1

Acknowledgement
I wish to offer my best regards and profound gratitude to my supervisor Mazharul Islam
Chowdhury, Senior Lecturer, Department of Pharmacy, ASA University Bangladesh for his
expert guidance, keen interest, encouragement and effort to prepare this project paper. His
precious advice inspired me during the entire time of project work.
I also want to offer my sincere respect to my teacher Prof. Dr. Kohinur Begum, Dean, Faculty of
Science and Eng. Department of Pharmacy, ASA University Bangladesh for her sincere advice
and inspiration for this work and helpful co-operation whatever I needed.
I am thankful to the laboratory assistants and other staffs of the Pharmacy Department for their
co-operation during my work. Iam also grateful to my friends who encourage and assist me
through the work.
Finally, I would like to thank my family members for their co-operation.

Abstract
The appearance of adverse effects in association with angiotensin-converting
enzyme (ACE) inhibitors is thought to be related to angiotensin receptor.
Several polymorphisms of the human angiotensin receptor gene may be
involved in ACE inhibitorrelated cough. To investigate this possibility, we
identified the A/C polymorphism in subjects with ACE inhibitorrelated
cough. We classified the study population into 2 groups: subjects with and
without cough that were treated with ACE inhibitor. The A/C was genotyped
by the polymerase chain reaction single-strand conformation polymorphism
method. In the presence of the A allele, miR-155 is able to bind to the AT1R mRNA and
suppress AT1R expression. In contrast, the C allele interrupts the base pairing complementarity
of miR-155 with the AT1R mRNA sequence, and miR-155 is considerably less effective at
suppressing AT1R expression . Thus, altered regulation by miR-155 is one mechanism by which
the AT1-1166 CC polymorphism can lead to increased expression of the AT1R . As the AT1
receptor is involved in the direct effects of angiotensin II, it can be hypothesised that genetic
variants in the AT1 receptor will influence the response to an ACE inhibitor.

CHAPTER 1
INRTODUCTION

1.INTRODUCTION:
1.1.Background
The World Health Organization describes hypertension as the number one risk factor for
mortality, as worldwide annually 7.5 million deaths (13% of all deaths) are attributable to high
blood pressure (BP)-related diseases, particularly cardiovascular diseases (CVD)(1). For that
reason, the guidelines of hypertension and cardiology societies emphasize that hypertension
treatment should aim at reducing the long-term risk of (cardiovascular) morbidity and
mortality(2). Hypertension is often referred to as the silent killer, as its presence is usually
symptomless. Therefore, compliance to antihypertensive medication is a challenge for most
patients, especially as adequate BP control often requires the use of multiple agents, causing
additional side effects and as a result inferior adherence(2). Thus, there is a continuing need for
potent medications, preferably with beneficial effects on mortality, to improve patients Between
1970 and 1973, Squibb scientists randomly tested about 2,000 chemical structures for ACE
inhibitor activity but could not find what they wanted. Their luck changed on Wednesday, 13
March 1974, when they decided to follow up some newly published research on an inhibitor of
carboxypeptidase A an exopeptidase thought to have a similar active site to ACE. Then, 60
compounds and 18 months later, they had captopril, and early clinical studies confirmed its
antihypertensive effects(3).adherence to the treatment prescribed.

In the early 1980s, hypertension conferences were routinely enlivened by the poisonous
Brazilian viper, Bothrops jararaca. With its striking zig-zag markings and aggressively
protruding tongue, images of the snake were a welcome break from graphs and tables in
presentations about captopril the first of the angiotensin-converting enzyme (ACE) inhibitors,
whose effects on blood pressure mechanisms mimicked those of the snakes venom. When the
cardiovascular juggernaut alighted in Sao Paulo, Brazil, for a major congress in 1984, there was
even an opportunity for delegates to visit a snake farm and see the beast in all its glory.

The discovery of the ACE inhibitors and the creation of captopril was one of the really
great advances in cardiovascular medicine, alongside beta blockers, calcium channel blockers
and statins. When captopril arrived, there was a lot of excitement and a feeling that acting on the
renin-angiotensin system was going to be a very important step forward.
ACE was identified as the enzyme responsible for the conversion of angiotensin I to the
vasoconstrictor substance, angiotensin II, in the mid 1950s(4). In 1968, studies carried out in the
Royal College of Surgeons laboratories of Nobel prize winner, John Vane, showed that peptides
from the Brazilian vipers venom inhibited the activity of ACE from dog lung(5).
When Vane proposed an ACE inhibitor research programme to US pharmaceutical
company, ER Squibb and Sons (now part of Bristol Myers Squibb), clinical advisers were wary
because, at that time, the renin-angiotensin system was thought to play a role only in the most
serious malignant hypertension(6,7). However, it was decided that there was enough clinical
interest to proceed with trying to develop synthetic ACE inhibitors that were orally active(6,7).
Between 1970 and 1973, Squibb scientists randomly tested about 2,000 chemical
structures for ACE inhibitor activity but could not find what they wanted. Their luck changed on
Wednesday, 13 March 1974, when they decided to follow up some newly published research on
an inhibitor of carboxypeptidase A an exopeptidase thought to have a similar active site to

ACE(7). Then, 60 compounds and 18 months later, they had captopril, and early clinical studies
confirmed its antihypertensive effects(8).
The outlook for ACE inhibitors changed dramatically in 1987 with the
publication of the Co-operative North Scandinavian Enalapril Survival Study
(CONSENSUS)(9). This showed a 31 per cent reduction in mortality at one
year in patients with severe heart failure who were treated with enalapril.
Dropping the dose of enalapril as low as 2.5mg daily in high risk patients
reduced the problem of hypotension to acceptable levels.

1.2.Goals and advantages of Angiotensin-converting enzyme (ACE) inhibitors:

Recent comparative trials and observational studies in diabetes
have suggested that, for the prevention of cardiovascular events, ACE
inhibitors may be superior to alternative antihypertensive
agents(10).That the greater benefit of ACE inhibitors was not explained
by better blood pressure control indicates that other mechanisms linked
to ACE inhibition may have played an additional role in the prevention of
major clinical events. The purpose of the present review and metaanalysis is to summarize the current evidence from randomized clinical
trials with clinical outcomes that directly compared ACE inhibitors to
alternative antihypertensive agents in patients with hypertension and
type 2 diabetes.

The benefits of antihypertensive treatment on cardiovascular morbidity are thought to be

mainly due to the BP-lowering effect, independent of the class of drug employed, as has been
demonstrated with -blockers, diuretics, calcium channel blockers, and recently with the renin
7

angiotensinaldosterone system (RAAS) inhibitors.(2) Blockade of the RAAS is one of the key
therapeutic targets in patients with hypertension, as an overactive RAAS is strongly associated
with high BP. The RAAS controls circulating volume and electrolyte balance in the human body
and is therefore an important regulator of haemodynamic stability(11). RAAS inhibitors are the
most widely prescribed class of drugs for the management of hypertension. Currently, the most
clinically relevant pharmacological agents that block the RAAS are angiotensin-converting
enzyme (ACE) inhibitors .
Angiotensin-converting enzyme inhibitors are widely used for the treatment of
hypertension and are presently the uncontested drugs of choice for the treatment of congestive
heart failure(12)Angiotensin converting enzyme inhibitors not only have become the cornerstone
of the treatment of heart failure ,but also play a major role in hypertension and in cardiovascular
protection.

The role of renin-angiotensin-aldosterone system in cardiovascular pathology,with excess

activities of angiotensin 2 and of aldosterone contributing to major adverse maladapative
roles.angiotensin converting enzyme inhibitors act on crutial enzyme that generate angiotensin 2
and mediate the breakdown of bradykinin.angiotensin converting enzyme inhibitors give both
primary and secondary protection from cardiovascular disease(13)
Angiotensin-converting enzyme (ACE) inhibitors block an enzyme needed to form a
substance that narrows blood vessels. As a result, blood vessels relax and widen, making it easier
for blood to flow through the vessels, which reduces blood pressure.
Angiotensin-converting enzyme (ACE) inhibitors competitively block the conversion of
angiotensin I into angiotensin II. This blockade results in a decrease in circulating and local
levels of angiotensin II, thereby inhibiting the main effects of angiotensin II: arteriolar
vasoconstriction and water and salt retention. However, ACE inhibitors do not antagonize the
AT1 receptor and thus do not inhibit the unfavorable effects of angiotensin II completely.
Furthermore, the formation of angiotensin II is restored, at least partially, due to the reactive rise
8

that occurs when renin release is blocked by angiotensin IIinduced negative feedback. A second
beneficial effect of ACE inhibitors, and a main difference between them and angiotensin receptor
antagonists, is the increase in bradykinin levels caused by the decrease in transformation of
bradykinin into inactive peptides(14)(15).The increase in bradykinin levels induced by ACE
inhibitors leads to the release of nitric oxide and prostaglandins with vasodilating effects on
vessel walls(15)(16).
The efficacy of ACE-inhibitors to improve outcome has been demonstrated by several
large clinical trials in patients with cardiovascular disease. These include post-myocardial
infarction (MI) patients, patients with asymptomatic left ventricular systolic dysfunction, heart
failure or a history of cerebrovascular disease, and stable CAD patients with preserved left
ventricular function (17-23).

Currently, the use of ACE inhibitors is recommended in guidelines on the management

of hypertension, stable CAD, MI, heart failure, and in the prevention of the progression of renal
insufficiency in diabetes mellitus related kidney disease (24-26).
The ACE-inhibitor perindopril has been extensively studied in several large, controlled
trials in a variety of patient groups with different etiologies (23, 2730). Of these, the EUROPA
trial is noteworthy, as it is the only secondary prevention study with perindopril in a stable CAD
population. ACE inhibitor research has also led to a better understanding of pathophysiological
processes and maladaptive responses in the reninangiotensin aldosterone system (RAAS). In
particular, several sub-studies of EUROPA (including PERFECT, PERSPECTIVE and
PERTINENT), have established that ACE inhibitors have additional effects beyond the blood
pressure reduction alone such as the improvement of endothelial function, improvement of the
neuro-humoral balance, and reduction of unfavorable remodeling of the coronary arteries (31
34). These medicines also increase the release of water and sodium to the urine, which also
lowers blood pressure.
9

ACE inhibitors favorably alter hemodynamics in patients with systolic dysfunction. ACE
inhibitors reduce afterload, preload, and systolic wall stress,such that cardiac output increases
without an increase in heart rate; ACE inhibitors promote salt excretion by augmenting renal
blood flow and by reducing the production of aldosterone and antidiuretic hormone. Since 1987,
several large, prospective, randomized, placebo-controlled trials have demonstrated that
treatment with ACE inhibitors results in a reduction in overall mortality in patients with
congestive heart failure due to systolic dysfunction(35). The reduction in mortality has been seen
even in patients with asymptomatic left ventricular dysfunction. This reduction in mortality
results primarily from a reduction in progression of congestive heart failure, although the
incidence of sudden death and MI may also decrease(35).

