BIOl2265 Lab - Manual - 2015 16

THE UNVERSITY OF THE WEST INDIES
DEPARTMENT OF LIFE SCIENCES

BIOL2265- FUNDAMENTALS OF MICROBIOLOGY
Laboratory Session No. 1- 2015/16
General Instruction
- Students are to work in groups of four (4) individuals, or as directed by TA;
- Each person must submit reports/worksheets on group data;
- Laboratory assessment: data sheet or Lab report.
Exercise 1. Review of basic techniques
Learning objectives: After completing this exercise, students will be able to use standard techniques
for microbiological analyses and investigations: General aseptic techniques, sterilization procedures
(loop, forceps, media, filtration etc), preparation of media (agar plates & slants, broth), inoculation
techniques (loop, stab, pipetting), plating techniques (pour plate, spread plate, swab transfers,
replica), rinse wash techniques.
The techniques in Table 1 will be reviewed by your demonstrator. No lab report is required, but content
will be covered on quiz.
Table 1. Basic techniques used in a microbiology laboratory
No Technique
Objective/procedure
1
General aseptic
procedures
a) Sanitizing work environment- before and

after use;
Instructions
As explained by
demonstrator
b) Sanitizing hands/gloves;
c) Handling materials/apparatus/utensils in
such a manner to prevent contamination
from hands, clothes, environment etc.
REMEMBER, MICROBES ARE
UBIQUITOUS ON AND IN HUMANS
AND THE ENVIRONMENT;
2
Loop
sterilization-
Hold handle, flame until red hot and allow

about 15 20 seconds to cool
As explained by
demonstrator
Forceps
sterilization
Immerse tip in 95% ethanol and flame to burn

off ethanol.
As explained by
demonstrator
Preparation of
media Agar
plates
a) add constituents (individual ingredients

or commercial preparation) to
appropriate amount of distilled water in
screw capped autoclavable bottle;
As explained by
demonstrator
(solid medium
using agar-agar as
gelling agent; used
b) adjust pH;
BIOL2265- Fundamentals of Microbiology

Academic Year: 2015/16
to culture
microorganism
with can form
colonies from
individual cells)
c) heat to melt agar-agar (heating plate can

be used or place in boiling water);
d) loosen screw cap slightly (to allow for

pressure release while autoclaving) and
sterilize by autoclaving for 15 minutes
or other heat treatment as necessary
(some media cannot be autoclaved due
to heat sensitive components);
e) temper at 44 46oC;
f) pour ~20mL into sterile Petridishes/Petriplates/plates;
lift lid and pour into dish
close lid immediately
allow to cool for about 15 minutes

to gel properly
Agar slants
(Agar medium in
tube with angled
surface for
increased area.
Used for short term
storage of cells and
also for some
biochemical tests)
Liquid or broth
medium
a) Prepare molten agar medium as before,

pour into screw capped tubes;
As explained by
demonstrator
b) Loosely cap tubes, autoclave as before

and after removal and tempering,
tighten caps and allow to gel at an
angle;
a) mix constituents in distilled water;
As explained by
demonstrator
b) dispense into tubes

c) loosely cap and autoclave or apply heat
treatment as necessary;
d) remove from autoclave, temper and
tighten cap.
7
Filter sterilization
Loop inoculation
(for isolating
Heat sensitive components (example

antibiotics and vitamins) if necessary can be
filter sterilized (through 0.45m membrane)
before adding to liquid medium when cooled
or to molten agar medium just before pouring
into plates.
a) Sterilize by flaming;

As explained by
demonstrator
As explained by
demonstrator
2
culturable
microorganisms or
for transferring
inoculum into new
medium)
b) Collect loopful of culture/sample and

carry out quadrant streak on NA plate
as outlined in Figure 1;
c) Label plate and incubate in an

INVERTED position for 48 hours at
room temperature; Check for isolated
colonies as well as pattern of growth;
9
Stab inoculation
of agar tube
(used to determine
characteristics such
as motility and
oxygen
requirements or
physiological
characteristics).
10
Swab transfers
(for semiquantitative
determination of
microbes on
surfaces)
a) Sterilize needle/straight wire, collect

inoculum and stab agar slant or semisolid agar tube a single time, making
sure the needle goes the bottom of the
tube;
As explained by
demonstrator
b) Incubate tube and observe pattern of

growth.
a) Remove sterile moistened swab from

wrapping and thoroughly rub on test
surface (5cm X 5cm area);
As explained by
demonstrator
b) Rub on surface of agar plate;

c) Incubate and observe as before.
11
Rinse wash
technique
(quantifying
microbes on
internal surfaces of
containers)
a)
Transfer 100mL sterile buffer into test

bottle;
b)
Cap and vigorously shake bottle;
c)
Aseptically transfer 0.1mL of rinse

wash onto the surface of agar plate;
d)
Sterilize triangular or L-shaped

spreader with 95% ethanol and
flaming and spread suspension evenly
on surface of plate (this is the spread
plate technique of enumerating
microbes as opposed to the pour plate
method which involves mixing the
suspension with molten agar before
allowing medium to gel on plate);
e)
Incubate as before and count the

number of colonies on plate;

d)
As explained by
demonstrator
Replica plating
(for rapidly
transferring
cells/growth from
one plate onto
other plates as
often required for
screening bacteria
for the ability to
utilize different
substrates)
f)
What was the number of culturable

microbes present on the internal
surface of the bottle?
a)
You are provided with a plate

containing colonies on its surface and
a sterilized replica plating apparatus
(cylindrical shaped piece of wooden
material with velvet cloth tied to one
end);
b)
Code the colonies present on the

plate;
c)
Make a stamp on the plate with the

cloth end of the apparatus;
d)
Imprint cells collected on the cloth

onto surface of a new plate;
e)
Incubate and observe for growth of

cells from coded colonies;
As explained by
demonstrator
Exercise 2: Partial establishment of Kochs Postulates on the disease causing agent for
Xanthomonas leaf spot (Full laboratory report required).
Learning objectives: After completion of this exercise, students will be able to use microbiological
techniques to prove the relationship between a culturable infectious agent and the disease it causes.
Kochs postulates are referred to the four steps in the process required to prove an infectious disease
is caused by a specific microbial agent. If all fours steps are satisfied, it is said that Kochs postulates
have been satisfied.
Constant association between the disease condition and the presence of a specific microbe
must be observed;
The microbe must be isolated and grown in pure culture outside of the original host;
A healthy, susceptible host must be inoculated with the pure culture and disease symptoms
must be observed as those in the original host.
The microbe from the inoculated host must be isolated again and it should be the same as the
original diseased organism.

