70 PDF

KISHORE VAIGYANIK PROTSAHAN YOJANA - 2012
Date : 04-11-2012 Duration : 3 Hours Max. Marks : 160
STREAM - SB/SX
GENERAL INSTRUCTIONS
The Test Booklet consists of 120 questions.
There are Two parts in the question paper. The distribution of marks subjectwise in each
part is as under for each correct response.
MARKING SCHEME :
PART-I :
MATHEMATICS
Question No. 1 to 20 consist of ONE (1) mark for each correct response.
PHYSICS
CHEMISTRY
BIOLOGY
PART-II :
MATHEMATICS
Question No. 81 to 90 consist of TWO (2) marks for each correct response.
PHYSICS
CHEMISTRY
BIOLOGY
KVPY QUESTION PAPER - STREAM (SB / SX)
PART-I
One Mark Questions
MATHEMATICS
1. Three children, each accompanied by a guardian, seek admission in a school. The principal wants to
interview all the 6 persons one after the other subject to the condition that no child is interviewed before its
guardian. In how many ways can this be done?
rhu cPps]ft uesaiz
R;sd viusvfHkHkkod d slkFkgS],d fo|ky; es aiz
os
'kikukpkgrsgS A fo|ky; d sizkpk;Z,d d sckn ,d
lHkh6 O;fDr;ksalsbl izd kj lk{kkRd kj d jukpkgrsgSfd fd lhHkhcPPksd klk{kkRd kj mld svfHkHkkod d sigy su gks
A ;g
fd rusrjhd slsfd ;k t k ld rk gS?
(A) 60 (B) 90 (C) 120 (D) 180
6! 720
Sol. Number ways are rjhd ksad h la[;k = = = 90 ways
2!2!2! 8
2. In the real number system, the equation x 3 4 x 1 + x 8 6 x 1 = 1 has

(A) no solution (B) exactly two distinct solutions
(C) exactly four distinct solutions (D) infinitely many solutions
okLrfod la[;k (fud k;) esalehd j.k x 3 4 x 1 + x 8 6 x 1 = 1 d sfy ,
(A) d ks
bZgy ughagSA (B) rF;r%nksfofHkUu gy gS
A
(C) rF;r%pkj fofHkUu gy gS A (D) vuUr gy laHko gSA
Sol. x 3 4 x 1 = x + 8 6 x 1 + 1 2 x 8 6 x 1
2 x 1 6 = 2 x 8 6 x 1
x 1 3 = x 8 6 x 1
Ans. (D) Infinite many solutions.
3. The maximum value M of 3x + 5x 9x + 15x 25x, as x varies over reals, satisfies

O;at d 3x + 5x 9x + 15x 25x, t gkx ,d okLrfod la[;kgS]d kvf/kd re eku (M) fufEufy f[kr d kslarq"V d jrkgS&
(A) 3 < M < 5 (B) 0 < M < 2 (C) 9 < M < 25 (D) 5 < M < 9
Sol. Let ekuk a = 3 and rFkk b = 5
x x
Therefore blfy, ,
3x + 5x 9x + 15x 25x = a + b a2 + ab b2
1
= [2 (a 1)2 (b 1)2 (a b)2]
2
1
(2)
2
Thus vr%, M = 1 (happens when t c x = 0)
Answer (B)
4. Suppose two perpendicular tangents can be drawn from the origin to the circle x2 + y2 6x 2py + 17 = 0,
for some real p. Then |p| is equal to
;fn fd lhokLrfod p d sfy , x2 + y2 6x 2py + 17 = 0 ij ewy fcUnqlsnksijLij y Ecor~Li'kZt hok[khap ht kld rh
gS]rc |p| gksxk&
(A) 0 (B) 3 (C) 5 (D) 17
RESONANCE PAGE - 2
Sol.
Equation of chord of contact T = 0 w.r.t. origin is

3(x + 0) p (y + 0) + 17 = 0
3x + py 17 = 0
By Homoginization
2
3 x py 3 x py
x2 + y2 (6x + 2py) + 17 =0
17 17
For perpendicular coeff of x2 + coeff of y2 = 0
6.3 .9 2p2 p2
1 + +1 + =0
17 17 17 17
34 18 + 9 p2 = 0
p2 = 25
|p| = 5
5. Let a, b, c, d be numbers in the set {1, 2, 3, 4, 5, 6} such that the curves y = 2x3 + ax + b and y = 2x3 + cx
+ d have no point in common. The maximum possible value of (a c)2 + b d is
;fn fd lh leqPp; {1, 2, 3, 4, 5, 6} d sin a, b, c, d bl izd kj gSfd y = 2x3 + ax + b rFkk y = 2x3 + cx + d ij
d ksbZfcUnqmHk;fu"B ughagS]rc (a c)2 + b d d k vf/kd re laHkkfor eku gksxk&
(A) 0 (B) 5 (C) 30 (D) 36
Sol. 2x3 + ax+ b 2x3 + cx + d
(a c)x d b
If a c = 0 & d b 0
Max. (a c)2 + (b d)
= 0 + 5 Ans.
6. Consider the conic ex2 + y2 2e2x 22y + e3 + 3 = e. Suppose P is any point on the conic and S1, S2
are the foci of the conic, then the maximum value of (PS1 + PS2) is
'kkad o (conic) ex2 + y2 2e2x 22y + e3 + 3 = e ij ;fn P d ksbZfcUnqgksrFkk S1, S2 'kkad o d sukfHkd gks]rc
(PS1 + PS2) d k vf/kd re eku gks xk&
(A) e (B)
e (C) 2 (D) 2 e
Sol. e(x 2 ex + e ) + (y 2y + 2) = e
2 2 2
x e 2 y 2 = 1 (a > b)
e
Ellipse a = ,b= e
Req. PS1 + PS2 = 2
sin( x a) sin( x a)
7. Let f(x) = , then
cos( x a) cos( x a)
(A) f(x + 2) = f(x) but f(x + ) f(x) for any 0 < < 2 (B) f is a strictly increasing function
(C) f is strictly decreasing function (D) f is a constant function
sin( x a) sin( x a)
;fn f(x) = cos( x a) cos( x a) , rc
(A) f(x + 2) = f(x) ijUrqfd lh Hkh 0 < < 2d sfy , f(x + ) f(x)
(B) f vfuok;Zr%,d o/kZeku Q y u gSA
(C) f vfuok;Z r%,d leku Q y u gSA
RESONANCE PAGE - 3
(D) f ,d fu;r Q y u gSA
2 sin x. cos a
Sol. f(x) = (x n, n I)
2 sin x sin a
= cot a
(D) = constant function
8. The value of tan 81 tan 63 tan27 + tan9 is

O;at d tan 81 tan 63 tan27 + tan9 d k eku gS&
(A) 0 (B) 2 (C) 3 (D) 4
Sol. tan81 tan63 tan27 + tan9
cot9 cot27 tan27 + tan9
(cot9 + tan9) (cot27 + tan 27)
2 cosec18 2 cosec54
4 4
2

5 1 5 1
2
8
4
=4
Ans. (D)
9. The midpoint of the domain of the function f(x) = 4 2x 5 for real x is
okLrfod x d sfy , Q y u f(x) = 4 2x 5 d sizkUr d k e/; fcUnqgS&

1 3 2 2
(A) (B) (C) (D)
4 2 3 5
Sol. 4 2x 5 0, 2x + 5 0
0 2x + 5 16
5 2x 11
5 11
x
2 2
5 11
.6 3
mid point is 2 2 = =
2 2.2 2
Ans. (B)
10. Let n be a natural number and let a be a real number. The number of zeros of x2n+1 (2n + 1) x + a = 0 in the
interval [1, 1] is
(A) 2 if a > 0
(B) 2 if a < 0
(C) at most one for every vale of a
(D) at least three for every value of a
eku y safd n ,d izkd `r la[;kgSrFkka ,d okLrfod la[;kgSA lehd j.kx2n+1 (2n + 1) x + a = 0 d s'kwU;ksad hla[;k
vUrjky [1, 1] esagS&
(A) 2 ;fn a > 0
(B) 2 ;fn a < 0
(C) iz R;sd a d seku d sfy , vf/kd lsvf/kd ,d
(D) iz R;sd a d seku d sfy , d e lsd e rhu
Sol. f(x) = x2n +1 (2n + 1) x + a
f (x) = (2n + 1)(x2n 1)
x = 1 point of local maxima
x = 1 point of local minima
RESONANCE PAGE - 4
graph of y = f(x) when a = 0

f(x) is decreasing on [1, 1]. Thus, f(x) will have atmost one root on [1,1] that too will happen if f(1) 0 and
f(1) 0 i.e. for a [2n, 2n]
Answer (C)
11. Let f : R R be the function f(x) = (x a1) (x a2) + (x a2) (x a3)+ (x x3) (x x1) with a1, a2, a3 R. Then
f(x) 0 if and only if
(A) at least two of a1, a2, a3 are equal (B) a1 = a2 = a3
(C) a1, a2, a3 are all distinct (D) a1, a2, a3 are all positive and distinct
;fn f : R R ,d Q y u f(x) = (x a1) (x a2) + (x a2) (x a3)+ (x x3) (x x1) t gka1, a2, a3 R rc
f(x) 0 ;fn vkSj d soy ;fn
(A) a1, a2, a3 es
ad e lsd e nkscjkcj gSA (B) a1 = a2 = a3
(C) a1, a2, a3 rhuks
afofHkUu gSA (D) a1, a2, a3 rhuks
a/kukRed vkSj fofHkUu gSA
2
Sol. f(x) = 3x 2(a1 + a2 + a3) x + a1a2 + a2a3 + a3a1 0
D 0
4(a1 + a2 + a3)2 4.3.(a1a2 + a2a3 + a3a1) 0
a12 + a 22 + a 32 a1a2 a2a3 a3a1 0
1
[(a a2)2 + (a2 a3)2 + (a3 a1)2] 0
2 1
a1 = a2 = a3
Ans. (B)
/2
2 1
(sin x)
0
dx
12. The value /2 is

2 1
(sin x)
0
dx
/2
2 1
(sin x)
0
dx
/2 d k eku gS&
2 1
(sin x)
0
dx
2 1 2 1 2 1
(A) (B) (C) (D) 2 2
2 1 2 1 2
/2
2
Sol. I1 = (sin
0
x) (sinx)1 dx
/2
/2 2 2 1
I1 = (cos x )(sin x )

2
0
+ 2 (cos
0
x ) (sin x ) dx
/2 /2
2 1 2 1
I1 = 2 (sin x )
dx sin x dx

0 0
RESONANCE PAGE - 5
/2
2 1
I1 = 2 (I2 I1) Here I1 = (sin x )
0
dx
1 2 2 1

= ( 2 1)
2 ( 2 1)

= 2 2 Ans.
2012
3
13. The value (sin( x ) x 5 1) dx is
2012
2012
3
(sin( x ) x 5 1) dx d k eku gS&
2012
(A) 2012 (B) 2013 (C) 0 (D) 4024

2012 2012
Sol. (sin x 3 x 5 ) dx + 1. dx
2012 2012
= 0 + 2012 ( 2012)
= 4024 Ans.
14. Let [x] and {x} be the integer part and fractional part of a real number x respectively. The value of the integral
5
[ x] { x} dx
0
is
;fn [x] vkSj {x}, ,d okLrfod la[;kx d s e'k%iw.kkd rFkkfHkUukRed va'kgSA rc lekd y [ x] { x} dx d keku gksxk&
0
(A) 5/2 (B) 5 (C) 34.5 (D) 35.5

5
Sol. [x]{x} dx
0
1 2 3 4 5
= 0.{x}dx +
.1. {x} dx + 2 {x} dx + 3 {x} dx + 4. {x} dx
1 2 3
0 4
1 1 1 1
=0+1 x . dx + 2 x . dx 3 xdx 4 .

