www.sciencemag.

org/content/356/6334/186/suppl/DC1

Supplementary Materials for

The preprophase band of microtubules controls
the robustness of division orientation in plants
Estelle Schaefer, Katia Belcram, Magalie Uyttewaal, Yann Duroc, Magali Goussot,
David Legland, Elise Laruelle, Marie-Ludivine de Tauzia-Moreau,
Martine Pastuglia,* David Bouchez*

*Corresponding author. Email: martine.pastuglia@inra.fr (M.P.);

david.bouchez@inra.fr (D.B.)

Published 14 April 2017, Science 356, 186 (2017)

DOI: 10.1126/science.aal3016

This PDF file includes:

Materials and Methods

Figs. S1 to S14
Tables S1 to S4
References

Other Supplementary Material for this manuscript includes the following:

(available at www.sciencemag.org/cgi/content/full/356/6334/186/DC1

Movies S1 to S3
 Schaefer et al. Supplementary Materials 2

Materials and Methods

Growth conditions and biological materials

Arabidopsis seedlings were grown in the greenhouse under long-day conditions (16-h light
8-h/dark regime). Arabidopsis seedlings were grown in vitro under long-day conditions (16-h
light 8-h/dark regime, 21C) on a pH 5.7 medium as described in (17) to which Morel and
Wetmore vitamins 1x were added.
T-DNA insertion mutants (18, 19) for TRM7 (At3g58650, trm7-1: SALK_074085, trm7-2
RATM_15_1899-1), TRM6 (At3g05750, trm6-1: GABI_048G03, trm6-2: SALK_112415) and
TRM8 (At5g26910, trm8-1: SALK_150274) were obtained from the Nottingham Arabidopsis
Stock Centre. All were in the Col0 background, except for the trm7-2 allele (Nossen ecotype).
Alleles trm6-1, trm7-1 and trm8-1 (all in the Col0 background) were crossed to produce double
and triple mutant lines.
The pCYCB1;1::CYCB1;1-GUS line is a gift of T. Schmlling (Freie Universitt Berlin,
Germany) (20).
All expression vectors were introduced in Agrobacterium tumefaciens strain
C58C1(pMP90) by electroporation. Plants were stably transformed as described (21).

DNA extraction from plants and genotyping

Primers used to genotype trm6, trm7 and trm8 mutants are indicated below. Genotyping
PCRs were performed on genomic DNA isolated from a rosette leaf (22).

Genotyping of the trm6 allele: Wild type allele (TRM6-01/GK_048G03-LP); Mutant allele
(GK_048G03-RP/LBGabi1).
TRM6-01 AGTTGGCTGAGATTGAGTACAT
GK_048G03-LP ATAGGCCGGTTACACTCCTTG
GK_048G03-RP TGTTACTGTCGAAAGTTCGGTC
LBGabi1 CCCATTTGGACGTGAATGTAGACAC

Genotyping of the trm7-1 allele: Wild type (SALK074085-LP/RP); Mutant allele

(SALK074085-RP/LBSalk2).
SALK074085-LP CTGGTTGTTTTGCCTAAGCAC
SALK074085-RP TCAAAACCCCTCTATTACGCC
LBSalk2 GCTTTCTTCCCTTCCTTTCTC

Genotyping of the trm8 allele: Wild type allele (TRM-04/TRM-05); Mutant allele (TRM8-
03/LBSalk2)
TRM8-03 TGTAAACAAGGTTCCAGTGGA
TRM8-04 CCCAAAACGGTCTGCGTAAA
TRM8-05 TTCTCCTCGGCCTTCCATTT

Constructs
To obtain the pTRM7::GUS and pTRM7::TRM71-71-GUS constructs, a region of 2200 bp
upstream of the TRM7 ATG start codon was amplified by PCR from the BAC F20A2 using
 Schaefer et al. Supplementary Materials 3

respectively the pTRM7-U2/pTRM7ATG and the pTRM7-U/TRM771-L primers pairs flanked

by AttB1 and AttB2 sites (see below), cloned into the Gateway vector pDONR207 using BP
recombination (Invitrogen) and sequenced. The expression vectors were obtained after LR
recombination (Invitrogen) between these entry vectors and a destination vector derived from the
pBI101 in which the Gateway cassette was introduced (pBI101-R1R2-GUS, Bertrand Dubreucq,
IJPB, France).

pTRM7-U GGGGACAAGTTTGTACAAAAAAGCAGGCTTGGTTTAAGGAGGAAGGGGACA
TRM771-L GGGGACCACTTTGTACAAGAAAGCTGGGTTCGGGTTGTAAGTTGGGTTC
ProTRM7-ATG GGGGACCACTTTGTACAAGAAAGCTGGGTTCATGATAATTTACCTATGGATCAAAAC

To obtain the TRM6-, TRM7-, and TRM8-3xYFP lines, a 3xYFP tag was fused by
recombineering (23) to the C-terminus of the TRM6, TRM7 and TRM8 genes contained in JAtY
clones 56C09, 53E09 and 79D06 respectively (purchased from the John Innes Centre, Norwich,
UK). In these clones, TRM6 is preceded and followed by 37.7 and 29.7 kb of genomic DNA
respectively, TRM7 coding sequence is preceded and followed by 10.8 and 51.8 kb of genomic
DNA respectively and TRM8 is preceded and followed by 59.0 and 20.0 kb of genomic DNA
respectively. The JAtY transformation-competent bacterial artificial chromosome was
transferred to Escherichia coli strain SW105, kindly provided by S. Creekmore (National Cancer
Institute - Frederick, MD, USA). The recombineering cassette (kind gift of J. Alonso, North
Carolina State University, USA) (24) was inserted downstream of the TRM7 coding sequence as
described previously (23, 24) using primers described below. The junctions between TRM7 and
the 3xYpet tag, as well as the 3xYpet tag itself were sequenced and the JAtY construct carrying
the TRM7-3xYFP construct introduced into Agrobacterium tumefaciens, which was then used to
transform wild type and trm678 Arabidopsis plants. Transformed lines were selected based on
Basta resistance and further characterized by PCR, ensuring the presence of the tagged TRM
genes. The progeny of PCR-positive T1 lines was assessed for YFP fluorescence. For TRM7-
3xYFP lines, 20 lines were analyzed, 14 displaying a weak but consistent fluorescent signal. For
TRM8-3xYFP lines, 34 lines were analyzed, 17 displaying a weak but consistent fluorescent
signal. For TRM6, 20 lines were analyzed and none of them displayed a fluorescent signal.

