Human Molecular Genetics, 2012, Vol. 21, No. 5 doi:10.

1093/hmg/ddr533 Advance Access published on November 14, 2011

10251036

Targeted mutation of SLC4A5 induces arterial hypertension and renal metabolic acidosis
ger1, Helga Vitzthum2, Henning Fro hlich1,{, Marcus Kru ger1, Heimo Ehmke2, Nicole Gro { { Thomas Braun1, and Thomas Boettger1, ,
Department of Cardiac Development and Remodelling, Max Planck Institute for Heart and Lung Research, re und Integrative Physiologie, r Zellula Ludwigstrasse 43, D-61231 Bad Nauheim, Germany and 2Institut fu tsklinikum Hamburg-Eppendorf, Martinistrae 52, 20246 Hamburg, Germany Universita
Received October 26, 2011; Revised and Accepted November 8, 2011
1

The human SLC4A5 gene has been identied as a hypertension susceptibility gene based on the association of single nucleotide polymorphisms with blood pressure (BP) levels and hypertension status. The biochemical basis of this association is unknown particularly since no single gene variant was linked to hypertension in humans. SLC4A5 (NBCe2, NBC4) is expressed in the collecting duct of the kidney and acts as an electrogenic ion-transporter that transports sodium and bicarbonate with a 1:2 or 1:3 stoichiometry allowing bicarbonate reabsorption with relatively minor concurrent sodium uptake. We have mutated the Slc4a5 gene in mice, which caused a persistent increase in systolic and diastolic BP. Slc4a5 mutant mice also displayed a compensated metabolic acidosis and hyporeninemic hypoaldosteronism. Analysis of kidney physiology revealed elevated uid intake and urine excretion and increased glomerular ltration rate. Transcriptome analysis uncovers possible compensatory mechanisms induced by SLC4A5 mutation, including upregulation of SLC4A7 and pendrin as well as molecular mechanisms associated with hypertension. Induction of metabolic alkalosis eliminated the BP difference between wild-type and Slc4a5 mutant mice. We conclude that the impairment of the function of SLC4A5 favors development of a hypertensive state. We reason that the loss of sodium-sparing bicarbonate reabsorption by SLC4A5 initiates a regulatory cascade consisting of compensatory bicarbonate reabsorption via other sodium-bicarbonate transporters (e.g. SLC4A7) at the expense of an increased sodium uptake. This will ultimately raise BP and cause hypoaldosteronism, thus providing a mechanistic explanation for the linkage of the SLC4A5 locus to hypertension in humans.

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

INTRODUCTION
A ne-tuned interaction of a multitude of transport processes in the kidney is mandatory for the normal regulation of the water and electrolyte homeostasis of an organism. Dysregulation of transport processes in the kidney can lead to severe electrolyte and acid-base disorders and can cause hypo- or hypertension. The Slc4 family of anion exchangers and sodium-bicarbonate transporters is involved in many essential transport processes. Slc4 ion-transporters mediate uptake or secretion of bicarbonate and sodium from cells depending on gradients of transported ions and on the stoichiometry of the transport. In the kidney, the NBC4/NBCe2-related NBCe1 encoded by the Slc4a4 gene has a Na+:HCO2 3 stoichiometry

of 1:3 and mediates the efux of sodium/bicarbonate at the basolateral membrane of proximal tubule cells essential for bicarbonate absorption of the proximal tubule (1). Loss of this related transporter leads to severe proximal renal metabolic acidosis associated with growth and mental retardation as well as ocular and dental defects caused by defective bicarbonate transport in humans or mice (2,3). In other cell types, NBCe1 has a different transport stoichiometry and hence can mediate the net inux of bicarbonate into cells. NBCe2, also referred to as NBC4, is encoded by the Slc4a5 gene. NBCe2 mediates electrogenic transport of sodium and bicarbonate, with 1:3 or 1:2 stoichiometry depending on the cell type (4 6). It has been shown that NBCe2 is located in the apical membranes of cells of the collecting duct (CD) of the

To whom correspondence should be addressed. Tel: + 49 60327051115; Fax: + 49 60327051104; Email: thomas.boettger@mpi-bn.mpg.de Present address: Institut fu r Humangenetik, Im Neuenheimer Feld 366, 69120 Heidelberg, Germany. The authors wish it to be known that, in their opinion, the last two authors should be regarded as joint Senior Authors.

# The Author 2011. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

1026

Human Molecular Genetics, 2012, Vol. 21, No. 5

kidney (7). Polymorphisms in the SLC4A5 gene locus are genetically linked to hypertension, although no clear correlation between specic mutations and hypertension was found (8,9). Yet, expression and functional properties of NBCe2 in the CD are compatible with a function in bicarbonate and sodium uptake from the lumen of the CD, which clearly has an impact on the control of blood pressure (BP). Here, we show that NBCe2 regulates the bicarbonate homeostasis of the animal by mediating net inux of bicarbonate into cells of the CD duct of the kidney. Mutation of NBCe2 in mice leads to arterial hypertension and renal metabolic acidosis associated with hyporeninemic hypoaldosteronism, elevated uid intake and excretion and an increased glomerular ltration rate (GFR). We demonstrate that the urinary loss of bicarbonate and the resulting metabolic acidosis are tightly linked to the observed arterial hypertension. Treatment of metabolic acidosis in NBCe2 mutant mice also eliminates the difference in BP between Slc4a5 mutant animals and wildtype (WT), indicating that the elevated BP is caused by the disturbed bicarbonate reabsorption.

RESULTS
We have generated a mouse model with mutation of Slc4a5 by deletion of the seventh coding exon (Slc4a5 7/7; ENSMUST00000039212; Fig. 1A). This deletion leads to a loss of an N-terminal part of the protein and truncation of the protein due to a frameshift in the open reading frame of the transcript before the putative rst transmembrane domain of the NCBe2 protein (10,11). Our strategy avoided deletion of exons that might be subject to alternative splicing and prevents use of alternative start codons. Analysis of the region from exon 6 to exon 8 in WT animals by reverse transcription polymerase chain reaction (RT PCR) (Fig. 1D) yielded only one single band indicating the absence of alternative splicing events in this region of the transcript. Deletion of exon 7 in mutant animals generated a shortened transcript as revealed by RT PCR as predicted from sequence data (Fig. 1D). Sequencing of the PCR products additionally conrmed the expected molecular changes (Supplementary Material, Fig. S1). Loss of the NBCe2 protein in Slc4a5 mutant mice was conrmed using a quantitative mass-spectroscopy-based proteomic approach (SILAC-MS) (12,13). Protein extracts of choroid plexus of WT or Slc4a5 7/7 animals were mixed 1:1 with choroid plexus extract of a 13C6-lysine labeled mouse (heavy mouse) as an internal reference. In the WT/

