:
Actin (I-19): sc-1616
Bim (H-191): sc-11425
caspase-3 (E-8): sc-7272
Cleaved caspase-3 p11 (h176)-R:sc-22171-R
FAS-L (C-178): sc-6237
FKHRL1 (N-16): sc-9813
MDM2 (C-18): sc-812
p53 (DO-1): sc-126
p-Akt1/2/3 (Ser 473): sc-33437
p-FKHRL1 (Ser 253): sc-12897
Akt1 (C-20): sc-1618
TRIB 2
Table 2 List of used antibodies. All the antibodies
were commercialized by Santa Cruz Bayer
Technology, except TRIB2, that was developed in the
laboratory.

those containing sodium dodecyl sulfate

and other ionic detergents considered to be
the harshest and therefore most likely to
give the highest yield. After incubation on
ice, the sample was centrifuged again, the
pellet was discarded and the supernatant
transferred into a new Eppendorf tube.
SDS-PAGE Gels
First, the samples were prepared and mixed
with sample buffer (loading buffer) and
then, the proteins were separated by gelelectrophoresis. After that, the separated
proteins were transferred to a sheet of
nitrocellulose. The blot was incubated with
a 5% milk to prevent non-specific binding
of the used antibodies. A specific primary
antibody to the interest protein is then
added to the solution, and incubated
overnight. The primary antibody is
removed, the membrane is washed three
times with TBS + Tween 20 (Bio-Rad), and
after that, the secondary antibody is added
in BSA. This antibody has an enzyme or
dye attached. The membrane is washed
again three times, with TBS + Tween 20
(Bio-Rad). Finally, the membrane is
revealed on ChemiDoc, using ECL Plus.
Co-Imunnoprecipitation

Protein Extraction
The cells were scraped from the plate into a
clean Eppendorf with PBS, and then
centrifuged. The supernatant was removed.
To prepare samples for running on a gel,
cells and tissues on the pellet need to be
lysed to release the proteins of interest. This
breaks the cell membrane and the nuclear
envelope, and allows the proteins to migrate
individually through a separating gel. Cells
(+/- treatments) were lysed using RIPA
buffer (100mM EDTA stock, PIC, Na 3VO4,
200mM NaF and RIPA Tris, NaCl, H 2O
and Nonidet P40 buffer and sodium dodecyl
chloride). In brief, these lysis buffers differ
in their ability to solubilize proteins, with

The cells were washed with medium.

Trypsin was added to the plate with the
cultivated cells and then the cells were
scraped. The solution was collected to new
Eppendorf tubes and centrifuged, and the
supernatant was collected to new tubes. The
protein A/G-agarose beads were washed for
2 times with PBS and a 50% protein A/G
agarose working solution (in PBS) was
made.
A 50% protein A/G agarose with ratio of
100l for a 500 l sample solution was
added.
The sample was centrifuged and the
supernatant was transferred to new tubes.

The primary antibody was added, and the

sample was incubated overnight at 4oC.
The samples were centrifuged, the pellet
was kept, and washed with pre-chilled
washing buffer (or cold PBS) for 3 times.

Chromatin Imunnoprecipitation (ChIP)

Cross-Linking and Cell Harvesting
The plates were washed with medium, and
a 1% formaldehyde/PBS solution was
added to promote cross-linking of proteins
to DNA. The solution was removed, and the
plates were washed with medium again.
The cells were scraped from the plates with
1M Tris-HCl with 10mM DTT, and
transferred to Eppendorf tubes. After
centrifugation, the pellets were washed with
Buffer I and II. After centrifugation, the
pellet was resuspended in lysis buffer
(made fresh with PIC).

To the remaining supernatant (after the

inputs were taken off), it was added sheared
salmon sperm DNA, the antibody of
interest, G Fast flow beads (SIGMA) and
Buffer D. After incubation, the beads were
pulled down and washed with TSE I, II and
III. Between incubations, each ChIP sample
was washed again with TSE I, II and III.
After that, the beads were washed with ice
cold TE. The DNA was extracted with three
washes with a solution of NaCHO 3 and
SDS. The beads were incubated each time
the DNA was extracted, and after
centrifugation, the supernatant was
transferred to a fresh Eppendorf. The elutes
were polled and incubated at room
temperature for one hour.
DNA Purification
After that, the input and the ChIP samples
were
loaded
into
SIGMA
gel
extraction/clean up kit., and eluted with
water. qPCR was then performed and the
products were also visualized on an agarose
gel.