TRM6-3xYFP construct:
RecF TRM6
TTGTGTCCGAATTAGTTGATGACTTAATTAATGATCTTATCATGTGTTGTGGAGGTGGAGGTGGAGCT
RecR TRM6
AACAATTTCACTCTCATGTTGGAGAGAAGAAGACCAAAGGATTGGTGTCAGGCCCCAGCGGCCGCAGCAGCACC
TestF TRM6 ATTTTGGCAGACCAAGTGTTG
TestR TRM6 GAGTTCGATTCTCGGAACACC

TRM7-3xYFP construct:
RecF TRM7
ATTTAGTTAGTGATATTTTATCTACTAGTGTTCTTAAACGGTCGTTGTTGGGAGGTGGAGGTGGAGCT
RecR TRM7
CAGACAATTTCAGAACCAGAAGAAGCTTCTTACGAAGACAATACAAGTTAGGCCCCAGCGGCCGCAGCAGCACC
TestF TRM7 GAGAGATGATGATCGACGAGC
TestR TRM7 TGAGAAACCGAAGAACTCGTG
 Schaefer et al. Supplementary Materials 4

TRM8-3xYFP construct:
RecF TRM8
GGGAAGGGGTAGTTTCTGCTTTAGTTGAGCCTCATCTTCTCTCGGCATTCGGAGGTGGAGGTGGAGCT
RecR TRM8
TCACTTTATCTCAATTCTCATGTCAGAGAAACTATTAGAAGAAGCATCTAGGCCCCAGCGGCCGCAGCAGCACC
TestF TRM8 GAAGGGAGATGGCTTGATTTC
TestR TRM8 TTTGGATTTTCTTGCAGAACC

The vector carrying the 2xPro35S::Cerulean-TUA6 microtubule marker was obtained after
an LR recombination between an entry vector carrying the TUA6 sequence constructed using the
primers TUA6-GW1/TUA6-GW2 and the pSITEII-2C1 destination vector (25). The Cerulean-
TUA6 marker was then introduced into a TRM7-3xYFP line by transformation.
TUA6-GW1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGAGAGAGTGCATTTC
TUA6-GW2 GGGGACCACTTTGTACAAGAAAGCTGGGTTTAGTATTCCTCTCCTT

The vector carrying the pUBI::GFP-MBD microtubules marker was obtained after an LR
recombination between an entry vector carrying the MBD of the mouse MAP4 as defined in (26)
and constructed using the primers MBD-GW1/MBD-GW2, and the pUBN-GFP-Dest destination
vector (27).
MBD-GW1 GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCGGCAAGAAGAAGC
MBD-GW2 GGGGACCACTTTGTACAAGAAAGCTGGGTTTAACCTCCTGCAGGAAAGT

The POK1-YFP construct (13) was obtained from S. Mller (University of Tbingen,
Germany) and the pKN::GFP-MBD construct (28) from S. Huang (Institute of Botany, Beijing,
China). The pSCR::SCR-YFP (29) and pWOX5::erGFP (30) constructs were obtained from B.
Scheres (Wageningen University, Netherlands). All constructs were introduced in the trm678
and the Col0 backgrounds by transformation.

The pKN::GFP-MBD vector (28) was used as a backbone to obtain the

pCycB1;1::CycB1;11-116-GFP-MBD marker. To do so, the pCycB1;1::CycB1;11-116 (20) was
amplified from genomic DNA using the primers :
CYCB1;1/NcoI GGGCCATGGCTAAATTTGAAAGAAAAAGG
CYCB1;1/SalI AAAGTCGACCTTCTCTCGAGCAGCAACTAAA
The pCycB1;1::CycB1;11-116 was then cloned into the pKN::GFP-MBD vector digested
with NcoI and SalI. The resulting pCycB1;1::CycB1;11-116-GFP-MBD vector was then verified
by sequencing.

RT-PCR analysis
RNA were isolated from 5 day-old seedlings starting with 100 mg of tissue using the
RNeasy Plant Mini kit (Qiagen). Reverse-transcription was performed from 500 ng of total RNA
with the RevertAid H Minus reverse transcriptase (ThermoFisher) and an Oligo(dT)18 primer,
following the manufacturers protocol. Primers used for semi-quantitative RT-PCR analysis
were:
TRM6 TRM6-03 AGGCTGTTGAGAGGAAACGA
GK_048G03-LP ATAGGCCGGTTACACTCCTTG
 Schaefer et al. Supplementary Materials 5

TRM7 TRM7-03 TCCAATCTCTCCCAACTCTCTG

PTIM7-L5 GAACTGGAGAAGAAGAATCA

TRM8 TRM8-04 CCCAAAACGGTCTGCGTAAA

TRM8-05 TTCTCCTCGGCCTTCCATTT

Histone AtHis-RP CACGTTCTCCTCTGATCCTG

AtHis-LP TGGCTCGTACTAAGCAAACAG

-glucurodinase (GUS) staining

GUS staining was performed as described previously (31) using a final concentration of 5
mM potassium ferrocyanide and 5 mM potassium ferricyanide. MG132 treatment was performed
on 5 day-old seedlings for three hours at a concentration of 50 M.

PI staining and combination of PI and GUS or DAPI staining

Cells wall imaging was performed using propidium iodide staining as described (31) except
that a starch digestion was performed for one hour at 37C using 0.1 mg/ml -amylase (Sigma
A4551) before the incubation in 1% periodic acid. A Zeiss LSM 710 confocal laser-scanning
microscope was used. The excitation wavelengths for PI stained samples were 488 nm and 561
nm, and emission was collected between 565 and 720 nm.
For GUS staining combined with PI staining, seedlings that were processed through the -
glucuronidase staining protocol were stained with PI as above. GUS staining was imaged with
the reflection mode of the confocal microscope. The excitation wavelength was 488 nm, and the
reflection signal was collected between 485 and 491 nm.
For measurement of spindle rotation (hence cell wall and metaphase plate staining), PI
staining was performed as above except for the clearing step where chloral hydrate was replaced
by a solution of 4 M Urea for at least two weeks (32). Root samples were then mounted in
Citifluor supplemented with DAPI (2 g/ml). A Zeiss LSM 710 confocal laser-scanning
microscope was used. The excitation wavelength for DAPI and PI staining was respectively 405
nM and 488/561 nm, and the emission for DAPI and PI staining was collected between
respectively 409484 nm and 565-720 nm.
All root Z-stacks were reoriented using the OsiriX Lite software to obtain for each detected
metaphase plate a perfect longitudinal root section passing through the metaphase plate. The
angle between a line passing through the metaphase plate and the axis of the cell file was
measured using the ImageJ software.

Calcofluor white staining for cell wall imaging

In vitro grown seedlings were fixed overnight in an ethanol/acetic anhydride solution (75/25
volume/volume). Seedlings were then incubated in hot ethanol for 15 minutes (80% ethanol at
80C), rehydrated in 50% then 30% ethanol for 10 minutes, then incubated in sodium hydroxyde
0.2N / SDS 1% for two hours at room temperature. Samples were then rinsed in water and
stained for 30 minutes in calcofluor white 0.25% (Fluorescent Brightener 28) to which few drops
of sodium hydroxyde 10 N were added to obtain complete dissolution. Seedlings were then
 Schaefer et al. Supplementary Materials 6

rinsed in water and mounted in Citifluor. Samples were excited at 405 nm with an emission band
of 410-550 nm.