WTheavy protein mix, unlabeled and heavy peptides of NBCe2 were equally detected, whereas in the Slc4a5 7/7/ WTheavy mix, only the reference heavy peptides were detected, indicating the loss of NBCe2 in the mutant animals (Fig. 1E and F; Supplementary Material, Fig. S2A D). The peptide VEEGGERWSK (Supplementary Material, Fig. S2A and B) is located in the N-terminal part of the NBCe2 protein upstream of the deletion site. Both versions of this peptide (unlabeled/heavy) were detected in the WT/WTheavy mix. In the Slc4a5 7/7/WTheavy mix, only the heavy peptide was detected, suggesting that also the N-terminal part of the NBCe2 protein is actually lost in the Slc4a5 7/7 animals. All subsequent experiments were carried out using adult male mice with a mixed 129SV/C57Bl6 background. In all experiments, Slc4a5 7/7 and WT mice were littermates or age-matched animals originating from comparable matings of heterozygous parents. Expression of Slc4a5 was detected by in situ hybridization employing two independent 35S labeled probes (Fig. 2A D, Supplementary Material, Figs S3 and S4) as well as by nonradioactive in situ hybridization combined with antibody staining (Fig. 2E L). Strong Slc4a5 signals were found in the medulla of the kidney, while expression in the cortex was scattered and less intense (Fig. 2A; Supplementary Material, Fig. S3E). Comparative in situ hybridization of Slc4a5 and of markers of other tubule segments or cell types revealed similarities in the expression of Slc4a5 with aquaporin-2 (Fig. 2B), which is expressed in the CDs (14,15). No similarity could be observed with the expression pattern of aquaporin-1 (Fig. 2C) expressed in the proximal tubule and thin descending limb (16,17) or with the tamm horsfall/uromodulin transcript (Fig. 2D) expressed in the thick ascending limb (18). Likewise, non-radioactive in situ hybridization detected Slc4a5 at the cellular level in tubules of the kidney cortex (Fig. 2E G) and the inner medulla (Fig. 2I K) in tubule segments negative for the marker of the proximal tubule aquaporin-1 (Fig. 2E and I), but co-expressed with the CD marker aquaporin-2 (Fig. 2F, H, J, L). These results are in accordance with the detection of NBCe2 in the apical plasma membrane of cells of the CD in the human and rat kidney (7). In addition, we detected Slc4a5 expression in the choroid plexus of the brain (Supplementary Material, Fig. S4A and B, arrow) and in the thyroid (Supplementary Material, Fig. S4A and C, arrowhead). Slc4a5 7/7 mice were characterized by a normal prenatal development, normal weight gain (Supplementary Material,

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

Figure 1. Targeted mutation of the Slc4a5 gene. (A) To mutate the Slc4a5 gene, the seventh coding exon (ENSMUST00000039212) was removed leading to an N-terminal deletion of the protein and to a frameshift resulting in truncation of the protein before the rst transmembrane domain of the ion-transport protein. A single loxP site was inserted in front of the seventh coding exon and a loxP-anked neoR cassette was inserted behind the seventh coding exon of Slc4a5. After homologous recombination in ES cells, we generated mice with a oxed allele of Slc4a5 (Slc4a5 lox). (B) Recombination of the Slc4a5 locus was detected using a southern blot with a 5 probe and BamHI digest. The mutant allele of Slc4a5 (Slc4a5 7) was recovered after Cre-recombination. (C) Southern blot analysis employing a 5 probe and a BlpI digest was used to identify the mutant allele. (D) Reverse transcription polymerase chain reaction (RT PCR) amplies the Slc4a5 transcript from the sixth to eighth coding exon; in the Slc4a5 7/7 animals, only the predicted smaller transcript without coding exon 7 is amplied. (E H) Quantitative mass-spectroscopy demonstrates the absence of the NBCe2 protein in Slc4a5 7/7 animals. Choroid plexus protein extracts of WT and Slc4a5 7/7 animals were mixed with choroid plexus protein extracts of a 13C6-lysin labeled mouse (heavy mouse) as a reference. Introduction of a 13 C6-lysine in a peptide induced a 6 Da shift in the molecular mass of the peptide and two 13C6-lysines lead to a 12 Da shift. In the WT/WTheavy mix, (E) the respective unlabeled ( ) and labeled heavy (#) SLC4A5-specic peptides were equally detected. In the Slc4a5 7/7/WTheavy mix, (F) the heavy peptide (#) was detected, whereas the unlabeled peptide ( ) was not detected for the Slc4a5 7/7 animal. For further reference, respective peptide pairs belonging to aquaporin-1 protein with unchanged abundance are shown (WT/WTheavy: G; Slc4a5 7/7/WTheavy: H).

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

Human Molecular Genetics, 2012, Vol. 21, No. 5

1027

1028

Human Molecular Genetics, 2012, Vol. 21, No. 5

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

Figure 2. Slc4a5 is expressed in the inner medulla and the outer cortex of the kidney. Slc4a5 expression (A) is detected by in situ hybridization using 35S-labeled probes (A D) and Affymetrix QuantiGene ViewRNA technology combined with antibody staining (E L). In the kidney, Slc4a5 expression is predominantly detected in the inner medulla and the outer cortex (A). This expression resembles strongly the expression of aquaporin-2 (B; a marker of the CD), but is different from the expression of aquaporin-1 (C; marker of proximal tubule and thin descending limb) and uromodulin (D; marker of thick ascending limb). The QuantiGene probe set also detects Slc4a5 RNA (red) in the kidney cortex (E G) and the inner medulla (IK) in tubule segments that are negative for aquaporin-1 (E, I, green) expression. However, expression of Slc4a5 RNA (F, G, J, K, red) is detected in tubule segments that are characterized by expression of aquaporin-2 (F, H, J, L, green). Nuclei are stained in blue. The scale bar in (A) corresponds to 3300 mm in (A D) and to 52 mm in (E L).

Fig. S5), adult weight (Slc4a5 7/7: 26.5 + 0.7, WT: 25.4 + 0.6 g, n 21/23, P 0.129, 10 weeks old) and food consumption (Slc4a5 7/7: 4.4 + 0.2, WT: 4.3 + 0.2 g/day, n 21/23, P 0.359), suggesting the lack of a major dysfunction of the thyroid in Slc4a5 7/7 mice. Further examination of the thyroid morphology in 7-month-old animals (Supplementary

Material, Fig. S6A and B) and normal T4 serum level (Slc4a5 7/7: 4.2 + 0.2, WT: 3.9 + 0.2 mg/dl, n 23/20, P 0.176, Supplementary Material, Fig. S6C) ruled out that the mutation of NBCe2 had a major effect on thyroid function. To analyze a potential physiological role of NCBe2 in the choroid plexus, we compared the ventricular volumes of

Human Molecular Genetics, 2012, Vol. 21, No. 5

1029

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

Figure 3. Metabolic acidosis and increased BP in Slc4a5 mutant mice. Slc4a5 7/7 (lled bars) compared with WT mice (open bars) excrete more urine (A) and suffer from renal metabolic acidosis as indicated by decreased total CO2 (B; TCO2) and bicarbonate (B; HCO2 3 ), a negative base excess of the extracellular uid (C, BEecf) in blood and increased urinary bicarbonate loss (D). (E) Increased BP of Slc4a5 7/7 mice. BP was measured telemetrically during day and night in 7/7 , lled bars) and WT mice (open bars); the upper end of the bars indicates the mean systolic, and the lower end of the bars indicates the mean mutant (Slc4a5 diastolic BP with the respective SEM. Systolic and diastolic BP were signicantly increased at day- and at nighttime in Slc4a5 mutant animals. Plasma atrial natriuretic peptide (ANP) concentration was increased in Slc4a5 7/7 animals (F), whereas plasma renin activity (G) and the plasma aldosterone concentration were signicantly lower in Slc4a5 7/7 mice (H). The GFR is increased in Slc4a5 7/7 animals and we observe reduced plasma creatinine levels (I). Induction of metabolic alkalosis by feeding of bicarbonate-enriched water increases BP in WT mice only and abolishes BP differences between Slc4a5 7/7 animals compared with WT animals (J).

adult Slc4a5 7/7 and WT brains by magnetic resonance imaging (MRI). No difference in the volume of the ventricles was found (Supplementary Material, Table S7), indicating that NBCe2 does not have a major function in uid secretion of the choroid plexus. These data are in contrast to the reduced brain ventricle volume in a recent description of a gene-trap mutant of Slc4a5 and may be due to differences in the gene targeting strategies, with the gene-trap insertion resulting in a potentially dominant negative SLC4A5 protein of 69 kDa still containing several of the predicted transmembrane domains (19).