Sonication

Real Time PCR

The cells were sonicated (6 times for 10 sec

each sample) on ice, to shear DNA to an
average fragment size of 200-100bp.
After centrifugation to pellet cell debris, the
supernatant was transferred into a new
Eppendorf and Buffer D and PIC (Protein
Inhibitor Coktail) were added. At this point,
it was removed part of the supernatant from
the inputs (sample after sonication; used to
quantify the DNA concentration and serve
as a control on the PCR process), and the
SDS and NaCHO3 concentrations were
adjusted.

Real-time PCR is usually the preferred

technique to analyze specific DNA
fragments in the immunoprecipitated
samples. Results are often presented as
percent input values, calculated by using
real-time PCR to quantify the abundance of
the DNA fragment of interest added to the
ChIP reaction, with respect to the
abundance of the DNA fragment found in
the final immunoprecipitate.
The used primers were BIM, p27, MDM2
and distal p21.

Reverse Cross-Linking

BIM
Reverse
Forward

The samples were heated overnight at 65C.

Immunoprecipitation

Primers Sequences

p27
Reverse
Forward

CCCGCTCCTACGCCCAATCA
AGCAAGCAGAGTTACTCCGGTAAA
CA

GGAAACCAACCTTCCGTTCT
GTCCCTTCCAGCTGTCACAT

distal p21
Reverse
CTCCTACCATCCCCTTCCTC
Forward CTGGACTGGGCACTCTTGT

C
MDM2
Reverse
Forward
Table 3 Primers Sequences used on the ChIP Real
Time PCR.

Figure 1 - Real Time PCR thermal profile

Each sample was tested for the previous

described genes, following the Real Time
PCR thermal profile on figure 1.

Results________________________________________________________________________
Figure 1: TRIB2 over expressing cells show significant resistance to PI3K inhibitors via
the repression of FOXO3-regulated genes. A). Western blots (100 ug total protein) B.
FACS (48 hours post BEZ treatment) C. Western blot (50 ug total protein per lane). D.
Gene expression (qRT-PCR) at hours post BEZ treatment (100nM)
A. Comparing the expression of caspase 3 and cleaved caspase 3 on the U2OS (empty-GFP)
and U2OS (TRIB2-GFP) cell lines, it is possible to conclude that the expression of caspase 3 is
not affected by the presence of Trib2 or treatment with Bez. Analyzing the expression of cleaved
caspase 3 (the active form of the enzyme caspase 3), it is visible that the absence of Trib2 and
the treatment with Bez, promote de expression of the enzyme. Trib2 served as a control for the
transfection and Actine as a control for the procedure.
B. Although there is not a significant difference between de two cell lines when there is no
damage inflicted (no treatment), comparing both cell lines, after 48 hours of damage with BEZ,
it is shown that cell line U2OS (TRIB2-GFP) has a much sharper G1 peak than U2OS (emptyGFP). Therefore, this shows that TRIB2 has no effect on cell division under non-damage
conditions, but with BEZ treatment (causing the inhibition of PI3Ks), TRIB2 confers resistance
(significantly less dying cells on subG1) and presents a healthier FACS profile (showing a
greater similarity between images 3 and 4 than between images 1 and 2).
C. Comparing the expression of BIM and FasL on the U2OS (empty-GFP) and U2OS (TRIB2GFP) cell lines, it is possible to conclude that the absence of Trib2 and the treatment with Bez,
promote de expression of the proteins. Actine served as a control for the procedure.
D. Real Time PCR confirms the previous findings, as it is possible to conclude that the absence
of Trib2 and the lasting of the treatment with Bez increases the expression of the genes in study.
There is more FOXO3a binding to the promoter under NT conditions, however when BEZ is
added, the empty cells show significant FOXO3a activation and promoter recruitment and the
TRIB2 cells do not show this. They show only a very minor increase in the amount of FOXO3a
on the p27 promoter. It is interesting because the cell cycle arrest aspect is not significantly
different between either cell line, rather it is the pro-apoptotic components.