0

0

0
xdx
0
= (1 + 2 + 3 + 4) x . dx
0
1
x2
= 10 . 2
0
1
= 10 . 0 = 5
2
Ans. (B)
RESONANCE PAGE - 6
n
15. Let Sn = k denote the sum of the first n positive integers. The numbers S1, S2, S3, ....S99 are written
k 1
on 99 cards. The probability of drawing a cards with an even number written on it is
n
eku y s
aSn = k 1 k iz
Fke n /kukRed iw
.kk
d ks
ad s;ks
x d ksfu: fir d jrkgS
A la
[;k,aS1, S2, S3,...S99 d ks99 i=kks
aij fy[kk
x;k gSA blesals,d i=k ft lij le la[;k vafd r gks]d s[khap usd h izkf;d rk gksxh&
1 49 49 48
(A) (B) (C) (D)
2 100 99 99
n
nn 1
Sol. Sn K =
k 1
2
is even (n : 1, 2, ............. 99)
n = multiple of 4
4, 8, .......... 96
Or (=) n is (multiple of 4 1)
3, 7 ............... 99
Total favourable cases 24 + 25 = 49
49
P[E] = Ans.
99
16. A purse contains 4 copper coins and 3 silver coins. A second purse contains 6 coins and 4 silver coins. A
purse is chosen randomly and a coin is taken out of it. What is the probability that it is a copper coin?
,d FkSy h esa4 rkacsvkSj 3 pkanh d sflDd sgSA ,d nwl jh FkSy h esa6 rkacsvkSj 4 pkanh d sflDd sgSA bu nksFkSfy ;ksaesals,d
FkSy h ;kn`fPNd fud ky h t krh gSvkSj mlesals,d flDd k fud ky kt krk gSA bl ckr d h izkf;d rkD;k gSfd flDd k rkacs
d k gS?
41 31 27 1
(A) (B) (C) (D)
70 70 70 3
Ans. (A)
1 4 6
Sol. req. prob =
2 7 10
1 40 42 41
= Ans.
2 70 70
17. Let H be the orthocentre of an acuteangled triangle ABC and O be its circumcenter. Then HA HB HC
(A) is equal to HO (B) is equal to 3HO
(C) is equal to 2HO (D) is not a scalar multiple of HO in general
;fn H ,d fuEud ks.k f=kHkqt ABC d k y Ec d sUnzgS,oaO bld k ifjd sUnzgSA rc HA HB HC

(A) HO d scjkcj gksxkA (B) 3HO d scjkcj gks xkA
(C) 2HO d scjkcj gks
xkA (D) lkekU;r% HO d k vfn'k xq
.ku ughagSA
Sol.

OH = a b c

HA = (b c )
RESONANCE PAGE - 7

HB = (c a)

HC = (a b)

HA HB HC = 2( a b c )
= 2 OH = 2 HO
Ans. (C)
18. The number of ordered pairs (m,n) where m, n {1, 2, 3, ......, 50}, such that 6m + 9n is a multiple of 5 is
fer ;qXeksa(m,n) t gkm, n {1, 2, 3, ......, 50} bl izd kj gSfd 6m + 9n, 5 d k xq.kt gSA bl izd kj d s fer ;qXeksa
d hla[;kgksxh&
(A) 1250 (B) 2500 (C) 625 (D) 500
Sol. 6m + 9n
Unit digit of 6m is = 6
Unit digit of 9n will be = 9 or 1
For multiple of 5 unit digit of 9n must be = 9
It occur when n = odd
Total number of ordered pair = 50 25 = 1250
19. Suppose a1, a2, a3, ....., a2012 are integers arranged on a circle. Each number is equal to the average of its
two adjacent numbers. If the sum of all even indeced numbers is 3018, what is the sum of all numbers?
eku ysafd iw.kkd a1, a2, a3, ....., a2012 d ks,d o`
kij lt ;kx;kgSA iz
R;sd la[;kviuhfud VorhZnksla
[;kvks
ad hvkSl r
gSA ;fn izR;sd le lwp d la[;k d k ;ksx 3018 gks]rkslHkh la[;kvksad k ;ksx D;k gksxk ?
(A) 0 (B) 1509 (C) 3018 (D) 6036
a1 a 3
Sol. a2 =
2
a2 a4
a3 =
2
a 2 a 2012
a1 =
2
a 2011 a1
a2012 =
2
Now a2 + a4 + ......... + a2012 = 3018 .................... (1)
2a2 + 2a4 + .................... + 2a2012 = 6036
a1 + a3 + a3 + a5 + .............. + a2011 + a1 = 6036
2(a1 + a3 + ................. + a2011) = 6036
a1 + a3 + ................ + a2011 = 3018 ..................... (2)
By adding (1) and (2) we get
a1 + a2 + a3 + ............ + a2012 = 6036
20. Let S = 1, 2, 3, ...., n} and A = {(a, b) | 1 a, b n} = S S . A subset B of A is said to be a good subset if

(x, x) B for every x S. Then the number of good subsets of A is
;fn S = 1, 2, 3, ...., n} rFkk A = {(a, b) | 1 a, b n} = S S . A d smileqPp; B d ksvPNk mileqPp; rc d gk
t k,xk t c izR;sd x S d sfy , (x, x) B gksA rc A d svPNsmileqPp;ksad h la[;k gksxh&
2
(A) 1 (B) 2n (C) 2n(n1) (D) 2 n
Sol. Number of element in B = n n = n2
Number of elements of type (x, x) = n
after choosing n elements.
We can choose any number of elements from remaining n2 n elements.
n2 n 2 2 2
Number of subsets = C0 n n
C1 n n
C 2 ......n n
Cn2 n
2
n n
= 2
RESONANCE PAGE - 8
PHYSICS
21. An ideal monatomic gas expands to twice its volume. If the process is isothermal, the magnitude of work
done by the gas is W i . If the process is adiabatic the magnitude of work done by the gas is W a . Which of
the following is true
,d ,d ijek.kfod vkn'kZxSl izl kfjr gksd j nksxquhvk;ru d hgkst krhgSA ;fn izf ;klerkih; gSrksxSl }kjkfd ;k
x;k d k;ZW i gSA ;fn izf ;k : ) ks"e gSrksxSl }kjk fd ;k x;k d k;ZW a gSA fuEufy f[kr esad kSu lgh gS\
(A) W i = W a > 0 (B) W i > W a > 0 (C) W i > W a = 0 (D) W a > W i = 0
Sol.
Since area of PV graph under isothermal curve is greater than area under adiabatic curve
So, wi > wa > 0
Ans. (B)
22. The capacitor of capacitance C in the circuit shown is fully charged initially, Resistance is R.
ifjiFkesan'kkZ, C /kkfjrkd k,d la/kkfj=kizkjEHklsiw.kZ: i lsvkosf'kr gSA R frjks/kgSA
After the switch S is closed, the time taken to reduce the stored energy in the capacitor to half its initial value
is :
fLop (S) d scan gksusd sckn la/kkfj=k esalafpr t kZfd rusle; esaizkjfEHkd eku d h vk/kh gkst k;sxh\
RC RC ln 2
(A) (B) RC ln 2 (C) 2RC ln 2 (D)
2 2
Sol. Q = Q0et/RC
Q0
= Q0et/RC
2
1
= et/RC Ans. (D)
2
1 t
n
2 RC
t
n 2
RC
n2
t = RC
2
RESONANCE PAGE - 9
23. A liquid drop placed on a horizontal plane has a near spherical shape (slightly flattened due to gravity). Let R
be the radius of its largest horizontal section. A small disturbance causes the drop to vibrate with frequency
c
about its equilibrium shape. By dimensional analysis the ratio can be (Here is surface tension,

R 3
is density, g is acceleration due to gravity, and k is an arbitrary dimensionless constant)

,d {kSfrt ry ij fLFkr nzo d h,d cwan y xHkx xksy kd kj vk fr d hgSxq: Rokd "kZ.kd sd kj.kcwan FkksM +hlhQ Sy t krhgS
xksy sd slclscM+s{kSfrt vuqLFkd hf=kT;kR gSA ,d NksVkfo{kksHkcwan d ksbld slkE;koLFkkvk fr d sifjr%vko`fk
c
ij d aiu d jkrkgSA foeh; fo'y s"k.kls vuqikr fuEufy f[kr esad kSulkgksld rkgS\ ;gk i`"B ruko] ?kuRo]

R 3
g xq
: Roh; Roj.k vkSj k ,d ;kn`PN foekjfgr fLFkjkad gSA
kgR 2 k R 3 k R 2 k
(A) (B) (C) (D) g
g g
R 3
Sol. 3 =
/ R
1/ 2
3 3
1 ML L
= T 2 = T1 T
MT
=1

K
/ R 3
R 3
2 K2

R 3 2
K2 = T

R 2
= RT 2

R 2
K= g

Ans. (A)
24. Seven identical coins are rigidly arranged on a flat table in the pattern shown below so that each coin touches
its neighbours. Each coin is a thin disc of mass m and radius r. Note that the moment of inertia of an
mr 2
individual coin about an axis passing through center and perpendicular to the plane of the coin is .
2
,d {kSfrt es
t ij leku vkd kj d slkr flDd sn`<+
rkiwoZd bl rjg lsO;ofLFkr gSfd R;s d flDd kviusut nhd hflDd ksa
d ksNw
rkgSA R;s
d flDd sd knz
O;eku m vkSj f=kT;kr gS
A /;ku ns
afd gj flDd sd kflDd sd sd s
Unzlsxq
t jrhgq
bZvkS
j flDd s
mr 2
d sry d sy Ecor v{k d slkis{k t M+Ro vk?kw.kZ gSA
2
RESONANCE PAGE - 10
The moment of inertia of the system of seven coins about an axis that passes through the point P (the centre
of the coin positioned directly to the right of the central coin) and perpendicular to the plane of the coins is
n'kkZ, x,sfp=kesabu lkrks
aflDd ksad slewg d kfcUnqP lsxqt jrsgq, ,oaflDd sd sy a
cor v{kd slkis{kt M+Ro vk?kw.kZD;k
gksxk\ P d sUnzh; flDd sd snkfgusfLFkr flDd sd k d sUnzgSA
55 127 111
(A) mr2 (B) mr2 (C) mr2 (D) 55 mr2
2 2 2
Sol.
mr 2 mr 2 mr 2 mr 2
P = m(2r )2 3 m(r 2 3 )2 2 m( 4r )2
2 2 2 2
111 2
= mr .
2
25. A planet orbits in an elliptical path of eccentricity e around a massive star considered fixed at one of the foci.
The point in space where it is closest to the star is denoted by P and the point where it is farthest is denoted
by A. Let vP and vA be the respective speeds at P and A. Then
,d xzg mRd sUnzrk(eccentricity) 'e' oky h,d nh?kZo`kkd kj d {kesa,d fo'kky rkjsd kpDd j y xkrkgSA fo'kky rkjknh?kZ
o`kd s,d ukfHkij fLFkj gSA rkjsd slclsut nhd d sfcUnqd ksP ,oalclsnwj d sfcUnqd ksA. lsn'kkZ;kx;kgSA ;fn vP
,oavA e'k%P vkSj A ij xzg d k osx gSrks
vP 1 e vP vP 1 e2 vP 1 e2
(A) v 1 e (B) v = 1 (C) (D)
A A vA 1 e v A 1 e2
RESONANCE PAGE - 11
Sol.
Angular momentum conservation about S

vp (a ae) = vA(a + ae)
vp a ae

vA a ae
vp 1 e

vA 1 e
Ans. (A)
26. In a Young's double slit experiment the intensity of light at each slit is 0. Interference pattern is observed
along a direction parallel to the line S1 S2 on screen S.
;ax f}&f>jh(Young's double slit) iz;ksx esaizR;sad f>jhij izd k'kfd j.kd hrhozrk0. gSA O;frd j.kizfr: i d ksinsZS
ij S1 S2 js[kk d slekukUrj ns[kk t krk gSA
The minimum, maximum, and the intensity averaged over the entire screen are respectively.
izd k'k d h U;wure] vf/kd re ,oaiwjsinsZij ekih xbZvkSl r rhozrk D;k gksxh\
(A) 0, 40 , 20 (B) 0 , 20 , 30/2 (C) 0, 40 , 0 (D) 0, 20 , 0
Sol. max = ( 0 0 )2
= 40
min = ( 0 0 ) 2 0
avg = 0 + 0 = 20
Ans. (A)
27. A loop carrying current has the shape of a regular polygon of n sides. If R is the distance from the centre to

any vertex, then the magnitude of the magnetic induction vector B at the centre of the loop is
n Hkq
t kvksaoky s,d lecgqHkqt kd j can ifjiFkesa/kkjkizokfgr gksjghgSA ;fn cgqHkqt d sd sUnzlsfd lh'kh"kZd hnqjhR gS

rksifjiFk d sd sUnzij ;qXed h; izsj.k B d k ifjek.k gksxkA&
0 0 2 0 0
(A) n tan (B) n tan (C) (D) tan
2 R n 2 R n 2R R n
RESONANCE PAGE - 12
Sol.
0 i
sin n sin n
B0 = 4 R cos
n
0 i
B0 = tan
2 R n
Ans. (A)
28. A conducting rod of mass m and length is free to move without friction on two parallel long conducting rails,
as shown below. There is a resistance R acorss the the rails. In the entire space around, there is a uniform
magnetic filed B normal to the plane of the rod and rails. The rod is given an impulsive velocity v0.
n'kkZ, x, fp=kesa,d m nzO;eku vkSj L y ackbZd hpky d NM nksy achvkSj lekUrj pky d iVfj;ksaij fcuk?k"kZ.kd sxfr
d j ld rhgSA iVfj;ksad schp d kizfrjks/kR gSA fp=kd hlrg d sy acor~]gj t xg ,d leku pqEcd h; {ks=kB gSA NM d ks
vpkud ,d v0 ifjek.k d k vkosxh osx iznku fd ;k t krk gSA
1
Finally, the initial energy mv02
2
(A) will be converted fully into heat energy in the resistor
(B) will enable rod to continue to move eith velocity v0 since the rails are frictionless
(C) will be converted fully into magnetic energy due to induced current
(D) will be converted into the work done against the magnetic field
1
vUrr%izkjafHkd t kZ mv02
2
(A) iw
.kZ: i lsizfrjks/k R esa "eh; t kZesa: ikUrfjr gkst k,xhA
(B) NM+d ksv0 xfr lsxfreku j[ks xh D;ksafd NM+,oaiVfj;ksad schp ?k"kZ.k ughagSA
(C) mRiz
sfjr fo|qr /kkjkd h ot g ls]iw.kZr;kpqEcd h; t kZesa: ikUrfjr gkst k,xhA
(D) pq
Ecd h; {ks=k d sf[ky kQ d k;Zd jusesaO;; gkst k,xhA
Sol. Due to the negative work on rod K.E. will decrease and finally become zero.
Ans. (A)
29. A steady current flows through a wire of radius r, length L and resistivity . The current produces heat in the
wire. The rate of heat loss in a wire is proportional its surface area. The steady temperature of the wire is
independent of
,d r f=kT;k]L y ackbZ,oa izfrjks/kd rk d srkj esaLFkk;h fo|qr /kkjk I izokfgr gksrh gSA /kkjk d hot g lsrkj esa "ek d k
fuekZ.kgksrkgSA rkj esa "ekd s{k; d hnj rkj d slrgh{ks=kQ y d svuqikrhgSA rkj d kfLFkj rkieku fuEu esalsfd ld s
ij fuHkZj ughagS\
(A) L (B) r (C) (D)
RESONANCE PAGE - 13