Given the potential role of SLC4A5 in human hypertension, we next examined a potential function of Slc4a5 in the kidney. Close scrutiny of the renal physiology using metabolic cages revealed an increased urinary volume in Slc4a5 7/7 mice compared with WT animals (Slc4a5 7/7: 0.068 + 0.005, WT: 0.054 + 0.004 ml/day g BW, n 27/29, P 0.0146; Fig. 3A). Also the absolute amount of daily urine excretion per animal was signicantly increased (Slc4a5 7/7: 1.8 + 0.13, WT: 1.4 + 0.1 ml/day, n 29/27, P 0.006). Accordingly, mutant mice compared with WT mice consume more water as determined by daily weighting of

1030

Human Molecular Genetics, 2012, Vol. 21, No. 5

drinking water bottles in the home cages (Slc4a5 7/7: 0.240 + 0.015, WT: 0.198 + 0.012 ml/day g BW, n 11/10, P 0.021). The osmolarity and pH of the urine was not signicantly changed in Slc4a5 7/7 vs. WT animals (osmolarity: Slc4a5 7/7: 2460 + 131.9, WT: 2522 + 147.5 mosm, n 9/9, P 0.38; pH: Slc4a5 7/7: 7.1 + 0.1, WT: 7.0 + 0.1, n 27/29, P 0.14). Analysis of the ionic composition of the urine revealed no signicant changes in the concentration of sodium, potassium, calcium, magnesium, chloride and inorganic phosphate of the Slc4a5 7/7 mice (n 9 Slc4a5 7/7/9 WT animals), although the concentration of excreted protein was increased (Slc4a5 7/7: 660.3 + 45.7, WT: 504.2 + 41.6 mg/dl, n 9/9, P 0.0112). Due to the increased urinary volume, we also calculated the daily secretion of electrolytes. This calculation revealed a slightly increased daily electrolyte excretion in Slc4a5 mutant mice compared with the WT (Supplementary Material, Table S8). Analysis of blood composition revealed no signicant change in pH (Slc4a5 7/7: 7.32 + 0.01, WT: 7.33 + 0.01 mM, n 16/15, P 0.2); however, we observe decreased bicarbonate concentration (Slc4a5 7/7: 17.1 + 0.6, WT: 18.9 + 0.8 mM, n 16/15, P 0.03; Fig. 3B), decreased total amount of carbon dioxide (TCO2; Slc4a5 7/7: 18.1 + 0.6, WT: 20.1 + 0.8 mM, n 16/15, P 0.027; Fig. 3B) and a reduced base excess of the extracellular uid (BEecf; Slc4a5 7/7: 2 9.0 + 0.8, WT: 2 6.9 + 0.9 mM, n 16/15, P 0.041; Fig. 3C). In addition, we observed increased urinary bicarbonate excretion in Slc4a5 7/7 vs. WT mice 7/7 (HCO2 : 3.14 + 0.35, WT: 2.1 + 0.24 mEq 3 ; Slc4a5 2 HCO3 /day kg BW, n 6/6, P 0.016; Fig. 3D). Taken together, these data indicate that mutation of Slc4a5 results in a compensated renal metabolic acidosis. Since the SLC4A5 genomic locus has been linked to BP levels and hypertension status in humans, we analyzed the arterial BP of Slc4a5 7/7 mice compared with WT mice by telemetric measurements. We noticed an increased diastolic (Slc4a5 7/7: 92.3 + 2.6, WT: 84.0 + 2.0 mmHg, n 10/12, P 0.009; Fig. 3E) and systolic (Slc4a5 7/7: 117.7 + 3.1, WT: 107.9 + 1.7 mmHg, n 10/12, P 0.004; Fig. 3E) BP at day and increased diastolic (Slc4a5 7/7: 99.4 + 2.2, WT: 92.9 + 2.6 mmHg, n 10/12, P 0.039; Fig. 3E) and systolic (Slc4a5 7/7: 125.4 + 2.8, WT: 117.7 + 2.4 mmHg, n 10/12, P 0.024; Fig. 3E) BP at night. To get more insights into the molecular changes associated with renal metabolic acidosis and hypertension after mutation of SLC4A5 function, we studied changes in the transcriptional prole of kidneys (Table 1, from n 5 Slc4a5 7/7/5 WT animals). The activity of several genes involved in the regulation of acid-base balance in the kidney was changed along with a dysregulation of genes implicated in the regulation of BP and kidney perfusion (Table 1, Arrayexpress: Accession#E-MEXP-2692). More specically, we observed upregulation of the anion exchanger 1 (AE1, Slc4a1), a key protein of bicarbonate reabsorption of the CD. This result was conrmed by western blot analysis, which corroborated a clear upregulation of AE1 in kidneys of mutant mice (AE1 signal; Slc4a5 7/7: 169.3 + 27.3, WT: 100.7 + 8.7, n 10/ 10, P 0.014, Fig. 4A). In addition, we observed several

Table 1. Analysis of the molecular changes caused by mutation of Slc4a5 Probe set id 1423257_at 1450391_a_at 1455431_at 1449553_at 1434502_x_at 1437605_at 1416560_at 1435043_at 1459982_a_at 1419725_at 1416637_at 1455876_at 1416193_at 1423166_at 1460256_at FC 20.10 2.51 2.26 1.68 1.66 1.60 1.47 1.42 1.41 1.40 1.28 1.23 0.75 0.69 0.62 P-value 0.0185 0.0001 0.0311 0.0164 0.0102 0.0120 0.0131 0.0078 0.0090 0.0149 0.0429 0.0107 0.0073 0.0055 0.0341 Gene Cyp4a14 Mgll Slc5a1 Nkain1 Slc4a1 Nphs2 Slc13a3 Plcb1 Aqp6 Slc26a4 Slc4a2 Slc4a7 Car1 Cd36 Car3 Gene title Cytochrome P450, family 4, subfamily a, polypeptide 14 Monoglyceride lipase Sodium/glucose cotransporter, member 1 Na+/K+ transporting ATPase interacting 1 Anion exchanger 1 Podocin Sodium-dependent dicarboxylate transporter, member 3 Phospholipase C, beta 1 Aquaporin 6 Pendrin Anion exchanger, member 2 Sodium-bicarbonate cotransporter, member 7 Carbonic anhydrase 1 CD36 antigen Carbonic anhydrase 3

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

Kidneys were isolated from ve Slc4a5 7/7 and ve WT animals; RNA abundance was analyzed using Affymetrix GeneChips 430 2.0. The robust multi-array average (RMA) procedure was used for the primary analysis of the microarray data, and an unpaired t-test was performed for the analysis of statistical signicance. Linear correlation of the two groups (Slc4a5 7/7 and WT) was R 2 0.9907. Transcriptional regulation of selected transcripts is shown in the table.

signicant changes in the expression of other transporters known to be involved in the regulation of acid-base balance, such as the sodium dicarboxylate transporter SLC13A3, the sodium/bicarbonate transporter SLC4A7 and pendrin/ SLC26A4 (conrmed by qRT PCR see Fig. 4B; Supplementary Material, Table S9). Downregulation of the carbonic anhydrases 1 and 3 indicated activation of regulatory events affecting acid-base balance. Furthermore, we found an upregulation of Cyp4a14 (20,21) and downregulation of CD36 (22), which both had been associated with the regulation of BP. However, it is possible that downregulation of CD36 is part of the response of the tubular epithelium to renal injury induced by the mutation of SLC4A5 (23,24). Similarly, upregulation of podocin (Nphs2) might represent a secondary event linked to the proteinuria of Slc4a5 mutants (25). Mgll (monoglyceride lipase) has been described to release arachidonic acid (26), suggesting that the upregulation of Mgll feeds into the arachidonic acid CYP4 20-HETE system, which regulates sodium excretion and vasoconstriction (21). It seems likely that the two major phenotypes, renal metabolic acidosis and arterial hypertension, which we observed in Slc4a5 7/7 mice, were caused by a common molecular mechanism. We reasoned that the loss of bicarbonate reabsorption by NBCe2 that is coupled to low sodium uptake due to the electrogenic nature of the NBCe2 transport led to compensatory bicarbonate reabsorption via other mechanisms requiring increased sodium uptake per reabsorbed bicarbonate molecule. Such a mode of compensation will result in increased sodium uptake and hence to increased extracellular volume and hypertension. To further determine