Figure 1. Illustration of Kochs postulates

Procedure
1. Initial isolation of organism
a. Using a scalpel, cut a few small pieces (~1 cm2) of the advancing
zone of Xanthomonas bacterial spots on infected leaf provided.
b. Surface sterilization: Transfer cut pieces in 10% bleach solution leave

for ~20 sec.
c. Wash off bleach: Using flamed sterilized forceps, sequentially wash
surface sterilized leaf pieces in three tubes of sterile tap water;
d. Isolation of bacteria:
i. Transfer washed leaf pieces in a sterile Petridish from last
wash, together with a few drops of sterile water.
ii. Using a sterilized glass rod, macerate leaf tissue
iii. Using a sterile inoculation loop, collect a loopful of macerated
tissue and streak (Quadrant streak as is illustrated in Figure 2)
onto the surface of a NA plate.
iv. Incubate the plate at room temperature for 24 - 48 hours in the
inverted position. (Please make arrangements with your
demonstrator for at least one member of group to come
and complete this step after incubation time).
v. After incubation, observe plates and note the colony
characteristics of bacterial colonies and/or bacterial mass;

vi. Using a sterile inoculating loop, collect a small amount of

growth from a well isolated YELLOW colony and perform a
Gram stain.
vii. I f the cells are Gram negative, then perform a quadrant streak
of the same colony on a new NA plate.
viii. Incubate plate at room temperature for 24 48 hours at room
temperature;
ix. After incubation of the second plate, use a sterile loop to
transfer growth from a single, well separated colony to the
surface of an agar slant (in a screw capped test tube or normal
test tube with a cotton plug). Note that when streaking on the
slant, the bacterial growth must be spread on as much of the
surface as possible);
x. Incubate slant for 24 48 hours at room temperature;
xi. The slants will now serve as the stock culture for continuing
the exercise;
The following section will be completed on the 2nd lab session
2. Inoculation of Healthy Plant
a. Select two leaves of healthy seedling plant and pre-wounded by slight
abrasion using a fine sand paper.
b. Mark the area using a marker.
c. Transfer a loopful of the slant culture onto 5 ml of sterile water and
shake thoroughly to form suspension.
d. Using a sterile pipette, transfer a drop of the pathogen suspension onto
the wounded area of the leaf.
e. Use the pipette tip to spread the drop on the wounded area.
f. Place seedling in the Greenhouse (cover with plastic for 1st 24 hrs).
g. Observe plant for development of typical leaf spot symptoms every 1
2 days from day 7 to 14 after inoculation.
h. Score symptoms using the following key: 0 no symptom; 1 - mild; 3
moderate; and 4 severe.
i. Controls would be set up by the technician (sterile water control and
Xanthomonas positive control).
Report
Write a full report, describing the methodology, presenting and discussing results. See details on lab
report requirements on Laboratory page.
Question: How can Kochs postulates be proven for non-culturable pathogens or in cases relating to
human and animal health?


Exercise 3: Grams Staining of Bacterial Cells

Learning objectives: After completing this exercise, students will be able to carry out the Grams
staining procedure for bacterial cells.
1. Each group is required to carry out Grams staining procedure on the bacterial isolates
provided;
2. Describe the observations in the worksheet and give a background on the organism,
specifically their general morphological and physiological characteristics, natural habitat and
importance to humans.
Procedure
a. Prepare smear for each organism as in Figure 3 below;
b. Apply a few drops of Crystal Violet to cover smear for 20 seconds;
c. Wash with tap water as in A (for about 2 3 seconds);
d. Apply a few drops of Grams Iodine solution and leave for 1 minute;
e. Wash gently with alcohol (95% ethanol) until solvent flows colourlessly;
f. Wash with tap water as in A (for about 2 3 seconds);
g. Apply a few drops of Safranin and leave for 20 seconds;
h. Wash with tap water as in A (for about 2 3 seconds);
i. Blot dry and examine under oil immersion;
j. See Figure 4 below for illustration

Figure 3. Preparation of bacterial smear

Figure 4. Gram staining procedure

10
BIOL2265- Worksheet for Exercise 3.

Organism Observation Discussion

11

12

Laboratory Session No. 2 2015/16
General Instruction
Students are to work in groups of four (4) individuals, or as directed by the TA;
Each person must submit worksheets on group data;
Remember to continue exercise on Kochs postulates
Reports:
Exercise 4.
Full lab report required.
Enumeration of coliform bacteria by Quantitative Plating and Multiple