Sol. R=
A
L
R=
r 2
dT
2R = K2rL
dt
2 L dT
2 = K2rL
r dt
dT 2 L
= Ans. (A)
dt K 2 2 r 3
30. The ratio of the speed of sound to the average speed of an air molecule at 300K and 1 atmospheric pressure
is close to
300K rkieku ,oa1 atm nkc ij /ofu d hxfr vkS j ok;qd s,d v.kqd hvkSl r xfr d kvuqikr fuEu es
alsfd ld sfud V
gS\
1
(A) 1 (B) 300 (C) (D) 300
300
RT
m 7
Sol. = = 0.73
8RT 58
m
So, closest ans is 1.
Ans. (A)
31. In one model of the election, tho electron of mass me is thought to be a uniformly charged shell of radius R
and total charge e, whose electrostatic energy E is equivalent to its mass me via Einstein's mass energy
relation E = m ec 2 . In this model, R is approximately (m e = 9.1 1031 kg, c = 3 108 m.s 1,
1
9
4 0 = 9 10 Farads m , magnitude of the electron charge = 1.6 10 C)
1 19
by sDVkWu d s,d fu: i.kesame nzO;eku d sby sDVkWu d ksR f=kT;kd sleku : i lsvkosf'kr ,d xksy k]ft ld kd qy vkos'k
e, gS]le>kt krkgSA bl vkosf'kr xksy sd hfLFkj oS| qr t kZE ,oanzO;eku me vkbaLVhu d sE = mec2 . laca/klsnht krh
gSA bl fu: i.k esa R d k eku fd l d s d jhc gS\ (m e = 9.1 10 31 kg, c = 3 10 8 m.s 1 ,
1
9
4 0 = 9 10 Farads m ,
1
by sDVkWu d k vkos'k = 1.6 1019 C)
(A) 1.4 1015 m (B) 2 1013 m (C) 5.3 1011 m (D) 2.8 1035 m
Sol. U = mc2
KQ 2
mc 2
2R
9 109 (1.6 10 19 )2
= 9.1 1031 (3 108)2
2R
9 10 9 (1.6 10 19 )2
R=
2 9.1 10 31 (3 108 )2
= 1.4 1015
RESONANCE PAGE - 14
Ans. (A)
32. A body is executing simple harmonic motion of amplitude a and period T about the equilibrium position
x = 0. Large numbers of snapshots are taken at random of this body in motion. The probability of the body
being found in a very small interval x to x + |dx| is highest at
viuslkE; voLFkk x = 0. d slkis{k ,d fiM+a vk;ke vkSj T vkorZd ky lsljy vkorZxfr (simple harmonic
morion) d jrk gS
A bl oLrqd h ;kn`fPNd xfr d sd bZlkjsQ ksVksfp=k snapshots [khpsat krsgSA x vkSj x + |dx| d s
chp NksVsvarjky d safiaM d sik, t kusd h lclsT;knk izkf;d rk d gkgksxh\
a
(A) x = a (B) x = 0 (C) x = a/2 (D) x =
2
Sol. Probability of being found is maximum where speed is minimum.
So, x = a
Ans. (A)
33. Two identical bodies are made of a material for which the heat capacity increases with temperature One of
these is held at a temperature of 100C while the other one is kept at 0C. If the two are brought into contact,
then, assuming no heat loss to the environment, the final temperature that they will reach is
nks,d & t Sl sfia
M ,d ,sl sinkFkZlscuk, t krsgSft ud h "ek& /kkfjrkrkieku d slkFkc<+rhgSA ,d fiaM d ks100C
ij j[kkt krkgSvkSj nql jsd ks0C.ijA ;fn nksuksfiaM ,d nql jslslaid ZesavkrsgSvkSj ;fn eku fy ;kt k, fd ifjos'k
esa "ek d k {k; ughagksrk]rksfiaM ksad k vafre rki D;k gksxk\
(A) 50C (B) more than 50C (C) less than 50C (D) 0C
(A) 50C (B) 50C lsvf/kd (C) 50C lsd e (D) 0C
Sol. Since heat capacity at high temperature is high. So for same amount of heat transfer T is more at lower
temperature then at higher temperature.
So, final temperature is more than 50C .
34. A particle is acted upon by a force given by F = x3 x4 where and are positive constants. At the point
x = 0, the particle is
,d cy F = x3 x4 t gka vkSj /kukRed fLFkjkad gS,d d .k ij y xk;k t krk gSA fd lh fcUnqx = 0, ij d .k
(A) in stable equilibrium (B) in unstable equiibrium
(C) in neutral equilibrium (D) not in equilibrium
(A) fLFkj lkE;koLFkkes agSA (B) vLFkk;hlkE;oLFkkes agSA
(C) mnklhu lkE;oLFkkes agSA (D) lkE;koLFkkes
aughagSA
Sol. As F = x3 x4
At x = 0, F = 0
Hence particle is in equilibrium.
35. The potential energy of a point particle is given by the expression V(x) = x + sin (x / ). A dimensionless
combination of the constants , and is
,d fcUnqd .kd hfLFkfrt t kZd ksV(x) = x + sin (x / ).lsfu: fir fd ;kt krkgSA , vkSj d schp ,d foekghu
(dimensionless) la
ca
/kgS
A
2
(A) (B) (C) (D)

Sol. It is clear that
dimension x = ML2T2 = MLT2
= ML2T2
and x=L

So, will be dimensionless.

RESONANCE PAGE - 15
36. A ball of mass m suspended from a rigid support by an inextensible massless string is released from a
height h above its lowest point. At its lowest point it colIides elastically with a block of mass 2m at rest on a
frictionless surface. Neglect the dimensions of the ball and the block. After the collision the ball rises to a
maximum height of
,d <`< lgkjslst qM +h ,d Hkkjghu ,oaf[kpkojfgr rkj lsy Vd h m nzO;eku d h ,d xsan d ksfuEure fcUnqlsh ap kbZ
ij mBkd j NksM fn;k t krkgSA (fp=knsf[k,) viusfuEure fcUnqij xsan ,d ?k"kZ.kjfgr lrg ij j[ks2m nzO;eku d s,d
Cy kWd lsizR;kLFk VDd j (elastic collision) d jrhgSA xsan ,oaCy kWd d svkd kj d h vuns[khd jrsgq,]Vd jkusd sckn xsan
d h vf/kd re ap kbZD;k gksxk\
h h h h
(A) (B) (C) (D)
3 2 8 9
Sol. 2gh
From conservation of momentum

m 2gh 0 = mv1 + 2mv2
2gh = v1 + 2v2 ...........(i)

From equation of e
v 2 v1
= 2gh = v2 v1 ..........(ii)
2gh 0
From (i) & (ii)
2gh
v1 =
3
Hence after collision maximum height
( 2gh / 3 )2
hmax =
2g
h
hmax = g
Ans. (D)
37. A particle released from rest is falling through a thick fluid under gravity. The fluid exerts a resistive force on
the particle proportional to the square of its speed. Which one of the following graphs best depicts the
variation of is speed v with time t?
fLFkj voLFkklsxq
: Roh; Roj.kesafxjrkgqv k,d d .k,d xk<sarjy inkFkZlsxqt jrkgSA rjy nzO;d .kij izfrjks/kd cy
y xrkgSt ksd .kd sosx d soxZd slekuqikrhgSA d .kd sosx (v) d kle; (t) d slkis{kifjorZu d ksfuEu vkjs[kksaesalsd kSu
lgh lghfu: fir d jrk gSs\
RESONANCE PAGE - 16
(A) (B)
(C) (D)
Sol. Let ball is moving with speed

v at anytime t hence
dv
Hence, m = mg Kv2
dt
On the basis of equation we can rays that speed first increase and become constant when mg = kv2
Hence, Ans. (A)
38. A cylindrical steel rod of length 0.10m and thermal conductivity 50 W.m1.K1 is welded end to end to copper
rod of thermal conductivity 400 W.m1.K1 and of the same area of cross section but 0.20 m long. The free
end of the steel rod is maintained at 100C and that of the copper rod at 0C. Assuming that the rods are
perfectly insulated from the surrounding the temperature at the junction of the two rods is
LVhy d h ,d csy ukd kj NM+ft ld h y ackbZ0.10m rFkk "eh; pky d rk 50 W.m1.K1 gS],d Nksj ij leku vuqizLFk
d kV ,oa0.20m yach,d nwl jhcsy ukd kj NM+ft ld h "eh; pkyd rk400 W.m1.K1 gS]lst qM hgSA LVhy NM+d s[kqy s
fljsd ks100C ,oarkcsad hNM+d s[kqy sfljsd ks0C.rkieku ij fLFkj j[kkx;kgSA ;g ekursgq, fd NMksalsifjos'kesa
"ek d k kl ughagksjgk gS]NMksad st ksM +ij rkieku D;k gksxk\
(A) 20C (B) 30C (C) 40C (D) 50C
0 .1 1
Sol. Resistance of steel = =
50 A 500 A
0 .2 1
Resistance of copper = =
400 A 200 A
Both are connected in series hence heat current in both will be same. So
100 T T0
= 1 T = 20C
1

500 A 2000 A
Ans. (A)
39. A parent nucleus X is decaying into daughter nucleus Y which in turn decays to Z. The half lives of X and Y
are 4000 years and 20 years respectively. In a certain sample, it is found that the number of Y nuclei hardly
changes with time. If the number of X nuclei in the sample is 4 1020 , the number of Y nuclei present in it
is
,d ewy ukfHkd X nwl jsukfHkd Y esa{kf;r gksrk gS]t ksfQ j Z. esa{kf;r gksrk gSA X vkSj Y d h v/kZvk;q e'k%4000 o"kZ
,oa20 o"kZgSA ,d uewusesa;g ns[kk x;k gSfd Y ukfHkd ksad h la[;k esale; d slkFk d ksbZ[kkl ifjorZu ughagksjgk gSA
;fn bl uewusesaX ukfHkd ksad h la[;k 4 1020 rksml le; Y ukfHkd ksad h la[;k D;k gksxh\
(A) 2 1017 (B) 2 1020 (C) 4 1023 (D) 4 1020
Sol. From
N11 = N22
RESONANCE PAGE - 17
n(2) n( 2)
4 1020 = = N2
40000 20
7
N2 = 2 10
Ans. (A)
40. An unpolarized beam of light of intensity 0 passes through two linear polarizers making an angle of 30 with
respect to each other. The emergent beam will have an intensity.
nksjs[kh; /kqzod ksad schp]t ksijLij 30 ij fLFkj gS,d 0 rhozrk d h v/kzqfor izd k'k fd j.k xqt jrh gSA ckgj vkusoky h
fd j.k d h rhozrk D;k gksxh\
3 0 3 0 3 0 0
(A) (B) (C) (D)
4 4 8 8
Sol.
0 3
cos 2 30 0
2 2 4
3 0
Final intensity will be =
8
Ans. (C)
CHEMISTRY
41. Among the following, the species with the highest bond order is :
fuEufy f[kr esafd ld kvf/kd re vkcU/k e (bond order) gS\
(A) O2 (B) F2 (C) O2+ (D) F2
Ans. (C)
Sol. According to MOT bond order of O2, F2, O2+ and F2 is respectively 2, 1, 2.5 and 0.5.
gy MOT d svuq l kj O2, F2, O2+ rFkk F2 d k ca/k e e'k%2, 1, 2.5 o 0.5 gSA
42. The molecule with non-zero dipole moment is :

v.kqft ld kf}/kzqo vk?kw.kZ(dipole moment) v'kwU; gS\
(A) BCl3 (B) BeCl2 (C) CCl4 (D) NCl3
Ans. (D)
Sol. BCl3, BeCl2 and CCl4 has zero dipole moment due to symmetric structure where as shape of NCl3 is pyrami-
dal due to presence of lone pair.
gy BCl3, BeCl2 o CCl4 d kf}/ko q vk?kw
z .kZ'kw
U; gks
rkgSD;ks
fd bud hlefer la
a jpukgks
rhgS
]t cfd NCl3 d hvk fr fijs
fefM;y
gksrh gSD;ksafd blesa,d kd h by sDVkWu ;qXe mifLFkr gksrk gSA
43. For a one-electron atom, the set of allowed quantum numbers is :