Immuno-localization
Roots of 3 to 4 day-old Arabidopsis seedlings were processed for whole-mount immuno-
localization essentially as described previously (33). Tissues were fixed in 4% paraformaldehyde
and 0.1% Triton X100 in MTSB buffer (25 mM PIPES, 2.5 mM MgSO4, 2.5 mM EGTA, pH
6.9) for 1 hour under vacuum, then rinsed in MTSB buffer with 0.1% Triton X100 buffer for
10 minutes. Samples were then permeabilized in Methanol for 10 minutes and rehydrated in PBS
for 10 minutes. Cell walls were digested using the following buffer for one hour: 25 mM MES
pH 5.5, 8 mM CaCl2, 600 mM mannitol, 0.02% pectolyase and 0.1% macerozyme. Tissues were
hybridized overnight at 4C with the B-5-1-2 monoclonal anti--tubulin (Sigma) and the anti-
KNOLLE antibody described in (34) (kind gift of G. Jrgens, University of Tbingen,
Germany). The next day, tissues were washed for 15 minutes in 50 mM glycine, incubated with
secondary antibodies (Alexa Fluor 555 goat anti-rabbit for KNOLLE antibody and Alexa Fluor
488 goat anti-mouse for the tubulin antibody) for 1 hour and washed again. Seedlings were
mounted in Citifluor and DAPI. A blind counting was set up to count the G2/M microtubule
arrays seen in four roots from the Col0, trm6, trm7, trm8, trm67, trm78, trm68, and trm678
genotypes.
Dissected shoot apical meristems were processed through fixation, sectioning and immuno-
localization as described previously (35).

Imaging of fluorescent fusions

For time-lapse observations of the TRM7-3xYFP localization during cell division,
Arabidopsis roots of 3 to 4 day-old seedlings were mounted in liquid 1/2 MS medium and
viewed directly using the SP5 confocal laser microscope. For simultaneous detection of
Cerulean-TUA6 and TRM7-3xYFP, samples were excited respectively at 458 nm or 514 nm,
with an emission band of 464-512 nm or 520-600 nm using for both a hybrid detector.
Since we observed that fixing the samples significantly increased the TRM7-3xYFP signal,
Arabidopsis roots of 3 day-old seedlings were also fixed in 4% paraformaldehyde in MTSB
and 0.1% Triton under vacuum for 1 h, then washed in PBS. Tissues were mounted in Citifluor
(Citifuor Limited) and viewed using an SP5 confocal laser microscope (Leica Microsystems).
Samples were observed as described above.
For POK1 localization study, 3 day-old seedlings expressing the POK1-YFP construct in
the Col0 and trm678 background were processed through immuno-localization of tubulin as
described above using the B-5-1-2 monoclonal anti--tubulin and an Alexa Fluor 555 goat
anti-mouse. For simultaneous detection of Alexa Fluor 555 and POK1-YFP, samples were
excited respectively with the resonant scanner of the Leica SP5 confocal microscope at 514 nm
or 561 nm, with an emission band of 520-548 nm or 575-620 nm using for both an hybrid
detector.
For microtubules localization, 3 to 4 day-old seedlings root tips expressing either the
pCycB1;1::CycB1;11-116-GFP-MBD or the pKN::GFP-MBD marker (28) were excited at 488
nm with an emission band of 495-550 nm.
 Schaefer et al. Supplementary Materials 7

Segmentation for extraction of root cell layers and recently divided cells
Image analysis of 3D root organization was performed using the ImageJ/Fiji software (36).
We applied a marker based watershed segmentation on propidium iodide stained root images
with the Morphological Segmentation plugin of the MorpholibJ package ((37);
http://imagej.net/MorphoLibJ). Over-segmentation (one cell split in several parts) and under-
segmentation (merged cells) errors were corrected by manually modifying markers before re-
running the watershed transform. The process was repeated until no segmentation error
remained. On the obtained labeled image, we then used in-house developed tools
(https://github.com/L-EL/labeledImg_tools) to manually extract cells of interest from cell files or
to select daughter cells. The volume ratios between daughter cells (volume of the quiescent
center proximal cell/volume of the quiescent center distal cell) were quantified using the
"MorpholibJ>Analyze>Particule Analysis3D" plugin of Fiji. To obtain the flattened view of the
epidermis (Fig. S12A), cortex or endodermis, we used the 3D Viewer plugin from Fiji on
each segmented cell file, to get a snapshot from the external view of the cell file. The flattened
view was then reconstituted putting each snapshot side by side.

Cell division angles quantification

A semi-automated image processing workflow was developed for quantifying cell division
angles on a large dataset. The workflow comprises cell segmentation, identification of cell files,
and automated measurement of division angles. Respectively 10 and 15 root tips were PI-stained
and imaged as z-stacks for the wild type and the triple mutant trm678. For each root tip, a
longitudinal section (slice) encompassing the root axis was extracted from a 3D stack. The
histogram of each slice was adjusted to correct differences in global fluorescence intensity
between root tips. Acquisition noise was reduced by using an integer approximation of a
Gaussian filter with radius 1 pixel. The cell sections were segmented using watershed algorithm
(38). To prevent over-segmentation, markers corresponding to the minimum intensities within
cells were first extracted using extended minima tool with a dynamic equal to 10 and
connectivity equal to 4, and imposed on the original image (39). The resulting segmentations
were visually inspected to remove any errors. The result was a label image containing for each
pixel the index of the cell it belongs to.
Cell files were identified by combination of manual selection and automated minimal path
extraction. The region adjacency graph of cell sections was first computed from the label image.
For each visible cell line in slices, several landmark cells corresponding to extremities plus one
or two cells within the file were manually pointed using the Free-D software (40). The labels of
landmark cells were combined with the region adjacency graph to identify the ordered list of cell
labels that minimize the sum of distances between adjacent cell centroids. The Dijkstra algorithm
was used to reduce the computational complexity (41). The path curve of the cell file was then
constructed by joining the centroid of adjacent cells in the file (Fig. 3C).
Division angles were measured by considering relative angle of the boundary between two
adjacent cells in a file with the tangent of the cell file path. The boundary between cells was
extracted from label image by identification of pixels neighbors to both cell labels. The two
extremities of the boundary were used to measure angle with horizontal. Difference with the
local angle of cell file path was used as a measure of cell division angle (Fig. 3C). The division
angles corresponding to valid cell divisions were manually selected by visual inspection of
 Schaefer et al. Supplementary Materials 8

section images to produce a final dataset of 1701 division angles for the wild type and 2489 for
the trm678 mutant.
Image processing workflow was developed with the Matlab software (the Mathworks,
Natick, MA), using the Image Processing Toolbox, and custom procedures.