Fermentation Tube Method (Most Probable Number)
.
Each group will be required to enumerate the number of coliform bacteria in water using one viable
count (Spread Plate on MacConkey Agar) and one most probable number (MPN) method (Multiple
Fermentation Tube Method). Further, each bench is to perform an additional viable count method
(Membrane Filtration Technique using mEndo Agar) to enumerate presumptive coliforms. The viable
count methods are based on spreading or distribution of cells from known volume/quantity of sample
on agar plates which are the appropriately incubated before counting colonies. Differential agar media
can be used for differentiating microbial groups, but most tests developed so far only give
presumptive results and colonies must be picked and verified using biochemical, serological or
molecular based techniques. A common alternative to quantitative plating methods is the use of most
probable number (MPN) methods which are statistical estimations based on the fact that cells in a
sample are not evenly distributed, but the distribution follows a Poisson model. Using this model,
complex statistical applications have been used to develop MPN Tables which are used to estimate
the number of organisms based on the presence or absence of the organism in replicates of different
sample volumes/quantities.
Introduction
One of the most important ways by which water can become polluted is from faecal contamination.
Many disease causing microorganisms such as Salmonella, Shigella, Vibrio cholarae and Staphylococcus
aureus are enteric pathogens in that they live in the gastro-intestinal tracts of humans and animals. The
faeces of humans and animals infected with enteric pathogens will have high levels of the diseasecausing organism, which can get into water systems via faecal contamination. Water or food
contaminated with these enteric pathogens can cause disease if they are consumed or ingested by healthy
individuals.
In assessing water quality, determination of the presence of enteric pathogens may be included in the
scope of tests, but this is usually expensive and time consuming. Most conventional testing systems for
these organisms involve selective and/or differential plating which give presumptive results.
Confirmation of presumptive colonies may follow using biochemical, serological or molecular methods.
13
Instead of testing for specific enteric pathogens, water is normally evaluated for faecal contamination,
which indicates the possible presence of enteric pathogens (since the faeces may have come from and
infected human or animal). The determination of faecal contamination is normally done indirectly via
determination of the presence of faecal coliforms or preferably E. coli. Other indicator organisms such as
faecal Streptococci can be used to indicate faecal contamination.
Faecal coliforms are a group of bacteria, which include E. coli as the main member, that are normal
inhabitants of the alimentary canal of warm blooded animals. They are always present in faeces of these
animals, in extremely high numbers. They are also detected and enumerated quickly and cheaply and are
normally non-pathogenic (except for some strains e.g. enterohemorrhagic E. coli 0157:H7). There are
some environmental coliforms that do not come from faeces, but originate from the environment. Faecal
coliforms are normally differentiated from environmental coliforms by use of specific media and
elevated incubation temperatures. Some testing systems enumerate Total Coliforms (Environmental +
Faecal) and the different types can then be differentiated if required.
Most drinking, recreational or effluent water standards include specifications for faecal coliforms and/or
E. coli. Example, US EPA drinking water standard has a requirement that no faecal coliforms must be
present and no more than 5% of samples may be positive for total coliforms in one month. Heterotrophic
Plate Counts, which indicate the general level of sanitation control, must not exceed 500CFU/mL. The
US EPA microbiological criterion for recreational water is <126 E. coli cells/100mL or <33 Enterococci
cells/100mL.
Each group is to use all three methods to quantify coliform bacteria in water.
A.
Q u an ti tati ve Pl ati n g on MacCon k ey A gar

MacConkey agar is designed to differentiate fermentative Gram-negative bacteria
from non-fermenting ones. It has neutral red dye that stains lactose positive colonies
(typical of the coliform group) as well as bile salts and to inhibit Gram-positive
bacteria). Lactose positive bacteria such as Escherichia coli and Klebsiella will
produce acid, which lowers the pH of the agar below 6.8 and this result in the
appearance of red/pink colonies. Non-Lactose fermenting bacteria such as
Salmonella and Shigella cannot utilize lactose and form ammonia from metabolism
of peptone, which raises the pH of the agar and leads to the formation of
white/colorless colonies.

14
Procedure
Diluting and Plating
Dilute water sample and spread 0.1ml of each dilution on McConkey Agar Plates as
illustrated in Figure 5 below:
Serial dilution of sample in sterile diluent (1/4 strength Ringers Solution or

Phosphate Buffer)
1 mL
Shake
1 mL
9
mL
Shake
10-1
dilution
C
1 mL
9
mL
Shake
10-2
dilution
9
mL
10-3
dilution
Sample
0.1 mL
0.1 mL
0.1 mL
McConkey Agar plates
Figure 5. Illustration of Quantitative Plating Procedure
Materials:
1 sample of water
6 McConkey Agar plates
E. coli culture (diluted)
Salmonella sp. culture (diluted)
0.1 to 1 ml sterile pipettes and tips
4 sterile 99 ml water blanks
L-shaped or triangular spreader
Container for discarded pipettes

15
Method
1. Label three 9 ml sterile diluent blanks A, B, C. Also, label 3 McConkey Agar
plates as follows:10-1, 10-2, and 10-3. Also label one of the plates sterile
control, another as positive control and the last as negative control;
2. Shake the water sample and transfer 1 ml into blank A, using a sterile 1ml
pipette. After using the pipette, place it in the discard container.
3. Secure cap and shake blank A 25 times in an arc of 1 foot for 7 seconds
with your elbow. Forceful shaking not only brings about good distribution,
but it also breaks up clumps of bacteria.
4. With a different 1 ml pipette, transfer 0.1 ml from blank A onto the surface of
the McConkey Plate labeled 10-1. With the same pipette transfer 1mL from
Blank A to Blank B. Shake water blank B 25 times in same manner.
5. With a different 1 ml pipette, transfer 0.1 ml from blank B onto the surface of
the McConkey Plate labeled 10-2. With the same pipette transfer 1mL from
Blank B to Blank C. Shake water Blank C 25 times in same manner.
6. With a different 1 ml pipette, transfer 0.1 ml from blank C onto the surface of
the McConkey Plate labeled 10-3.
7. Sterilize the glass spreader and spread the cell suspension as evenly as
possible starting with the highest dilution (10-3).
8. For the controls, spread 0.1ml of appropriate culture or sterile water on
respective McConkey Agar plate: E.coli- Positive; Salmonella sp.- negative
and sterile water- sterile control. (Re-sterilize spreader before spreading each
plate);
9. Incubate plates at 35oC and count colonies as follows:
Counting and Calculations

1. Lay out the plates on the table in order of dilution and compare them. Select the
plates that have no fewer than 30 nor more than 300 colonies (of all types).
Plates with less than 30 or more than 300 colonies are statistically unreliable.
2. Remove the lid and place the plate upside down on the colony counter. Count
the colonies with red/pink nucleated centers using a felt pen to mark off each
colony to prevent counting a single colony more that once. Count every
colony, regardless of how small or insignificant.