,d &by sDVkWu ijek.kqd sfy , vuqer DokaVe la[;k,(allowed quantum numbers) gS\
(A) n = 1, = 0, m = 0, ms = + (B) n = 1, = 1, m = 0, ms = +
(C) n = 1, = 0, m = 1, ms = (D) n = 1, = 1, m = 1, ms =
Ans. (A)
Sol. The value of n > and m should have values from to + .
n d k eku > o m d seku ls+ rd gksuspkfg,A .
RESONANCE PAGE - 18
44. In the reaction of benzene with an electrophile E+, the structure of the intermediate -complex can be
represented as :
cs
at hu d h,d by s
DVkWuLus
gh(electrophile) E+ d slkFkvfHkf ;kes
ae/;orhz-la
d j d hla
jpukd ksbl izd kj iznf'kZ
r dj
ld rsgSa\
(A) (B) (C) (D)
Ans. Option D Closest, if () is change to

fod Yi D lgh gS]D;ksafd () d ksesaifjofrZr fd ;k t k ld rk gSA
Sol.
45. The most stable conformation of 2, 3-dibromobutane is :

2, 3-Mkbcz
kseksC;wVsu d kvf/kd re LFkk;h la: i.k D;kgS\
(A) (B) (C) (D)
Ans. (Bonus)
46. Typical electronic energy gaps in molecules are about 1.0 eV. In terms of temperature, the gap is closest to:
v.kq
v kasd sbys
DV
kW
fud t kZ
& va
rjky (energy gaps) d keku yxHkx 1.0 eV gS
A rkieku d sla
nHkZes
a;g varj buesalsfd ld s
fud V gS\
(A) 102 K (B) 104 K (C) 103 K (D) 105 K
Ans. (B)
Sol. KE = | T.E. |
(KE) = (T.E.)
3
8.3 (T) = 1.6 1019 6 1023
2
9.6 10 4 2
(T) =
8 .3 3
(T) = 7.6 103 K i.e. close to 104 K.
(T) = 7.6 103 K vFkkZr 104 K d sfud V gSA
47. The major final product in the following reaction is :

fuEu vfHkf ;k d k eq[; vafre mRikn D;k gS\
31) CH MgBr
CH3CH2CN
2) H3O
(A) (B)
(C) (D)
RESONANCE PAGE - 19
Ans. (C)
Sol.
48. A zero-order reaction, A Product, with an initial concentration [A]0 has a half-life of 0.2 s. If one starts with
the concentration 2[A]0, then the half-life is :
,d 'kwU; d ksfV vfHkf ;k] A mRikn (product), d h v) Z& vk;q0.2 s gS] t c izkFkfed lkanzrk [A]0 gSA ;fn vfHkf ;k
2[A]0 d h lkUnz rk ls'kq: gksrh rksbld h v) Zvk;qD;k gksxh \
(A) 0.1 s (B) 0.4 s (C) 0.2 s (D) 0.8 s
Ans. (B)
Sol. t1/2 (a)1 n
10
( t1/ 2 )I a1
( t1/ 2 )II = a2

0 .2 A0
( t1/ 2 )II = 2 A 0
(t1/2)II = 0.4 s
49. The isoelectronic pair of ions is :

fuEu vk;fud ;qXe leby sDVkWfud (isoelectronic) gS%
(A) Sc2+ and V3+ (B) Mn3+ and Fe2+ (C) Mn2+ and Fe3+ (D) Ni3+ and Fe2+
Ans. (C)
Sol. 25
Mn2+ and 26Fe3+ both has 23 electrons.
25
Mn2+ o 26Fe3+ nks
uksaesa23 by sDVkWu gSA
50. The major product in the following reaction is :

fuEu vfHkf ;k d k eq[; mRikn D;k gS\
NaNH
2

(A) (B) (C) (D)
Ans. (A)
Sol.
51. The major product of the following reaction is :

fuEu vfHkf ;k d k eq[; mRikn D;k gS\
Conc.HBr

(A) (B) (C) (D)
Ans. (B)
Sol.
RESONANCE PAGE - 20
52. The oxidation state of cobalt in the following molecule is :
fuEufy f[kr v.kqesad ksckYV d h vkWDlhd j.k voLFkk (oxidation state) D;kgS\
(A) 3 (B) 1 (C) 2 (D) 0

Ans. (D)
Sol. In metal carbonyls oxidation state of metal is equal to zero.
/kkrqd kcksZfuy esa/kkrqd hvkWDlhd j.kvoLFkk'kwU; d scjkcj gksrhgSA
53. The pKa of a weak acid is 5.85. The concentrations of the acid and its conjugate base are equal at a pH of:
,d nqcZy vEy d spKa d keku 5.85 gSA pH d sfd l eku d sfy , vEy d hvkSj bld sla
;qXe (conjugate) {kkj d hlkUnz
rk
leku gksxh \
(A) 6.85 (B) 5.85 (C) 4.85 (D) 7.85
Ans. (B)
Sol. At pH = pKa the concenteration of acid and its conjugate base are equal.
pH = pKa ij vEy o bld sl;q fXer {kkj d h lkUnzrk cjkcj gksrh gSA
54. For a tetrahedral complex [MCl4]2, the spin-only magnetic moment is 3.83 BM. The element M is :
prq"Q y d h; lad qy (tetrahedral complex) [MCl4]2 d sfy , d soy izp .k pqEcd h; vk?kw.kZ(spin-only magnetic
moment) 3.83 BM gS A rRo M D;k gS\
(A) Co (B) Cu (C) Mn (D) Fe
Ans. (A)
Sol. It is high spin complex as Cl is weak field effect ligand. In [CoCl4]2 oxidation state of Co is +2 in which 3
unpaired electrons are present which gives the spin-only magnetic moment equal to 3.83 BM.
;g mPp p .klad qy gSD;ksafd Cl ,d nqcZy {ks=kfy xs.M gSA [CoCl4]2 esaCo d hvkWDlhd j.kvoLFkk+2 gSA blesarhu
v;qfXer by sDVkWu mifLFkr gSt ksfd 3.83 BM d scjkcj d soy p .k pqEcd h; vk?kw.kZn'kkZrsgSaA
55. Among the following graphs showing variation of rate (k) with temperature (T) for a reaction, the one that
exhibits Arrhenius behavior over the entire temperature range is :
fuEu vkjs[kesavfHkf ;knj d sifjorZ
u (k) d ksrkieku (T) d slkFkn'kkZ
;kx;kgS
A iw
jsrki ifjlj es
avkgs
fu;l (Arrhenius)
Z
O;ogkj d ksbuesalsfd l vkjs[k }kjk n'kkZ;k x;k gS\
(A) (B) (C) (D)
Ans. (D)
Sol. K = Ae Ea / RT
Ea
ln K = + ln A
RT
56. The reaction that gives the following molecule as the major product is
fuEufy f[kr v.kqfd l vfHkf ;k d k eq[; mRikn gS\
RESONANCE PAGE - 21
(A) (B)
(C) (D)
Ans. (B)
Sol.
57. The CO bond length in CO, CO2 and CO32 follows the order :
CO, CO2 vkS j CO32 esaCO vkca/k d h y EckbZd k e D;k gS\
(A) CO < CO2 < CO32 (B) CO2 < CO32 < CO (C) CO > CO2 > CO32 (D) CO32 < CO2 < CO
Ans. (A)
Sol. Greater is the bond order shorter will be bond length. In CO32 bond order in between 1 and 2, bond order of
CO2 is 2 where as bond order for CO is in between 2 and 3.
gy ft ld kca/k e vf/kd gksxkmld hca/ky EckbZd e gksxhA CO32 esaca/k e 1 o 2 d se/; gS]CO2 d kca/k e 2 gSt cfd
CO d k ca/k e 2 o 3 d se/; gSA
58. The equilibrium constant for the following reactions are K1 and K2, respectively.
2P(g) + 3Cl2(g) 2PCl3(g)
PCl3(g) + Cl2(g) PCl5(g)
The the equilibrium constant for the reaction
2P(g) + 5Cl2(g) 2PCl5(g)
is :
fuEufy f[kr vfHkf ;kvksad sfy , lkE; fLFkjkad e'k%K1 rFkkK2 gSA
2P(g) + 3Cl2(g) 2PCl3(g)
PCl3(g) + Cl2(g) PCl5(g)
rc 2P(g) + 5Cl2(g) 2PCl5(g) vfHkf ;kd sfy , lkE; fLFkjka
d D;kgksxk\
2 2 2
(A) K1K2 (B) K1K2 (C) K1 K2 (D) K12K2
Ans. (B)
Sol. 2P(g) + 3Cl2(g) 2PCl3(g) ........(i)
PCl3(g) + Cl2(g) PCl5(g) ........(ii)
2P(g) + 5Cl2(g) 2PCl5(g) ........(iii)
On multipling equation (ii) by 2 and adding in (i) we obtain equation (iii)
Therefore, K3 = K1K22
lehd j.k (ii) d ks2 lsxq.kk d j lehd j.k (i) esat ksM +usij gesalehd j.k (iii) izkIr gksrh gSA
blfy ,, K3 = K1K22
RESONANCE PAGE - 22
59. The major product of the following reaction is :
fuEufy f[kr vfHkf ;k d k eq[; mRikn D;k gS\
3 AlCl
+ (CH3C)2CHCH2Cl

(A) (B)
(C) (D)
Ans. (A)
Sol. The reagent given the question has an addition C within bracket.
fn;sx;siz'u d svfHkd eZd d sczsd sV esa,d vfrfjDr C fn;k x;k gSA
(CH3)2CHCH2Cl + AlCl3 (CH3)2CHCH2Cl - - - - AlCl3 (CH3)2CHCH2+ + AlCl4

(CH3)2CHCH2+
1,2H shiffting (CH ) C+
3 3
60. Doping silicon with boron produces a :

(A) n-type semiconductor (B) metallic conductor
(C) p-type semiconductor (D) insulator
flfy d u d scksjkWu vifeJ.k (Doping) lsd kSu&lk mRikn curk gS\
(A) n-izd kj d sv) Zp ky d (B) /kkfRod pky d
(C) p-iz d kj d sv) Zp ky d (D) fo|q r jks
/kh
Ans. (C)
Sol. As boron is trivalent impurity it will proudce p-type semiconductor.
D;ksafd cksjksu f=kla;kst hv'kqf) gS;g p-izd kj d sv) Zp ky d cukrkgSA
BIOLOGY
61. The disorders that arise when the immune system destroys 'self' cells are called autoimmmune disorders.
Which of the following would be classified under this
(A) rheumatoid arthritis (B) asthma (C) rhintis (D) eczema
Ans (A)
ft l fod kj jksx d sd kj.kizfrj{kd ra=k(immune system) viuhghd ksf'kd kvksad kfouk'kd jrkgS]mlsvkReizfrj{kd
jksx d grsgSA fuEufy f[kr esalsd kSu lk ,d jksx d grsgSA fuEufy f[kr esalsd kSulk ,d ,sl k jksx gSA
(A) xfB;kla f/k'kks
Fk(rheumatoid archritis) (B) nek(asthma)
(C) uklk& 'kks Fk (rhintis) (D) Nkt u (eczema)
Ans (A)
62. Which of the following class of immunoglobulins can trigger the complement cascade ?
(A) IgA (B) IgM (C) IgD (D) IgE
Ans (A)
d kWfIy esUV d SLd sM d ksbuesalsd kSu lk bEequksXy kscqy hu (immunoglobulins) izofrZr d jrkgS\
(A) IgA (B) IgM (C) IgD (D) IgE
Ans (A)
RESONANCE PAGE - 23
63. Diabetes insipidus is due to
(A) hypersecretion of vasoperssin
(B) Hyposecretion of insulin
(C) hypersecretion of insulin
(D) hyposecretion of vasopressin
Ans (D)
MkbfCkVht buflfiMl (Diabetes insipidus) d kd kj.kD;kgS\
(A) oS
l ksxzsflu d kvf/kd ek=kkesalzo.kgksukA (B) bUL;w y hu d k lzo.k d e gksukA
(C) bUL;w y hu d kvf/kd ek=kkesalzo.kgksukA (D) oS
l ksizsflu d klzo.kd e gksukA
Ans (D)
64. Fossils are most often found in which kind of rocks ?