1.3. Studies on ACE inhibitors

ACE inhibitors are a class of drugs that inhibit the activity of ACE, an enzyme
located on endothelial cells (36). In addition to being bound to endothelial cells, ACE also
circulates freely in an unbound form. This enzyme has 2 key metabolic effects: 1) it catalyzes the
conversion of angiotensin I to angiotensin II, in both cir-culation and tissue; and 2) it catalyzes
the breakdown of bradykinin into inactive products . Inhibition of the activity of
this enzyme, therefore, may decrease tissue and circulating levels of angiotensin II and
may increase levels of bradykinin. Lower levels of angiotensin II result in decreased
vasoconstriction, decreased stimulation of vascular smooth muscle growth, decreased
sympathetic stimulation, decreased levels of plasminogen activator inhibitor, and
decreased platelet aggregation . Lower levels of circulating angiotensin II also result
in less adrenal production of aldosterone and increased urinary potassium loss; this
effect may help maintain optimal-cell function . Increased bradykinin levels

10

lead to direct vasodilation as well as indirect vasodilation through bradykinin-mediated nitric

oxide and prostacyclin production. In addition, increased production of nitric oxide helps
facilitate insulin-mediated glucose uptake, thereby improving insulin sensitivity . In addition to
all of the above vascular and metabolic effects, inhibition of ACE also reduces blood
pressure(36).
These mechanisms are active in all individuals taking an ACE inhibitor and are all
possible explanations for the observed beneficial effect of ACE inhibitors in people at
risk for cardiovascular disease. Individuals with diabetes are at a particularly high risk
for cardiovascular disease; for example, the presence of diabetes increases the risk of
cardiovascular mortality multifold in both men and women . Therefore, if ACE
inhibitors do have particular cardioprotective effects, they may be more easily detectable in this
group of high-risk patients than in the general population. Moreover, the benefits of any of the
metabolic effects may be more relevant to this population(36).

This possibility was explored in the Heart Outcome Prevention Evaluation (HOPE)Study,
in which 3,577 individuals with diabetes received either placebo or ramipril(up to 10 mg daily)
and were followed for 4.5 years . Ramipril reduced the risk of the composite outcome of
myocardial infarction, stroke, or cardiovascular death by 25% and that of overt nephropathy by
24%. This benefit occurred with a very modest decrease in blood pressure and was shown to be
independent of the change in blood pressure. Only 56% of the individuals with diabetes in the
study had a diagnosis of hypertension at randomization. Of these patients, 28% were taking Bblockers,20% were taking diuretics and 44% were taking calcium channel blockers at
randomization in addition to either an ACE inhibitor or placebo. Thus, the HOPE Study suggests
that ACE inhibitors may have a cardioprotective effect over and above any antihypertensive
effect(36).

11

The study also suggested favorable metabolic effects. Levels of glycated hemoglobin
were lower in participants on ramipril than in participants on placebo during the first 2 years of
the study. It is important to note that the HOPE Study did not compare ramipril with another
active agent and that the study was clearly not designed as a trial to control blood pressure or to
be relevant to people with hypertension only(36).
Other large studies have carefully compared the benefits of an ACE inhibitor with those
of other antihypertensive drugs in people with diabetes and hypertension.These studies were
carefully sought and analyzed in a systematic overview by Pahor et al. in this issue of Diabetes
Care. All randomized controlled trials that included hypertensive patients with type 2 diabetes
and compared an ACE inhibitor with another active therapy for the treatment of hypertension
were included in the overview if they reported a follow-up dura-tion of 2 years and assessed the
development of cardiovascular events(36).

Four clinical trials were identified that studied a combined total of 2,180 individuals for a
follow-up of 13,300 person-years. ACE inhibitors were compared with calcium channel
blockers,B -blockers, or diuretics in these studies. Comparable blood pressure reduction was
achieved in both arms.All of the studies, except for the hypertension component of the U.K.
Prospective Diabetes Study (UKPDS), had consistent findings and, when meta-analyzed,
demonstrated an overall relative-risk reduction of 51% (95% CI 3364) for cardiovascular events
and 43% for all-cause mortality. The UKPDS was not combined because it was statistically
heterogeneous in comparison with the other 3 studies. Although the authors provide several
explanations for this heterogeneity, the reason remains unclear and is likely to not be resolved
until further trials are published(36).

Studies in patients with left ventricular dysfunction have suggested the possibility that
ACE inhibitors decrease the frequency of ischemic events. For example, in the SAVE and
SOLVD trials, ACE inhibitors reduced the incidence of recurrent MI and angina in patients with
left ventricular dysfunction or mild congestive heart failure by >20%(37)(38). Nevertheless, it is

12

not known whether ACE inhibitors will prevent ischemic events in patients with normal
ventricular function.
However, there is experimental evidence that ACE inhibition can retard the development
of atherosclerosis. In animal models of atherosclerosis, including apolipoprotein E knockout
mice(39), Watanabe rabbits(40), and cholesterol-fed monkeys,(41) ACE inhibitors have been
shown to reduce the extent of vascular lesions. Furthermore, ACE inhibition has been shown to
reverse endothelial dysfunction in normotensive patients with CAD, in hypertensive patients, and
in patients with noninsulin-dependent diabetes mellitus(42) .ACE inhibition is thought to
improve endothelial function by attenuating the vasoconstrictive and superoxide radical
generating effects of Ang II while simultaneously enhancing the bradykinin-dependent induction
of endothelial nitric oxide production.

ACE inhibitors also promote ischemic preconditioning, probably through a bradykinin-mediated

mechanism(43). Studies in vitro and in humans suggest that ACE inhibitors favorably alter
fibrinolytic balance, both by decreasing Ang II, a potent stimulus to plasminogen activator
inhibitor synthesis(44)(45) ,and by increasing bradykinin, a potent stimulus to tissue
plasminogen activator secretion(46)(47). Several ongoing clinical trials are designed to address
the hypothesis that ACE inhibitors prevent ischemic events in high-risk patients without left
ventricular dysfunction(48)(49).
The RAS and increased glomerular capillary pressure have been implicated in the
progression of renal dysfunction due to a number of renal diseases, including diabetic
nephropathy(50) .ACE inhibitors decrease glomerular capillary pressure by decreasing arterial
pressure and by selectively dilating efferent arterioles(51).
In addition, Ang II causes mesangial cell growth and matrix production.(52)(53)
.Numerous animal studies and small clinical trials have suggested that ACE inhibitors
significantly reduce the loss of kidney function in diabetic nephropathy(54).
13

These medicines are used alone for high blood pressure, or they are used with other
medicines such as a diuretic. ACE inhibitors are a good choice for people who have had a heart
attack, because the medicine helps reduce the workload on the heart. Also a good choice for
people who have diabetes, because this medicine does not affect blood sugar levels and may help
protect the kidneys. ACE inhibitors may also help to prevent a heart attack or stroke.

1.4.Adverse effects of ACE inhibitors

All medicines have adverse effects. But many people don't feel the adverse effects,
or they are able to deal with them.ACE inhibitors have also some adverse effects.The adverse
effects of ACE inhibitors can be divided into those that are specific to the entire class and those
that are related to chemical structure (specifically, related to the presence of a sulfhydryl group).
Like all antihypertensive agents, These medicines are used alone for high blood pressure, or they
are used with other medicines such as a diuretic. ACE inhibitors can cause hypotension. The
frequency of hypotension is greater in renin-dependent states, such as during low sodium intake
and diuretic use, and it is recommended that lower starting doses be used under these conditions.
ACE inhibitors can cause hyperkalemia because of a decrease in aldosterone(55) .This effect is
usually not significant in patients with normal renal function. However, in patients with impaired
kidney function or in patients who are taking potassium supplements (including salt substitutes)
or potassium-sparing diuretics, hyperkalemia can occur(56) (57).

14

ACE inhibitors can cause a reversible decline in renal function in the setting of
decreased renal perfusion, whether this is due to bilateral renal artery stenosis(58),severe
congestive heart failure(59), or volume depletion(60). When perfusion pressure or afferent
arteriolar pressure is decreased in the glomerulus, glomerular filtration is maintained by efferent
arteriolar vasoconstriction, . The mechanism is not known but may involve increased levels of
bradykinin or substance P and stimulation of vagal C fibers(61).
Dry ,irritant cough is a common adverse effect of ace inhibitor. The frequency of cough
varies among different patient populations; the rate appears to be 10% in white populations but
may be as high as 44% in Asian populations(62). Cough is more frequent among women than
men(63) (64). The cough tends to be a dry, mildly annoying cough, but it often requires cessation
of therapy.

Angioedema is a rare but potentially life-threatening adverse effect of ACE

inhibitors(65). It is characterized by localized swelling of the lips, tongue, mouth, throat, nose, or
other parts of the face(66). The mechanism appears to involve bradykinin or one of its
metabolites(67).

The rate of angioedema has been reported to be 1 to 2 per 1000 in primarily white
populations, but appears to be increased in blacks.160 Although the rate of angioedema is highest
within the first month of ACE inhibitor use, angioedema may occur years after the initiation of
therapy(68). Therefore, patients should be advised to recognize early warning signs of localized
edema and to discontinue the drug should they occur.
If administered in the second or third trimester of pregnancy, ACE inhibitors can cause a
number of fetal anomalies, including oligohydramnios, fetal calvarial hypoplasia, fetal
15

pulmonary hypoplasia, fetal growth retardation, fetal death, neonatal anuria, and neonatal
death(69) (70). For this reason, ACE inhibitors should be used with caution in women of childbearing potential and must be stopped immediately in any woman in whom pregnancy has been
diagnosed.
Adverse effects that appear to be related to the presence of a sulfhydryl group are
neutropenia, nephrotic syndrome, and skin rash(71). Neutropenia occurs in <0.05% of
patients(72). The incidence is higher in patients who have renal insufficiency or collagen
vascular disease(73) (74). Skin rash occurs in 1% of patients(75) and usually consists of a
pruritic maculopapular eruption; rarely, exfoliativedermatitis has been reported. The rash appears
to be dose related.

1.5.Adverse effects caused by genetic polymorphism

Different studies show that these adverse effects of ace inhibitors are not common in all
people.genetic polymorphism can be a cause of these adverse effects.It has been suggested that
the response to drug therapy may be influenced by genetic polymorphisms in different ways.
Patients vary widely in their response to drugs. Having an understanding of the
pharmacokinetic and pharmacodynamic properties of various medications is important when
assessing ethnic differences in drug response. Genetic factors can account for 20 to 95 percent of
patient variability(76).

16

Genetic polymorphisms for many drug-metabolizing enzymes and drug targets (e.g.,
receptors) have been identified. Although currently limited to a few pathways, pharmacogenetic
testing may enable physicians to understand why patients react differently to various drugs and
to make better decisions about therapy. Ultimately, this understanding may shift the medical
paradigm to highly individualized therapeutic regimens(76).
Several factors may be expected to play a dominant role in determining the response of a
patient to therapy. In particular, in the case of ACE inhibition, genetic factors within the RAS
pathway are likely to affect its pharmacodynamics and clinical efficacy. Genetic factors causing
differences in drug absorption and metabolic clearance are also relevant.However, until now
there are no strong leads to explore this pharmaco-genetically since there are no metabolic (CYP)
genes linked specifically to ACE-inhibitors, although this might also be a relevant pathway to
investigate in future research(77).