16
3. Calculate the number of bacteria per ml of undiluted culture by multiplying the

number of colonies counted by the dilution factor (the reciprocal of the dilution)
as follows:
a) Presumptive count = No of colonies counted X 10n
b) The results are given as Colony Forming Units (CFU)/mL
c) When 1.0mL is plated, n is the positive value of the dilution factor;
When 0.1mL is plated, n is the positive value of the dilution factor plus
1.
d) Example: If you counted 130 colonies on the plate that received
0.1ml of the 10 -3 dilution, the count is 130 X 103+1 CFU per ml = 130
X 104 CFU per ml = 1.3 X106 CFU/mL.
e) An alternative formula that can be used is: CFU/mL = No of
colonies/volume of original sample plated
4. When only one dilution is within the appropriate range, the average count for
this dilution is reported.
5. When more than one dilution is within the appropriate range, the average of the
counts at each of these dilutions is reported.
6. If colony densities are less than the optimal (<30 for bacteria colonies) on all
the dilutions, the result is reported as the average of the counts at all the
dilutions.
7. If there is no plate with the optimal range, and one or more plates have more
than the higher limit, the plate(s) having a count closest to optimal range of
colonies is used to estimate the Count. The count is given as Estimated CFU per
g or per mL.
8. When there are much more than 300 colonies per plate, the number of colonies
is estimated using the following guidelines:
a) If there are fewer than 10 colonies/cm2 (on the colony counter) 13
squares having representative colony distribution are counted and the
sum multiplied by 4.4 (for plastic petri dishes) or 5 (for glass petri
dishes) to obtain the estimated number of colonies per plate. If
possible, seven consecutive horizontal squares and six consecutive
vertical squares are counted.
b) When there are >10 colonies /cm2, four representative squares are
counted and the average per square calculated. The average count per
square is then multiplied by 57 (for plastic Petri dishes) or 65 (for
glass petri dishes) to obtain estimated number of colonies in the plate.
c) When there are >100 colonies/ cm2, the number of colonies present is
17
recorded as > 5700 (for plastic petri dishes, 90cm dia) or 6500 (for
glass petri dishes, 100cm dia.).
d) The Count is calculated by dividing the estimated number of colonies
by Actual Weight or Volume of sample in the petri dish and is
reported as Estimated CFU per g or per mL, as relevant.
e) If spreaders are encountered, colonies on representative sections of the
plate are counted when colonies are well distributed in the spreaderfree area and the area covered by the spreader(s) does not exceed onehalf of the plate.
9. If there is excessive spreader growth, the result is reported as Spreaders.
10. When no growth is observed in any of the plates, the result is reported as: < 1
X dilution factor. Alternatively, the results can be given as None detected at
range of dilutions used.
B.
Multiple fermentation tube method

The presence of presumptive coliforms can be determined by the production of acid and gas
when growing (fermenting) lactose. This method is based on inoculating replicates tubes of
Lauryl Tryptose (LT) broth with different volumes (typically decimal dilutions) and
observing for gas production (in Durham tube) and/or acid production (as characterized by
colour change from purple to yellow) after incubation at 35oC. The number of tubes that give
positive results from each replicate set is then used to determine the presumptive coliform
count, MPN/100mL) using MPN tables. Sometimes non-coliform organisms can produce
acid and/or gas from lactose broth and hence the positive tubes must be confirmed for
coliforms. Hence coliforms (total) must be confirmed by inoculating each positive LT tube
onto Brilliant Green Bile Salts (BGB) broth and inocubating at 35oC. The number of positive
tubes (based on gas production) from each replicate set is similarly used to estimate the
number of organisms (MPN/100mL). Faecal coliforms can similarly be confirmed by
inoculating each LT tube onto tubes of EC medium, incubating at 45oC and observing for gas
production.

18
Materials
1. Tubes of Lauryl Tryptose (LT) Broth (containing Bromocresol indicator) with
inverted Durham tubes-Double Strength
2. Tubes of Lauryl Tryptose (LT) Broth (containing Bromocresol indicator) with
inverted Durham tubes-Single Strength
3. Tubes of BGB Broth with inverted Durham tubes
4. Tubes of EC Broth with inverted Durham tubes
5. Sterile pipettes for transferring 10, 1 and 0.1 mL;
6. Bunsen burner of flame source;
7. 95% ethanol in a 250mL beaker;
8. Inoculation loops.
Procedure (See Figure 6 below)

Presumptive Phase
1. Sanitize work bench surfaces using 70% ethanol;
2. Light Bunsen burner;
3. Remove sample from cooler and dry outer surface using paper tissue;
4. Shake bottle vigorously for about 30 seconds;
5. Carefully remove a sterile 10mL pipette from the canister and transfer 10ml of
sample into each of three (3) tubes of Double strength LT broth. Hold pipette
close to the top to prevent contamination of areas that will come in contact with
the sample and be careful to prevent contamination of plugs or caps of tubes; [If a
10mL pipette is not available you may transfer 1mL 10 times, but note this
increases the error associated with the volume];
6. Using a 1ml sterile pipette, transfer 1mL of sample into each of three (3) tubes of
Single Strength LT broth;
7. Using a 1mL or 0.1ml sterile pipette, transfer 0.1mL of sample into each of three
(3) tubes of Single Strength LT broth;
8. Incubate LT tubes at 35oC for 24 48 hours and observe for the production of gas
in Durham Tubes, which is indicative of presumptive total coliforms.