(A) meteorites (B) sedimentary rocks
(C) igneous rocks (D) metamorphic rocks
Ans (B)
fd l izd kj d h f'ky kvksaesaT;knkrj t hok'e ik, t krsgS\
(A) mYd kfi.M (meteorites) (B) volknh'kS y (sedimentary rocks)
(C) vkXus ; 'kSy (igneous rocks) (D) d k;krj.kh'kS
y (metamorphic rocks)
Ans (B)
65. Peptic ulcers are caused by

(A) a fungus, Candida albicans
(B) a virus, cytomegalo virus
(C) a parasite, Trypanosoma brucei
(D) a bacterium, Helicobacter pylori
Ans (D)
isV d soz.k (Peptic ulcers) fd l t ho d sd kj.k gksrsgS\
(A) ,d d od h] (Candida albicans) (B) ,d ok;jl (cytomegalo virus)
(C) ,d ijt ho](Trypanosoma bruci) (D) ,d t hok.kq(Helicobacter pylori)
Ans (D)
66. Transfer RNA (tRNA)

(A) is present in the ribosomes and provides structural integrity
(B) usually has clover leaf-like structure
(C) carries genetic information from DNA to ribosomes
(D) codes for proteins
Ans (B)
V
kUlQ j (tRNA)
(A) jkbcks l kse esafLFkr gSvkSj lajpukRed v[kaM rknsrk gSA
(B) lkekU;r%frifr;k(clover leaf-like) vkd kj d hgks rhgSA
(C) DNA lsjkbcks l kse rFkkvkuqoaf'kd lwp ukigqap krkgSA
(D) izksVhu cukrkgS
Ans (B)
67. Some animals excrete uric acid in urine (uricotelic) as it requires very little water. This is an adaptation to
conserve water loss. Which animals among the following are most likely to be uricotelic?
(A) fishes (B) amphibians (C) birds (D) mammals
Ans (C)
ew
=kesa;wfjd vEy folft Zr d jusoky siz k.khd ks;wfjd ks
Vsfy d d grsgSA ;g izf ;kikuhd slaj{k.kd sfy, vuqd w
y gSA buesa
lsd kSu lkizk.kh;wfjd ksVsfy d gS\
(A) eNfy ;k (B) i{kh (C) mHk;pj (D) Lru/kkjh
Ans (C)
RESONANCE PAGE - 24
68. A ripe mango, kept with unripe mangoes causes their ripening. This is due to the release of a gaseous plant
hormone
(A) auxin (B) gibberlin (C) cytokinine (D) ethylene
Ans (D)
,d id svke d ksd Ppsvkeksad slkFk j[kuslsd PPksvke id us'kq: gkst krsgSA ;g fd l xSl h; ikni gkeksZu d sfud y us
d k d kj.k gS\
(A) vkDlhu (B) lkbVkds kbuhu (C) ft Ccjyha
u (D) ,Fkhyhu
Ans (D)
69. Human chromosomes undergo structural changes during the cell cycle. Chromosomal structure can be best
visualized if a chromosome is isolated from a cell at
(A) G1 phase (B) S phase (C) G2 phase (D) M phase
Ans (D)
euq"; d sd ksf'kd kp d snkSjku kseksl kse d hlajpukesacny ko gksrkgSA bl cny ko d ksLi"V : i lsns[kus d sfy , p
d hfd l izkoLFkkesa kseksl kse d kijh{k.kfd ;kt kukpkfg,\
(A) G1 izkoLFkk (B) S iz
koLFkk (C) G2 izkoLFkk (D) M izkoLFkk
Ans (D)
70. By which of the following mechanisms is glucose reabsorbed from the glomerular filtrate by the kidney tubule
(A) osmosis (B) diffusion (C) active transport (D) passiver transport
Ans (C)
fuEufy f[kr fd l izf ;k d s}kjk xqnsZd sfuL;aan }kjk Xy kses: y j fQ YVsV lsXy qd kst iqu%'kksf"kr gksrk gS\
(A) ijklj.k(osmosis) (B) folj.k(diffusion)
(C) lf ; xeu (active transport) (D) fuf" ; vfHkxeu (passiver transport)
Ans (C)
71. In mammals, the hormones secreted by the pituitary, the master gland, is itself regulated by
(A) Hypothalamus (B) median cortex (C) pineal gland (D) cerebrum
Ans (A)
efLr"d d sfd l Hkkx }kjk Lru/kkjh ih;w"k ( pituitary gland) d sgkeksZu d k lzo.k & fu;a=k.k gksrk gSA
(A) v/k'ps
rd (Hypothalamus) (B) ehfM;u d kVs ZDl (median cortex)
(C) ihfu;e xz
fUFk(pineal gland) (D) iz
efLr"d (cerebrum)
Ans (A)
72. Which of the following is true for TCA cycle in eukaryotes

(A) takes place in mitochondrion
(B) produces no ATP
(C) takes place in Golgi complex
(D) independent of electron transport chain
Ans (A)
;wd Sfj;ksV d sTCA p d sckjsesafuEufy f[kr d kSu lk d Fku lgh gS\
(A) ekbVks d kfUM
;kesagksrkgSA (B) ATP ughacukrkA
(C) xkW Yt hd kEIy sDl esagksrkgSA (D) iz
efLr"d (cerebrum)
Ans (A)
73. A hormone molecule binds to a specific protein on the plasma membrane inducing a signal. The protein it
binds to it called
(A) ligand (B) antibody (C) receptor (D) histone
Ans (C)
d ksf'kd k f>Yy h ij fLFkr ml izksVhu d ksD;k d grsgSt ksgkeksZu lst qM rk gSvkSj lad sr izsfjr d jrk gS\
(A) la y Xuh(ligand) (B) xz kgh(receptor) (C) izfrj{kh(antibody) (D) fgLVks u (histone)
Ans (C)
RESONANCE PAGE - 25
74. DNA mutations that do not cause my functional change in the protein product are known as
(A) nonsense mutations (B) missense mutations (C) deletion mutations (D) silent mutations
Ans (D)
DNA es amRifjorZu]t ksizksVhu d sizd k;Zesacny ko ughay krs]mUgsaD;k d grsgSa\
(A) vuFkZd mRifjorZu (nonsense mutations) (B) vikFkZ
d mRifjorZu (missense mutations)
(C) foy ks
ihmRifjorZu (deletion mutations) (D) uhjo mRifjorZ u (silent mutations)
Ans (D)
75. Plant roots are usually devoid of chlorophyll and cannot perform photosynthesis. However, three are excep-
tions. Which of the following plant root can perform photosynthesis
(A) Arabidopsis (B) Tinospora (C) Rice (D) Hibiscus
Ans (B)
ikS/kksad ht M+esaDy ksjksfQ y ughagksrkgS]ft ld sd kj.k osizd k'kla'y s"k.k(photosynthesis) ughad j ikrsA buesalsd kSu
lkvlk/kkj.kfoijhr mnkgj.kgS\
(A) vjs
chMkIlhl (Arabidopsis) (B) Vhuks
Likjsk(Tinospora)
(C) pkoy (Rice) (D) fgfcLd l (Hibiscus)
Ans (B)
76. Vitamin A deficiency leads to night-blindness. Which of the following is the reason for the disease ?
(A) rod cells are not converted to cone cells
(B) rhodopsin pigment of rod cells is defective
(C) melanin pigment is not synthesized in cone cells
(D) cornea of eye gets dried
Ans (B)
foVkfeu , d h d eh lsjrkSa/kh (night-blindness) gksrhgSA bld kd kj.k D;kgS\
(A) 'ky kd kd ksf'kd kvksa(rod cells) d k'kad qd ksf'kd kvksa(cone cells) esaifjofrZr ughagksukA
(B) 'ky kd kd ksf'kd kvksad sjksM kW
fIlu o.kZd d k(pigment) d knks"kiw.kZgksukA
(C) 'ka
d qd ksf'kd kesaesy kuhu o.kZd d kughacuukA
(D) vka[kksad sLoPN eaM y (cornea) d klw[kt kukA
Ans (B)
77. In Dengue virus infection, patients often develop haemorrhagic fever due to internal bleeding. This happens
due to the reduction of
(A) platelets (B) RBCs (C) WBCs (D) lymphocytes
Ans (A)
MsUX;qok;jl d sla e.klsd bZjksfx;ksaesavkUrfjd jDrlzko gksrkgSA buesalsfd l d ksf'kd kd sd e gksusls,sl kgksrkgS\
(A) jDr foEck.kq(platelets) (B) y ky : f/kj d f.kd k(RBCs)
(C) lQ sn : f/kj d f.kd k(WBCs) (D) y lhd k.kq(lymphocytes)
Ans (A)
78. If the sequence of bases in sense strand of DNA is 5'-GTTCATCG-3, then the sequence ofd bases in its RNA
transcript would be
(A) 5'-GTTCATCG-3' (B) 5'GUUCAUCG-3 (C) 5'CAAGTAGC-3' (D) 5'CAAGUAGC -3
Ans (B)
vxj DNA d ssence strand d kvuq e, 5'-GTTCATCG-3, 5'-GTTCATCG-3 5'-GTTCATCG-3 gS ]rksmld sRNA
d h izfrfy fi (transcript) d k vuq e D;k gksxk\
(A) 5'-GTTCATCG-3' (B) 5'GUUCAUCG-3 (C) 5'CAAGTAGC-3' (D) 5'CAAGUAGC -3
Ans (B)
79. A refilex aciton is a quick involuntary response to stimulus. Which of the following is an example of BOTH,
unconditioned and conditioned reflex
(A) knee jerk reflex
(B) secretion of saliva in response to the aroma of food
(C) sneezing reflex
(D) contration of the pupil in response to bright light
Ans (A)
RESONANCE PAGE - 26
fd lhmhiu d svuS fPNd vuqf ;kd ksizfrorhZf ;kd grsgSA buesalsd kS
u lkmnkgj.kvizkuqd w y hvkS j izkuqd w
y hizfrorhZ
f ;k,gS\
(A) uh&t d Z(knee jerk) iz
frorhZ (B) [kkusd h [kq
'kcqlseaqg esaikuh vkuk
(C) Nha
d iz frorhZ (D) ped hy sizd k'kesaiqrfy ;ksad kfld qM Ukk
Ans (A)
80. In a food chain such as grass deer lion, the energy cost of respiration as a proportion of total assimi-
lated energy at each level would be
(A) 60%- 30%-20% (B) 20%- 30%-60% (C) 20%- 60%-30% (D) 30%- 30%-30%
Ans (B)
?kkl & fgj.k & 'ksj]fd vkgkj J`a[ky k esad qy laxzghr t kZd svuqikr esaizR;sd Lrj ij 'olu t kZd h y kxr fd ruh
gksxh\
a
(A) 60%- 30%-20% (B) 20%- 30%-60% (C) 20%- 60%-30% (D) 30%- 30%-30%
Ans (B)
PART-II
Two Mark Questions
MATHEMATICS
81. Suppose a, b, c are real numbers, and each of the equations x2 + 2ax + b2 = 0 and x2 + 2bx + c2 = 0 has two
distinct real roots. Then the equation x2 + 2cx + a2 = 0 has
(A) two distinct positive real roots (B) two equal roots
(C) one positive and one negative root (D) no real roots
eku y safd a, b, c okLrfod la[;k,agSrFkk izR;sd lehd j.k x2 + 2ax + b2 = 0 ,oax2 + 2bx + c2 = 0 d snksfofHkUu
okLrfod ewy gSA rc lehd j.k x2 + 2cx + a2 = 0 d s
(A) nksfofHkUu /kukRed okLrfod ew y gksxsaA (B) nksleku ew y gksxsaA
(C) ,d /kukRed o ,d _ .kkRed ew y gksxkA (D) d ks
bZokLrfod ewy ughagksxkA
Sol. D1 = 4a2 4b2 > 0 4 (a2 b2) > 0
a2 b2 > 0 .......... (1)
D2 = 4b2 4c2 > 0 b2 c2 > 0 ............. (2)
now D = 4c2 4a2 = 4(c2 b2 + b2 a2)
= 4 (b2 c2 + a2 b2)
= 4 (D1 + D2)
= Negative
Equation have no real root.
1 x
82. The coefficient of x2012 in is
(1 x 2 )(1 x )
1 x
esax2012 d k ,d xq.kkad gS&
(1 x 2 )(1 x )
(A) 2010 (B) 2011 (C) 2012 (D) 2013
Sol. (1+x) (1+x2)1 (1-x)1

r
(1+x) x 2r ( 1)r x r = x 2r ( 1)r x + x 2r
( 1)r (x r 1
)
r 0 r 0 r 0 r 0 r 0 r 0
for Coffi. of x2012 = (-1)0 + (-1)1 + (-1)2 + ....... (-1)1006) + ((-1)0 + (-1)1+ ..... +(-1)1005)
=1+0
=1
No answer
RESONANCE PAGE - 27
83. Let (x, y) be a variable point on the curve 4x2 + 9y2 8x 36y + 15 = 0. Then
min (x2 2x + y2 4y + 5) + max(x2 2x + y2 4y + 5) is
;fn o 4x2 + 9y2 8x 36y + 15 = 0 ij (x, y) ,d pjfcUnqgS] rc
min (x2 2x + y2 4y + 5) + max(x2 2x + y2 4y + 5) d k eku gksxk&
325 36 13 25
(A) (B) (C) (D)
36 325 25 13
Sol. 4x2 + 9y2 8x 36y + 15 = 0
4(x2 2x + 1) + 9(y2 4y + 4) 25 = 0
4(x 1)2 + 9 (y 2)2 = 25
( x 1)2 ( y 2) 2
2
2 =1
5 5