Statistical methods
Statistics analyses were performed using the R package (42) and the XLStat tool
(Addinsoft). Graphs were produced in R using the ggplot2 library and the JGR/Deducer
packages (http://www.deducer.org; http://rforge.net/JGR/). As all datasets strongly departed from
normality (Shapiro-Wilk), non parametric tests were used for comparing samples (Mann-
Whitney). For comparing variances, the Levene's statistic was used under its median form as it is
not sensitive to normality of data.
 Schaefer et al. Supplementary Materials 9

Fig. S1. Three premitotic cells at PPB stage

Wild-type root tip premitotic cells expressing a pCycB1;1::CycB1;11-116-GFP-MBD construct.
(A) Side view of three adjacent cells at PPB stage. The top cell displays a young PPB with very
few perinuclear microtubules, the middle one a mature PPB with forming polar caps, and the
bottom one an intermediate PPB with perinuclear microtubules. Grey dashed lines underline the
cells limits.
(B) A rotated view (140 along the y axis) of the confocal stack, showing PPB rings at the cortex
of the three square-shaped root cells (for a complete 3D view see Movie S1). The 3D-project tool
of ImageJ was used to generate this view.
Image was acquired at a z-resolution of ~200 nm and deconvoluted using the DeconvolutionLab
ImageJ plugin (Thikonov-Miller algorithm), using a theoretical Born and Wolf PSF generated by
the PSF Generator plugin (http://bigwww.epfl.ch/). Scale bar, 10 m in A and B.
 Schaefer et al. Supplementary Materials 10

Fig. S2. The TTP complex is a major regulator of cortical microtubule arrays in plants
The TTP complex is composed of three components involved in regulation (TON1),
assembly/targeting (TRM) and phosphatase activity (PP2A) of the complex: the Protein
Phosphatase 2A is a heterotrimeric enzyme composed of a scaffolding (A), a catalytic (C), and a
B-type regulatory subunit, here FASS (5). The targets of FASS- PP2A activity are yet unknown.
TON1, a small acidic protein, is required for TTP activity and interacts with Centrin (4) and a
Cyclin-Dependent Kinase (43), connecting the TTP to centrosome-like functions and the cell
cycle machinery. The third TTP component is a member of a plant-specific protein family named
TRM, with 34 members grouped in 8 sub-families in Arabidopsis (8). TRMs directly bind MTs
in vivo and in vitro and control the recruitment of the TON1-FASS complex to microtubules
through specific interaction motifs (7, 8). Mutations in core TTP components like TON1, FASS
or PP2A-A and C lead to absence of PPB, mispositioning of division planes in Arabidopsis,
maize and moss (3-7, 44, 45), and disorganization of the interphase cortical array. Therefore, the
TTP complex has both interphasic and mitotic functions and is a central regulator of MT
organization at the cell's cortex, notably through its action on nucleation geometry (46). Most
TTP components are present in several isoforms in Arabidopsis (PP2A-A: 3; PP2A-C: 2; TON1:
2; TRM: 34), suggesting a high combinatorial diversity of TTP composition and function,
especially in link with the highly variable TRM component (7). Composition, localization and
activity of the TTP complex are consequently expected to vary significantly during the cell
cycle. All TTP components and interactants display various degrees of sequence similarity with
animal centrosomal proteins (4, 8), pointing to an ancient eukaryotic network involved in MT
regulation.
Physical interactions are indicated by blue arrows. A typical TRM is shown, with (in light blue)
the M2 and M3 motifs involved in interaction with TON1 and FASS respectively, and the
Microtubule Binding Domain (MBD) involved in interaction with microtubules (8).
 Schaefer et al. Supplementary Materials 11

Fig. S3. The TRM7 promoter contains a M-specific activator (MSA) element
(A) Sequence analysis of the TRM7 promoter in Arabidopsis and related Brassicaceae. Here is
shown a DNA sequence alignment of the TRM7 promoter from Arabidopsis thaliana,
Arabidopsis lyrata, Thelungiella halophila, Capsella rubella and Brassica rapa. A red box
indicates the position of the MSA element.
(B) Alignment of the MSA element found in the TRM7 promoter from Arabidopsis thaliana,
Arabidopsis lyrata, Thelungiella halophila, Capsella rubella and Brassica rapa. The MSA
element consensus sequence is as defined in (47).
 Schaefer et al. Supplementary Materials 12

Fig. S4. TRM7 is regulated by proteasome-mediated degradation

(A) GUS staining patterns in three-day-old root tips treated with dimethyl sulfoxide (DMSO) or
50 m MG132 for 3 hours. Transgenic plants expressing TRM transcriptional (pTRM7::GUS
fusion) or translational (pTRM7::TRM71-71-GUS) GUS fusions were treated with MG132, a
potent inhibitor of the proteasome, and compared with mock-treated plants (DMSO). No
differences were noted for the transcriptional fusion, whereas for the translational fusion the
GUS signal was significantly stabilized upon MG132 treatment, similarly to a control CyclinB1
construct (20) indicating that TRM7 is regulated by proteasome-mediated degradation. Scale bar,
50 m.
(B) Prediction of D-box and KEN-box in the TRM7 protein sequence using the GPS-ARM
software package (48). The score and specificity are indicated.
(C) Sequence alignment of the TRM7 N-terminal protein sequence from Arabidopsis thaliana,
Arabidopsis lyrata, Thelungiella halophila, Capsella rubella and Brassica rapa. The position of
the M5 TRM motif (8) is shown in a red box, and the position of the putative D-Box and KEN-
box in blue. The junction between TRM7 and the GUS protein reporter in the TRM71-71-GUS
fusion is shown using a blue arrow.
 Schaefer et al. Supplementary Materials 13

Fig. S5. The TRM7-3xYFP construct complements the trm678 mutant phenotype
In order to check the functionality of the TRM7-3xYFP fusion, we assessed its ability to
complement the trm7 phenotype. Since the trm7 mutant phenotype is rather mild,
complementation was easier to assess in a triple trm678 mutant (ie trm6 trm7 trm8) background.
Therefore, we introduced the TRM7-3xYFP construct in the trm678 triple mutant and assessed
its ability to revert the triple mutant phenotype to a trm68 one (ie trm6 trm8). Out of 24
transgenic lines obtained, 20 displayed a phenotype similar to the wild type and the trm68
mutant, demonstrating the functionality of the TRM7-3xYFP construct. Here are shown 3-week-
old plants.
 Schaefer et al. Supplementary Materials 14

Fig. S6. Localization of the TRM7-3xYFP and TRM8-3xYFP signals

(A) Time lapse imaging (seconds) of a root tip cell expressing both the TRM7-3xYFP (grey) and
the Cer-TUA6 microtubule marker (blue).
(B) Comparison of fluorescence pattern of a root tip expressing the TRM7-3xYFP or the TRM8-
3xYFP constructs.
Scale bars, 10 m in A, and 50 m in B.
 Schaefer et al. Supplementary Materials 15

Fig. S7. Analysis of trm6, trm7 and trm8 mutant alleles

(A) The position of all insertional alleles studied is represented with an arrowhead. Primers used
for RT-PCR are indicated with a blue arrow. The structure of the mutant allele chosen for further
study is shown below the gene models. Sequencing both flanking sites of each insertion allowed
us to determine the exact position of each insertion (underlined and dashed sequences). All have
a T-DNA left border at each end of the inserted T-DNA. T-DNA insertion in the GABI_048G03
and SALK_074085 induced a small deletion of 10 bp and 41 bp in TRM6 and TRM7 genes
respectively whereas the SALK_150274 insertion induced a small duplication of 5 bp at the
insertion site in TRM8.
(B) RT-PCR analysis showing absence of full-length TRM6, TRM7, and TRM8 mRNA in the
respective trm mutants. Histone H3.3 (At4G40040) primers were used as a control.
 Schaefer et al. Supplementary Materials 16