Human Molecular Genetics, 2012, Vol. 21, No. 5

1031

Figure 4. Expression of molecular markers of kidney function after mutation of Slc4a5. Expression of anion exchanger 1 (AE1) protein is increased Slc4a5 7/7 animals (A). qRTPCR experiments corroborate signicant upregulation of pendrin, Slc4a7 as well as Cyp4a14 and Mgll (B). The qRT PCR experiments conrm the results of the Affymetrix GeneChip analysis; please note results of additional qRT PCRs experiments in the Supplementary Material, Table S9.

the relation between hypertension and metabolic acidosis, we induced metabolic alkalosis in Slc4a5 mutant mice thereby compensating for the acidosis-related changes. Two hundred eighty millimolar sodium bicarbonate was added to the drinking water of Slc4a5 7/7 and WT animals (27) resulting in an increase in the urinary pH in both WT and mutant mice (urinary pH; Slc4a5 7/7: 8.7 + 0.1, WT: 8.9 + 0.1; n 6/ 6, ns). Interestingly, induction of metabolic alkalosis leads to increased BP in WT mice and abolished the difference in the BP of Slc4a5 mutant compared with WT mice (diastolic BP at day: Slc4a5 7/7: 92.6 + 3.3, WT: 94.3 + 3.9 mmHg, n 8/8, P 0.373; systolic BP at day: Slc4a5 7/7: 116.5 + 4.4, WT: 119.5 + 5.2 mmHg, n 8/8, P 0.338; diastolic BP at night: Slc4a5 7/7: 103.2 + 3.6, WT: 106.8 + 5.6 mmHg, n 8/8, P 0.300; systolic BP at night: Slc4a5 7/7: 128.8 + 4.5, WT: 133.0 + 6.7 mmHg, n 8/8, P 0.303; Fig. 3J). However, experimental induction of acidosis by addition of 280 mM ammoniumchloride to the drinking water did not affect the hypertension induced by mutation of NBCe2 (diastolic BP at day: Slc4a5 7/7: 96.6 + 4.2, WT: 89.5 + 2.2 mmHg, n 4/5, P 0.077; systolic BP at day: Slc4a5 7/7: 123.1 + 2.5, WT: 110.9 + 2.7 mmHg, n 4/5, P 0.0072; diastolic BP at night: Slc4a5 7/7: 104.5 + 3.0, WT: 97.8 + 3.2 mmHg, n 4/5, P 0.09; systolic BP at night: Slc4a5 7/7: 131.9 + 0.8, WT: 121.0 + 4.5 mmHg, n 4/5, P 0.036). To determine whether the observed hypertension in Slc4a5 7/7 mice is due to volume retention due to increased sodium reabsorption, we determined the levels of atrial natriuretic peptide (ANP) in blood plasma. Indeed, ANP levels were increased in Slc4a5 mutant mice (Slc4a5 7/7: 10.5 + 1.6, WT: 5.3 + 0.5 ng/ml, n 9/10, P 0.002, Fig. 3F). If the increased sodium retention in the kidney of Slc4a5 mutant mice is actually driven by an aldosterone-independent mechanism, plasma renin activity and systemic aldosterone levels should be reduced as a compensatory response. To test this conjecture, we determined plasma renin activity as well as serum aldosterone concentration of WT and mutant mice. The results indicate the presence of hyporeninemic hypoaldosteronism in Slc4a5 mutant mice [renin Slc4a5 7/7: 63.1 + 9.5, WT: 93.5 + 9.1 ng Ang I (ml/h), n 5/7, P 0.047; aldosterone Slc4a5 7/7: 473.5 + 84.9, WT: 669.8 + 60.2 pg/ml, n 11/9, P 0.044; Fig. 3G and H].

Urine volume as well as ANP concentration in blood plasma was increased in Slc4a5 mutant mice (Fig. 3A and F). Determination of the clearance of single bolus-injected uorescein isothiocyanate (FITC)-inulin reveals an increased GFR in Slc4a5 mutant mice (Slc4a5 7/7: 35.9 + 8.0 WT: 10.9 + 2.2 ml/min g BW, n 8/7, P 0.0046; Fig. 3I). Increased GFR should lead to reduced plasma creatinine concentration. Indeed, plasma creatinine concentration was reduced (Slc4a5 7/7: 0.146 + 0.02, WT: 0.233 + 0.03 mg/dl, n 7/ 8, P 0.019, Fig. 3I). In contrast, plasma concentrations of sodium, potassium and chloride were not signicantly different between WT and mutant mice (Supplementary Material, Table S10).

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

DISCUSSION
Perturbations in the systems that maintain homeostasis of uids and ions often result in BP dysregulation and hypertension. In some cases, increased salt reabsorption by the kidney is caused directly by mutations in proteins involved in salt handling (28). However, in many other cases, increased sodium retention results from the interplay of several molecules with minor malfunctions, which by themselves may generate only subtle changes. Such a scenario makes it difcult to establish multi-factorial traits, which rely on the combination of several genetic variations. Clearly, a dened mutation of a particular gene helps sometimes uncover the function of an individual molecule within a complex regulatory network. Several genome-wide linkage analyses have been conducted to localize genes affecting BP regulation. Among others, regions of the human chromosome 2 have been identied to contain genes associated with increased BP (29 and references therein). One of the candidate genes at chromosome 2 that might contribute to hypertension is SLC4A5 based on a study of the Family Blood Pressure Program (FBPP) in African Americans (9). This work has been conrmed in a second study using pedigrees of large mormone families (8). However, no clear correlation of SLC4A5 mutations to hypertension was established (30). Here, we have employed a mouse model mutant for Slc4a5 to demonstrate that SLC4A5/NBCe2 is involved in the regulation of body uid homoeostasis and prevents hypertension. In previous studies, it has been shown that SLC4A5 is an electrogenic sodiumbicarbonate transporter (4,5), which mediates sodium-bicarbonate

1032

Human Molecular Genetics, 2012, Vol. 21, No. 5

reabsorption in the cells of the CD of the kidney (7). We found that Slc4a5 7/7 mice are indeed hypertensive, thus demonstrating a mechanistic basis for the observations from linkage analysis. In addition to the elevated BP, Slc4a5 7/7 mice displayed a compensated metabolic acidosis which is most likely caused by the renal bicarbonate loss. Interestingly, we could eliminate the BP difference via overcompensation of the metabolic acidosis using bicarbonate-enriched drinking water in Slc4a5 7/7 and WT mice, which indicates a causal relation between the hypertension and the metabolic acidosis in Slc4a5 mutant mice. Apparently, the loss of sodium-sparing bicarbonate reabsorption by SLC4A5, which has a stoichiometry of 1:2 or 1:3 for sodium:bicarbonate transport, initiates a regulatory cascade consisting of compensatory bicarbonate reabsorption via other sodium-bicarbonate transporters at the expense of an increased sodium uptake which ultimately leads to an increased sodium uptake in the kidney tubules. At the molecular level, we observed an increased abundance of the Slc4a7 transcripts, suggesting that this electroneutral sodiumbicarbonate transporter partially compensates for SLC4A5 function. Since SLC4A7 shows a stoichiometry of 1:1 for the sodium:bicarbonate transport, increased activity of SLC4A7 will lead to an increased sodium uptake. A chronically increased sodium uptake also requires increased chloride reabsorption, which may explain the upregulation of Slc26a4/ pendrin. The presence of reduced renin activity and of hypoaldosteronism in Slc4a5 mutant mice indicates that the renin angiotensin aldosterone system is downregulated as a compensatory response to the increased BP and sodium reabsorption. Increased sodium reabsorption, hypervolemia and increased BP result in increased plasma ANP concentration, resulting in greatly elevated GFR in the Slc4a5 mutant mice. The latter, in combination with the arterial hypertension, would also explain the mild proteinuria as a consequence of glomerular hypertension. In summary, we have shown that SLC4A5 is involved in the regulation of the acid-base balance as well as in the regulation of BP. Both functions of SLC4A5 appear to be tightly linked. Accordingly, a major physiological function of SLC4A5 might be to ensure bicarbonate reabsorption associated with a minimum of concurrent sodium reabsorption. Consequently, mutation of SLC4A5 causes renal metabolic acidosis, arterial hypertension and compensatory hyporeninemic hypoaldosteronism. The greatly increased GFR may be the result of hypervolemia and increased ANP concentration, resulting in mild proteinuria and increased uid intake and excretion. The identication of SLC4A5 as a critical component of the regulatory machinery, which maintains ion homeostasis and BP, allows a new assessment of the role of this gene in multi-factorial traits leading to hypertension.