19
Estimation of the number of Total Coliforms

1. For each gassing LT tube, transfer a loopful of culture into BGB using an
inoculating loop. Sterilize the loop by flaming until red-hot and then allow to cool
for about 30 seconds before making the transfer. Sterilize the loop before each
transfer;
2. Incubate BGB tubes at 35oC for 24 - 48 hours and observe for gas production (in
the inverted Durham tube);
3. BGB tube that show gas production are positive for Total Coliforms
4. Determine the Most Probable Number (MPN) per 100 mL of Total Coliforms
using the MPN statistical Table provided below (Table 1);
5. Example:
i. Number of LT tubes (10mL, 1ml and 0.1 mL) showing gas production- 3 3
1;
ii. Number of BGB tubes (10mL, 1ml and 0.1 mL) showing gas production- 3
2 0: Total Coliforms = 93 MPN/100 mL;
iii. Number of EC tubes (10mL, 1ml and 0.1 mL) showing gas production- 2 1
0: Faecal Coliforms = 15 MPN/100 mL

20
Eg. of MPN method for Total and Faecal coliforms

10mL/g
1mL/g
0.1mL/g
+
+
+
+
LAURYL TRYPTOSE BROTH (35oC)
+
BGB Broth
For Total
Coliforms
(35oC)
EC
Medium
(45oC)
Figure 6. Illustration of multiple fermentation tube methods of enumerating coliforms.

21
Table 1. MPN Statistical table

22
C.
Membrane filtration method (This is to be done only per bench basis)

Membrane filtration allows filtration of liquids onto 0.45m pore size membranes to
collect cells. The membranes is then placed onto the surface of an agar medium and cells
will grow on the membranes to from colonies. Coliforms will produce colonies with a
green metallic sheen in mENDO agar. Some non-coliforms will similarly produce colonies
with metallic sheen and thus a fraction (usually 10%) or minimum or 10 colonies mush be
picked and subjected to biochemical confirmation.
Materials
Plates of mEndo
1. Sterile Membrane filtration apparatus
2. Vacuum pump
3. Sterile 47mm, 0.45m pore size membranes
Procedure
A. Total Coliforms
1. Set up filtration apparatus (see Figure 7 below) and connect to vacuum pump;
2. Aseptically remove funnel, place sterile membrane on base using sterilized forceps and
replace funnel;
3. Secure funnel with clamp;
4. Shake water sample and pour into funnel up to the 100mL mark;
5. Turn on vacuum;
6. Immediately turn off vacuum as soon as filtration is complete;
7. Aseptically remove membrane and place on the surface of an mEndo agar plate;
8. Incubate plates at 350.5oC for 22 to 24 hours; [The colonies may lose their sheen
after 24 hours].
10. After incubation select and count colonies with metallic green sheen in plates up to
200 colonies (of all types);
11. If plates have >200 colonies, estimate number using principles as viable count method;
12. Calculate Presumptive Total Coliform Count (CFU/100mL) using the following
formula:
CFU/100mL= No. of colonies counted*100/Vol. of sample filtered;
13. Verification of Total Coliforms: (NOT TO BE DONE IN THIS LAB)

a. Pick a minimum of ten (10) presumptive total coliform colonies using an
inoculation loop and streak on nutrient agar plate (5/colonies per plate streaked in
single lines);
23
b. Incubate plates for 24h and then conduct Oxidase and ONPG tests from growth
in NA plates as follows:
i. Oxidase
-
Place a few drops of freshly prepared Oxidase reagent (1%

aqueous solution of Tetramethly p-phenylenediamine
dihydrochloride) on a strip of filter paper;
Pick some growth from NA plate using a wooden or plastic

applicator and smear test strip;
A positive reaction is characterized by the development of a

dark purple colour within ~10 seconds.
ii.
ONPG Hydrolysis
-
Inoculate 0.5mL ONPG Broth (Peptone water, ONPG, Buffer)

with a heavy loopful of growth from NA plate;
Incubate at 35 0.5oC for up to 24h;
ONPG Hydrolysis is characterized by the development of a

yellow colour;
c. Coliform organisms are Oxidase negative and ONPG positive;
Figure 7. Filtration apparatus

24

General Instruction
Students are to work in groups of four (4) individuals;
Each person must submit worksheets on group data;
Exercise 5. Environmental Effects on Microbial Growth (Completed worksheet required)

A. Temperature: Effects on Growth
Temperature is one of the most important factors influencing the activity of bacterial
enzymes. Enzymes have optimal temperatures at which activity is at maximum speed.
Rates of activity will decrease as temperature increases or decreases from the optimal
up to a certain point after which activity will cease.
This experiment attempts to measure the effects of various temperatures on growth rate
of E. coli and pigment production in Serratia marcescens.
Materials
1.
Nutrient broth cultures of E. coli and Serratia marcescens;
2.
Two (2) nutrient agar plates
3.
Three (3) nutrient broth tubes.
Procedure
1.
Using a wire loop, inoculate both agar plates each with one loopful of Serratia
marcescens culture; label one plate 25oC and the other 45oC;
2.
Inoculate the three nutrient broth tubes each with a loopful of E. coli culture
and label one 5oC, one 25oC and the other 45oC;
3.
Place inoculated slants and broths in the appropriately labeled basket. These
will be incubated at the appropriate temperature;

25
4.
Evaluate results AFTER 48 HOURS of incubation as follows. If it is not

possible to take results after 48 hours, then the slants and broth will be held in a
refrigerator until results can be taken within 36 hours. Make arrangements with
demonstrators and technician:
a. Plates- Compare growth characteristics of the Serratia marcescens slants
incubated at the two different temperatures;
b. Broth cultures- Shake the broth cultures properly and visually measure
growth as follows: no growth = none; least growth = +; more growth =
++; and most growth = +++.
Exercise 6. Antimicrobial Sensitivity (Completed worksheet required)