Fig. S8. Phenotype of combinations of the trm6, trm7 and trm8 mutations
Pictures of rosettes of 18-day-old plants (A), and of 49-day-old mature plants of wild-type, trm6,
trm7, trm8, trm6 trm7, trm7 trm8, trm6 trm8, trm6 trm7 trm8 genotype.
 Schaefer et al. Supplementary Materials 17

Fig. S9. PPB defects in root and shoot apical meristem cells
(A-B) Wild-type (A) and mutant (B) premitotic cells of a 3 day-old seedling expressing a
pCycB1;1::CycB1;11-116-GFP-MBD construct. Images were acquired at a z-resolution of ~200
nm and deconvoluted using the DeconvolutionLab ImageJ plugin (Thikonov-Miller algorithm),
using a theoretical Born and Wolf PSF generated by the PSF Generator plugin
(http://bigwww.epfl.ch/) A single confocal section bissecting the nucleus is shown.
(C-D) Plot of the average gray value along a rectangular region of interest (indicated in red in A,
B), showing a strong accumulation of PPB microtubules at the cortex and a minor peak around
the nucleus in the wild-type (C), and a strong signal of perinuclear MTs with an absence of
 Schaefer et al. Supplementary Materials 18

cortical signal in the mutant (D). Red arrows point to the cortex, whereas blue arrowheads point
to the nuclear periphery.
(E, F) Orthogonal (xz) views of the same cells corresponding to the top-bottom direction of
images A and B, showing the PPB cortical ring in the wild-type (E), and its absence in the
mutant (F). Both views are y-projections of the ~2 m central regions of the z-resliced original
stacks. Arrowheads in E and F indicate the optical section planes corresponding to images A and
B respectively. Scale bar, 10 m.
(G-H) Co-immunolocalization in wild type and trm678 shoot apical meristem (A) and floral
meristem cells (B) using an anti-KNOLLE antibody as a G2/M marker (red) and an anti-Tubulin
antibody as a microtubule marker (green). Nuclei were counter-stained with DAPI (blue).
Asterisks indicate G2/M cells defined as KNOLLE-positive without spindle or phragmoplast/cell
plate. Scale bars, 10 m.
(I) Quantification of normal PPBs, abnormal frailed PPBs with sparse microtubules at the cortex
and a high density of perinuclear microtubules and absence of PPB in Col0 and trm678
genotypes. The number of G2/M cells, defined as KNOLLE-positive without spindle or
phragmoplast/cell plate is indicated.
 Schaefer et al. Supplementary Materials 19

Fig. S10. Interphase microtubule arrays in the trm678 mutant

(A-B) Col0 (A) and trm678 (B) root tip epidermal cells of 5-day-old seedlings expressing the
pUBI::GFP-MBD marker introduced in these two genetic backgrounds by transformation. Here
are shown epidermal root tip cells in the zone just above the root cap.
(C-D) Col0 (C) and trm678 (D) hypocotyl epidermal cells of 3-day-old etiolated seedlings
expressing the pUBI::GFP-MBD marker. Here are shown epidermal cells in the zone below the
hypocotyl cross.
Scale bars, 50 m.
 Schaefer et al. Supplementary Materials 20

Fig. S11. Microtubule arrays dynamics during G2/M transition in Col0 and trm678 cells
(A-D) Time lapse analysis of wild type (A) and trm678 (B-D) root tip cells expressing the
pKN::GFP-MBD marker (28) introduced in these two genetic backgrounds by transformation. In
the wild type, cell division is preceded by PPB formation and at prophase by a polarized
accumulation of microtubules on the nuclear surface forming so-called polar caps that mark the
spindle poles upon nuclear envelope breakdown. In contrast, cell divisions in the trm678
background occur without the formation of PPB and polar caps as shown in B-D. The time frame
in minutes and seconds is indicated within all images. Scale bars, 10 m.
Schaefer et al. Supplementary Materials 21
 Schaefer et al. Supplementary Materials 22

Fig. S12. Root morphology in trm678, pok1 pok2, and fass mutants
(A) Flattened views of a 100-m-long section of 3D-segmented epidermis, cortex and
endodermis cell layers of wild type and trm678.
(B-I) Longitudinal (B-E) and transverse (F-I) sections of calcofluor white-stained root of 5 day-
old seedlings of wild type (B, F), trm678 (C, G), pok1-1 pok2-3 (D, H) and fass/ton2-5 (E, I)
genotype. Scale bars = 50 m.
(J-M) Five-day-old seedlings of wild type (J), trm678 (K), pok1-1 pok2-3 (L) and fass/ton2-5
(M). Scale bars = 5 mm in J-M and 1 mm in the inset showing a close-up of a fass seedling.
(N-P) Cell identity markers in Col0 and trm678 root tips. (N) Visualization of the endodermis
layer using a SCR-YFP marker (29). Left panels: SCR-YFP signal (orange); right panel: same
overlaid with DAPI staining (cyan). On the left are shown longitudinal median sections through
the middle of the root, and on the right tangential sections passing through the endodermal layer.
This shows the continuity of the endodermis in mutant roots, with rare instances of misalignment
of the cell file. (O) Visualization of the quiescent center using a WOX5 marker (30). Left panels:
WOX5-GFP signal (orange); right panel: same overlaid with DAPI staining in cyan. In mutant
root tips, the QC was readily marked at the origin of root cell files, although WOX5 expression
appeared to encompass a larger number of cells. (P) Differentiating and differentiated
protophloem cells (arrows) in Col0 and trm678 identified on the basis of their characteristic
shape and thickened cell walls in PI stained root tips (31). Scale bars, 20 m (N), 10 m (O), and
50 m (P).
 Schaefer et al. Supplementary Materials 23

Fig. S13. Morphology of the trm678 mutant

(A-D) 18-day-old rosette (A), mature silique (B), 37-day-old plant (C), and 12-day-old in vitro
grown seedlings (D) of wild type and trm678 genotype. trm678 mature siliques contained 20%
less seeds than in the wild type (51 3,05 seeds/silique for the wild type and 40 5.5
seeds/silique for the trm678 mutant at the 95% confidence interval).
(E) Wild type and trm678 5-day-old seedlings. 2.5 % (29/1159) and 0.5% (6/1159) trm678
seedlings had one or three cotyledons respectively, compared to none out of 1183 wild type
seedlings.
(F) Number of sepals and petals in wild type and trm678 flowers (n=46 for wild type and n=40
for trm678). Error bars represent the 95% confidence interval of the mean. Scale bars, 1 cm.
Schaefer et al. Supplementary Materials 24
Schaefer et al. Supplementary Materials 25
 Schaefer et al. Supplementary Materials 26