Depending on the translational start site used, the seventh coding or alternatively the ninth coding exon of Slc4a5 (exon-acc#ENSMUSE00000615286) and its anking sequences was amplied from 129SV genomic DNA using primers (GCACAGAACCTGAGCTAATTTCCAG,CCTGAGTTCCCTGGT GCACAGCAG) and was inserted into the SmaI site of the two loxP sites containing pBS246 vector (Invitrogen) containing a neomycin resistance cassette in the EcoRV site between the loxP sites. A third loxP site was inserted into a KpnI site of pBS246 between the exon-containing genomic DNA and the neomycin resistance cassette using oligonuleotides (GGGATAACTTCGTATAATGTATGCTATACGAAGTTATAAGCT TGTAC, AAGCTTATAACTTCGTATAGCATACATTATAC GAAGTTATCCCGATC). The 3 sequence of the targeting vector was a 3.1 kb fragment reaching from CTCTAATTTAGAAGCACTATCCAG to GATATCACACAGGGACAAGG CCATG. MPI II mouse embryonic stem cells (31) were electroporated with the NotI-linearized vector, recombinant clones were isolated and mouse lines were established from two independent ES-cell clones. The seventh exon and the neomycinR cassette were removed from the genome by breeding the mice to the Meu-Cre 40 mouse line (32). Loss of the seventh exon of Slc4a5 leads to a frameshift mutation of SLC4A5 and truncation of the NBCe2 protein before the rst transmembrane domain. ES cells were analyzed for homologous recombination using a southern blot with BamHI and a 5 probe amplied by PCR (GGTTCTGTATCTGTCTCCAGGTATG, CCAACAGCTAGCAAAAGAGCATCC; WT: 11.25 kb, recombined: 7.8 kb). After Cre-recombination, a southern blot using BlpI and the 5 probe was used to identify the mutant allele of Slc4a5 (Slc4a5 7/7) and to genotype the mice (WT: 7.2 kb, Slc4a5 7/7: 6.7 kb; Fig. 1A and C). The frameshift mutation of the Slc4a5 mRNA was conrmed by RTPCR (CCAACGT GCTCGTGGGCGAGGTGGA, CCTCTTGTCAGCTGAGGG AACTTTC; Fig. 1C). The resulting animals were backcrossed to C57Bl6 for at least two generations. Litter mates originating from heterozygous breedings or age-matched animals originating from comparable heterozygous breedings were used for all experiments. Two- to 6-month-old male animals were used for all experiments. All animal work was approved by the animal experiment committee of the federal state of Hessen, Germany. Mass-spectroscopy-based proteomics Choroid plexus was isolated from WT and Slc4a5 7/7 animals as well as from an animal that was labeled with a 13 C6-lysine-substituted version of lysine (SILAC mouse, heavy mouse) as an internal reference. Protein extracts were prepared in buffer containing 4% sodium dodecyl sulfate (SDS), 100 mM Tris/HCl, pH 7.6, 0.1 M DTT. Protein extracts of WT or Slc4a5 7/7 mice were mixed 1:1 with the protein extract of the labeled animal. The quantitative mass spectrometry has been described earlier (13). In brief, after sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) and coomassie staining gel, bands were excised and subjected to LysC digestion as described and concentrated and desalted using STAGE tips (33). Samples were measured by nano-LC-MS/MS using a nanoow high-performance liquid chromatography system (Proxeon) coupled online to a nanoelectrospray ion source (Proxeon) and

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

MATERIALS AND METHODS

Targeting construct and mutant mice Genomic DNA originating from 129 mice and the vector pKO V901 containing a DTA selection cassette in the RsrII site were used to construct the Slc4a5 targeting vector. The 5 arm was a 3.9 kb EcoRV AvaI fragment of the Slc4a5 locus.

Human Molecular Genetics, 2012, Vol. 21, No. 5

1033

LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientic). Peptides were separated on a 20 cm C18-reversed phase column (75 mm diameter) packed in house with Reprosil (ReproSil-Pur C18-AQ 3 mm, Dr Maisch). We used 150 min gradient from 4 to 60% acetonitrile in 0.5% acetic acid at a ow of 250 nl/min. The LTQ-Orbitrap Velos was operated in the data-dependent mode to automatically measure MS and MS/MS spectra. The following parameters were used: full scan (mass range m/z 300 2000) was recorded in the Orbitrap analyzer with a resolution R 60 000 followed by the sequential isolation and fragmentation of the 15 most intense ions from each scan (34). RAW (raw data le, contains minimally processed data) spectra were analyzed with the MaxQuant Software package (Version 1.2.0.18) based on the Andromeda search algorithm (35,36). The International Protein Index (IPI) database (Version 3.64 mouse) was used for peptide identication. False discovery rates ( , 1%) were controlled by searching in a concatenated database consisting of the reverse versions of the original protein sequences. In situ hybridization For radioactive in situ hybridization, probes were amplied and cloned into the pGEM-T vector (Promega). The templates for probe transcription were: Slc4a5 (409 bp; GCAGATAGAGGATGGACTTCTGCGA, GGCAGACTGGACAAGACGAACAAAT; second probe: 333 bp: GGGGGATGCCAC AGACAACTAC, TTGATGGCGTCGTAGATGAAGAT), aquaporin-1 (810 bp; ATGGCCAGTGAAATCAAGAAGAA GC, CTATTTGGGCTTCATCTCCACCCTG), aquaporin-2 (663 bp; ATGTGGGAACTCCGGTCCATAGCGT, GGTAG TTGTAGAGGAGGGAACCGAT), Slc4a1 (960 bp; TGACG CTACGAAAGTTCAAGAACAG, CGTCATATTCATCCAG GCCATTCTC), uromodulin (980 bp; AGTGTAAACAGGAC TCCAACATCA, TCATTGAACCATGAAGATCAAAGTG). Two hundred fty nanograms of puried DNA template was in vitro transcribed to generate 35S UTP labeled probes using MAXIscript T7/Sp6- Kits (Ambion) according to the manufacturers instructions. Ten microliters of 1 M DTT, 10 ml of 3 M NaoAC, 5 ml of tRNA (10 mg/ml) and 45 ml of H2O were added after the labeling reaction, and the probe was puried using G50 Quick Spin Columns (Roche). RNA probes were precipitated, resolved in 50 ml 100 mM DTT and 50 ml formamide was added. Twelve micrometer cryosections were thawed at room temperature (RT) for 2 min and xed with 4% PFA/PBS for 10 min. Sections were washed with phosphate-buffered saline (PBS) and treated for 10 min with acetylation buffer [0.1 M triethanolamine (Sigma), 0.9% NaCl, 2.5 ml/l acetic anhydrate], washed with PBS and dehydrated via ascending ethanol series. Sections were air-dried and treated with pre-hybridization solution at RT for 2 h [50% formamide, 0.75 M NaCl, 25 mM PIPES, 25 mM EDTA (pH 6.8), 0.1% coll, 0.1% polyvinylpyrrolidon, 0.1% BSA, 0.2% SDS, 10 mM DTT, 0.25 mg/ml salmon sperm-DNA, 0.25 mg/ml yeast tRNA). 1 106 cpm of probe was diluted in 130 ml of hybridization buffer [50% formamide, 0.75 M NaCl, 25 mM piperazine-N,N-bis(2-ethanesulfonic acid) [PIPES], 25 mM ethylenediaminetetraacetic acid (EDTA) (pH 6.8), 0.1% coll, 0.1% polyvinylpyrrolidon, 0.1% bovine serum albumin (BSA), 0.2% SDS, 20 mM DTT,