A. Antibiotic sensitivity
Antibiotics are a group of compounds originally produced by metabolic reactions of
bacteria and fungi, which kill or inhibit the multiplication of other microbes. The most
common antibiotics are produced by two bacterial genera Streptomyces (streptomycin) and
Bacillus (Bacitracin) and the fungal genus Penicillium (Penicillin). Many antibiotics can
now be manufactured synthetically and may even be altered to increase effectives. The
disc diffusion antibiotic sensitivity test measures the zones of inhibition around filter paper
discs that have been dipped into different concentration of antibiotic solutions.
Procedure:
a. Each group is to determine antibiotic sensitivity of two organisms: E. coli and
Staphylococcus aureus;
b. Make a nutrient agar-pour plate with each organism:
i. Place about 0.1mL of broth culture in sterile Petri-plate;
ii. Pour molten, tempered nutrient agar, mix to distribute cells and allow to
solidify;
c. Antibiotic (streptomycin) solutions are provided: 0.01%, 0.1% and 1%;
d. Using sterile forceps, immerse sterile filter paper discs (5mm) into each antibiotic
concentration and also a control ( sterile water);
e. After Leave discs in solution for at least 1 minute, remove and then place one disc
each from the different antibiotic concentration and the control on the surface of
one of the pour plates, spaced evenly apart; DO NOT PRESS DISC INTO THE

26
PLATE; GENTLY TAP IT WITH FORCEPS TO MAKE SURE IT REMAINS IN

PLACE (See Figure 8);
Discs
Figure 8. Filter disc method on antibiotic/antiseptic evaluation
f. Label the concentration of each disc on the plate;

g. Repeat the procedure for the next plate with the other organism;
h. Incubate plates at 35oC for 48 hours and measure the zone of inhibition (edge of
disc to the point where growth occurs. See Figure 9.
Disc
Zone of
inhibition
Area of
bacterial
growth
Figure 9. Determination of zone of inhibition

27
B. Antiseptic sensitivity
Sensitivity to antiseptic and disinfectant agents can be similarly evaluated as antibiotics
sensitivity via the use of the disc diffusion method.
Procedure:
a. Follow the procedure of the Antibiotic sensitivity method (A) above, except that
antiseptic agents are used instead of antibiotic solutions.
b. The antiseptic agents and concentrations are: 10% household bleach, 70% ethanol
and 1.5% lysol.
Exercise 7. IDENTIFICATION OF BACTERIA (Results and Discussion)

Microorganisms can be identified using a combination of methods based on the following techniques:
a.
Cultural (growth in microbiological media) and microscopic examination (cell

morphology and staining characteristics):
- Least discriminatory;
- Give presumptive identification;
b.
Biochemical/physiological identification:
- Most important conventional method
- Used in conjunction with cultural and microscopic examination;
- Identification is based on determination of physiological traits by biochemical
reactions in broth or agar media;
- Major disadvantages include long time for completion, subjectivity in interpreting
some test reactions and variations in traits among specific groups;
c.
Serological testing
- Detection is based on interaction (binding) between antibodies and microbial
cells/components (antigens);
- Still one of the most important identification method, especially in medical
microbiology and plant pathology;
- Antisera may be genus, species or strain specific;
- Very important in viral identification
- Disadvantages include unavailability of antisera for most microbes (except medially
important species/strains);
d.
Bacteriophage typing (ability of certain virus to infect specific strains of bacteria);

28
e.
Molecular methods e.g:

- DNA hybridization probes- labeled genes or segments of DNA from know organisms
which are used to detect similar regions in the genome of unknown organisms;
- Molecular fingerprinting analysis- ID based on comparison of fingerprints of DNA,
RNA or proteins of known and unknown organisms
- Molecular sequencing analysis- ID based on comparison of sequences of DNA, RNA
or proteins of known and unknown organisms;
- These methods are now becoming more and more important due to speed and
discriminatory ability;
A. Biochemical identification
Procedure
Each group is give an unidentified bacterial culture labeled Unknown A, Unknown B, Unknown C, or
Unknown D.
1. Utilization (Fermentation) of lactose;
a. Inoculate the unknown organism into a tube of lactose broth containing phenol red
indicator and Durham tubes;
b. Incubate tubes at 35oC and observe after 24 48hr;
c. Utilization of the lactose will be characterized by a change in color of the medium
from reddish to yellowish and/or gas production (air in Durham tube);
d. A positive (E. coli) and a negative (Salmonella sp.) control would be inoculated and
similarly incubated for you by the lab personnel for comparison when you come to
observe results;
2. Determination if organism is a facultative anaerobe
a. Heavily stab inoculate one (1) tube of Thioglycolate Medium with the unknown
organism;
b. Cap tubes tightly and incubate for 48hr at room temperature IN THE DARK;
c. Observe tubes for growth characteristics as follows:
Aerobic
Microaerophilic
Facultative
Anaerobic
d. An obligate aerobe (Pseudomonas aeroginosa) and a facultative anaerobe (E. coli)

control would be inoculated and similarly incubated for you by the lab personnel for
comparison when you come to observe results;

29
3. Determination of motility
a. Stab inoculate a tube of semi-solid motility medium with the unknown organism using
inoculating needle;
b. Incubate for 24 48hr and observe growth pattern;
c. Motility will be characterized by cloudiness around the stab due to migration of the
bacteria;
d. A motile (E. coli) and a non-motile (Enterococcus sp) control would be inoculated and
similarly incubated for you by the lab personnel for comparison when you come to
observe results;
4. Utilization of citrate
a. Using an inoculating loop, streak the unknown on the surface of a Simmons citrate
agar slant ;
b. Incubate the slants at 35oC and observe after 24 48hr;
c. Positive utilization of citrate is characterized by a color change in the medium from
greenish to blue;
d. A positive control (Enterobacter aerogenes) and a negative control (E. coli) would be
inoculated and similarly incubated for you by the lab personnel for comparison when
you come to observe results;
5. Methyl Red Test (for mixed acid fermentation) and Voges-Proskauer Test (oxidation of
acetylmethylcarbinol)
a. Inoculate MR-VP broth tube with a loopful of the unknown organism;
b. Incubate tubes for 3 4 days
c. Transfer one half of the content of the tube to a new test tube
d. Methyl red test:
1. Add 3 4 drops of methyl red reagent to one of the tubes;
2. A positive reaction is characterized by the immediate appearance of a reddish
color in the medium;
e. Voges-Proskauer Test:
1. Add about 0.5mL of 5% alpha-naphthol reagent to the other tube
2. Observe with periodic shaking for up to 15 minutes;
3. A positive reaction is characterized by development of a pink to red colour
f. Positive and negative controls will be set up by the lab personnel for comparisons
when results are being taken). E. coli: MR positive, VP negative; Enterobacter: MR
positive, VP positive; Pseudomonas: MR negative, VP negative
After taking results, use Figures 10, 11 and 12 of the supplementary handout (Use of Bergeys
Manual) to identify the unknown (at the genus or species level), if possible.
A. Molecular identification
1. Extract DNA from pure bacterial culture ((This would be performed by Laboratory personnel)
2. Polymerase chain reaction of 16S rRNA gene (This would be performed by Laboratory
personnel)
a. Primers
-
forward: 16SF- 5'- AGAGTTTGATCCTGGCTCAG-3'