Fig. S14. Visual classes used for comparing the trm678 mutant with the wild type
(A) Examples of visual classes for assessing TRM7-3xYFP localization in root tip cells (Figure 1
and Table S1). TRM7-3xYFP fluorescence is in grey and microtubules labelling using the Cer-
TUA6 marker in blue.
(B) Examples of visual classes for assessing PPB defects in trm mutants (Figure 2 and Table S2).
(a-h) Abnormal PPB stages (a, b, h: trm78; c-e: trm67; f, g: trm68). (i-l) Normal PPBs in the
wild-type background. (m-p) Absence of PPB in trm678. Arrowheads point to faint/or
asymmetric cortical signals in abnormal PPBs. Microtubules are false colored in yellow, and the
KNOLLE signal in grey.
(C-D) Examples of visual classes for assessing POK1-YFP localization in Col0 (C) and trm678
(D) root tip cells (Figure 4 and Table S4). The POK1-YFP fluorescence is in grey and
microtubules in red.
Scale bars, 10 m.
 Schaefer et al. Supplementary Materials 27

Table S1: Localization of the TRM7-3xYFP signal in root tip cells (Figure 1)

Localization of the TRM7-3xYFP signal in Arabidopsis root tip cells at different mitotic stages.
The Cer-TUA6 marker was used to identify mitotic stages (Figure 1). The number of cells
observed in 16 independent roots is indicated. Examples of visual classes for assessing TRM7-
3xYFP localization in root tip cells are shown in Fig. S14.
 Schaefer et al. Supplementary Materials 28

Table S2: PPB defects in trm mutants (Figure 2)

Proportion of cells with normal (PPB), abnormal (Abnormal PPB) or absence of PPB (No PPB)
in combinations of trm6, trm7, and trm8 mutations (Figure 2). Abnormal PPB refers to faint
and/or asymmetric PPB with sparse microtubules at the cortex and a high density of perinuclear
microtubules. Examples of visual classes for assessing PPB defects in trm mutants are displayed
in Fig. S14. The number of G2/M cells scored is indicated. Root tip cells were co-
immunolocalized using an anti-KNOLLE antibody and an anti-Tubulin antibody as a
microtubule marker. G2/M cells are defined as KNOLLE-positive with no spindle or
phragmoplast/cell plate.
 Schaefer et al. Supplementary Materials 29

Table S3: PPB absence and robustness of cell division orientation (Figure 3)

(A) 2D division angles in the three external cell layers of the root tip (Figure 3). Angles between
the division plane and the cell file's axis are expressed in degrees. The average division angle
was identical between the mutant and the wild type, whereas its variance was significantly
increased in all mutant tissues, showing a 2 to 3-fold increase. All datasets were non-normal. The
Mann-Whitney test was used for comparing samples, and the Levene's statistics in its median
form for comparing variances.

(B) Distributions of division angles in wild type (red) and trm678 mutant (blue) tissues.
 Schaefer et al. Supplementary Materials 30

(C) Volume ratio of sister cells originating from a recent division. Recently divided cells with a
thin transverse wall were identified in 2D sections, and their volumes computed from 3D-
segmented root tips. The volume ratio was obtained by dividing the volume of the cell proximal
to the quiescent center by the volume of the distal cell. The average volume ratio was identical in
the mutant and the wild type, while its variance was significantly (1.6-fold) increased in mutant
roots. All datasets were non-normal. The Mann-Whitney test was used for comparing samples,
and the Levene's statistics in its median form for comparing variances.

(D) Distributions of 3D volume ratios in the wild type (red) and the trm678 mutant (blue).
 Schaefer et al. Supplementary Materials 31

(E) Spindle rotation in metaphase root-tip cells. Angles are in degrees with respect to the cell
file's axis. Off-site divisions refer to complete switches of the metaphase plate from a normally
anticlinal to a periclinal orientation. These represent ~10% of the cases in the trm678 mutant,
and are never observed in the wild-type. In addition, for cells where an angle could be measured,
the variance of metaphase plate orientation is 3.7-fold higher in the mutant compared to the wild
type. Despite this large increase in variance, the average angle is not significantly different
between the mutant and the wild type.

(F) Distributions of spindle angles in the wild type (red) and the trm678 mutant (blue), after
exclusion of the 10 cases of extreme rotations in the mutant.
 Schaefer et al. Supplementary Materials 32

Table S4: POK1 localization in Col0 and trm678 root tip cells (Figure 4)

(A) Classification of root tip cells according to the partitioning of the POK1-YFP signal between
the cytoplasm and the cortex (Figure 4). Root tips expressing the POK1-YFP construct in the
Col0 and trm678 background were processed through immuno-localization of tubulin and
imaged. Cells were visually classified into 5 categories, from exclusively cytoplasmic to
exclusively cortical, as exemplified in Fig. S14.

(B) Cell counts with normal (continuous) or abnormal (discontinuous or loosely defined) POK1
cortical ring in Col0 and trm678 backgrounds at phragmoplast stage.
 Schaefer et al. Supplementary Materials 33

Caption for Movie S1

3D view of three wild-type cells at PPB stage (see Fig. S1). The original image stack was
acquired at a z-resolution of ~200 nm and deconvoluted using the DeconvolutionLab ImageJ
plugin (Thikonov-Miller algorithm), using a theoretical Born and Wolf PSF generated by the
PSF Generator plugin (http://bigwww.epfl.ch/). The rotation movie was generated using the 3D-
Project tool of ImageJ (5 steps, with interpolation)

Caption for Movie S2

3D view of a 100-m-long section above the root cap of 3D-segmented epidermis, cortex and
endodermis cell layers of the wild type.