0.25 mg/ml salmon sperm-DNA, 0.25 mg/ml yeast tRNA and 10% dextrane sulfate]. Sections were covered with the diluted probe, cover slips were applied and slides were incubated in a humid chamber at 558C overnight. After incubation slides were washed with once for 20 min in 4 SSC at RT, thrice for 15 min in 4 SSC containing 0.4 M DTT and incubated in RNAse A buffer (0.5 M NaCl, 10 mM Tris, pH 7.5, 1 mM EDTA, pH 8, 500 ml Rnase A 0.02 mg/ml) for 30 min at 378C. Thereafter, slides were rinsed with 2 SSC containing 0.4 M DTT for 15 min, and then with 1 SSC for 15 min. Slides were dehydrated using an ascending ethanol series, airdried and covered with an X-ray lm (KODAK BioMax MR Film) for 3 to 14 days. Non-radioactive in situ hybridization was performed using the QuantiGene ViewRNA FFPE Assay (Affymetrix/ Panomics) according to the manufacturers instructions. A probe set was designed by Affymetrix corresponding to the bases 509 1553 of ENSMUST00000113900. In brief, freshly dissected tissue was xed in 10% neutral-buffered formaline for 24 h at RT. Tissues were embedded into parafn using an alcohol series. Five micrometer sections were mounted onto Histobondw slides. Slides were processed strictly following the QuantiGene protocol. Pre-hybridization conditions were found to be optimal with 10 min of boiling in pre-treatment solution and 20 min of Protease QF digestion. After hybridization, washing, pre-amplier hybridization, amplier hybridization and alkaline phosphatase reaction, sections were washed thrice for 5 min in PBS, blocked for 1 h and incubated with an anti-aquaporin-1 antibody (Alpha Diagnostics#AQP11-A, 1:100) or an anti-aquaporin-2 antibody [(37); 1:100] in blocking buffer containing 2% BSA and 0.5% NP-40 in PBS. After overnight incubation, at 48C, sections were washed 3 5 min in PBS and an anti-rabbit-Cy2 antibody (Dianova#711-225-152) was applied 1:100 in blocking solution 2 h at RT. Slides were washed in PBS containing DAPI 1:1000 and embedded in Fluromount (Fluka). Images were acquired using a Zeiss Z1 Imager. Histology Tissue samples were perfused and xed with 4% paraformaldehyde, dehydrated and embedded in parafn. Sections were stained with hematoxylin and eosin and examined for histological changes by light microscopy. Metabolic cages, blood gas and electrolyte analysis Mice were kept in metabolic cages (Techniplast). Urine and feces were collected over 24 h periods after initial customization of the cage. Urine electrolyte composition and osmolarity was determined by IDEXX (Ludwigsburg, Germany). Blood was collected from unrestrained mice by decapitation. Blood composition was determined using the i-STATw System with EG6 + Cartridges (Abott). Plasma electrolytes were determined using Spotchem EL SE-1520 (Axonlab) after retro-orbital blood collection under isourane anesthesia. Urinary bicarbonate was determined using a titration method (38). Urine samples were collected for 24 h and volume was determined. For titration of bicarbonate, the pH of urine was determined at 378C and 1 ml of 0.1 N HCl was added to

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

1034

Human Molecular Genetics, 2012, Vol. 21, No. 5

1 ml of sample. Samples were heated for 10 min in a 1008C water bath; thereafter, samples were cooled to RT. The volume of 0.1 N NaOH needed to reach the initial pH was determined at 378C. One milliliter of distilled water was measured as a blank. The concentration of bicarbonate was calculated: urinary HCO2 3 [mEql/l] ((volume 0.1 N NaOH sample [ml] volume 0.1 N NaOHblank[ml])/1 ml sample) 0.1 mEq/ml 1000 ml/l. Blood pressure measurement Blood pressure (BP) of mice was determined using DSI TA11PA-C10 implantable telemetric transmitters. The catheter of the transmitter was inserted into the left carotid artery of the mice. Data were recorded every 30 min for 120 s for 7 days. First recordings were done 7 days after implantation of transmitter. Data were sampled with Dataquest A.R.T. 4.0 with a sample rate of 500 Hz and with a lter cut-off of 100 Hz. Data reduction was performed by Dataquest A.R.T. 4.0 by calculating the reduced mean for the sampled signals. Recorded parameters were diastolic, systolic, pulse pressure, activity and heart rate. The mean of these values was calculated for day- and nighttime. These mean values of the individual animals were used for the statistical analysis using the t-test with GraphPad Prism 5.0. To induce metabolic alkalosis, animals were provided with drinking water supplemented with 280 mM bicarbonate (27). Effectiveness of this treatment was ascertained by analysis of urinary pH. To induce metabolic acidosis, animals were provided with drinking water supplemented 2% sucrose and 280 mM ammonium chloride (39,40). Mice were treated at least 2 days before start of BP recording. Analysis of transcriptional changes RNA was isolated from PBS-perfused kidneys using the TRIZOL method (Invitrogen). RNA quality was analyzed with the Agilent 2100 Bioanalyzer using the RNA 6000 Nano Kit (Agilent Technologies). For mRNA expression analysis, the Affymetrix GeneChip Mouse Genome 430 2.0 Array was employed using the one-cycle target labeling protocol (Affymetrix). Data were analyzed by the robust multichip analysis algorithm using the Affymetrix Expression Console. Threshold tests for all arrays were within the bounds according to criteria of the Affymetrix Expression Console. Annotation and statistical analyses were performed with the ArraystarTM 3.0 software (DNASTAR) using log2 transformed data. An unpaired t-test without further correction was used for statistical analysis. Fold change was calculated based on the median of signal intensity of the groups. Linear correlation was R 2 0.9907 between combined WT and mutant mice data sets, indicating high correlation between the two data sets. Minimum information about a microarray experiment (MIAME) criteria were met (41). The microarray data sets of this study are publicly available at ArrayExpress at EMBL-EBI (http://www. ebi.ac.uk/arrayexpress/) with the Acc#E-MEXP-2692. To validate GeneChip results, RT PCR experiments were performed using TaqManw Gene Expression Assays with a StepOnePlus PCR system (Applied Biosystems). RNA was isolated from kidneys of Slc4a5 mutant and WT animals (n 5/5 for

Pendrin, Cyp4a14, Mgll; n 17/15 for Slc4a7, Slc4a8) using the TRIZOL method. One microgram of RNA was reverse transcribed with Superscript II using the oligo(dT) protocol (Invitrogen). cDNA was diluted 1:100 for the TaqManw gene expression assays protocol (Applied Biosystems). All assays were done as duplex reactions with GAPDH (VIC-dye labeled; Applied Biosystems, Assay#4352339E) as an endogenous reference. Assay IDs (FAM-dye labeled) for Pendrin, Slc4a7, Slc4a8, Cyp4a14, Plcb1 and Mgll were Mm00442308_m1, Mm0131 09072_m1, Mm00491397_m1, Mm00484132_m1, Mm00479 987_m1 and Mm00449274_m1, respectively. The [delta] [delta]Ct method was used to calculate relative expression of the analyzed transcripts; all [delta][delta]Ct values were referred to the mean of [delta]Ct WT values. Statistical analysis was performed using the Students t-test with GraphPad Prism 5.0 (GraphPad Software, San Diego, CA, USA).
Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