2 3
min ( x 1)2 ( y 2)2 + max. x 12 ( y 2)2

2 2
5 5 100 225 325
= + = =
3 2 36 36
Ans. (A)
1
84. The sum of all x [0, ] which satisfy the equation sinx + cosx = sin2(x + ) is
2 4
1
;fn x [0, ] lehd j.k sinx + cosx = sin2(x + ) d ksla
rq"V d jrk gS] rc x d s,sl slHkh ekuksad k ;ksx gS&
2 4
5
(A) (B) (C) (D) 2
6 6
1
Sol. sinx + cos x = sin2 x
2 4
1 1 cos 2 x / 2
sinx + cosx =
2 2
1 1 1
sinx + cosx = sin2x
2 2 2
2sinx + cosx = 1 + sin2x
2sinx + cosx = 1 + 2 sinx cosx
2sinx (1 cosx) 1 (1 cosx) = 0
(1 cosx) (2sinx 1) = 0
1
cos x = 1 or sinx =
2
5
x=0 x= ,
6 6
5
sum of roots = 0 + + =
6 6
Ans. (C)
85. A polynomila P(x) with real coefficients has the property that P(x) 0 for all x. Suppose P(0) = 1 and
P(0) = 1. What can you say about P(1)?
cgqin P(x) d s okLrfod xq.kkad bl izd kj gS fd l Hkh x d s fy , P(x) 0. eku y sa fd P(0) = 1 rFkk
P(0) = 1 rc vki P(1) d sckjses
aD;k d g ld rsgS?
1 1
(A) P(1) 0 (B) P(1) 0 (C) P(1) 0 (D) < P(1) <
2 2
RESONANCE PAGE - 28
2
Sol. P(x) = ax + bx + c a 0
P(x) = 2ax + b
P(x) = 2a
P(0) = c = 1
P(0) = b = 1
P(x) = ax2 x + 1
P(1) = a 1 + 1 = a 0
Ans. (C)
an
86. Define a sequence (an) by a1 = 5, an = a1a2 ... an1 + 4 for n > 1. Then lim
n an 1
1 2
(A) equals (B) equal 1 (C) equals (D) does not exists
2 5
n a
,d vuq e (an) d ksbl izd kj ifjHkkf"kr d jssafd n > 1 d sfy , a1 = 5, an = a1a2 ... an1 + 4 rc nlim
a n 1
d k eku
1 2
(A) d scjkcj gSA (B) 1 d scjkcj gS
A (C) d scjkcj gSA (D) vfLrRo ughagS
A
2 5
Sol. a1 = 5
an = a1a2a3 .......an 1 + 4
a1a 2a 3 ......a n 1a n
= an +4
a n1 4
an = an +4
an2 = an + 1 4 + 4an
an+1 = an2 4an + 4 = (an 2)2
a n 1 = an 2
an 1 2 an 1
=1 a =1 a
an n a n 1 n 1
an 2
lim = nlim 1 ( nlim
an 1 = 1 an = )

n an 1

cos 2 x
87. The value of the integral 1 a x
dx , where a > 0, is

cos 2 x
lekd y 1 a x
dx , t gka > 0 d k eku gS&

(A) (B) a (C) (D) 2
2

cos 2 x
Sol. I= 1 a x
dx , (a > 0) ...(1)

cos 2 ( x )
I= dx

1 ax

a x cos 2 x
I= dx ...(2)

1 ax
RESONANCE PAGE - 29
(1) + (2)

cos 2 x(1 a x )
2I = dx

(1 a x )

2
2I = 2 cos x dx

0

1 cos 2x 1 sin 2x
I= dx x
2 2 2 0
0
1
I= sin 2 0 sin00
= .
2 2
88. Consider
L= 3 3 3
2012 + 2013 + ... + 3011
R= 3 3 3
2013 + 2014 + ... + 3012
3012
and I = 3 x dx .
2012
eku y safd
L= 3 3 3
2012 + 2013 + ... + 3011
R= 3 3 3
2013 + 2014 + ... + 3012
3012
rFkk I = 3 x dx rc
2012
(A) L + R < 2I (B) L + R = 2I (C) L + R > 2I (D) LR = I

1/3
Sol. Since y = x is concave downwards for x > 0
2013
1/ 3
Area of trapezoid AABB < x
2012
dx
2013
(2012)1 / 3 (2013 )1/ 3 1/ 3
i.e.
2
< x
2012
dx
2014
(2013)1/ 3 (2014)1 / 3 1/ 3
Similarly,
2
< x
2013
dx
2015
(2014)1/ 3 (2015)1 / 3 1/ 3
2
<
2014
x dx
...................................
and so on
RESONANCE PAGE - 30
3012
(3011)1/ 3 (3012)1/ 3 1/ 3
2
<
3011
x dx
Adding we get
3012
L R 1/ 3
2
< x
2012
dx
L R
<I
2
L + R < 2I
Hence Answer is (A)
89. A man tosses a coin 10 times, scoring 1 point for each head and 2 points for each tail. Let P(K) be the
1
probability of scoring at least K points. The largest value of K such that P(K) > is
2
,d vkneh ,d flDd sd ks10 ckj mNky rk gSA mlsizR;sd fpk d sfy , 1 vad vkSj izR;sd iV~V d sfy , 2 vad izkIr gksrs
1
gSA eku y safd d e lsd e K vad izkIr d jusd hizkf;d rkP(K) gks]rc P(K) > d sfy , K d kvf/kd re eku D;kgksxk?
2
(A) 14 (B) 15 (C) 16 (D) 17
Sol. P(K) = P (at least K points)
x1 + x2 + x3 + ....... x10 = K
Coeff xK in (x1 + x2)10
= x10(1 + x)10
k10
coeff x in (1 + x)10
10
= CK10 K 10
1
Now P(K) >
2
10
C 0 10 C1 10 C 2 ...... 10 CK 10 1
10
2 2
10
C0 + 10C1 + ............. + 10CK10 > 29
1 + 10 + 45 + 120 + 210 + 252 + ...... > 512
10
C0 + 10C1 + 10C2 + 10C3 + 10C4 + 10C5 > 512
K 10 = 5
K = 15
Ans. (B)
x 1
90. Let f(x) = for all x 1. Let f1(x) = f(x), f2(x) = f (f(x)) and generally fn(x) = f(fn1(x)) for n > 1. Let P = f1(2)
x 1
f2(3) f3(4) f4(5) which of the following is a multiple of P
x 1
eku y safd lHkh x 1 d sfy , f(x) = gSA ;fn f1(x) = f(x), f2(x) = f (f(x)) vkSj n > 1 d sfy , lkekU;r%
x 1
fn(x) = f(fn1(x)) gSvkS j P = f1(2) f2(3) f3(4) f4(5). buesalsP d kxq.kt D;kgksxk?
(A) 125 (B) 375 (C) 250 (D) 147
Sol. P = f(2) . f(f(3)) f(f(f(4)) ff(f(f(5)
3 4 5 6
= f f f f f f
1 2 3 4

5
3
f 1
3 3
1
2
= (3) 5 f f
1 1
3
3
1
2
= (3) (3) (f(4)) f(f(5))
RESONANCE PAGE - 31
5 6
=9 f
3 4
3
1
2
= (15) 3
1
2
= (15) (5) = 75
375 is multiple of 75.
Ans. (B)
PHYSICS
91. The total energy of a black body radiation source is collected for five minutes and used to heat water. The
temperature of the water increases from 10.0C to 11.0C. The absolute temperature of the black body is
doubled and its surface area halved and the experiment repeated for the same time. Which of the following
statements would be most nearly correct?
d `f".kd kfofd j.klsmRlft Zr d qy t kZd ks5 feuV rd ,d f=kr d jd sikuhxeZfd ;kt krkgSA ikuhd krki 10.0C ls
11.0C gkst krkgS
A d `f".kd kd kije rki nq
xqukd jd s,oa{ks=kQ y vk/kkd jd siz;ks
x d ksmrusghle; (5 feuV) d s fy ,
nksgjk;k t rk gSA buesalsd kSulk d Fku lclslgh y xrk gS\
(A) The temperature of the water would increase from 10.0C to a final temperature of 12C
ikuhd krki 10.0C ls12C gkst k;sxkA
(B) The temperature of the water would increase from 10.0C to a final temperature of 18C
ikuhd krki 10.0C ls18C gkst k,xkA
(C) The temperature of the water would increase from 10.0C to a final temperature of 14C
(D) The temperature of the water would increase from 10.0C to a final temperature of 11C
Sol. H1 = AT4 5 = Ms1
A
H2 = (2T)4 5 = msq2
2
2 = 81
2 = 8C
The temperature of water would increase from 10C to a final temperature of 18C
92. A small asteroid is orbiting around the sun in a circular orbit of radius r0 with speed V0. A rocket is launched
from the asteroid with speed V = V0 where V is the speed relative to the sun. The highest value of for
which the rocket will remain bound to the solar system is (ignoring gravity due to the asteroid and effect of
other planets)
,d xzfgd kV0 osx lslw ;Zd spkjksavks
j r0 f=kT;kd so`
kh; iFkesapDd j y xkrhgSA bl xzfgd klsV = V0 osx ls,d jkd sV
iz{ksfir fd ;kt kkrkgS]t gkWV lw;Zd slkis{kosx gSA d kmPpre~eku D;kgksxkt ksjkd sV d kslkSj eaM y lsca/kj[ksxh\
(xzfgd k,oavU; xzgksad sxq: Roh; izHkko d ksvuns[kkd hft ,A)
(A) 2 (B) 2 (C) 3 (D) 1
Sol. Mechanical energy of asteroid
1 GMm
= mv2 r
2 0
Rocket will remain band to the solar system its B moving energies negative.
GMm 1
mv 2 0
r0 2
GMm 1
mv 2
r0 2
RESONANCE PAGE - 32
GMm 1
m 2 v 02
r0 2
1
mv02 = m2v02
2
= 2.
93. A radioactive nucleus A has a single decay mode with half life A. Another radioactive nucleus B has two
decay modes 1 and 2. If decay mode 2 were absent, the half life of B would have been A/2. If decay mode 1
B
were absent, the half life of B would have been 3 A. If the actual half life of B is B , then the ratio is
A
,d jsfM;ksalf ; ukfHkd A ,d y &{k; iz.kky hsingle decay mode) ls{kf;r gksrkgSvkSj bl izf ;kd hv/kZvk;qA gSA
,d nwl jsjsfM;ksalf ; ukfHkd B d hnks{k; iz.kkfy ;kW1 vkSj 2 gSaA ;fn {k; iz.kky h2 miy C/kughagksrhrksB d hv/kZvk;q
A/2 gks
rhgSA ;fn {k; iz.kky h1 miy C/kughagksrhrksB d hv/kZvk;q3 A gksrhgSA ;fn B d hokLrfod v/kZvk;qB gSrc
B
vuqikr d k D;k eku gksxk \
A
3 7 7
(A) (B) (C) (D) 1
7 2 3
Sol. B = 1 + 2
n2 2n2 n2 7n2