Caption for Movie S3

3D view of a 100-m-long section above the root cap of 3D-segmented epidermis, cortex and
endodermis cell layers of trm678.
References
1. T. Yabuuchi, T. Nakai, S. Sonobe, D. Yamauchi, Y. Mineyuki, Preprophase band formation and
cortical division zone establishment: RanGAP behaves differently from microtubules during
their band formation. Plant Signal. Behav. 10, e1060385 (2015).
doi:10.1080/15592324.2015.1060385 Medline
2. C. G. Rasmussen, A. J. Wright, S. Mller, The role of the cytoskeleton and associated proteins in
determination of the plant cell division plane. Plant J. 75, 258269 (2013).
doi:10.1111/tpj.12177 Medline
3. J. Traas, C. Bellini, P. Nacry, J. Kronenberger, D. Bouchez, M. Caboche, Normal differentiation
patterns in plants lacking microtubular preprophase bands. Nature 375, 676677 (1995).
doi:10.1038/375676a0
4. J. Azimzadeh, P. Nacry, A. Christodoulidou, S. Drevensek, C. Camilleri, N. Amiour, F. Parcy,
M. Pastuglia, D. Bouchez, Arabidopsis TONNEAU1 proteins are essential for preprophase
band formation and interact with centrin. Plant Cell 20, 21462159 (2008).
doi:10.1105/tpc.107.056812 Medline
5. C. Camilleri, J. Azimzadeh, M. Pastuglia, C. Bellini, O. Grandjean, D. Bouchez, The Arabidopsis
TONNEAU2 gene encodes a putative novel protein phosphatase 2A regulatory subunit
essential for the control of the cortical cytoskeleton. Plant Cell 14, 833845 (2002).
doi:10.1105/tpc.010402 Medline
6. Y. Zhang, M. Iakovidis, S. Costa, Control of patterns of symmetric cell division in the epidermal
and cortical tissues of the Arabidopsis root. Development 143, 978982 (2016).
doi:10.1242/dev.129502 Medline
7. L. Spinner, A. Gadeyne, K. Belcram, M. Goussot, M. Moison, Y. Duroc, D. Eeckhout, N. De
Winne, E. Schaefer, E. Van De Slijke, G. Persiau, E. Witters, K. Gevaert, G. De Jaeger, D.
Bouchez, D. Van Damme, M. Pastuglia, A protein phosphatase 2A complex spatially
controls plant cell division. Nat. Commun. 4, 1863 (2013). doi:10.1038/ncomms2831
Medline
8. S. Drevensek, M. Goussot, Y. Duroc, A. Christodoulidou, S. Steyaert, E. Schaefer, E. Duvernois,
O. Grandjean, M. Vantard, D. Bouchez, M. Pastuglia, The Arabidopsis TRM1-TON1
interaction reveals a recruitment network common to plant cortical microtubule arrays and
eukaryotic centrosomes. Plant Cell 24, 178191 (2012). doi:10.1105/tpc.111.089748
Medline
9. M. Menges, L. Hennig, W. Gruissem, J. A. Murray, Genome-wide gene expression in an
Arabidopsis cell suspension. Plant Mol. Biol. 53, 423442 (2003).
doi:10.1023/B:PLAN.0000019059.56489.ca Medline
10. L. Mestek Boukhibar, M. Barkoulas, The developmental genetics of biological robustness. Ann.
Bot. 117, 699707 (2016). doi:10.1093/aob/mcv128 Medline
11. A. L. Cleary, L. G. Smith, The Tangled1 gene is required for spatial control of cytoskeletal
arrays associated with cell division during maize leaf development. Plant Cell 10, 1875
1888 (1998). doi:10.1105/tpc.10.11.1875 Medline
12. Y. Mineyuki, The preprophase band of microtubules: Its function as a cytokinetic apparatus in
higher plants. Int. Rev. Cytol. 187, 149 (1999). doi:10.1016/S0074-7696(08)62415-8
13. E. Lipka, A. Gadeyne, D. Stckle, S. Zimmermann, G. De Jaeger, D. W. Ehrhardt, V. Kirik, D.
Van Damme, S. Mller, The phragmoplast-orienting kinesin-12 class proteins translate the
positional information of the preprophase band to establish the cortical division zone in
Arabidopsis thaliana. Plant Cell 26, 26172632 (2014). doi:10.1105/tpc.114.124933
Medline
14. J. C. Ambrose, R. Cyr, Mitotic spindle organization by the preprophase band. Mol. Plant 1,
950960 (2008). doi:10.1093/mp/ssn054 Medline
15. C. Lloyd, J. Chan, Not so divided: The common basis of plant and animal cell division. Nat.
Rev. Mol. Cell Biol. 7, 147152 (2006). doi:10.1038/nrm1831 Medline
16. J. Pcraux, S. Redemann, Z. Alayan, B. Mercat, S. Pastezeur, C. Garzon-Coral, A. A. Hyman,
J. Howard, The mitotic spindle in the one-cell C. elegans embryo is positioned with high
precision and stability. Biophys. J. 111, 17731784 (2016). doi:10.1016/j.bpj.2016.09.007
Medline
17. V. Santoni, C. Bellini, M. Caboche, Use of two-dimensional protein-pattern analysis for the
characterization of Arabidopsis thaliana mutants. Planta 192, 557566 (1994).
doi:10.1007/BF00203594
18. J. M. Alonso, A. N. Stepanova, T. J. Leisse, C. J. Kim, H. Chen, P. Shinn, D. K. Stevenson, J.
Zimmerman, P. Barajas, R. Cheuk, C. Gadrinab, C. Heller, A. Jeske, E. Koesema, C. C.
Meyers, H. Parker, L. Prednis, Y. Ansari, N. Choy, H. Deen, M. Geralt, N. Hazari, E. Hom,
M. Karnes, C. Mulholland, R. Ndubaku, I. Schmidt, P. Guzman, L. Aguilar-Henonin, M.
Schmid, D. Weigel, D. E. Carter, T. Marchand, E. Risseeuw, D. Brogden, A. Zeko, W. L.
Crosby, C. C. Berry, J. R. Ecker, Genome-wide insertional mutagenesis of Arabidopsis
thaliana. Science 301, 653657 (2003). doi:10.1126/science.1086391 Medline
19. N. Kleinboelting, G. Huep, A. Kloetgen, P. Viehoever, B. Weisshaar, GABI-Kat SimpleSearch:
New features of the Arabidopsis thaliana T-DNA mutant database. Nucleic Acids Res. 40,
D1211D1215 (2012). doi:10.1093/nar/gkr1047 Medline
20. A. Coln-Carmona, R. You, T. Haimovitch-Gal, P. Doerner, Spatio-temporal analysis of mitotic
activity with a labile cyclin-GUS fusion protein. Plant J. 20, 503508 (1999).
doi:10.1046/j.1365-313x.1999.00620.x Medline
21. S. J. Clough, A. F. Bent, Floral dip: A simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J. 16, 735743 (1998). doi:10.1046/j.1365-
313x.1998.00343.x Medline
22. M. Pastuglia, J. Azimzadeh, M. Goussot, C. Camilleri, K. Belcram, J. L. Evrard, A. C. Schmit,
P. Guerche, D. Bouchez, Gamma-tubulin is essential for microtubule organization and
development in Arabidopsis. Plant Cell 18, 14121425 (2006). doi:10.1105/tpc.105.039644
Medline
23. R. Zhou, L. M. Benavente, A. N. Stepanova, J. M. Alonso, A recombineering-based gene
tagging system for Arabidopsis. Plant J. 66, 712723 (2011). doi:10.1111/j.1365-
313X.2011.04524.x Medline
24. S. Pietra, A. Gustavsson, C. Kiefer, L. Kalmbach, P. Hrstedt, Y. Ikeda, A. N. Stepanova, J. M.
Alonso, M. Grebe, Arabidopsis SABRE and CLASP interact to stabilize cell division plane
orientation and planar polarity. Nat. Commun. 4, 2779 (2013). doi:10.1038/ncomms3779