The study of genetic variations in drug response is called pharmacogenetics when

studying an individual gene, or pharmacogenomics when studying all genes. A person's genotype
is his or her genetic makeup. The term can pertain to all genes or to a specific gene. The
phenotype is a person's outward physical appearance or function resulting from the interaction
between the genotype and the environment. Genetic polymorphisms are naturally occurring
variants in gene structure that occur in more than 1 percent of the population. Polymorphisms
may influence a drug's action by changing its pharmacokinetics or its pharmacodynamics(76).
Firstly, pharmacodynamics may be affected by polymorphisms in the genes of all the
proteins involved in the RAAS system and related systems, including receptors and signal
transduction molecules. Secondly, variations in drug absorption and metabolic clearance may
cause interindividual variation in pharmacokinetics. Thirdly, variations within genes of the

17

RAAS system and related systems may influence atherosclerosis (underlying disease process)
and inherent differences in the susceptibility to therapeutic agents such as ACE inhibitors(78).
Angiotensin II (AGT II) is the central component of the RAS pathway, one of the most
important physiological pathways affecting the cardiovascular system and fluid and electrolyte
balance is the renin angiotensin system (RAS) which, in parallel with kinins, has diverse
regulatory roles in vasoconstriction, cell proliferation, and secretion of aldosterone from the
adrenal gland(79,80) .
It acts through two main receptors: the angiotensin II type I receptor (AGTR1 or AT1R) and the
angiotensin II type II receptor (AGTR2). It is generally believed that AGTR1 is the dominant
receptor in the cardiovascular system(7981).AGTR1 is located on 3q2325(82) and spans about
60 kb including five exons and four introns. Exon sizes range from 59 to 2014 bp. Exon 5 is the
largest and the only coding exon, while the first four exons encode a 5 untranslated region
(UTR)(8385).AGTR1 is expressed in different organs including the heart, skeletal muscle,
brain, human liver, lung, and adrenal gland. This receptor is included in the guanyl nucleotide
binding protein (G-protein) coupled receptor superfamily for which the intracellular messengers
are phospholipase, calcium, and protein kinase(86,87) .

Many polymorphisms in genes of the RAS pathway have been identified. In AGTR1
(GenBank accession no. AF245699), A1166C (single nucleotide polymorphism (SNP) ID:
rs5186) represented in the 3 UTR of the mRNA has been widely studied. It has been associated
with phenotypic effects including essential hypertension,(88-90) systolic blood pressure,(91)
myocardial infarction, left ventricular hypertrophy,(97) coronary artery disease (CAD),(92,93)
pre-eclampsia,(94) pulse wave velocity in Caucasian subjects,(95-97) and also stroke in Japanese
subjects(98).
Single nucleotide polymorphisms, frequently called SNPs (pronounced snips), are the
most common type of genetic variation among people. Each SNP represents a difference in a
single DNA building block, called a nucleotide. For example, a SNP may replace the nucleotide
18

cytosine (C) with the nucleotide thymine (T) in a certain stretch of DNA. SNPs occur normally
throughout a persons DNA. They occur once in every 300 nucleotides on average, which means
there are roughly 10 million SNPs in the human genome. Most commonly, these variations are
found in the DNA between genes. They can act as biological markers, helping scientists locate
genes that are associated with disease. When SNPs occur within a gene or in a regulatory region
near a gene, they may play a more direct role in affecting the genes function,as a result disease
can occureor the body shows some adverse effects to the drugs.

1.6.Adverse effects and SNP in AGTR1 gene

More than 150 candidate genes have been implicated in the regulation of blood pressure
that is linked to several pathways. Among these genes, RAS has significant direct involvement in
the BP regulation as it is reported in several studies and most of the antihypertensive drugs are
targeting this system. The genetic variation of RAS encoding genes, angiotensinogen (AGT),
angiotensin-1-converting enzyme (ACE), and angiotensin II type 1 receptor (AGTR1), were
associated with EHT and have been important genes for the association studies in various
populations (99-101).among them AGTR 1 gene has a significant effect on inducing ACEI
related adverse effects.
If single neucleotide polymorphism is occurred in a gene called AGTR 1 gene ,then ace
inhibitors can show some adverse effects.
The AGTR1 gene provides instructions for making a protein called the angiotensin II
receptor type 1 (AT1 receptor) .This protein is part of the renin-angiotensin system, which
regulates blood pressure and the balance of fluids and salts in the body. Through a series of steps,
the renin-angiotensin system produces a molecule called angiotensin II, which attaches (binds) to
the AT1 receptor, stimulating chemical signaling.This signaling causes blood vessels to narrow
(constrict), which results in increased blood pressure. Binding of angiotensin II to the AT1
receptor also stimulates production of the hormone aldosterone, which triggers the absorption of
water and salt by the kidneys.The increased amount of fluid in the body also increases blood
pressure. Proper blood pressure during fetal growth, which delivers oxygen to the developing
tissues, is required for normal development of the kidneys, particularly of structures called the
19

proximal tubules, and other tissues. In addition, angiotensin II may play a more direct role in
kidney development, perhaps by affecting growth factors involved in the development of kidney
structures(102).
The agtr1 gene belongs to a family of genes called GPCR .variation in the agtr1 gene have
been reported to be associated with anincreased risk of aform of high biood pressure called
essential hypertension; heart disease;ordiabeticnephropathy,a complication of diabetes that
affects kidney function (102).
rs5186, a SNP known as +1166A/C or A1166C, is located in the 3' untranslated region of the
angiotensin II receptor type 1 gene AGTR1, which is also known as AT2R1 or AT1R. It is among
the most studied of over 50 SNPs in AGTR1(103).
In previous studies, several genetic polymorphisms in RAAS genes have been associated
with high blood pressure levels or an increased cardiovascular risk (104,105). Nearly all these
studies focused at two polymorphisms, the ACE I/D polymorphism and the M235T
polymorphism in the angiotensinogen gene.
Because of limited power, due to limited study sample size, results have been inconsistent
and the underlying questions not answered adequately. With regard to interaction between
genetic factors and treatment response, the results are scarce. No prior studies have been
performed yet with ACE-inhibitors at a large scale neither in a randomized setting nor in stable
CAD (one of the major indications of ACE-inhibitors).
Another important limitation of prior research in cardiovascular pharmacogenetics is the
investigation of one or two polymorphisms within only one gene, thereby ignoring the welldocumented feedback mechanisms within the RAAS and the fact that there are two angiotensin
II receptors (AT1 and AT2), which have counteracting effects also in humans. We suggest that a
more comprehensive coverage of genetic variation in multiple RAAS genes is needed, by using a
correct haplotype approach. This is achieved by using the latest information on genetic variation
and linkage disequilibrium patterns in the selection of haplotype-tagging SNPs.
New approaches to guiding ACE inhibitor therapy We used more patient-specific
characteristics such as patients genetic information (DNA). Pharmacogenetics is aimed to
20

understand why some drugs work better for some people than others and why some people are
more likely to experience side effects. If genetic factors are indeed related to drug response,
pharmacogenetic profiling might be a new way to reach significant advances in individualised
cardiovascular medicine. Currently, pharmacogenetic research of ACE inhibitors is rare. In
general, it is expected that the response of a patient to therapy can be influenced by several types
of genetic factors.

We constructed a pharmacogenetic risk score by combining the unfavourable alleles of

the treatment effect modifying SNPs (106). Unfavourable alleles were associated with
diminished treatment effect as observed in the overall study group. The pharmacogenetic risk
score demonstrated a decrease in the level of treatment benefit of perindopril with an increasing
number of unfavourable alleles. In patients with no unfavourable alleles, a much more
pronounced treatment benefit was observed as compared with the overall study result (which
yielded a 20% relative risk reduction). By combining pharmacogenetic risk scores, we observed
that the treatment benefit was concentrated in about 3 out of 4 of the patients and absent in 1 out
of 4 of the patients (106). This is the first time that subgroups of responders and non-responders
to ACE inhibitor treatment have been identified. An interaction effect of similar direction and
magnitude was observed in Selected candidate genes in the reninangiotensinaldosterone system .
The AT1 receptor A1166C single nucleotide polymorphism (SNP) (rs5186) is located in
the 3 untranslated region (UTR) on the q22 band of chromosome 3. Previous studies have shown
that the AT1-1166 CC polymorphism is associated with endothelial dysfunction, early
development of hypertension, coronary atherosclerosis, MI, and left ventricular dysfunction
(107, 108). This is believed to be related to changes in the density of AT1 receptors in target
tissues, resulting in increased sensitivity to AT II (109111) and subsequent activation of
heterotrimeric G proteins and production of second messengers, such as inositol trisphosphate,
diacylglycerol and reactive oxygen species (112). Recently, it was shown that AT1R expression
could be regulated by miR-155 through binding to the AT1R mRNA 3UTR, at the site of the
AT1-A1166C SNP (113). Importantly, in the presence of the A allele, miR-155 is able to bind to
the AT1R mRNA and suppress AT1R expression. In contrast, the C allele interrupts the base
pairing complementarity of miR-155 with the AT1R mRNA sequence, and miR-155 is
21

considerably less effective at suppressing AT1R expression (113, 114, 115). Thus, altered
regulation by miR-155 is one mechanism by which the AT1-1166 CC polymorphism can lead to
increased expression of the AT1R and cardiovascular disease. ]. Functionality of this SNP is at
this moment unknown, but more basic research has been started based on these findings. As the
AT1 receptor is involved in the direct effects of angiotensin II, it can be hypothesised that genetic
variants in the AT1 receptor will influence the response to an ACE inhibitor(106).

The goal of the present analysis is to assess the effect of singlenucieotide polymorphism
in AGTR 1 gene( at rs number ) and its effect on ace inhibitor induced adverse effects in
Bangladeshi population. In this case-control study, we examined single nucleotide
polymorphism of AGTR1 genes and ACEI induced adverse effects in the Bangladeshi
population age between 30 and 70 years.
We advocate that future large-scale randomised clinical trials should also integrate a
pharmacogenetic analysis in their trial design to prospectively test treatment efficacy in a similar
way. Pharmacogenetic analyses of clinical trials truly open up a perspective to individualise
preventive therapy in patients with cardiovascular disease. Physicians will be able to predict the
response to treatment (responders and non-responders) in advance, before starting prescription.
Individualised therapy by pharmacogenetic profiling will avoid unnecessary treatment of nonresponding patients and considerably reduce healthcare costs.

22

CHAPTER 2
METHODES AND MATERIALS

23

2.METHODES AND MATERIALS:

2.1.Study Population
We retrospectively studied the genetic susceptibility to ACE inhibitorinduced adverse
effects in hypertensive patients by examining the AGTR1 receptor gene polymorphism. The
participants were randomly selected Bangladeshi outpatients at Dhaka Medical Collage Hospital
in Dhaka, Bangladesh.