B A 3 A 3 A
B 3
= 7.
A
94. A stream of photons having energy 3 eV each impinges on a potassium surface. The work function of
potassium is 2.3 eV. The emerging photo-electrons are slowed down by a copper plate placed 5 mm away.
If the potential difference between the two metal plates is 1V, the maximum distance the electrons can move
away from the potassium surface before being turned back is
3 eV t kZd sQ ks
Vkud .k ,d iksVsf'k;e d sIy sV d h lrg ij iM+rsgSaA iksVsf'k;e d k d k;ZQ y u (work function) 2.3
eV gS
A mRlft Z
r Q ks
VksbysDVkW
uks
ad ks5 mm nw j j[ksrkacsd sIy s
V ls/khekfd ;kt krkgSA ;fn nksuks
aIys
Vks
ad schp d kfoHkoka
rj
1V gksrks
]ihNsy kSVusd sigy sby sDVkWu iksVksf'k;e Iy sV lsvf/kd re~fd ruh nwjh rd t k ld rsgSa\
(A) 3.5 mm (B) 1.5 mm (C) 2.5 mm (D) 5.0 mm
Sol. 3eV
= 2.3 eV
Kmax = 3 2.3 = 0.7 eV
5 mm 1V
1V 5mm
0.7 V 5 0.7 mm
= 3.5 mm.
95. Consider three concentric metallic spheres A, B and C of radii a, b, c respectively where a<b<c. A and B are
connected whereas C is grounded. The potential of the middle sphere B is raised to V then the charge on the
sphere C is
/kkrqd srhu lad sUnzhxksy sA, B ,oaC d hf=kT;k,aa, b, c gSat gkWa<b<cAA ,oaB t qM +sgSa]t cfd C d ksHkwl aifd Zr fd ;kx;k
gSA ;fn chp oky sxksy sB d k foHko c<+kd j V fd ;k t krk gSrc C xksy sij vkos'k D;k gksxk \
bc bc ac
(A) 40V (B) + 40V (C) 40V (D) zero 'kw
U;
c b c b ca
RESONANCE PAGE - 33
Kq KQ
Sol. V=
b c
k( q Q )
0
c
q+Q=0
q = Q
K KQ
( Q ) V
b c
1 1
KQ V
c b
bcV
Q= 4 0 .
(b c )
96. On a bright sunny day a diver of height h stands at the bottom of a lake of depth H. Looking upward, he can
see objects outside the lake in a circular region of radius R. Beyond this circle he sees the images of objects
lying on the floor of the lake. If refractive index of waler is 4/3, then the value of R is :
,d mTt oy fnu esah y ackbZd k ,d xksrk[ksj H xgjkbZoky s,d rky kc d sry ij [kM+k gSA ij d h vksj ns[kusij og
rky kc d sckgj d k n`'; R f=kT;kd so`kd snk;jsesans[kld rk gSA bl o`kd sckgj og rky kc d sry ij fLFkr oLrqv ks
d sizfrfcEc gh ns[k ikrk gSA ;fn t y d k viorZukad 4/3 gSrksR d k eku D;k gksxk \
3(H h) (H h) (H h)
(A) (B) 3h 7 (C) (D)
7 7 5
3 3
Sol.
4 3
(sinC) = 1 sinC =
3 4
3 R
tanC = =
17 Hh
3
R= (H h) .
7
RESONANCE PAGE - 34
97. As shown in the figure below, a cube is formed with ten indentical resistance R (thick lines) and two shorting
wires (dotted lines) along the arms AC and BD.
uhpsn'kkZ
, fp=kes a,d ?ku 10 leku ifjek.kokysiz
frjks
/kR eksVhjs
[kk,arFkkHkqt kvks
aBD ,oaAC d svuq fn'knksy |q
ifFkr
rkjksalscukgqv k gSA
Resistance between point A and B is

A ,oaB d schp d k iz
frjks/k D;k gksxk \
R 5R 3R
(A) (B) (C) (D) R
2 6 4
Sol.
W.S. Bridge
RAB = R/2.
98. A standing wave in a pipe with a length L = 1.2 m is described y

,d L = 1.2 ehVj y ackbZd sikbi eas,d vizxkkeh rjax d ksbl Q y u lsfu: fir fd ;k t krk gSA
2 2
y (x, t) = y0 sin L x sin L x 4

Based on above information, which one of the following statement is incorrect.
(Speed of sound in air is 300 ms1)
ijh nh xbZt kud kjh d svk/kkj ij fuEufy f[kr esalsd kSu lk d Fku xy r gS\ /;ku nsfd ok;qesa/ofu d h xfr 300
ms1 gSA)
(A) A pipe is closed at both ends
ikbi nksuksafljksaij can gSA
(B) The wavelength of the wave could be 1.2 m
rjax d k rjaxnS/;Z1.2 m gksld rk gSA
(C) There could be a nods at x = 0 and antinode at x = L/2
x = 0 ij fuLian (node) ,oax = L/2 ij izLian (antinode) gksld rk gSA
RESONANCE PAGE - 35
(D) The frequency of the fundamental mode of vibrations is 137.5 Hz
d aiu d hewy fo/kk(fundamental mode of vibrations) d hvko`fk137.5 Hz gSA
Sol. From equation
2 4 L
= = = 0.6 m.
L 2
Ans. (B)
99. Two block (1 and 2) of equal mass m are connected by an ideal string (see figure below) over a frictionless
pulley. The blocks are attached to the ground by springs having spring constants k1 and k2 such that
k1 > k2 .
fp=k esa,d vkn'kZjLlh lsca/ksleku nzO;eku m d snksxqVd s(1 ,oa2) ,d ?k"kZ.k jfgr f?kjuh lsy Vd sgSaA nksuksaxqVd ksa
d ksnksd ekuh (spring) ft ud k d ekuh fu;rkad k1 ,oak2 gS(k1 > k2) d sek/;e lst ehu lst ksM +fn;k x;k gSA
Initially, both springs are unstretched. The block 1 is slowly pulled down a distance x and released. Just after
the release the possible value of the magnitudes of the acceleration of the blocks a1 and a2 can be
'kq: esanksuksad ekfu;kaes
ad ks
bZf[ka
p ko rukoughagS
A xqVd s1 d ks/khjslsuhpsx nw
jhrd [khap d j Nks
M +fn;kt krkgSA Nks
M+us
d srRd ky ckn nksuksaxqVd ksad sRoj.k a1 ,oaa2 d sifjek.k buesalsd kSu gksld rsgS\
(k 1 k 2 ) x k x k x
(A) either a1 a 2 or vFkok a1 1 g and a 2 2 g
2m m m
(k 1 k 2 ) x
(B) a1 a 2 only d s
oy
2m
(k 1 k 2 ) x
(C) a1 a 2 only d s
oy
2m
(k 1 k 2 ) x (k 1k 2 ) x
(D) either a1 a 2 or vFkok a1 a 2 g
2m ( k 1 k 2 )m
RESONANCE PAGE - 36
Sol.
T + k1x mg = ma
k2x + mg T = ma
T + k1x mg = k2x + mg T
2T = (k2 k1)x + 2mg
(k 2 k 1 )x
T= mg
2
(k 1 k 2 )x
a= If T is not zero
2m
If T is 0 then
k 1x mg k 1x
a1 = = g
m m
k 2 x mg k2x
a2 = = g
m m
100. A simple pendulum is released from rest at the horizontally stretched position. When the string makes an
angle with the vertical, the angle which the acceleration vector of the bob makes with the string is given
by
,d ljy y ksy d d ks{kSfrt ls[khap hgqbZfLFkfr lsfLFkj voLFkkesaNksM +kt krkgSA t c jLlh /oZls d ks.kcukrhgS]ml
le; y ksy d d sRoj.k lfn'k ,oajLlh d h chp d k d ks.k D;k gksxk \
tan
(A) = 0 (B) = tan1 (C) = tan1 (2 tan ) (D) =
2 2
Sol.
at = g sin ........... (i)

ac = v2/ ........... (ii)
RESONANCE PAGE - 37
1
0+0= mv2 mg cos ........... (iii)
2
aC = v2/ = 2g cos
at = g sin
tan = at/ac
= g sin/2g cos
tan
=
2
1 tan
= tan
2
Ans. (B)
CHEMISTRY
101. The final major product obtained in the following sequence of reactions is :
fuEufy f[kr vuq fed vfHkf ;kvksad k eq[; vafre mRikn D;k gS\
(A) (B) (C) (D)
Ans. (D)
Sol.
102. In the DNA of E. Coli the mole ratio of adenine to cytosine is 0.7. If the number of moles of adenine in the DNA
is 350000, the number of moles of guanine is equal to :
E Coli d sDNA es a,sM suhu vkSj lkbVksl hu d keksy j vuqikr 0.7 gSA ;fn DNA esa,sM suhu d seksy ksad hla[;k350000 gS
rc Xokuhu d seksy ksad h la[;k D;k gksxh \
(A) 350000 (B) 500000 (C) 225000 (D) 700000
Ans. (B)
T A 350000
Sol. 0.7
G C G
350000
G= = 5,00,000 Ans.
0.7
103. (R)-2-bromobutane upon treatment with aq. NaOH gives

(R)-2-cz
kseksC;qVsu vkSj t y h; NaOH vfHkf ;kd kmRikn D;kgksxk\
(A) (B)
(C) (D)
Ans. (C)
RESONANCE PAGE - 38
Sol.
104. Phenol on treatment with dil. HNO3 gives two products P and Q. P is steam volatile but Q is not. P and Q are
respectively
Q hukWy d kruqHNO3 (dil. HNO3) d slkFkfoosp u d jusij nksmRikn P vkSj Q cursgSaA P Hkki }kjkok"i'khy (steam
volatile) gSt c fd Q ,s
l k ughagSA P vkSj Q e'k%D;k gksaxs\
(A) and (rFkk) (B) and (rFkk)
(C) and (rFkk) (D) and (rFkk)
Ans. (A)
Sol. Phenol on treatment with dil HNO3 gives onitrophenol and p-nitrophenol.
onitrophenol has intra molecular Hbonding hence steam volatile ie P, where as Q is p-nitrophenol, Q has
inter molecular H-bonding.
105. A metal is irradiated with light of wavelength 660 nm. Given that the work function of the metal is 1.0 eV, the
de-Broglie wavelength of the ejected electron is close to :
,d /kkrqd ks660 nm rjax}S/;Zd sizd k'klsfd jf.kr (irradiated) fd ;kt krkgSA Kkr gSfd /kkrqd kd k;Z& Q y u (Work
function) 1.0 eV gS A fu"d kflr by sDVku d h Mh&czksXy h (de-Broglie) rjax}S/;Zbuesalsfd l d sfud V gS:
(A) 6.6 107 m (B) 8.9 1011 m (C) 1.3 109 m (D) 6.6 1013 m
Ans. (C)
Sol. Kinetic energy xfrt t kZ= h work function d k;ZQ y u
1240
KE = 1
660
KE = 0.878 eV
150
=
V
150
=
0.878
= 13.07 = 1.3 109 m
106. The inter-planar spacing between the (2 2 1) planes of a cubic lattice of length 450 pm is :
,d ?ku t ky d (Cubic lattice) d h y EckbZ450 pm gSA bld s(2 2 1) ry ksad h varj&ry nwjh D;k gS\
(A) 50 pm (B) 150 pm (C) 300 pm (D) 450 pm
Ans. (B)
a 450
450
Sol. = = = 150 pm
h2 K 2 2 (2)2 (2)2 (1)2 3
RESONANCE PAGE - 39
107. The H for vaporization of a liquid is 20 kJ/mol. Assuming ideal behaviour, the change in internal energy for
the vaporization of 1 mole of the liquid at 60C and 1 bar is close to :
,d nzo d sok"iu d h,UFkSYih]H d keku 20 kJ/mol gSA ;fn vkn'kZO;ogkj ekusrks]60C rkieku vkSj 1 bar nkc ij
nzo d s1 mol d sok"iu d snkSjku vkarfjd t kZesagq, ifjorZu d k eku fuEu d sfud V gS:
(A) 13.2 kJ/mol (B) 17.2 kJ/mol (C) 19.5 kJ/mol (D) 20.0 kJ/mol
Ans. (B)
Sol. H = 20 kJ/mol
U = H ng RT
U = 20 103 1 8.314 (273 + 60)
U = 20 2.768
U = 17.2 kJ/mol
108. Among the following, the species that is both tetrahedral and diamagnetic is :
buesalsd kSu prq"Q y d h; vkSj izfrpqEcd h; nksuksagh gS\
(A) [NiCl4]2 (B) [Ni(CN)4]2 (C) Ni(CO)4 (D) [Ni(H2O)6]2+
Ans. (C)
Sol. As in Ni(CO)4 hybridisation of Ni is sp3 and CO is strong field effect ligand therefore, it is diamangetic.
Ni(CO)4 es aNi d k lad j.k sp3 gSrFkk CO izcy {ks=k fy xs.M gSblfy , ;g izfrpqEcd h; gSA
109. Three moles of an ideal gas expands reversibly under isothermal condition from 2 L to 20 L at 300 K. The
amount of heat-change (in kJ/mol) in the process is :
,d vkn'kZxS l d srhu eksy 300 K ij lerkihvoLFkkesa2 L ls20 L rd mR e.kh; rjhd slsiz
l kfjr gks
rsgSa
A bl iz
f ;k
esa "ek ifjorZu d k ifjek.k (kJ/mol bd kbZesa) D;k gS:
(A) 0 (B) 7.2 (C) 10.2 (D) 17.2
Ans. (D)
V2
Sol. W = nRT ln V
1
W = 3R 300 ln 10
900 8.314
= 2.3 = 17.2 kJ/mol.
1000
q = W = 17.2 kJ/mol. (For isothermal process lerkih; iz e d sfy , E = 0).
110. The following data are obtained for a reaction, X + Y Products.