Figure 2: Our PI3K inhibitor is effective at the concentration (100 nM) we have used.
Western blots (100 ug protein per lane).
It is possible to conclude that the use of BEZ decreases the expression of the phosphorylated
proteins (P-Ser473-Akt and P-Ser253-FOXO3a), but does not affect the total proteins (Total
AKT and Total FOXO3a, regardless the phosphorylation state).

Figure 3: TRIB2 over expressing cells show a deregulated p53-MDM2 relationship. A.

Western blot (50 ug per lane). B). Immunoprecipitation for p53 or FOXO3a to confirm our
antibody would bind to each protein prior to conducting ChIP assays.
1. Comparing the expression of MDM2 on U2OS (empty-GFP) and U2OS (TRIB2-GFP), it is
not possible to show a pattern for the influence of the treatment with Bez, or for the relationship

between MDM2 and Total p53. Despite that, BEZ treatment on U2OS (empty-GFP), appears to
induce the expression of Total p53, having the opposite effect on the U2OS (TRIB2-GFP) cell
line
2. Binding of our antibody to the proteins of interest was confirmed before conducting the ChIP
assays.

Figure 4: Chromatin immunoprecipitation indicates significant differences in FOXO3a

and p53 recruitment to gene promoters following PI3K inhibition. A. ChIP assays for
FOXO3a and p53 in G361 cells B. Quantification of the captures shown in A. C. ChIP
assays for FOXO3a and p53 in U2OS cells. D. Quantification of ChIP assays shown in C.
A and B. Recruitment of FOXO3a to p21 and MDM2 gene promoters doesnt occur, and there
are no differences between the treated (12h BEZ) and non-treated samples. On the contrary,
there is significant FOXO3a recruitment to p27 and Bim gene promoters, and that recruitment is
increased by the treatment with BEZ on the G631 (TRIB2shRNA). These conclusions are
confirmed by the quantification of the captures, showing a major difference between both cell
lines and the influence of BEZ treatment. As for the recruitment of p53, has exactly the opposite
profile of recruitment to the same gene promoters: recruitment of p53 doesnt occur to p27 and
BIM gene promoters, but is recruited to p21 and MDM2 gene promoters, showing an increase
of this recruitment on the G631 (TRIB2shRNA) after treatment with BEZ. These conclusions
are once again sustained by the quantifications of the ChIP assays by Real Time PCT.
C and D. The U2OS cell line presents the exact same patern of recruitment FOXO3a and p53 to
p27, Bim, p21 and MDM2 gene promoters.

Discussion_____________________________________________________________________
Analyzing the effect of the overexpression
of TRIB2, it is possible to conclude that it
confers resistance to the chemotherapic
agent BEZ, confirmed by the fact that on
the cellular line overexpressing TRIB2, had
a much smaller amount of the active form
of the enzyme caspase 3, that plays an
important role in the execution-phase of
cell apoptosis. That fact is also confirmed
by the promotion of the expression of the
proteins BIM and FasL, both pro-apoptotic
regulators,
on
cells
lacking
the
overexpression of TRIB2.
Another proof of the interaction of TRIB2
with the cell cycle, is increased binding of
the transcription factor FOXO3a to the proapoptotic components (such as p27) on the
cell lines without the overexpression of

TRIB2, when compared to the cell line that

overexpress it.
The treatment with BEZ also decreases the
expression of the phosphorylated forms of
AKT and FOXO3a, decreasing this way the
cell proliferation.
Aside from these gene promoters, MDM2
and p53 were also studied, but a clear
relation between p53 and MDM2 couldnt
be established.
The interaction between FOXO3a and the
p27 and BIM gene promoters apparently is
increased on the cell lines overexpressing
TRIB2 after the treatment with BEZ. As for
p53, it apparently shows a high recruitment
to p27 and BIM gene promoters after BEZ

treatment of cell lines overexpressing

TRIB2. Since the levels after BEZ
treatment are similar on both cell lines
(empty and overexpressing TRIB2), this

results suggest that the BEZ influence on

the apoptosis of cancer cells is independent
from TRIB2.

Future Perspectives_____________________________________________________________
To confirm these new findings, and confirm
if the chemotherapic agent BEZ is able to
surpass the resistance problems that other

chemotherapic agents find when TRIB2 is

overexpressed in melanoma cells, all these
experiments should be performed again.