We classified the study population into 2 groups. These 2 groups included a combined
total of _ patients, with and without cough (cough + and cough -, respectively), who had been
given ACE inhibitors for the treatment of essential hypertension. They were all essential
hypertensive subjects free of complications such as ischemic heart disease, hyperlipidemia, and
24

diabetes mellitus. None had any history of recent respiratory infection, other respiratory diseases,
or pulmonary congestion. In the cough +patients , previous therapy with ACE inhibitors had to
be withdrawn because of the development of a cough within 2 weeks after starting therapy.
These patients had complained of dry cough, and all of their symptoms disappeared soon after
withdrawal of the ACE inhibitors. The cough-patients , age- and gender-matched to the
cough+patients, had no complaints of cough and other unwanted effects and continued the ACE
inhibitor regimen for the treatment of essential hypertension.
Blood pressure was measured with each subject in the sitting position after 15 minutes of
rest. Blood samples were obtained after a fast of at least 12 hours. Written informed consent is a
form regarding the approval of the patients was obtained from each subject for participation in
the study.

2.2. Materials

Instruments

Sources

Refrigerated Bench-Top Centrifuge

Germany

Mini Gradient Thermal Cycler

USA

Alpha Imager HP (Gel Doc. System)

USA

Gel Electrophoresis Machine (Elite)

Germany

UV Spectrophotometer

Shimadzu, USA

PH Meter

Italy

Distillation Plant (Distinction D4000)

China

Micropipette

USA

Freeze ( 800 C)

Sweden

25

Microcentrifuge Machine

Germany

Freeze ( 200 C)

USA

Vortex Mixer Machine (Rotamixer-9590)

UK

Autoclave Machine

Korea

Incubator

UK

2.3. Consumable materials

Materials

Sources

Reagent Bottle (250, 500, 1000 ml)

German

Conical Flasks

Germany

Pipettes (Precicolor)

Germany

Eppendorf Tube (1.5 ml)

Germany

Pipette Tips

USA

PCR Tubes (0.2/0.5 ml)

USA

Falcon Tubes (50 ml)

China

Polypropylene Tubes (15 ml)

China

2.4. Chemicals and reagents

26

2.4.1 Agarose

Gel Strength
Type

DNA Size (kbp)

(gm/cm2)

HS

0.5-30

2000 (1.5%)

1-200

2800 (1.5%)

0.01-1.0

1000 (3.0%)

1600

0.01-1.0

1400 (1.5%)

2.4.2. Other Reagents

Reagents

Sources

Triton-X 100

USA

Sodium Lauryl Sulphate

USA

Ethanol

USA

Chloroform

USA

Sodium Perchlorate

USA

27

USA

Glacial Acetic Acid

Sodium Chloride

USA

Sucrose

USA

Magnesium Chloride

USA

Tris-HCl

USA

EDTA-Na2

USA

Nuclease Free Water

USA

Ethidium Bromide

UK

Standard Reaction Buffer

US
A

MgCl2 Solution

US
A

Deoxyribonucleotide Solution Mix (dNTP)

US
A

Quick-Load 50bp DNA Ladder

US
A

100 bp DNA ladder

US
A

2.5. Restriction enzymes

28

Name
TAE Buffer (10x)
TBE Buffer(10x)

2.6. Solutions

TE Buffer(1x)

2.7. Methods of genotyping

Venous blood collection from the volunteers

Genomic DNA isolation from the blood samples
Quantification of Genomic DNA & agarose gel
Electrophoresis
PCR for amplification of polymorphic genes
Agarose gel electrophoresis of PCR products
Restriction enzyme digestion of the PCR products
Agarose gel electrophoresis

29

2.7.1 Blood collection

Venous blood (3 ml) was collected from all cases in sterile tubes containing EDTA-Na 2 and
stored at -80C until DNA extraction.
2.8. Preparation of DNA Isolation Reagents
2.8.1. Cell Lysis Buffer
To prepare 1 L buffer, 10 mM Tris-(hydroxymethyl)-amino methane, 320 mM Sucrose, 5 mM
MgCl2 were taken in a 1L buffer container and it was diluted to 850 ml with Milli-Q water. pH
was adjusted to 8.0 by adding Glacial acetic acid. After autoclaving 1% Triton X-100 was added
to it and the total solution was made up to 1L by Milli-Q water and it was stored at 4C.
2.8.2. Nuclear Lysis Buffer
400 mM Tris-(hydroxymethyl)-amino methane, 60 mM EDTA-Na2 , 150 mM Sodium chloride
were taken in a 1L buffer container and it was added to 850 ml with Milli-Q water. pH was
adjusted to 8.0 by adding Glacial acetic acid. After autoclaving, 1% Sodium lauryl sulphate was
added to it and the total solution was made up to 1L by adding Milli-Q water and stored at room
temperature.
2.8.3. Sodium Perchlorate (5 M)
61.22 gm of Sodium perchlorate was dissolved in 100 ml Milli-Q water and stored at 4C.

2.8.4. Tris-EDTA (TE) Buffer (1x)

10 ml of 1M Tris - (Hydroxymethyl) - amino methane and 2 ml of 500 mM EDTA-Na 2 were
mixed in buffer container and then diluted to 1L by adjusting pH to 8.0 and stored at 4C. The
final concentration of Tris - (Hydroxymethyl) - amino methane and EDTA-Na 2 were 10Mm and
1mM respectively.
30

2.8.5. TAE buffer (10x)

0.4 M Tris -(Hydroxymethyl)-amino methane, 11.4 %( v/v)/0.2 M Glacial acetic acid and 0.01
M EDTA-Na were taken in a buffer container and diluted to 1L after adjusted pH to 7.6 and
stored at 4C.
2.9 Genomic DNA isolation procedure
1. 3 ml blood was taken in a 50 ml Falcon centrifuge tube containing 2 mg of EDTA.
2. 20 ml Lysis Buffer was added to it and it was mixed gently for 2 minutes by inversion. It was
then centrifuged for 10 minutes at 3000 rpm at 4C by using UNIVERSAL 240V 50i60Hz
Refrigerated Bench-Top Centrifuge Machine (Hettich GmbH & Co., Germany).
3. The supernatant was discarded into a bottle containing enough savlon. The pellet was
collected.
4. 2 ml Nuclear Lysis Buffer and 0.5 ml of 5 M Sodium Perchlorate were added to it.

5. Then the tube was mixed in a rotary mixture at room temperature for about 15 min so that
pellet was dissolved completely.
6. Then the sample tube was incubated at 65C for 30 min.
7. Then 2.5 ml of chilled Chloroform was added to it.
8. Then it was mixed in a rotary mixture for 10 min at room temperature.
9. Then the tube was centrifuged at 1500 rpm for 5 min. (37C).
10. The DNA containing phase (uppermost phase) was transferred to a fresh autoclaved 15 ml
polypropylene tube using a disposable Pasteur pipette.
11. Two volumes of Ethanol (double that of DNA phase) was added to it.
12. It was then mixed immediately by slow gentle inversion until all cloudiness was disappeared.
13. DNA was seen to come out of the solution as a white cotton-wool pellet.
14. The white cotton-wool pellet was collected with a disposable microbiology loop.
15. The loop was air dried.
16. The DNA was dissolved in 5 mM Tris-HCl Buffer contained in a 1.5 ml screw cap tube.
31

17. Then the tube was kept at 65C overnight.

18. Then it was taken back and was stored in Freezer(-20C).
2.10. Quantification of Genomic DNA
The quantity and purity of DNA isolated from blood samples were assessed by using a
UV Spectrophotometer (UV Prove v2.1) at 260 nm. In order to ensure complete sample
homogeneity, which is critical when measuring genomic DNA concentration and purity
with this instrument, samples were very gently shaken on a vortex shaker for approximately 30
minutes before measurements were taken. A sample volume of 1.5 to 2 l was pipetted onto the
fibre optic measurement surface. Working solutions of genomic DNA were made up to a standard
concentration of 50 ng/l with Nuclease free water, except in cases where the sample had an
initial concentration of less than 50 ng/l, in which case an undiluted aliquot was taken as a
working solution.
For calculation of DNA concentration of samples free of RNA, the following conversion factor is
used: 1 OD260 = 50 mg of DNA/ml.DNA concentration in g/l was calculated as follows:

OD260/OD280 should be = 1.7-1.9 (OD=Optical density)

A value out of this range is not acceptable. It may indicate that the DNA sample is not in solution
or that there are contaminants (i.e., protein) in the sample that may inhibit subsequent reactions.
All working solutions of genomic DNA were stored at -20C until genotype analysis.

The purity and integrity of isolated genomic DNA were also assessed by means of agarose gel
electrophoresis. A sample volume of 5 l (50-70 ng/l) was resolved on a 2% (w/v) agarose gel.
2.11. Genotyping of Single Nucleotide Polymorphism (SNPS) of genes

32

In order to facilitate the accurate genotyping of the volunteers DNA samples for the selected
SNPs, PCR-RFLP was employed due to its affordability, efficiency, ease of use and reliability.
This method of genotyping produces the restriction enzyme (REase) digestion of polymerase
chain reaction (PCR) amplification product. The subsequent digestion or lack of digestion, of
PCR amplification product due to the presence or absence of an SNP within the REase
recognition site allows for accurate and reliable genotyping and the consequent determination of
SNP frequencies within a sample cohort. The classification of an SNP genotype as wild-type or
variant was done according to accepted nomenclature and the relevant reference sequences
available from the National

Centre

for

Biotechnological Information (NCBI)

Entrez

Nucleotides Database (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide).

2.11.1 DNA Amplification by PCR (Polymerase Chain Reaction)
The relevant genomic target regions, containing the SNPs of interest, were amplified by means
of primer-directed PCR using thermo stable DNA polymerase, as originally described by (Saiki
et al., 1985; Saiki et al., 1988).

This primer-directed PCR method facilitates the in vitro amplification of single-copy genomic
DNA sequences by a factor of more than ten million with extremely high sequence specificity.
2.11.2 Primer Design
There are some guidelines for primer design:
i.
ii.

PCR primers should be generally 15-30 nucleotides long.

Optimal GC content of the primer is 40-60%. Ideally, C and G nucleotides should

iii.

be distributed uniformly along the primer.

Should avoid placing more than three G or C nucleotides at the 3-end to lower

iv.

the risk of non-specific priming.

Should avoid primer self-complementarities or complementarities between the

v.

primers to prevent hairpin formation and primer dimerization.

Should check for possible sites of non-desirable complementarities between
primers and the template DNA.

33

vi.

Differences in melting temperatures (Tm) of the two primers should not exceed
5C.

By considering all the factors, the primers for the study were designed. The sequences of the
primers used and their sizes are presented in Table 2.4

Table 2.1: Name of the allele, sequence of the designed primer with their size and melting
point.
No

Allele
AGTR1
(rs5186)

FP
AGTR1
(rs5186)

Primer Sequence

M.T

Size

(C)

(Bp)

5-GGTTGAGGAGTTGGCTCTGC-3

5-ATGAACTCCTGGGGGACGGT-3

RP
FP=Forward Primer; RP=Reverse Primer; M.T=Melting Temperature
Primers are obtained from Jena Bioscience.