Western blot Proteins extracted from kidneys of Slc4a5 mutant and WT animals were homogenized in lysis buffer containing 18 mM Tris-Cl, pH 6.8, 4.5 mM EDTA, 125 mM NaCl and complete proteinase inhibitor cocktail (Roche). Cell debris was removed by centrifugation at 1000g for 5 min, and the membrane fraction of the lysate was collected by centrifugation for 30 min at 1 35 000g. The pellet was resuspended in 100 ml of sample buffer containing 45 mM Tris, pH 6.8, 4.5 mM EDTA, 1.8% SDS and complete proteinase inhibitor. Protein concentration was determined using the DC assay kit (Biorad). Ten micrograms of protein lysates were separated on 4 12% SDS PAGE gradient gels and transferred onto nitrocellulose membranes (Invitrogen). Proteins were visualized by Ponceau S (Merck) staining. We used a polyclonal antibody against AE1 from Milllipore (1:100; AB3500P), and the secondary antibody was from Pierce: goat anti-rabbit HRP (1:1000, #1858415). HRP was detected using SuperSignal West Femto detection solutions (Perbio Science). Signals were recorded and analyzed with a Biorad Versadoc System and Quantity One Software and were normalized against the Ponceau S staining of the nitrocellulose membrane. Students t-test was performed using GraphPad Prism 5.0. Glomerular ltration rate For the determination of the GFR, we used the method described by Qi et al. (42). In brief, 5% FITC inulin (Sigma#F3272-1) in 0.9% NaCl solution was dialyzed (1 kDa cut-off) overnight against 0.9% saline and lter sterilized. WT and Slc4a5 mutant mice were injected with 3.74 mg FITC-inulin/g body weight into the tail vein. Twenty-ve microliter blood was collected from the tail vein 3, 7, 10, 15, 30, 55 and 75 min after injection. Blood plasma was prepared using Microvettenw CD300 LH (Sarstedt) at 2000g for 10 min. Ten microliter plasma was mixed with 40 ml of 500 mM HEPES, pH 7.4 and stored at 48C. Fluorescence of the samples was determined using a Mithras LB940 uorescence reader (Berthold Technologies) with excitation at 485 nm and determination of emission at 538 nm. Fluorescence of the injected amount FITC inulin was

Human Molecular Genetics, 2012, Vol. 21, No. 5

1035

determined using an appropriate FITC-inulin/mouse serum reference. For calculation of GFR, we used the onecompartment model as described earlier (42). Log2 values of plasma uorescence were plotted vs. time using GraphPad Prism 5.0 (GraphPad Software) to determine the elimination rate constant (Ke). The volume of distribution (Vd) was determined by the equation Vd total amount of injected uorescence units/plasma uorescence. The GFR was calculated using the equation: GFR Vd Ke (42). Determination of renin, aldosterone, creaninine and ANP concentrations For the determination of renin activity in blood plasma, mice were accustomed to anesthesia handling for 10 days, and 60 ml blood was collected from the retro-orbital sinus into tubes containing 5 ml Na-EDTA (0.5 M). Plasma was stored at 2 208C. Diluted plasma samples were incubated in a total volume of 100 ml containing 22 ml substrate (plasma taken from nephrectomized rats). After samples were incubated either at 37 or 48C for 90 min, release of angiotensin I was determined using a RIA (Byk & DiaSorin Diagnostics). Specic Ang I formation (378C values) was corrected by subtraction of unspecic interference (48C values). Blood serum aldosterone was determined after blood collection by decapitation of unrestrained animals. Serum was isolated by centrifugation (4000g; 5 min) and used for the aldosterone RIA (Diganostic Systems Laboratories, Inc). After retro-orbital blood collection (500 ml) from anesthetized mice into K-EDTA and aprotinin containing tubes, the plasma ANP concentration was determined with an EIA kit (Phoenix Pharmaceuticals, Inc.). Plasma creatinine concentrations were determined by an improved Jaffe method using the Quantichrome Creatinine Assay Kit (BioAssay Systems).

4. 5.

6. 7. 8.

9.

10. 11. 12.

13.

14. 15.

ACKNOWLEDGEMENTS
We thank Sylvia Thomas, Katja Kolditz and Astrid Wietelmann for technical assistance. We thank Dr R. Fenton for supplying the anti-Aqp-2 antibody. Conict of Interest statement. None declared.

16. 17. 18.

FUNDING
The work was supported by the Deutsche Forschungsgemeinschaft with a grant to Thomas Boettger (grant number: BO1970/1); by the Max-Planck-Society and the Excellence Cluster Cardio-Pulmonary System (ECCPS).

19.

20. 21. 22.

REFERENCES
1. Soleimani, M., Grassi, S.M. and Aronson, P.S. (1987) Stoichiometry of Na+-HCO-3 cotransport in basolateral membrane vesicles isolated from rabbit renal cortex. J. Clin. Invest., 79, 12761280. 2. Igarashi, T., Inatomi, J., Sekine, T., Cha, S.H., Kanai, Y., Kunimi, M., Tsukamoto, K., Satoh, H., Shimadzu, M., Tozawa, F. et al. (1999) Mutations in SLC4A4 cause permanent isolated proximal renal tubular acidosis with ocular abnormalities. Nat. Genet., 23, 264 266. 3. Gawenis, L.R., Bradford, E.M., Prasad, V., Lorenz, J.N., Simpson, J.E., Clarke, L.L., Woo, A.L., Grisham, C., Sanford, L.P., Doetschman, T. et al.

23.