Medline
25. K. Martin, K. Kopperud, R. Chakrabarty, R. Banerjee, R. Brooks, M. M. Goodin, Transient
expression in Nicotiana benthamiana fluorescent marker lines provides enhanced definition
of protein localization, movement and interactions in planta. Plant J. 59, 150162 (2009).
doi:10.1111/j.1365-313X.2009.03850.x Medline
26. J. Marc, C. L. Granger, J. Brincat, D. D. Fisher, Th. Kao, A. G. McCubbin, R. J. Cyr, A GFP-
MAP4 reporter gene for visualizing cortical microtubule rearrangements in living epidermal
cells. Plant Cell 10, 19271940 (1998). Medline
27. C. Grefen, N. Donald, K. Hashimoto, J. Kudla, K. Schumacher, M. R. Blatt, A ubiquitin-10
promoter-based vector set for fluorescent protein tagging facilitates temporal stability and
native protein distribution in transient and stable expression studies. Plant J. 64, 355365
(2010). doi:10.1111/j.1365-313X.2010.04322.x Medline
28. Q. Wang, S. Huang, Visualization of microtubule organization and dynamics in living
Arabidopsis embryonic cells. Mol. Plant 7, 13971401 (2014). doi:10.1093/mp/ssu038
Medline
29. A. Cruz-Ramrez, S. Daz-Trivio, I. Blilou, V. A. Grieneisen, R. Sozzani, C. Zamioudis, P.
Miskolczi, J. Nieuwland, R. Benjamins, P. Dhonukshe, J. Caballero-Prez, B. Horvath, Y.
Long, A. P. Mhnen, H. Zhang, J. Xu, J. A. H. Murray, P. N. Benfey, L. Bako, A. F. M.
Mare, B. Scheres, A bistable circuit involving SCARECROW-RETINOBLASTOMA
integrates cues to inform asymmetric stem cell division. Cell 150, 10021015 (2012).
doi:10.1016/j.cell.2012.07.017 Medline
30. I. Blilou, J. Xu, M. Wildwater, V. Willemsen, I. Paponov, J. Friml, R. Heidstra, M. Aida, K.
Palme, B. Scheres, The PIN auxin efflux facilitator network controls growth and patterning
in Arabidopsis roots. Nature 433, 3944 (2005). doi:10.1038/nature03184 Medline
31. E. Truernit, H. Bauby, B. Dubreucq, O. Grandjean, J. Runions, J. Barthlmy, J.-C. Palauqui,
High-resolution whole-mount imaging of three-dimensional tissue organization and gene
expression enables the study of phloem development and structure in Arabidopsis. Plant
Cell 20, 14941503 (2008). doi:10.1105/tpc.107.056069 Medline
32. H. Hama, H. Kurokawa, H. Kawano, R. Ando, T. Shimogori, H. Noda, K. Fukami, A. Sakaue-
Sawano, A. Miyawaki, Scale: A chemical approach for fluorescence imaging and
reconstruction of transparent mouse brain. Nat. Neurosci. 14, 14811488 (2011).
doi:10.1038/nn.2928 Medline
33. K. Belcram, J.-C. Palauqui, M. Pastuglia, Studying cell division plane positioning in early-stage
embryos. Methods Mol. Biol. 1370, 183195 (2016). doi:10.1007/978-1-4939-3142-2_14
Medline
34. M. H. Lauber, I. Waizenegger, T. Steinmann, H. Schwarz, U. Mayer, I. Hwang, W. Lukowitz,
G. Jrgens, The Arabidopsis KNOLLE protein is a cytokinesis-specific syntaxin. J. Cell
Biol. 139, 14851493 (1997). doi:10.1083/jcb.139.6.1485 Medline
35. M. G. Heisler, O. Hamant, P. Krupinski, M. Uyttewaal, C. Ohno, H. Jnsson, J. Traas, E. M.
Meyerowitz, Alignment between PIN1 polarity and microtubule orientation in the shoot
apical meristem reveals a tight coupling between morphogenesis and auxin transport. PLOS
Biol. 8, e1000516 (2010). doi:10.1371/journal.pbio.1000516 Medline
36. J. Schindelin, I. Arganda-Carreras, E. Frise, V. Kaynig, M. Longair, T. Pietzsch, S. Preibisch, C.
Rueden, S. Saalfeld, B. Schmid, J.-Y. Tinevez, D. J. White, V. Hartenstein, K. Eliceiri, P.
 Tomancak, A. Cardona, Fiji: An open-source platform for biological-image analysis. Nat.
Methods 9, 676682 (2012). doi:10.1038/nmeth.2019 Medline
37. D. Legland, I. Arganda-Carreras, P. Andrey, MorphoLibJ: Integrated library and plugins for
mathematical morphology with ImageJ. Bioinformatics 32, 35323534 (2016).
doi:10.1093/bioinformatics/btw413 Medline
38. F. Meyer, Topographic distance and watershed lines. Signal Process. 38, 113125 (1994).
doi:10.1016/0165-1684(94)90060-4
39. P. Soille, Morphological Image Analysis: Principles and Applications (ed. 2) (Springer-Verlag,
Berlin Heidelberg, 2004).
40. P. Andrey, Y. Maurin, Free-D: An integrated environment for three-dimensional reconstruction
from serial sections. J. Neurosci. Methods 145, 233244 (2005).
doi:10.1016/j.jneumeth.2005.01.006 Medline
41. E. W. Dijkstra, A note on two problems in connexion with graphs. Numer. Math. 1, 269271
(1959). doi:10.1007/BF01386390
42. R Core Team, R: A language and environment for statistical computing. R Foundation for
Statistical Computing, Vienna, Austria. URL https://www.R-project.org/. (2015).
43. J. Van Leene, H. Stals, D. Eeckhout, G. Persiau, E. Van De Slijke, G. Van Isterdael, A. De
Clercq, E. Bonnet, K. Laukens, N. Remmerie, K. Henderickx, T. De Vijlder, A. Abdelkrim,
A. Pharazyn, H. Van Onckelen, D. Inz, E. Witters, G. De Jaeger, A tandem affinity
purification-based technology platform to study the cell cycle interactome in Arabidopsis
thaliana. Mol. Cell. Proteomics 6, 12261238 (2007). doi:10.1074/mcp.M700078-MCP200
Medline
44. L. Spinner, M. Pastuglia, K. Belcram, M. Pegoraro, M. Goussot, D. Bouchez, D. G. Schaefer,
The function of TONNEAU1 in moss reveals ancient mechanisms of division plane
specification and cell elongation in land plants. Development 137, 27332742 (2010).
doi:10.1242/dev.043810 Medline
45. A. J. Wright, K. Gallagher, L. G. Smith, Discordia1 and alternative discordia1 function
redundantly at the cortical division site to promote preprophase band formation and orient
division planes in maize. Plant Cell 21, 234247 (2009). doi:10.1105/tpc.108.062810
Medline
46. A. Kirik, D. W. Ehrhardt, V. Kirik, TONNEAU2/FASS regulates the geometry of microtubule
nucleation and cortical array organization in interphase Arabidopsis cells. Plant Cell 24,
11581170 (2012). doi:10.1105/tpc.111.094367 Medline
47. M. Ito, M. Iwase, H. Kodama, P. Lavisse, A. Komamine, R. Nishihama, Y. Machida, A.
Watanabe, A novel cis-acting element in promoters of plant B-type cyclin genes activates M
phase-specific transcription. Plant Cell 10, 331341 (1998). Medline
48. Z. Liu, F. Yuan, J. Ren, J. Cao, Y. Zhou, Q. Yang, Y. Xue, GPS-ARM: Computational analysis
of the APC/C recognition motif by predicting D-boxes and KEN-boxes. PLOS ONE 7,
e34370 (2012). doi:10.1371/journal.pone.0034370 Medline