General Biology 2

Genetic Engineering
 competent, they are incubated with the desired plasmid at about 4°C for about 30min. The plasmids concentrate
near the cells during this time. Afterwards, a “Heat Shock” is done on the plasmid-cell solution by incubating it at
42°C for 1 minute then back to 4°C for 2 minutes. The rapid rise and drop of temperature is believed to increase and
decrease the pore sizes in the membrane. The plasmid DNA near the membrane surface are taken into the cells by
this process. The cells that took up the plasmids acquire new traits and are said to be “transformed”.

Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but, the expansion of the
membrane pores is done through an electric “shock”. This method is commonly used for insertion of genes into
mammalian cells.

5. Some methods to screen recombinant cells are as follows:

Selection of plasmid DNA containing cells
A selection marker within the inserted plasmid DNA sequence allows the selection of “transformants”. Usually, an
antibiotic resistance gene (e.g. AMP ampicillin resistance gene) is included in the plasmid DNA. This allows only
“transformed” cells to survive in the presence of the antibiotic (e.g. ampicillin). Plating the plasmid-cell solution on
antibiotic-containing media will select for these “transformants” and only allow plasmid-containing cells to grow
and propagate into colonies.

Selection of transformed cells with the desired gene

Certain inserted genes within the plasmids provide visible proof of their presence. These include the antibiotic
resistance genes that allow for the selection of the transformed cells within the solution. Some inserted genes also
produce colored (e.g. chromogenic proteins) or fluorescent products (e.g. GFP) that label the colonies/cells with the
inserted gene.
In some cases, the location of the cloning site within the plasmid is in the middle of a gene (i.e. β-galactosidase, lacZ)
that generates a (blue) colored product in the presence of a substrate (i.e. isopropyl β-D-1 thiogalactopyranoside, or
IPTG). Cells transformed with these “empty” plasmids will turn blue in the presence of IPTG. Insertion of a gene in
the cloning site disrupts the sequence of the β-galactosidase gene and prevents the generation of the colored
product in the presence of the substrate. Cells transformed with the disrupted β-galactosidase gene will remain
“white” in the presence of IPTG. This “blue-white screening” protocol is thus able to screen for cells that were
transformed with the desired gene in the cloning site.

PCR detection of plasmid DNA

Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed using PCR amplification.
PCR reactions specific for the desired gene may be done using DNA from cells. Amplification of the expected
product would confirm the presence of the gene within the samples. PCR reactions specific for plasmid sequences
will also confirm/identify the type of plasmid used for the transformation.

Genetically Modified Organisms (GMOs)

With the ability to insert gene sequences, comes the possibility of providing new traits for these target organisms.
This has allowed the development of GMOs. Some of these genetic modifications promise higher product yield for
their targets. These include the Flavr-Savr Tomato and Bt-Corn.

The Flavr-Savr (“Flavor Savor”) tomato was the first genetically modified organism that was licensed for human
consumption. The trait modified in this tomato is its ripening process. A gene for an enzyme that causes the
degradation of pectin in the cell walls (i.e. polygalacturonase) normally softens the fruit as it ripens. In Flavr Savr
tomatoes, an inhibitor (i.e. antisense RNA) disrupts the expression of this gene, thereby delaying the softening of the
fruit and extending the time it may be kept in storage and transported to markets.

Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) from Bacillus thuringensis in corn
plants. This toxin results in the death of pests that feed on these plants like the corn borer larvae. The toxin has been
shown to be selective for Lepidoptera larvae and is non-toxic to humans, mammals, fish and birds. The selective
toxicity of the toxin allows its use in foodcrops. The introduction of the toxin is believed to increase crop
production due to decreased losses from pest infestation. The same technology has been applied in the Philippines
for the development of Bt-Eggplant.
Despite the proposed benefits of GMOs, some people have raised their concerns regarding the consumption of these
modified foods. While most of the products are tested for safety, concerns are raised for the possibility of not being
able to detect hazards that are present, but are currently undetectable by today’s current technology.

Because of these issues, manufacturers are urged to provide labels that notify consumers of GMO presence in their
products. While GMOs are believed to be safe when licensed by the food regulatory agencies, it is believed that the
consumers must be provided with enough information to make their own choices regarding their use.
 General Biology 2
Discuss the Applications of
Recombinant DNA
PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression in a
given organism.

1 Detection
. Some researchers may be interested in determining if a given gene/trait is available in a particular organism. If no
previous research provides this information, researchers may test the DNA of different organisms for the presence of
these specific genes. A technique that allows the detection of specific genes in target organisms is called PCR.
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a thermostable (heat-
resistant) DNA polymerase that builds single stranded DNA strands unto unwound DNA templates. PCR uses
repeated cycles of incubation at different temperatures to promote the unwinding of the DNA template (~95°C);
the annealing of a primer (a ~20bp oligonucleotide sequence (recall RNA primers in DNA replication) onto the
ssDNA template strand (~54 - 60°C); and the extension of the generated ssDNA strand through the binding of
complementary bases to the template strand (~72° C). The thermostability of the polymerase allows it to survive the
repeated cycles of denaturation, annealing and extension with little loss of enzyme function. Each cycle of PCR
doubles the amount of the target sequence. A typical PCR experiment uses about 35 cycles of amplification. This
increases the original amount of the target sequence by 235 (i.e. ~34 billion) times.