2.12. Required Conditions for PCR

. Primers were designed from the agtr1 receptor gene . The total reaction volume was 100 L in a
mixture containing 1 g of genomic DNA, 50 ng of each primer, 200 mol of each dNTP, 1.5
mmol/L of MgCl2, and 0.5 U of Taq DNA polymerase. Cycle conditions for PCR were initially 5
34

minutes at 94C, followed by 1 minute at 94C, 30 seconds at 58C, and 30 seconds at 72C for
30 cycles, with a final extension time of 5 minutes at 72C.
PCR conditions to synthesize various alleles with their respective lengths are given in Table-2.5.

Table 2.2: PCR conditions to synthesize various alleles and their respective lengths.

POLYMORPH

AGTR1
(rs5186)

PCR Conditions
(35 Cycles)

Size of PCR
Products
(bp)

940C For 30s

630C For 45s
720C For 2min

35

281

2.13. Restriction Enzyme Digestion

After PCR amplification, 25 l of the PCR products were digested with approximately 1 unit of
respective restriction enzyme obtained from New England BioLabs

Inc., UK. Incubation

conditions are listed in Table 2.6. Electrophoreses was done for the digested products using 2%
agarose gel.
Table 2.3: The restriction enzymes, digestion condition and length of the expected
fragments on digestion to diagnose genes:

SNP

AGTR1
Rs5168

RESTRICTION

DIGESTION

ENZYME

CONDITIONS

Incubation at 37C

HaeII

overnight

EXPECTED
FRAGMENTS
(bp)
NH: 281
HE: 104 ,177,281
MH: 177,104

NH: Normal Homozygote; HE: Heterozygote; MH: Mutant Homozygote

2.12. Visualization of PCR Products and REase Digestion Fragments

PCR amplification products were visualized by means of agarose gel electrophoresis in order to
allow for size estimation and thus confirmation of amplification of the desired genomic target
region. REase digestion fragments that were of sufficient size (>100 bp) and size differential
between fragments (>30 bp) were also visualized on agarose gel. EZ Load Molecular ruler
(100 bp) was used for size estimation of PCR amplification products, which served as
confirmation that amplification of the desired genomic target region had occurred, as well as for
quantification of PCR product prior to REase digestion reactions. EZ Load 100 bp DNA ladder
36

was also used for size estimation of all REase digestion fragments, allowing for accurate and
reliable genotyping of samples. EZ Load 100 bp DNA ladder is thus evident in lane 1 of all
agarose gel photos. All agarose gels were visualised under ultraviolet (UV) light and photographed
with a Gel Documentation and Analysis System.
2.15. Gel Electrophoresis
Electrophoresis is a method of separating substances based on the rate of movement while under
the influence of an electric field. Agarose gel electrophoresis of DNA is used to determine the
presence and distinguish the type of nucleic acids obtained after extraction and to analyze
digestion products. Desired DNA fragments can be physically isolated for various purposes such
as sequencing, probe preparation, or for cloning fragments into other vectors. Both agarose and
polyacrylamide gels are used for DNA analysis. Agarose gels are usually run to size larger
fragments (greater than 200 bp) and polyacrylamide gels are run to size fragments less than 200
bp. Typically agarose gels are used for most purposes and polyacrylamide gels are used when
small fragments, such as digests of 16S rRNA genes, are being distinguished. Regular agarose
gels may range in concentration from 0.6 to 3.0%.
Agarose is a polysaccharide purified from seaweed. An agarose gel is created by suspending dry
agarose in a buffer solution, boiling until the solution becomes clear, and then pouring it into a
casting tray and allowing it to cool.

The result is a flexible gelatine-like slab. During

electrophoresis, the gel is submersed in a chamber containing a buffer solution and a positive and
negative electrode. The DNA to be analyzed is forced through the pores of the gel by the
electrical current.
Under an electrical field, DNA will move to the positive electrode (red) and away from the
negative electrode (black). Several factors influence how fast the DNA moves, including; the
strength of the electrical field, the concentration of agarose in the gel and most importantly, the
size of the DNA molecules. Smaller DNA molecules move through the agarose faster than larger
molecules. DNA in the gel will be visualized by the use of Ethidium Bromide, added to the gel.
Ethidium bromide binds to DNA and illuminates when exposed to ultraviolet light, causing the
DNA to glow.

37

All PCR products were resolved by electrophoresis in 2% (w/v) agarose gel at 80 volts
(V). The REase digestion fragments were also observed in 2% (w/v) agarose gel. All REase
digestion fragments were resolved at 80 V, so as to ensure sufficient resolution to allow for
accurate genotyping.
2.16. Agarose Gel Electrophoresis Procedure:
All

agarose

gels

were

made

with

and

resolved

in

1X

tris

acetate

ethylenediaminetetraacetic acid (TAE) buffer, which was made and stored as a 10X stock
solution and diluted to the required working concentration as was needed. In order to facilitate
the visualization of DNA within the agarose gel under UV light, 1 g of ethidium bromide (EtBr)
per ml agarose solution was added -i.e. 0.01% (v/v) EtBr stock solution (10 mg/ml)
Procedure:
A. Casting a gel
1. An appropriate volume of 1X Tris-acetate-EDTA (TAE) buffer with an appropriate amount of
agarose (these values are determined based on the gel dimensions and the desired percentage of
agarose) was mixed in a conical flask. The flask was swirled to evenly distribute the agarose.
2. The solution was then heated in the microwave oven for 1 minute. Protective gloves were
worn and the flask was removed from the microwave oven (before it boiled over), swirled, and
reheated while keeping constant watch to be sure it did not boil over. When it started to boil,
boiling was stopped and swirled again repeating the process until all of the agarose went into
solution.
3. The flask was allowed to cool. The gel was poured when the temperature of the solution was
55-65 C.
4. The gel apparatus was prepared for casting the gel while the agarose was cooling.
5. Prior to pouring the gel, Ethidium bromide was added to the dissolved agarose and swirled to
mix.
6. The gel was poured into the casting tray and the comb was adjusted to keep the wells
perpendicular. The gel was allowed to cool and was hardened (20-30 minutes) prior to use.

38

B. Preparing the gel for electrophoresis

8. A few ml of 1X TAE buffer was added to the well area of the gel and the comb was carefully
removed by pulling straight up.
9. The electrophoresis tank was filled with buffer solution (1X TAE) and the gel was placed (In
the casting tray) on the tank platform.
C. Preparing samples for loading/running the gel
10. An appropriate volume of loading dye (6X) was added to the sample (1 l of 6X sample dye
for every 5 l of sample).
11. The sample was loaded using a 1-10 l micropipette. The marker was also loaded at Lane-1.
12. After the gel had been loaded, the cover was gently placed on the apparatus and the
Power leads were hooked up. The power was adjusted to 80 volts (constant voltage). The gel was
run until the first dye front (bromophenol blue) had migrated about two-thirds
the length of the gel and the second dye front (xylene cyanol) had migrated approximately onethird of the length of the gel.
13. The power was turned off before removing the gel for photographing.
14. The gel was placed on the UV transilluminator to visualize the DNA.

2.15 Study End Point

Prospective study was done to evaluate the role of the AGTR1 polymorphism in the response
of the adverse effects of ACE inhibitor. Patients were divided into two groups as responders and
non-responders . In the second part of the study, the role of the selected polymorphisms on
AGTR1 were evaluated on the patients. Patient showing different drug induced adverse effects
were assessed according to the Common Terminology Criteria for Adverse Events.

39

40

CHAPTER 3
RESULT AND DISCUSSION

41

Result and Discussion

Result

3.1.PCR-RFLP of Gene AGTR1(rs5186):

GAGCCATATTCTCAGAAGGGAGATCAAG
GACCACGCTTGTGATTTACTTCTGACTTCAGGAGCCACTTTCTGTCAGTGAA
ATTTCTCTTTTTGCTTCT
Insertion (A) type of

AGCACCGAGTGGATTTCCTTCAGCTGATGATTGACTCTCAGAATTCAAA
AGAAACTGAGTCCCACAAAGGTAACCAGAGTGTTTCTGAGGGCTACTT
GTGGGGCACTCAGAGGGAAGGCCTTGTTCTGAAAATGTGCAGGAAGTATTC
CAGGATGATGAGAATTTCTGCCACATAGCAGAACGACACATGTTTG
DARK RED---------------> PRIMER SEQUENCE
RED

--------------> EXON SEQUENCE

GREEN
YELLOW

--------------> OTHER POSSIBLE SNPs

--------------> SNP OF INTEREST

By using the appropriate pair of primers and other PCR reaction program
parameters the PCR product of AGTR1 was obtained. The PCR product size was
290 bp.
42

300 bp
200 bp
100 bp

290 bp

Figure 3.8: PCR product of AGTR1 (290bp) (Lane 3 to 8) (2% w/v agarose gel) (Lane-1
contains Molecular ruler; Lane-2 contains Control-No DNA).

Fragmentation Pattern:
The PCR product was digested with HinfI. The fragments were observed in
agarose gel (2%) as well as polyacrylamide gel (10%).

Table 3.10: Name of the restriction enzyme with its sites of digestion.
Restriction enzyme

Sites of digestion

HinfI

43

Table 3.11: Type of nucleotide changes, cutting sites and fragments of the allele in
case of normal homozygote, heterozygote, and mutant homozygote.
Changes
When there is no

Fragments
129,24,137

insertion

Type
Normal

Reference

Homozygote

(AC/AC)
When insertion of A

129,24,137

occurs

153,137

(AC/AAC)
When insertion of A

153,137

Heterozygote

Rais et al., 2006

Mutant

occurs

Homozygote

(AAC/AAC)

Observed Results:
Restriction enzyme digestion products were visualized in agarose (2%) as well as
polyacrylamide gel (10%). Very small fragment (24 bp) was not observed in the
gel.
Table 3.12: Name of the allele, PCR product size, restriction enzyme, length of
the expected and observed fragments on digestion.
Allele Name

PCR Product

AGTR1

Size (bp)
290

RE
HinfI

Expected Fragments
(bp)
NH 137, 129, 24

Observed
Fragments (bp)
137, 129, 24

HE153, 137, 129, 24

MH 153,137
NH: Normal Homozygote; HE: Heterozygote; MH: Mutant Homozygote

For all the volunteers 137, 129, 24 bp fragments were obtained i.e. all the samples
are normal homozygote.

44

300 bp

200 bp
137
bp
100 bp

129

Figure 3.9: Restriction Endonuclease (HinfI) digestion fragment of AGTR1 (Lane 3 to 10) (10%
Polyacrylamide gel) (Lane-1 contains Molecular ruler; Lane-2 contains Control-PCR product).

Individual Results:
SERIAL
NO

Type of Allele
CODE

1
2
3
4
5
6
7
8
9
10

M3
M4
M5
M6
M7
M8
M9
M10
M11
M12
45

*
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH

11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30

M13
M14
M16
M20
N4
N5
N6
N7
N9
N10
N11
N12
N13
N14
N15
N16
N17
N18
N19
N20

NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH
NH

NH=NORMAL HOMOZYGOTE

46

Summary of Genotyping Results

Table 3.7: Identification of each allele present in each DNA sample.
Allele

RE

PCR

Expected

Observed

Conclusion about

product

fragments

fragments

samples

size (bp)

(bp)

for all
samples

AGTR1

HinfI

290

NH 137, 129, 24
HE153, 137, 129,

137, 129,24

All are normal

homozygote.