(2007) Colonic anion secretory defects and metabolic acidosis in mice lacking the NBC1 Na+/HCO32 cotransporter. J. Biol. Chem., 282, 90429052. Virkki, L.V., Wilson, D.A., Vaughan-Jones, R.D. and Boron, W.F. (2002) Functional characterization of human NBC4 as an electrogenic Na+-HCO cotransporter (NBCe2). Am. J. Physiol. Cell Physiol., 282, C1278 C1289. Sassani, P., Pushkin, A., Gross, E., Gomer, A., Abuladze, N., Dukkipati, R., Carpenito, G. and Kurtz, I. (2002) Functional characterization of NBC4: a new electrogenic sodium-bicarbonate cotransporter. Am. J. Physiol. Cell Physiol., 282, C408C416. Boron, W.F., Chen, L. and Parker, M.D. (2009) Modular structure of sodium-coupled bicarbonate transporters. J. Exp. Biol., 212, 1697 1706. Damkier, H.H., Nielsen, S. and Praetorius, J. (2007) Molecular expression of SLC4-derived Na+-dependent anion transporters in selected human tissues. Am. J. Physiol. Regul. Integr. Comp. Physiol., 293, R2136 R2146. Hunt, S.C., Xin, Y., Wu, L.L., Cawthon, R.M., Coon, H., Hasstedt, S.J. and Hopkins, P.N. (2006) Sodium bicarbonate cotransporter polymorphisms are associated with baseline and 10-year follow-up blood pressures. Hypertension, 47, 532536. Barkley, R.A., Chakravarti, A., Cooper, R.S., Ellison, R.C., Hunt, S.C., Province, M.A., Turner, S.T., Weder, A.B. and Boerwinkle, E. (2004) Positional identication of hypertension susceptibility genes on chromosome 2. Hypertension, 43, 477 482. Zhang, D., Kiyatkin, A., Bolin, J.T. and Low, P.S. (2000) Crystallographic structure and functional interpretation of the cytoplasmic domain of erythrocyte membrane band 3. Blood, 96, 2925 2933. Zhu, Q., Azimov, R., Kao, L., Newman, D., Liu, W., Abuladze, N., Pushkin, A. and Kurtz, I. (2009) NBCe1-A transmembrane segment 1 lines the ion translocation pathway. J. Biol. Chem., 284, 8918 8929. Boettger, T., Beetz, N., Kostin, S., Schneider, J., Kruger, M., Hein, L. and Braun, T. (2009) Acquisition of the contractile phenotype by murine arterial smooth muscle cells depends on the Mir143/145 gene cluster. J. Clin. Invest., 119, 26342647. Kruger, M., Moser, M., Ussar, S., Thievessen, I., Luber, C.A., Forner, F., Schmidt, S., Zanivan, S., Fassler, R. and Mann, M. (2008) SILAC mouse for quantitative proteomics uncovers kindlin-3 as an essential factor for red blood cell function. Cell, 134, 353364. Fushimi, K., Uchida, S., Hara, Y., Hirata, Y., Marumo, F. and Sasaki, S. (1993) Cloning and expression of apical membrane water channel of rat kidney collecting tubule. Nature, 361, 549552. Nielsen, S., DiGiovanni, S.R., Christensen, E.I., Knepper, M.A. and Harris, H.W. (1993) Cellular and subcellular immunolocalization of vasopressin-regulated water channel in rat kidney. Proc. Natl Acad. Sci. USA, 90, 11663 11667. Nielsen, S., Smith, B.L., Christensen, E.I., Knepper, M.A. and Agre, P. (1993) CHIP28 water channels are localized in constitutively water-permeable segments of the nephron. J. Cell Biol., 120, 371 383. Nielsen, S., Frokiaer, J., Marples, D., Kwon, T.H., Agre, P. and Knepper, M.A. (2002) Aquaporins in the kidney: from molecules to medicine. Physiol. Rev., 82, 205244. Sikri, K.L., Foster, C.L., Bloomeld, F.J. and Marshall, R.D. (1979) Localization by immunouorescence and by light- and electron-microscopic immunoperoxidase techniques of Tamm-Horsfall glycoprotein in adult hamster kidney. Biochem. J., 181, 525 532. Kao, L., Kurtz, L.M., Shao, X., Papadopoulos, M.C., Liu, L., Bok, D., Nusinowitz, S., Chen, B., Stella, S.L., Andre, M. et al. (2011) Severe neurologic impairment in mice with targeted disruption of the electrogenic sodium bicarbonate cotransporter NBCe2 (Slc4a5 gene). J. Biol. Chem., 286, 32563 32574. Quigley, R., Chakravarty, S., Zhao, X., Imig, J.D. and Capdevila, J.H. (2009) Increased renal proximal convoluted tubule transport contributes to hypertension in Cyp4a14 knockout mice. Nephron Physiol., 113, p23p28. Fleming, I. (2005) Cytochrome P-450 under pressure: more evidence for a link between 20-hydroxyeicosatetraenoic acid and hypertension. Circulation, 111, 5 7. Pravenec, M., Churchill, P.C., Churchill, M.C., Viklicky, O., Kazdova, L., Aitman, T.J., Petretto, E., Hubner, N., Wallace, C.A., Zimdahl, H. et al. (2008) Identication of renal Cd36 as a determinant of blood pressure and risk for hypertension. Nat. Genet., 40, 952 954. Okamura, D.M., Lopez-Guisa, J.M., Koelsch, K., Collins, S. and Eddy, A.A. (2007) Atherogenic scavenger receptor modulation in the tubulointerstitium in response to chronic renal injury. Am. J. Physiol. Renal Physiol., 293, F575F585.

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014

1036

Human Molecular Genetics, 2012, Vol. 21, No. 5

24. Baines, R.J. and Brunskill, N.J. (2008) The molecular interactions between ltered proteins and proximal tubular cells in proteinuria. Nephron Exp. Nephrol., 110, e67 e71. 25. Hildebrandt, F. and Heeringa, S.F. (2009) Specic podocin mutations determine age of onset of nephrotic syndrome all the way into adult life. Kidney Int., 75, 669 671. 26. Saario, S.M. and Laitinen, J.T. (2007) Monoglyceride lipase as an enzyme hydrolyzing 2-arachidonoylglycerol. Chem. Biodivers., 4, 1903 1913. 27. Wagner, C.A., Finberg, K.E., Stehberger, P.A., Lifton, R.P., Giebisch, G.H., Aronson, P.S. and Geibel, J.P. (2002) Regulation of the expression of the Cl-/anion exchanger pendrin in mouse kidney by acid-base status. Kidney Int., 62, 21092117. 28. Lifton, R.P., Gharavi, A.G. and Geller, D.S. (2001) Molecular mechanisms of human hypertension. Cell, 104, 545 556. 29. Rice, T., Cooper, R.S., Wu, X., Bouchard, C., Rankinen, T., Rao, D.C., Jaquish, C.E., Fabsitz, R.R. and Province, M.A. (2006) Meta-analysis of genome-wide scans for blood pressure in African American and Nigerian samples. The National Heart, Lung, and Blood Institute GeneLink Project. Am. J. Hypertens., 19, 270 274. 30. Stutz, A.M., Teran-Garcia, M., Rao, D.C., Rice, T., Bouchard, C. and Rankinen, T. (2009) Functional identication of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study. Eur. J. Hum. Genet., 17, 1481 1489. 31. Voss, A.K., Thomas, T. and Gruss, P. (1997) Germ line chimeras from female ES cells. Exp. Cell Res., 230, 4549. 32. Leneuve, P., Colnot, S., Hamard, G., Francis, F., Niwa-Kawakita, M., Giovannini, M. and Holzenberger, M. (2003) Cre-mediated germline mosaicism: a new transgenic mouse for the selective removal of residual markers from tri-lox conditional alleles. Nucleic Acids Res., 31, e21. 33. Rappsilber, J., Mann, M. and Ishihama, Y. (2007) Protocol for micro-purication, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat. Protoc., 2, 18961906.

34. Olsen, J.V., Schwartz, J.C., Griep-Raming, J., Nielsen, M.L., Damoc, E., Denisov, E., Lange, O., Remes, P., Taylor, D., Splendore, M. et al. (2009) A dual pressure linear ion trap orbitrap instrument with very high sequencing speed. Mol. Cell. Proteomics, 8, 27592769. 35. Cox, J. and Mann, M. (2008) MaxQuant enables high peptide identication rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantication. Nat. Biotechnol., 26, 13671372. 36. Cox, J., Neuhauser, N., Michalski, A., Scheltema, R.A., Olsen, J.V. and Mann, M. (2011) Andromeda: a peptide search engine integrated into the MaxQuant environment. J. Proteome Res., 10, 1794 1805. 37. Moeller, H.B., Knepper, M.A. and Fenton, R.A. (2009) Serine 269 phosphorylated aquaporin-2 is targeted to the apical membrane of collecting duct principal cells. Kidney Int., 75, 295 303. 38. Lin, S.L. and Chan, J.C. (1973) Urinary bicarbonate: a titrimetric method for determination. Clin. Biochem., 6, 207210. 39. Stehberger, P.A., Schulz, N., Finberg, K.E., Karet, F.E., Giebisch, G., Lifton, R.P., Geibel, J.P. and Wagner, C.A. (2003) Localization and regulation of the ATP6V0A4 (a4) vacuolar H+-ATPase subunit defective in an inherited form of distal renal tubular acidosis. J. Am. Soc. Nephrol., 14, 30273038. 40. Nowik, M., Lecca, M.R., Velic, A., Rehrauer, H., Brandli, A.W. and Wagner, C.A. (2008) Genome-wide gene expression proling reveals renal genes regulated during metabolic acidosis. Physiol. Genomics, 32, 322334. 41. Brazma, A., Hingamp, P., Quackenbush, J., Sherlock, G., Spellman, P., Stoeckert, C., Aach, J., Ansorge, W., Ball, C.A., Causton, H.C. et al. (2001) Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat. Genet., 29, 365 371. 42. Qi, Z., Whitt, I., Mehta, A., Jin, J., Zhao, M., Harris, R.C., Fogo, A.B. and Breyer, M.D. (2004) Serial determination of glomerular ltration rate in conscious mice using FITC-inulin clearance. Am. J. Physiol. Renal Physiol., 286, F590 F596.

Downloaded from http://hmg.oxfordjournals.org/ by guest on January 24, 2014