Gene detection by PCR involves the design of primers that would only bind to sequences that are specific to a target.
For example, researchers would want to find out if gene X (e.g. the gene for insulin) is available in a target organism
(e.g. a mouse, Mus musculus). Primers may be designed by looking at the available sequences for gene X in the
databases (e.g. all the genes for insulin in different organisms; humans, pigs, cows, etc.). The different gene X
sequences must be aligned/ compared to match areas of sequence similarity (conserved sequences) and areas of
sequence dissimilarity (non-conserved sequences). Primers designed to have the same sequence as the conserved
areas will be specific for binding gene X sequences in all the target organisms. Primers designed to have the same
sequence as the non-conserved areas will only be specific for the organisms which match its sequence.
Primers may be classified as forward or reverse primers. Forward primers are complementary and bind to the reverse
complementary (non-coding) sequence of the gene. Reverse primers are complementary and bind to the coding sequence
of the gene.

STEPS in PCR Amplification

Step 0: Undenatured Template ; Temp ~ 54 ° C;
Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 1: Template denaturation ; Temp ~ 95 ° C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 2: Primer Annealing ; Temp ~ 54 ° C (dependent on primer melting temperature);

Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.

5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)

Direction of elongation CCATAGATC (Reverse Primer)

5’ GCGATGAGG 3’ Direction of elongation (Forward Primer)

3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand)

Step 3: New DNA strand elongation ; Temp ~ 72 ° C;
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds between the
complementary sequences on these new strands and their templates. Each of the new dsDNA strands is made up of
one old strand from the original template, and one new strand that was generated as a reverse complement of the
template. This is called semiconservative replication of the sequence.

New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)

New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)

Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)

PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5’ end) of a 43bp long
gene, and the reverse primer binds at a position complementary to nucleotide 39 of the coding strand, then a 37bp
product is expected per cycle of PCR.
New Strand 1:
Nucleotide # 3 Nucleotide # 39
37 bp product
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’- CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC – 5’ (Reverse Primer) (new)
42
New Strand 2:
Nucleotide # 3 Nucleotide # 39
37 bp product
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3’ (Forward Primer) (new)
3’ T A C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5’ (Non-coding strand) (old)

PCR Applications
PCR may be used to detect the presence of a desired gene in an organism. Depending on the primer
design, the expected product may represent only a specific region of the gene or the entire gene itself.
The first case is useful for detection of the gene, or the detection of organisms with that specific gene within a sample.
The second case is useful for the amplification of the entire gene for eventual expression in other organisms. The direct
amplification/copying of a full gene is part of the process for “cloning” that gene.

2. Cloning and Expression

Some genes provide economically, and industrially important products (e.g. insulin-coding genes; genes for
collagen degradation). In some cases, scientists would want to put these genes into organisms for the expression of
their products. One example would be the insertion of an insulin- coding gene from the human genome into
bacteria. This allows the “transformed” bacteria to now produce human insulin as a product.

Certain types of bacteria are capable of this process since they are able to take genes within their cell membranes for
eventual expression. The genes are normally in the form of small, circular DNA structures called plasmids.

The genes found in the inserted plasmid DNA sequence will be expressed as proteins that provide specific traits to the
transformed bacteria. The basic components of an expression plasmid are listed in the following table. The purpose of
each of these is also provided.
 COMPONENT PURPOSE
Promoter Allows the controlled expression of the desired gene in the presence of an inducing agent
(e.g. beta- galactosidase; heat treatment (~65° C)

Multiple Cloning Site DNA sequence or portion for the insertion of the desired gene. This section may contain
sequences that will be cut by specific restriction endonucleases ( cuts within the molecule) If
both the amplified gene and the plasmid are cut with the same restriction enzyme, then
complementary sequences will be generated for each, allowing them to bind together or
anneal. The desired gene is inserted into the multiple cloning site through this process.

Restriction enzymes cut at specific sequences.

EcoR1 Target Sequence:

5’ GAATTC 3’
3’ CTTAAG 5’

Digestion Reaction
Undigested: Digested dsDNA:

5’ GAATTC 3’ 5’ G AATTC3’
3’ CTTAAG 5’ 3’ CTTAA G5’

If the desired cut sites are not found in the gene that needs to be inserted; the sequences
can be added by including the target sequences in the primers used for PCR
amplification.
 COMPONENT PURPOSE
Multiple Cloning Site PCR Primers:
5’ GCGATGAGG 3’ (Forward Primer)
3’ CCATAGATC 5’ (Reverse Primer)

Forward Primer + EcoRI target sequence: 5’

GAATTCGCGATGAGG 3’
Reverse Primer + EcoRI target sequence: 3’
CCATAGATCCTTAAG 5’

Inserted Gene Sequence Successful insertion of a gene allows the expression of its protein product. This
usually provides a specific trait to the “transformed” bacteria. For example, if the
gene for Green Fluorescent Protein is placed within the expression plasmid, bacteria
transformed with this plasmid will produce protein (GFP) that will allow the
bacterial cells / colonies to glow green in the dark.

Antibiotic Resistance Gene Provides a way to screen a population of bacteria for those that took up the plasmid.
For example, if an ampicillin resistance gene is encoded in the plasmid, then only
bacteria which took up the plasmid will be able to grow on media with ampicillin.
However, if the ampicillin resistance gene is cut and the gene is inserted here for
cloning, then the cell will no longer be resistant to ampicillin. This is a way to select
which among the colony of cells actually contain the inserted gene sequence.
Bacterial cells whose ampicillin resistance gene have been cut will die in the presence
(agar plate) of ampicillin.