reverse: 16SR- 5'- ACGGCTACCTTGTTACGACTT -3'

30
b. PCR reaction tubes (25L):

-
15.875 PCR grade water

5L 5X PCR buffer
1.5 L MgCl2 (25Mm)
5 L dNTP mix (10mM each)
1 L DNA solution (from PrepMan extraction)
0.125 Taq DNA polymerase (GoTaq)
0.5L forward primer (16S forward)
0.5L reverse primer (6S reverse)
c. PCR cycling conditions

-
Initial denaturation: 94C/ 5mn

34 cycles
o 94C /30s
o 55C/ 45s
o 72C/ 120s
Final elongation : 72C / 10mn
3. DNA sequencing.
a. PCR products would be sequenced using ABI3500 sequencer. This data would be
made available to the class.
4. BLAST search sequence in GenBank using NCBI tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi)
(see lecture presentation) and determine probable identity.

31
Use of identification keys

The classical method of identifying bacteria is by use of morphological and biochemical
characteristics described in the Bergey's Manual of Systematic Bacteriology The separation of
organisms at the genus level is often pretty straight forward for common groups, especially of health
importance. However, identifying bacteria by the use of this manual to the species level can be
complex, requiring a large number of biochemical tests. Figures 10 13 give some examples of using
keys from the Bergeys Manual for identifying unknown bacteria.

32

33
BIOL 2265- Labs

Worksheet for Exercise 5
Student I.D.____________________ Group No. _______
Demonstrator: ____________________
A. Temperature: Effects on growth

Serratia marcescens plates:
Incubated
Temperature
Observation
25oC
45oC
E. coli cultures
Incubated
Temperature
Score
(o +, ++, +++)
5oC
25oC
45oC
DISCUSSION
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
34
BIOL2265- Labs
Worksheet for Exercise 6
Student I.D.________________Group No. _______
A. Antibiotic sensitivity
Antibiotic
concentration
Demonstrator: _________________
Zone of inhibition (mm)

Staphylococcus
E. coli
1%
0.1%
0.01%
Control (sterile
diluent: water)
Discussion
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________

35
Ex. 6. Continued
B. Antiseptic evaluation
Concentration
Zone of inhibition (mm)

Staphylococcus
E. coli
10% Household Bleach

70% Ethanol
1.5% Lysol
Control (sterile water)
Discussion
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________
_________________________________________________________________________________

36

Exercise 8. Observation of Zygomycetes

A. Zygomycetes
a. Rhizopus sp.
-
Mount growth from agar culture of each organism onto drop of glycerol-lactic acid on
a slide;
Cover with cover slip and observe under the microscope using X10 - X40 lens;
Observe and draw mycelium, sporangia and other structures;
Refer to DIAGRAMS PROVIDED.
Figure 13. Rhizopus sp.

b. Pilobolus.
-
Observe structures of organism growing on its natural medium;
Pay emphasis to the sporangium and its dispersal;
Refer to DIAGRAM PROVIDED.

37
Figure 14. PILOBOLUS SP.
Exercise 9. Basidiomycetes
A. Coprinus sp. (Order: Agaricales)
a. Use dissecting microscope to observe structures of organism growing on its natural
medium (cow dung);
b. Pay emphasis to the sporangium and its dispersal;
c. Refer to DIAGRAM PROVIDED.
B. RUSTS (Order Uredinales)
The rust fungi are in the order Uredinales. They are major plant pathogens that affect
mostly leaves and stems of a wide range of plants. The characteristic feature of most rusts
is spots which appear as rusty, orange, yellow or even white postules depending on the
fungal species and plant host. Most rusts produce five types of spores and are called
macrocyclic and may require more than one host to complete their life cycles
(heteroecious types). E.g. in wheat affected by Puccinia grammis:
- Haploid basidiospores germinate and infect epidermal cells of the
dicotyledonous weed -Barberry Bush, and then grow intercullarly.
38
The mycelium then develops into spermagonia (formerly called pycnia)