24
MH 153,137
RE=Restriction enzyme; NH: Normal Homozygote; HE: Heterozygote; MH: Mutant
Homozygote

Discussion
In recent years, the clinical use of ACE inhibitors has been increasingly applied for the
treatment of hypertension, congestive heart failure, and myocardial infarction. The mechanism of
the benefit for left ventricular systolic dysfunction has been thought to be largely due to the
prevention of left ventricular dilatation and remodeling. The drawback, however, is that ACE
inhibitors have been reported to cause dry cough as a side effect in 1% to 33% of the patients.
Dry cough is the most common and unexplained symptom, and although it can often be
annoying, it seldom is harmful. Persistent cough, usually more severe at night, forces a
significant number of patients to discontinue use of the drugs. The cough may improve with a
reduction in the dose but is usually not wholly dose dependent.After withdrawal, it abates within
1 days to 4 weeks. The symptom seems to be more prevalent in females than in males; in most
larger studies, two thirds of the affected patients are females. The symptom is also more common
in nonsmokers than in smokers.

47

Despite considerable scientific investigation on the cause and mechanism of the dry cough
induced by ACE inhibition, the specific mechanism of this adverse effect is not fully understood.
It may be related to the genetic polymorphism of agtr1 gene. The accumulation of kinins has
been suggested to play a major role in these adverse effects of ACE inhibitors. The appearance of
a cough has been attributed to a possible local accumulation of bradykinin. A local accumulation
of bradykinin may lead to activation of a proinflammatory peptide (eg, substance P and
neuropeptide Y) and a local release of histamine, and those, in turn, may additionally induce
cough reflex hypersensitivity. For these reasons, most research on putative mechanisms has
focused on the effects mediated by bradykinin.
Moreover, it has been speculated that the occurrence of adverse effects of ACE inhibitors is
genetically predetermined. The candidate genes implicated thus far include variants of the genes
encoding the ACE gene,to determine whether genetic variants in the agtr1 receptor gene could
affect receptor expression and function and induce ACE inhibitorrelated cough, we
retrospectively studied the genetic susceptibility to ACE inhibitorrelated cough in patients with
hypertension by examining agtr1 receptor gene promoter polymorphism.
In the present study, we retrospectively investigated the genetic susceptibility to ACE inhibitor
related cough by examining agtr1 receptor gene promoter polymorphism. As a result, we found
that a genetic variation of the gene may explain the occurrence of this adverse drug reaction. This
genetic variation might be an effective predictor of ACE inhibitorrelated cough in advance.

48

CHAPTER 4
CONCLUSSION

Conclussion:
In the present study we showed a significant correlation between B 2 9/+9 and low ACE
activity and the development of ACE-AE and ACE-cough. Furthermore,no significant
association was shown between ACE I/D or B2 C-58Tgene polymorphisms and ACE-AE
49

and ACE-cough. The difficulty in elucidating the genetic basis of complex diseases is
entrenched in multiple factors that have an effect in the development of a disease. Therefore,
further studies should be carried out to determine whether the combination of genetic
polymorphisms might be risk factors for the development of both ACE-AE and ACE-cough.

As is clear from the above overview, in the study of the role of genetic
variability in ACE inhibitor induced adverse effects.
The available evidence supports the view that the
C allele of AGTR1 Gene is a risk factor for progressive adverse effects of ACE
Inhibitor.
renal function loss in a spectrum of chro
nic renal disorders. The ACE I/D genotype
may also affect the therapeutic response to
ACE-inhibition in renal patients, but this
interaction may be different in Caucasia
n as compared to Japanese populations.
Thus, albeit of modest potency and not under
all circumstances, ACE genotype is the
first genetic risk factor for progressive
renal function loss. More detailed genetic
analysis in genetically homogeneous populations [124] could elucidate the genetic
basis of these renal effects. While large ep
idemiological studies can serve to define its
overall impact in the renal population, it
may be even more important to delineate
under which circumstances, by which mechanisms, and in which patients, ACE (I/D)
genotype exerts an effect on renal risk.
It has been pointed out that clinical and
pathophysiological studies, preferably in
genetically homogeneous populations, are of
crucial importance to turn the data generated by the new genetic techniques into
clinical benefit [125].
What studies would be needed ?

50

1. Ezzati M, Lopez AD, Rodgers A,Vander Hoorn S, Murray CJ; Comparative Risk Assessment
Collaborating G. Selected major risk factors and global and regional burden of disease. Lancet
2002;360:1347-1360.CrossRefMedlineWeb of Science
2.Laura C. van Vark, Michel Bertrand, K. MartijnAkkerhuis, Jasper J. Brugts, Kim Fox, JeanJacques Mourad, Eric Boersma. Angiotensin-converting enzyme inhibitors reduce mortality in
hypertension: a meta-analysis of randomized clinical trials of reninangiotensinaldosterone
system inhibitors involving 158 998 patients(CC).
3. Gavras H, Brunner HR, Turini GA, Kershaw GR, Tifft CP, Cuttelod S et al.
Antihypertensive effect of the oral angiotensin converting enzyme inhibitor SQ
14225 in man. New England Journal of Medicine 1978;298,9915.
4.

Erds EG. The ACE and I: how ACE inhibitors came to be. The FASEB Journal

2006;20:103438.
5.

Bakhle YS. Conversion of angiotensin I to angiotensin II by cell-free extracts of

dog lung. Nature 1968;220:91921.

6.

Smith CG, Vane JR. The discovery of captopril. The FASEB Jounal 2003;17:7889.

7.

Cushman DW, Ondetti MA. History of the design of captopril and related

inhibitors of angiotensin converting enzyme. Hypertension 1991;17;58992.

8.

Gavras H, Brunner HR, Turini GA, Kershaw GR, Tifft CP, Cuttelod S et al.

Antihypertensive effect of the oral angiotensin converting enzyme inhibitor SQ

14225 in man. New England Journal of Medicine 1978;298,9915.
9. The CONSENSUS Trial Study Group. Effects of enalapril on mortality in severe
congestive heart failure. Results of the Co-operative North Scandinavian Enalapril
Survival Study (CONSENSUS).New England Jounal of Medicine 1987;316:142935.

51

10 .Marco Pahor,Therapeutic Benefits of ACE Inhibitors and Other

Antihypertensive Drugs in Patients With Type 2 Diabetes .

11. Skeggs LT, Dorer FE, Kahn JR, Lentz KE, Levine M. The biochemistry of the reninangiotensin system and its role in hypertension. Am J Med 1976;60:737-74822
12.SOLVD Investigators. Effect of enalapril on survival in patients with reduced left ventricular
ejection fraction and congestive heart failure. N Engl J Med. 1991;325:293302.Medline
13.SaraFatima,sobianoor,AyeshaFatima,mohammedmaazuddin.A REVIEW ON IMPORTANCE
OF ACE INHIBITORS IN CLINICAL PRACTICE.
14. Pellacani A, Brunner HR, Nussberger J. Plasma kinins increase after angiotensin enzyme
inhibition in human subjects. Clin Sci (Lond). 1994;87:567-574.

15.Ferrari R. Angiotensin-converting enzyme inhibition in cardiovascular disease: evidence with

perindopril. Expert Rev Cardiovasc Ther). 2005;3:15-29.

16.Brugts JJ, den Uil CA, Danser AHJ, Boersma E. The renin-angiotensin-aldosterone system:
approaches to guide angiotensin-converting enzyme inhibition in patients with coronary artery
disease. Cardiology). 2009;112:303-312.
17.Pfeffer MA, Braunwald E, Moye LA, SAVE Investigators, et al. Effect of captopril on
mortality and morbidity in patients with left ventricular dysfunction and myocardial infarction:
results of the survival and ventricular enlargement trial. N Engl J Med 1992;327:66977.PubMed
18.The SOLVD investigators. Effect of enalapril on survival in patients with reduced left
ventricular ejection fractions and congestive heart failure. N Engl J Med 1991;325:293302.
19.The Acute Infarction Ramipril Efficacy (AIRE) study investigators. Effect of ramipril on
mortality and morbidity of survivors of acute myocardial infarction with clinical evidence of
heart failure. Lancet 1993;342:8218.

52

20.Torp-Pedersen C, Kober L, TRACE Study Group. Effect of ACE inhibitor trandolapril on life
expectancy of patients with reduced left-ventricular function after acute myocardial infarction.
Lancet 1999;354:912.PubMedCrossRef
21.The Heart Outcomes Prevention Evaluation study investigators. Effects of an angiotensinconverting enzyme inhibitor, ramipril, on cardiovascular events in high-risk patients. N Engl J
Med 2000;342:14553.CrossRef
22.The PEACE Trial Investigators. Angiotensin-converting-enzyme inhibition in stable coronary
artery disease. N Engl J Med 2004;351:205868.CrossRef
23.The European Trial on Reduction of Cardiac Events with Perindopril in Patients with Stable
Coronary Artery Disease investigators. Efficacy of perindopril in reduction of cardiovascular
events in stable coronary artery disease: randomized, double-blind, placebo controlled,
multicentre trial (the EUROPA study). Lancet 2003;362:7828.CrossRef
24.The Task Force on the Management of Stable Angina Pectoris of the European Society of
Cardiology. Guidelines on the management of stable angina pectoris.Eur Heart J 2006;27:1341
81.CrossRef
25.Wood D, DeBacker G, Faergam O, Graham I, Mancia G, Pyrl K, and the task force.
Prevention of coronary disease in clinical practice: recommendation of the second Joint Task
Force of European and other societies on Coronary Prevention. Atherosclerosis 1998;140:99
270.CrossRef
26.Gibbons RJ, Abrams J, Chatterjee K, et al. ACC/AHA 2002 guideline update for the
management of patients with chronic stable anginasummary article: a report of the American
College of Cardiology/American Heart Association Task Force on practice guidelines
(Committee on the Management of Patients With Chronic Stable Angina). J Am CollCardiol
2003;41:15968.PubMedCrossRef
27.Dahlf B, Sever PS, stergren J. Prevention of cardiovascular events with an
antihypertensive regimen of amlodipine adding perindopril as required versus atenolol adding
bendroflumethiazide as required, in the Anglo-Scandinavian Cardiac Outcomes Trial-Blood

53

Pressure Lowering Arm (ASCOT-BPLA): a multicentre randomized controlled trial. Lancet

2005;366:895906.PubMedCrossRef
28.PROGRESS Collaborative Group. Randomised trial of a perindopril based blood pressurelowering regimen among 6105 individuals with previous stroke or transient ischemic attack.
Lancet. 2001;200(358):103341.
29.The PREAMI Investigators. Effects of angiotensin-converting enzyme inhibition with
perindopril on left ventricular remodeling and clinical outcome. Results of the Randomized
Perindopril and Remodeling in Elderly with Acute Myocardial Infarction (PREAMI) Study. Arch
Intern Med 2006;166:65966.CrossRef
30.ADVANCE Collaborative Group. Effects of a fixed combination of perindopril and
indapamide on macrovascular and microvascular outcomes in patients with type 2 diabetes
mellitus (the ADVANCE trial): a randomized controlled trial. Lancet 2007;370:82940.CrossRef
31.Bots ML, Remme WJ, Lscher TF, et al. ACE inhibition and endothelial function: main
findings of PERFECT, a sub-study of the EUROPA trial. Cardiovasc Drugs Ther 2007;21:269
79.PubMedCrossRef
32.Rodriguez-Granillo GA, Vos J, De Feyter PJ. Long-term effect of perindopril on coronary
atherosclerosis progression (from the PERindoprils Prospective Effect on Coronary
aTherosclerosis by Angiography and IntraVascular Ultrasound Evaluation [PERSPECTIVE]
Study). Am J Cardiol 2007;100:15963.PubMedCrossRef
33.Ceconi C, Fox KM, Ferrari R, et al. ACE inhibition with perindopril and endothelial function.
Results of a substudy of the EUROPA study: PERTINENT. Cardiovasc Res 2007;73:237
46.PubMedCrossRef
34.Remme WJ, Deckers JW, Fox KM, Ferrari R, Bertrand M, Simoons ML. for the EUROPA
investigators. Secondary prevention of coronary disease with ACE inhibitiondoes blood
pressure reduction with perindopril explain the benefits in EUROPA? Cardiovasc Drugs Ther
2009;23 (this issue).