Expt. [X0]/mol [Y0]/mol rate/mol L1 s1
1 0.25 0.25 1.0 106
2 0.50 0.25 4.0 106
3 0.25 0.50 8.0 106
The overall order of the reaction is :
(A) 2 (B) 4 (C) 3 (D) 5
vfHkf ;k X + Y mRIkkn d sfy , fuEufy f[kr vkad M+sizkIr gq,A
iz;ksx vuq e [X0]/eky
s [Y0]/eks
y nj/eksy L1 s1
1 0.25 0.25 1.0 106
2 0.50 0.25 4.0 106
3 0.25 0.50 8.0 106
bl vfHkf ;kd hlexzd ksfV (overall order of the reaction) D;kgS\
(A) 2 (B) 4 (C) 3 (D) 5
Ans. (D)
Sol. Rate nj = K . [X]p [Y]q
From expt. 1 and 2, p = 2 and from expt. 1 and 3, q = 3. Therefore, over all order = 5.
iz;ksx 1 o 2 lsp = 2 rFkk iz;ksx 1 o 3 lsq = 3A
blfy , lEiw.kZd ksfV = 5 gSA
RESONANCE PAGE - 40
BIOLOGY
111. When hydrogen peroxide is applied on the wound as a disinfectant, there is frothing at the site of injury,
which is due to the presence of an enzyme in th skin that uses hydrogen peroxide as a substrate to produce
(A) hydrogen (B) carbon dioxide (C) water (D) oxygen
Ans (D)
t c gkbMkst u ijvkDlkbM ?kko ij jksxk.kq& uk'kd d srkSj ij y xk;k t krk gS]rc >kx curk gSA bld h ot g Ropk esa
mifLFkr fd .od (enzyme) gSt ksgkbMkst u ijvkDlkbM lsfuEufy f[kr d kseqDr d jrk gSS&
(A) gkbZ
Mks
tu (B) ikuh (C) d kCku
ZMkbZvkDlkbM (D) vkDlht u
112. Persons suffering from hypertension (high blood pressure) are advised a low-salt diet because
(A) more salt is absorbed in the body of a patient with hypertension
(B) high salt leads to water retention in the blood that further increases the blood pressure
(C) high salt increases nerve conduction and increases blood pressure
(D) high salt causes adrenaline release that increases blood pressure
Ans (B)
mPp jDrpki lsihfMr O;fDr d ksued d e y susd h ly kg nh t krh gSA D;ksafd ]
(A) mPp jDrpki d sd kj.k ued d k vo'kks "k.k T;knk gksrk gS
(B) T;knk ued d sd kj.k [kq
u esaikuh d k izfr/kkj.k gksrk gSft ld sd kj.k jDrpki c<+rk gSA
(C) T;knk ued lsraf=kd k mksft r gksarh gSvkSj jDrpki c<+rk gSA
(D) T;knk ued ls,WfMufy u d k lzko.k gksrk gS]ft ld sd kj.k jDrpkii c<+rk gSA
Ans (B)
113. Insectivorous plants that mostly grow on swampy soil use insects as a source of
(A) carbon (B) nitrogen (C) phosphorous (D) magnesium
d hV&Hk{kh ikS/ksny ny esaik, t krsgSA bu ikS/kksad ksd hMksalsD;k fey rk gS\
(A) d kCkZ
u (B) ukbVks
tu (C) Q kLQ ks
jl (D) eS
Xuhf'k;e
Ans (B)
114. In cattle, the coat colour red and white are two dominant traits, which express equally in F1 to produce roan
(red and white clour in equal proportion). If F1 progeny are self-bred, the resulting progeny in F2 will have
phenotypic ratio (red:roan:white) is -
(A) 1 : 1 : 1 (B) 3 : 9 : 3 (C) 1 : 2 : 1 (D) 3 : 9 : 4
,d izd kj d si'kqv ksad h [kky d snksizcy fo'ks"kd jax]Hkwjk vkSj lQ sn gSat ksF1 larfr esacjkcj vuqikr esaizd V gkrsgS]
t ksfd gYd sHkwjsjax d sgksaxsA vxj F1 larfr d k Loizt uu fd ;k t k, t c F2 larfr d sHkwjk %gYd k Hkwjk%lQ sn jaxksad s
ley {k.kh; (phenotypic) vuqikr D;k gksxk\
(A) 1:1:1 a (B) 3:9:3 (C) 1:2:1 (D) 3:9:4
Ans (C)
115. The restriction endonuclease EcoR-I recognises and cleaves DNA sequence as shown below -
5 G A A T T C 3
3 C T T A A G 5
What is the probable number of cleavage sites that can occur in a 10 kb long random DNA sequence?
(A) 10 (B) 2 (C) 100 (D) 50
Ans (B)
EcoR-1 ,d fjfLV
D'ku ,UMksU;w
Dy h,l fd .od gSt ksfd fuEufy f[kr DNA vuq e d ksigpku d j mld kfoHkkt u d jrk
gS
5 G A A T T C 3
3 C T T A A G 5
,d 10 kb y Ecsala;ksfxd DNA vuq e Ecor-I }kjkfd rusfoHkkt uksad sgksusd hlaHkkoukgS\
(A) 10 (B) 2 (C) 100 (D) 50
Ans (B)
RESONANCE PAGE - 41
116. Which one of the following is true about enzyme catalysis ?
(A) the enzyme changes at the end of the reaction
(B) the activation barrier of the process is lower in the presence of an enzyme
(C) the rate of the reaction is retarded in the presence of an enzyme
(D) the rate of the reaction is independent of substrate concentration
Ans (B)
fd .od (enzyme) mRizsj.k (catalysis) d sckjsesad kSu lk fuEufy f[kr d Fku lgh gS\
(A) vfHkf ;k d sckn fd .od es acny ko vkrk gSSA
(B) fd .od d st fj;slf ;.kjks /k(activation barrier) d e gkst krkgS
(C) fd .od d st fj, vfHkf ;k d hxfr d e gkst krh gS A
(D) vfHkf ;kd hxfr d k;Z nzO; (substrate) lkaUnzrkij fuHkZj ughad jrhA
Ans (B)
117. Vibrio cholerae causes cholera in humans. Ganga water was once used successfully to combat the infec-
tion. The possible reason could be -
(A) high salt content of Ganga water
(B) low salt content of Ganga water
(C) presence of bacteriophages in Ganga water
(D) presence of antibiotics in Ganga water
Ans (C)
euq";ks
aes
ad kWy sjkjksx fofcz;ks ad kWy sjsd hVk.kqlsgksrkgS
A xa
xkt y d slsou lsbl la e.kd ksjksd kt kld rkFkkA bld kD;k
d kj.k gk ld rk gS\
(A) xaxkt y esaued d h ek=kk vf/kd gSA (B) xa
xkt y esaued d h ek=kk d e gS
(C) xaxkt y es at hok.kqHkkst h(bacteriophages) gS A (D) xa
xkt y esaizfrt Sfod h (antibiotics ) gSaA
Ans (C)
118. When a person begins to fast, after some time glycogen stored in the liver is mobilized as a source of
glucose. Which of the following graphs best represents the change of glucose level (y-axis) in his blood,
starting from the time (x-axis) when he begins to fast ?
(A) (B)
(C) (D)
Ans (C)
RESONANCE PAGE - 42
miokl 'kq: d jusd sd qN le; (time x v{k d sckn ;d `r d sXy kbd kst u d sHkaM kj d k Xy wd kst (glucose y v{k
esaifjorZu 'kq: gksrk gSA fuEufy f[kr fd l xzkQ esamiokl d jusoky sd sjDr esaXy wd kst d h ek=kk d kslgh n'kkZ;k
x;k gS\
(A) (B)
(C) (D)
Ans (C)
119. The following sequence contains the open reading frame of a polypeptide. How many amino acids will the
polypeptide consist of ?
5 AGCATATGATCGTTTCTCTGCTTTGAACT3
(A) 4 (B) 2 (C) 10 (D) 7
Ans (D)
fuEufy f[krcc DNA d svuq e esa,d isiVkbM d k vksiu jhfMax se gSA ;g isiVkbM fd rusvehuksa,flM d k gksxk\ 5'
AGCATATGATCGTTTCTCTOGCTTTGAACT - 3'
(A) 4 (B) 2 (C) 10 (D) 7
Ans (D)
120. Insects constitute the largest animal group on earth. About 25-30% of the insect species are known to be
herbivores. In spite of such huge herbiore perssure, globally, green plants have persisted. One possible
reason for this persistence is :
(A) food preference of insects has tended to change with time
(B) herbivore insects have become inefficient feeders of green plants
(C) herbivore population has been kept in control by predators
(D) decline in reproduction of herbivores with time
Ans (C)
i`Fohd sizk.khlewg esad hVksad hek=kklclsT;knkgSA 25% - 30% d hVd t kfr 'kkd kgkjhgSA fQ j HkhouLifr d hek=kkesa
cny ko ughavk;k gSA bld k d kj.k D;k gksld rk gS\
(A) d hVksad h[kk| izkf;d rkle; d slkFkifjofrZr gksrhjgrhgSA
(B) 'kkd kgkjhd hV gjsikniks ad svi;kZIr Hk{kd gksrsgSaA
(C) 'kkd kgkjh;kjsad sleqnk; d ksijHkf{k;ksa}kjkfu;af=kr j[kkt krkgSA
(D) 'kkd kgkjh d hVks
ad sizt uu esale; d slkFk d eh gksrht krh gSA
Ans (C)
RESONANCE PAGE - 43

70 PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

70 PDF

Uploaded by

Copyright:

Available Formats

KISHORE VAIGYANIK PROTSAHAN YOJANA - 2012

Date : 04-11-2012 Duration : 3 Hours Max. Marks : 160

2. In the real number system, the equation x 3 4 x 1 + x 8 6 x 1 = 1 has

3. The maximum value M of 3x + 5x 9x + 15x 25x, as x varies over reals, satisfies

Equation of chord of contact T = 0 w.r.t. origin is

8. The value of tan 81 tan 63 tan27 + tan9 is

9. The midpoint of the domain of the function f(x) = 4 2x 5 for real x is

okLrfod x d sfy , Q y u f(x) = 4 2x 5 d sizkUr d k e/; fcUnqgS&

graph of y = f(x) when a = 0

12. The value /2 is

(A) 2012 (B) 2013 (C) 0 (D) 4024

(A) 5/2 (B) 5 (C) 34.5 (D) 35.5

;fn H ,d fuEud ks.k f=kHkqt ABC d k y Ec d sUnzgS,oaO bld k ifjd sUnzgSA rc HA HB HC

20. Let S = 1, 2, 3, ...., n} and A = {(a, b) | 1 a, b n} = S S . A subset B of A is said to be a good subset if

is density, g is acceleration due to gravity, and k is an arbitrary dimensionless constant)

Angular momentum conservation about S

From conservation of momentum

2gh = v1 + 2v2 ...........(i)

Sol. Let ball is moving with speed

42. The molecule with non-zero dipole moment is :

43. For a one-electron atom, the set of allowed quantum numbers is :

(A) (B) (C) (D)

Ans. Option D Closest, if () is change to

45. The most stable conformation of 2, 3-dibromobutane is :

(A) (B) (C) (D)

47. The major final product in the following reaction is :

49. The isoelectronic pair of ions is :

50. The major product in the following reaction is :

(A) (B) (C) (D)

51. The major product of the following reaction is :

(A) (B) (C) (D)

(A) 3 (B) 1 (C) 2 (D) 0

(A) (B) (C) (D)

60. Doping silicon with boron produces a :

64. Fossils are most often found in which kind of rocks ?

65. Peptic ulcers are caused by

66. Transfer RNA (tRNA)

72. Which of the following is true for TCA cycle in eukaryotes

min ( x 1)2 ( y 2)2 + max. x 12 ( y 2)2

(A) L + R < 2I (B) L + R = 2I (C) L + R > 2I (D) LR = I

Resistance between point A and B is

98. A standing wave in a pipe with a length L = 1.2 m is described y

at = g sin ........... (i)

(A) (B) (C) (D)

103. (R)-2-bromobutane upon treatment with aq. NaOH gives

(A) and (rFkk) (B) and (rFkk)

(C) and (rFkk) (D) and (rFkk)

110. The following data are obtained for a reaction, X + Y Products.

You might also like