containing a type of spore called spermatia that serve as the male gamete in
reproduction; The spermagonia also produce receptive hyphae that contain
the other gamete. The spermagonia ruptures the epidermal layer and
spermatia are disseminated by insects or wind and water; When a
spermatium comes in contact with a compatible receptive hypha,
fertilization takes place and the nucleus enters but does not fuse to form a
diploid nucleus. Instead, the nucleus divides and one copy moves into the
adjacent cell. This nucleus the divides and move into the next cell. This
process (dikaryotization) continues until a complete dikaryon is formed.
The dikaryotic mycelium then give rise to the aecium containing
aeciospores (produced in chains) on the lower surface of the leaf. The
dikaryotic aeciospores are released and are carried by the wind to the
wheat plant which is infected;
The dikaryotic mycelium in the wheat grows and eventually gives rise to
the uredium containing uredospores. The uredosprores exert pressure on the
epidermis to form the postules. Eventually the postules raptures to release
the spores. The uredospores can re-infect wheat and can be carried by the
wind for very long distances.
At the end of the season, the uredia produce thick walled di-karyotic
teliospores that serve as the resting stage of the organism. These spores
cannot infect the wheat but in the beginning of the next season karyogamy
takes place and they germinate into basidia.
Meiosis takes place in the basidia which give rise to basidiospores.
Some species complete their life cycle on one host (autoecious) and some may only
produce teliospores and basidiospores (Microcyclis)
a. Observation of disease symptoms in fresh specimens
(Euromyces in bodi and/or Puccinia in corn).
C. SMUTS (Order Ustilaginales)
The smut fungi are in the order Ustilaginales. They produce black dusty spore masses,
which resemble soot or smut. These organisms produce two types of spores: Basidiopores
and teliospores. E.g. in Ustilago, resting stage teliospores germinate into basidia which
give rise to baisdiospores. The basidiospores then germinate into haploid hypha which
infects epidermal cells. After some initial development, growth stops and it can die unless
it comes in contact a hypha of a compatible mating type. When this happens, the two
hphae fuses to form a dikaryon that grows intercellularly until development of dikaryotic
teliospores. Most rust fungi attack ovaries of grains and grasses and develop in them and
in developing fruit (kernels of grain). Cells of infected tissues are destroyed and are
replaced by black smut spores. Some species stimulate cells in infected tissues to divide
and enlarge to form galls which are then destroyed and replaced with spores.
i.
Observation of preserved specimens

Examine and note the disease symptoms of the following museum specimens:
- Corn smut (Hypertrophy);
- Sugar cane smut.

39
Exercise 10: Miscellaneous observations of museum specimens

a. Cordyceps Ascomycete
b. Cookenia sp. Ascomycete
c. Witches broom of cocoa (Crinipellis sp) Basidiomycete
d. Smut in Corn Ustilago Basidiomycete
e. Jews ear Auricularia Basidiomycete
f. Puff Balls of a Basidiomycete
g. Black rot of Cocoa Phytophthora palmivora Oomycete
SEE SUPPLEMENTARY FIGURES FOR GUIDANCE
Exercise 11. Ascomycetes

c. Aspergillus flavus and Penicillium sp. :
-
Mount growth form agar culture on slide with drop of Lactic Acid Cotton Blue
mixture;
Cover with cover slip;
Observe under microscope using X10 X40 objective lens and draw vegetative and
reproductive structures;
Use illustrations provided as a guide for observing the various structures.
Fig. 15 Aspergillus sp

40
Fig. 16 Penicillium sp
Saccobolus sp. and Ascobolus sp.

- Observe dung plates for organisms under the dissecting microscope;
- Note apothecia and arrangement of asci. (See pictures below).

41
Fig. 17 Saccobolus fruiting bodies (apothecia) and ascospores
Fig. 18 Ascobolus fruiting bodies (apothecia)

Saccharomyces cerevisiae
- Place a drop of yeast suspension on a slide, cover with a cover slip and observe shape
and size of cells;
- Look for signs of budding.
42
Fig. 19. Saccharomyces cerevisiae
Fig. 20. Coprinus fruiting bodies

43
Fig. 21. Life cycle of Puccina rust

44

BIOl2265 Lab - Manual - 2015 16

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

BIOl2265 Lab - Manual - 2015 16

Uploaded by

Copyright:

Available Formats

THE UNVERSITY OF THE WEST INDIES

DEPARTMENT OF LIFE SCIENCES

a) Sanitizing work environment- before and

Hold handle, flame until red hot and allow

Immerse tip in 95% ethanol and flame to burn

a) add constituents (individual ingredients

BIOL2265- Fundamentals of Microbiology

c) heat to melt agar-agar (heating plate can

d) loosen screw cap slightly (to allow for

lift lid and pour into dish

close lid immediately

allow to cool for about 15 minutes

a) Prepare molten agar medium as before,

b) Loosely cap tubes, autoclave as before

a) mix constituents in distilled water;

b) dispense into tubes

Heat sensitive components (example

BIOL2265- Fundamentals of Microbiology

b) Collect loopful of culture/sample and

c) Label plate and incubate in an

a) Sterilize needle/straight wire, collect

b) Incubate tube and observe pattern of

a) Remove sterile moistened swab from

b) Rub on surface of agar plate;

Transfer 100mL sterile buffer into test

Cap and vigorously shake bottle;

Aseptically transfer 0.1mL of rinse

Sterilize triangular or L-shaped

Incubate as before and count the

BIOL2265- Fundamentals of Microbiology

What was the number of culturable

You are provided with a plate

Code the colonies present on the

Make a stamp on the plate with the

Imprint cells collected on the cloth

Incubate and observe for growth of

BIOL2265- Fundamentals of Microbiology

Figure 1. Illustration of Kochs postulates

b. Surface sterilization: Transfer cut pieces in 10% bleach solution leave

BIOL2265- Fundamentals of Microbiology

vi. Using a sterile inoculating loop, collect a small amount of

BIOL2265- Fundamentals of Microbiology

BIOL2265- Fundamentals of Microbiology

Exercise 3: Grams Staining of Bacterial Cells

BIOL2265- Fundamentals of Microbiology

Figure 3. Preparation of bacterial smear

Figure 4. Gram staining procedure

BIOL2265- Fundamentals of Microbiology

BIOL2265- Worksheet for Exercise 3.

BIOL2265- Fundamentals of Microbiology

BIOL2265- Fundamentals of Microbiology

THE UNVERSITY OF THE WEST INDIES

Each person must submit worksheets on group data;

Remember to continue exercise on Kochs postulates

Full lab report required.

Enumeration of coliform bacteria by Quantitative Plating and Multiple

Q u an ti tati ve Pl ati n g on MacCon k ey A gar

BIOL2265- Fundamentals of Microbiology

Serial dilution of sample in sterile diluent (1/4 strength Ringers Solution or

McConkey Agar plates

Figure 5. Illustration of Quantitative Plating Procedure

BIOL2265- Fundamentals of Microbiology

Counting and Calculations