54

35. Nancy J. Brown, MD; Douglas E. Vaughan, MD.Cardiovascular Drugs.AngiotensinConverting Enzyme Inhi. Pellacani A, Brunner HR, Nussberger J. Plasma kinins increase after
angiotensin enzyme inhibition in human subjects. Clin Sci (Lond). 1994;87:567-574.
bitors.Circulation. 1998; 97: 1411-1420
36. Cardiovascular and Metabolic Benefits ofACE Inhibition,Moving beyond blood pressure
reduction.

37.Pfeffer MA, Braunwald EA, Moye LA, Basta L, Brown EJJ, Cuddy TE, Davis BR, Geltman
EM, Goldman S, Flaker GC, Klein M, Lamas GA, Packer M, Rouleau J, Rouleau JL, Rutherford
J, Wertheimer JH, Hawkins CM. Effect of captopril on mortality and morbidity in patients with
left ventricular dysfunction after myocardial infarction. N Engl J Med.
1992;327:669677CrossRefMedline
38.Yusuf S, Pepine CJ, Garces C, Pouleur H, Salem D, Kostis J, Benedict C, Rousseau M,
Bourassa M, Pitt B. Effect of enalapril on myocardial infarction and unstable angina in patients
with low ejection fractions. Lancet. 1992;340:11731178.CrossRefMedline
39.Hayek T, Keidar S, Mei-Yi, Oiknine J, Breslow J. Effect of angiotensin converting enzyme
inhibitors on LDL lipid peroxidation and atherosclerosis progression in apo E deficient mice.
Circulation. 1995;92(suppl I):I-625.
40.Chobanian AV, Haudenschild CC, Nickerson C, Drago R. Anti-atherogenic effect of captopril
in the Watanabe heritable hyperlipidemic rabbit.Hypertension. 1990;15:327331.Abstract/FREE
Full Text
41.Aberg G, Ferrer P. Effects of captopril on atherosclerosis in cynomolgus monkeys. J
CardiovascPharmacol. 1990;15(suppl):S65S72.
42.Mancini GB, Henry GC, Macaya C, ONeill BJ, Pucillo AL, Carere RG, Wargovich TJ,
Mudra H, Luscher TF, Klibaner MI, Haber HE, Uprichard AC, Pepine CJ, Pitt B. Angiotensinconverting enzyme inhibition with quinapril improves endothelial vasomotor dysfunction in
55

patients with coronary artery disease: the TREND (Trial on Reversing Endothelial Dysfunction)
Study. Circulation. 1996;94:258265.Abstract/FREE Full Text
43.Linz W, Wiemer G, Gohlke P, Unger T, Scholkens BA. Contribution of kinins to the
cardiovascular actions of angiotensin-converting enzyme inhibitors.Pharmacol Rev. 1995;47:25
49.Abstract
44.Vaughan DE, Lazos SA, Tong K. Angiotensin II regulates the expression of plasminogen
activator inhibitor-1 in cultured endothelial cells. J Clin Invest. 1995;95:9951001.
45.Ridker PM, Gaboury CL, Conlin PR, Seely EW, Williams GH, Vaughan DE. Stimulation of
plasminogen activator inhibitor in vivo by infusion of angiotensin II.Circulation. 1993;87:1969
1973.Abstract/FREE Full Text
46.Emeis JJ, Tranquille N. On the role of bradykinin in secretion from vascular endothelial
cells.Agents Actions. 1992;38:285291.
47.Brown NJ, Nadeau J, Vaughan DE. Selective stimulation of tissue-type plasminogen activator
(t-PA) in vivo by infusion of bradykinin.ThrombHaemost. 1997;77:522525.Medline
48.Lees RS, Pitt B, Chan RC, Holmvang G, Dinsmore RE, Campbell LW, Haber HE, Klibaner
MI, Cashin-Hemphill L. Baseline clinical and angiographic data in the Quinapril Ischemic Event
(QUIET) trial. Am J Cardiol. 1996;78:10111016.CrossRefMedline
49.The HOPE Study Investigators. The HOPE (Heart Outcomes Prevention Evaluation) Study:
the design of a large, simple randomized trial of an angiotensin-converting enzyme inhibitor
(ramipril) and vitamin E in patients at high risk of cardiovascular events. Am J Cardiol.
1996;12:127137.CrossRef Jun 1;77(11):1553-1560.
50.Ichikawa I, Brenner BM. Glomerular actions of angiotensin II. Am J Med. 1984;76:43
49.CrossRefMedline
51.Anderson SG, Rennke HG, Brenner BM. Therapeutic advantage of converting enzyme
inhibitors in arresting progressive renal disease associated with systemic hypertension in rat. J
Clin Invest. 1986;77:19932000.

56

52.Fogo A, Yoshida Y, Yared A, Ichikawa I. Importance of angiogenic action of angiotensin II in

the glomerular growth of maturing kidneys. Kidney Int. 1990;38:10681074.Medline
53.Ruiz-Ortega M, Gomez-Garre D, Alcazar R, Palacios I, Bustos C, Gonzalez S, Plaza JJ,
Gonzalez E, Egido J. Involvement of angiotensin II and endothelin in matrix protein production
and renal sclerosis. J Hypertens. 1994;12:S51S58.
54.Hoelscher DD, Weir MR, Bakris GL. Hypertension in diabetic patients: an update of
interventional studies to preserve renal function. J ClinPharmacol. 1995;35:7380.Medline
55.Warren SE, OConnor DT. Hyperkalemia resulting from captopril administration.JAMA.
1980
244:25512552.CrossRefMedline.
56.Textor SC, Bravo EL, Fouad FM, Tarazi RC. Hyperkalemia in azotemic patients during
angiotensin-converting enzyme inhibition and aldosterone reduction with captopril. Am J Med.
1982;73:719725.CrossRefMedline
57.Burnakis TG, Mioduch HJ. Combined therapy with captopril and potassium supplementation:
a potential for hyperkalemia. Arch Int Med. 1984;144:23712
58.Hricik DE, Browning PJ, Kopelman R, Goorno WE, Madias NE, Dzau VJ. Captopril-induced
functional renal insufficiency in patients with bilateral renal-artery stenoses or renal-artery
stenosis in a solitary kidney. N Engl J Med. 1983;308:373376.CrossRefMedline

59.Dzau VJ. Renal effects of angiotensin-converting enzyme inhibition in cardiac failure. Am

Kastner PR, Hall JE, Guyton AC. Control of glomerular filtration rate: role of intrarenally
formed angiotensin II. Am J Physiol. 1984;246:F897F906. J Kidney Dis. 1987;10:7480.

57

60. Murphy BF, Whitworth JA, Kincaid-Smith P. Renal insufficiency with combinations of
angiotensin converting enzyme inhibitors and diuretics. Br Med J Clin Res. 1984;288:844845.
61. Kastner PR, Hall JE, Guyton AC. Control of glomerular filtration rate: role of intrarenally
formed angiotensin II. Am J Physiol. 1984;246:F897F906.
62.Woo KS, Nicholls MG. High prevalence of persistent cough with angiotensin converting
enzyme inhibitors in Chinese. Br J ClinPharmacol. 1995;40:141144.Medline.
63.Visser LE, Stricker BH, van der Velden J, Paes AH, Bakker A. Angiotensin converting
enzyme inhibitor associated cough: a population-based case-control study. J ClinEpidemiol.
1995;48:851857.CrossRefMedline
64.Os I, Bratland B, Dahlof B, Gisholt K, Syvertsen JO, Tretli S. Female sex as an important
determinant of lisinopril-induced cough. Lancet. 1992;339:372. Letter.Medline
65.BHS,Drugclasses,angiotensin converting enzyme(ace) inhibitors.
66.Israili ZH, Hall WD. Cough and angioneurotic edema associated with angiotensin-converting
enzyme inhibitor therapy. Ann Intern Med. 1992;117:234242.
67.Brown NJ, Ray WA, Griffin MR. Black Americans have an increased rate of angiotensin
converting enzyme inhibitor-associated angioedema. ClinPharmacolTher.
1996;60:813.CrossRefMedline
68.Sedman AB, Kershaw DB, Bunchman TE. Recognition and management of angiotensin
converting enzyme inhibitor fetopathy.PediatrNephrol. 1995;9:382385.CrossRefMedline
69.Pryde PG, Sedman SB, Nugent CE, Barr MJ. Angiotensin-converting enzyme inhibitor
fetopathy. J Am Soc Nephrology. 1993;3:15751582.
70.DiBianco R. Adverse reactions with angiotensin converting enzyme inhibitors. Med Toxicol.
1986;1:122141.Medline
71.Vidt DG, Bravo EL, Fouad FM. Captopril. N Engl J Med. 1982;306:214
219.CrossRefMedline

58

72.Cooper RA. Captopril-associated neutropenia: who is at risk? Arch Intern Med.

1983;143:659660.CrossRefMedline
73.Erslev AJ, Alexander JC, Caro J, Boyd RL. Hematologic side effects of captopril and
associated risk factors.Cardiovasc Rev Rep. 1982;3:660671.
74.Edwards IR, Coulter DM, Beasley DM, MacIntosh D. Captopril: 4 years of post marketing
surveillance of all patients in New Zealand. Br J ClinPharmacol. 1987;23:529536.Medline
75.Goodfield MJ, Millard LG. Severe cutaneous reactions to captopril. BMJ. 1985;290:1111.
76.DONNA J. BELLE, PhD, RPh, and HARLEEN SINGH, PharmD, Oregon State University
College of Pharmacy, Portland Campus at Oregon Health & Science University, Portland,
Oregon.Genetic Factors in Drug Metabolism.AmFam Physician. 2008
77. J. J. Brugts, M. P. M. de Maat, E. Boersma, J. C. M. Witteman, C. van Duijn, A. G.
Uitterlinden, M. Bertrand, W. Remme,

K. Fox,

R. Ferrari, A. H. J. Danser, M.

L.Simoons, On behalf of the EUROPA-PERGENE investigators .The Rationale and Design of

the Perindopril Genetic Association Study (PERGENE): A Pharmacogenetic Analysis of
Angiotensin-Converting Enzyme Inhibitor Therapy in Patients with Stable Coronary Artery
Disease. April 2009, Volume 23, Issue 2, pp 171-181.
78. Pellacani A, Brunner HR, Nussberger J. Plasma kinins increase after angiotensin enzyme
inhibition in human subjects. Clin Sci (Lond). 1994;87:567-574.
79. Guyton AC, Hall JE, eds. In: Textbook of medical physiology 9th ed. Philadelphia, PA: WB
Saunders, 2000:22730.
80.Ganong WF. In: Review of medical physiology. 18th ed. Stamford, CT: Appleton and Lange,
1997:4258.
81.Braunwald E .ed. In: Heart Disease: A Textbook of Cardiovascular Medicine 5th ed.
Philadelphia, PA: WB Saunders, 1997:414, 471-2.
82.Gemmill RM, Drabkin HA.Report of the Second International Workshop on Human
Chromosome 3 Mapping.Cytogenet Cell Genet1991;57 (4) :1626. [Medline]

59

83.Guo DF, Furuta H, Mizukoshi M, Inagami T. The genomic organization of human angiotensin
II type 1 receptor.BiochemBiophys Res Commun1994;200 (1) :3139. [CrossRef][Medline]
[Web of Science]
84.Antonellis A, Rogus JJ, Canani LH, Makita Y, Pezzolesi MG, Nam M, Ng D, Moczulski D,
Warram JH, Krolewski AS. A method for developing high-density SNP maps and its application
at the type 1 angiotensin II receptor (AGTR1) locus. Genomics2002;79 (3) :32632. [CrossRef]
[Medline]
85.Takayanagi R, Ohnaka K, Sakai Y, Nakao R, Yanase T, Haji M, Inagami T, Furuta H, Gou DF,
Nakamuta M. Molecular cloning, sequence analysis and expression of a cDNA encoding human
type-1 angiotensin II receptor. BiochemBiophys Res Commun1992;183 (2) :9106. [CrossRef]
[Medline][Web of Science]
86. Duncan JA, Scholey JW, Miller JA. Angiotensin II type 1 receptor gene polymorphisms in
humans: physiology and pathophysiology of the genotypes. CurrOpinNephrol Hypertens2001;10
(1) :1116. [CrossRef][Medline][Web of Science]
87.Murphy TJ, Alexander RW, Griendling KK, Runge MS, Bernstein KE. Isolation of a cDNA
encoding the vascular type-1 angiotensin II receptor. Nature1991;351 (6323) :2336.
88.[CrossRef][Medline][Web of Science] Bonnardeaux A, Davies E, Jeunemaitre X, Fery I,
Charru A, Clauser E, Tiret L, Cambien F, Corvol P, Soubrier F. Angiotensin II type 1 receptor
gene polymorphisms in human essential hypertension. Hypertension1994;24 (1) :639.
[Abstract/FREE Full text]
89.Wang WY, Zee RY, Morris BJ. Association of angiotensin II type 1 receptor gene
polymorphism with essential hypertension.Clin Genet1997;51 (1) :314. [Medline][Web of
Science]
90.Kainulainen K, Perola M, Terwilliger J, Kaprio J, Koskenvuo M, Syvanen AC, Vartiainen E,
Peltonen L, Kontula K. Evidence for involvement of the type 1 angiotensin II receptor locus in
essential hypertension. Hypertension1999;33 (3) :8449. [Abstract/FREE Full text]

60

91.Castellano M, Muiesan ML, Beschi M, Rizzoni D, Cinelli A, Salvetti M, Pasini G, Porteri E,

Bettoni G, Zulli R, Agabiti-Rosei E. Angiotensin II type 1 receptor A/C1166 polymorphism.
Relationships with blood pressure and cardiovascular structure. Hypertension1996;28 (6) :1076.
[Abstract/FREE Full text]
92.Chistiakov DA, Kobalova ZD, Tereshchenko SN, Moiseev SV, Nosikov VV. [Polymorphism
of vascular angiotensin II receptor gene and cardiovascular disorders]. Ter Arkh2000;72 (4) :27
30.
93.Wierzbicki AS, Lambert-Hammill M, Lumb PJ, Crook MA. Renin-angiotensin system
polymorphisms and coronary events in familial hypercholesterolemia. Hypertension2000;36 (5) :
80812. [Abstract/FREE Full text]
94.Tiret L, Blanc H, Ruidavets JB, Arveiler D, Luc G, Jeunemaitre X, Tichet J, Mallet C, Poirier
O, Plouin PF, Cambien F. Gene polymorphisms of the renin-angiotensin system in relation to
hypertension and parental history of myocardial infarction and stroke: the PEGASE study.
ProjetdEtude des Genes de lHypertensionArterielle Severe a modereeEssentielle. J
Hypertens1998;16 (1) :3744. [CrossRef][Medline][Web of Science]

95.Nalogowska-Glosnicka K, Lacka BI, Zychma MJ, Grzeszczak W, Zukowska-Szczechowska

E, Poreba R, Michalski B, Kniazewski B, Rzempoluch J. Angiotensin II type 1 receptor gene
A1166C polymorphism is associated with the increased risk of pregnancy-induced hypertension.
Med Sci Monit2000;6 (3) :5239. [Medline]
96. Barker DJ, Osmond C. Infant mortality, childhood nutrition, and ischaemic heart disease in
England and Wales. Lancet1986;1 (8489) :107781. [Medline][Web of Science]
97.Benetos A . [Relation between cardiac hypertrophy and changes in the large arterial
trunks.Role of the renin-angiotensin system]. Arch Mal Coeur Vaiss1995;88 (Spec No 2) :214.
98.Benetos A, Gautier S, Ricard S, Topouchian J, Asmar R, Poirier O, Larosa E, Guize L, Safar
M, Soubrier F, Cambien F. Influence of angiotensin-converting enzyme and angiotensin II type 1

61

receptor gene polymorphisms on aortic stiffness in normotensive and hypertensive patients.

Circulation1996;94 (4) :698703. [Abstract/FREE Full text]
99.M. Fornage, S. T. Turner, C. F. Sing, and E. Boerwinkle, Variation at the M235T locus of the
angiotensinogen gene and essential hypertension: a population-based case-control study from
Rochester, Minnesota, Human Genetics, vol. 96, no. 3, pp. 295300, 1995.
100.B. J. Morris, R. Y. L. Zee, and A. P. Schrader, Different frequencies of angiotensinconverting enzyme genotypes in older hypertensive individuals, Journal of Clinical
Investigation, vol. 94, no. 3, pp. 10851089, 1994.
101.L. A. Hindorff, S. R. Heckbert, R. Tracy et al., Angiotensin II type 1 receptor
polymorphisms in the cardiovascular health study: relation to blood pressure, ethnicity, and
cardiovascular events, The American Journal of Hypertension, vol. 15, no. 12, pp. 10501056,
2002. View at Publisher.
102.Genetic home references,agtr1 gene.
103.SNPedia,rs 5186.
104.Brugts JJ, de Maat M, den Uil CA, et al. Pharmacogenetics of ACE inhibition in stable
coronary artery disease: steps towards tailored drug therapy. CurrOpinCardiol 2008;23:296
301.PubMedCrossRef
105.Brugts JJ, den Uil CA, de Maat M, Danser AHJ. The reninangiotensinaldosteron system:
approaches to guide angiotensin-converting enzyme inhibition in patients with coronary artery
disease. Cardiology 2008;112:30312.PubMedCrossRef

106. J. J. Brugts, M. P. M. de Maat, E. Boersma, J. C. M. Witteman, C. van Duijn, A. G.

Uitterlinden, M. Bertrand, W. Remme,

K. Fox,

R. Ferrari, A. H. J. Danser, M.

L.Simoons,
On behalf of the EUROPA-PERGENE investigators .The Rationale and Design of the
Perindopril Genetic Association Study (PERGENE): A Pharmacogenetic Analysis of
62

Angiotensin-Converting Enzyme Inhibitor Therapy in Patients with Stable Coronary Artery

Disease. April 2009, Volume 23, Issue 2, pp 171-181.
107. Sayed-Tabatabaei FA, Oostra BA, Isaacs A, van Duijn CM, Witteman JC. ACE
polymorphisms. Circ Res. 2006 May 12;98(9):112333. [PubMed]
108. Araujo MA, Goulart LR, Cordeiro ER, Gatti RR, Menezes BS, Lourenco C, et al.
Genotypic interactions of renin-angiotensin system genes in myocardial infarction. Int J Cardiol.
2005 Aug 3;103(1):2732. [PubMed]
109. Ceolotto G, Papparella I, Bortoluzzi A, Strapazzon G, Ragazzo F, Bratti P, et al. Interplay
between miR-155, AT1R A1166C polymorphism, and AT1R expression in young untreated
hypertensives. Am J Hypertens. 2011 Feb;24(2):2416. [PubMed]
110. Elton TS, Martin MM. Angiotensin II type 1 receptor gene regulation: transcriptional and
posttranscriptional mechanisms. Hypertension. 2007 May;49(5):95361. [PubMed]
111. Spiering W, Kroon AA, Fuss-Lejeune MM, Daemen MJ, de Leeuw PW. Angiotensin II
sensitivity is associated with the angiotensin II type 1 receptor A(1166)C polymorphism in
essential hypertensives on a high sodium diet. Hypertension. 2000 Sep;36(3):4116. [PubMed]
112. Higuchi S, Ohtsu H, Suzuki H, Shirai H, Frank GD, Eguchi S. Angiotensin II signal
transduction through the AT1 receptor: novel insights into mechanisms and pathophysiology.
Clin Sci (Lond) 2007 Apr;112(8):41728. [PubMed]
113. Martin MM, Buckenberger JA, Jiang J, Malana GE, Nuovo GJ, Chotani M, et al. The
human angiotensin II type 1 receptor +1166 A/C polymorphism attenuates microrna-155 binding.
J Biol Chem. 2007 Aug 17;282(33):242629. [PMC free article] [PubMed]
114. Martin MM, Lee EJ, Buckenberger JA, Schmittgen TD, Elton TS. MicroRNA-155 regulates
human angiotensin II type 1 receptor expression in fibroblasts. J Biol Chem. 2006 Jul
7;281(27):1827784. [PubMed]
115. Sethupathy P, Borel C, Gagnebin M, Grant GR, Deutsch S, Elton TS, et al. Human
microRNA-155 on chromosome 21 differentially interacts with its polymorphic target in the

63

AGTR1 3 untranslated region: a mechanism for functional single-nucleotide polymorphisms

related to phenotypes. Am J Hum Genet. 2007 Aug;81(2):40513. [PMC free article] [PubMed]

64